Medical genetics
-
Upload
quemby-raymond -
Category
Documents
-
view
101 -
download
1
description
Transcript of Medical genetics
![Page 1: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/1.jpg)
Medical genetics
Dr. Lina Basel
Schneider Children’s
Medical Center of Israel
![Page 2: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/2.jpg)
1. What is the problem
2 .Why did it happen
3 .What will it mean for our baby
4 .Will it happen again
Benefits of genetic evaluation
![Page 3: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/3.jpg)
Reproductive counseling: carrier testing, prenatal diagnosis
Presymptomatic screening for associated complications
Referral to support groups
Benefits of genetic evaluation
![Page 4: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/4.jpg)
How do you make a syndrome diagnosis?
History
Examination
Investigations
![Page 5: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/5.jpg)
Family history
Any relative with mental retardation or known malformations
Neonatal deaths, stillbirths or childhood deaths
Familial disorders or physical features
Consanguinity in parents
Ethnic background
Prior genetic testing or screening
![Page 6: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/6.jpg)
History
Family history – pedigree:
what is the mode of inheritance?
- AR, AD, XL, Y-linked, mitochondrial, trinucleotide repeat expansion
![Page 7: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/7.jpg)
History
Maternal health, vitamin supplements and drug use
hydantoin
![Page 8: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/8.jpg)
History
Maternal health, vitamin supplements and drug use
valproic acid
![Page 9: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/9.jpg)
History
Maternal health, vitamin supplements and drug use
alcohol
![Page 10: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/10.jpg)
History
Pregnancy investigations:
NT
US
Biochemical screening
Amniocentesis
Fetal MRI
![Page 11: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/11.jpg)
Physical examination
Height
plot on appropriate growth chart
![Page 12: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/12.jpg)
Physical examination
Proportions
U/L segment
Arm span
Hand length
![Page 13: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/13.jpg)
Posture and tone:
trisomy 18
PWS
Physical examination
![Page 14: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/14.jpg)
Facial expression:
Angelman syndrome
Physical examination
![Page 15: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/15.jpg)
Movements and behavior:
Rett syndrome
Physical examination
![Page 16: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/16.jpg)
Characteristic personality:
Williams syndrome
Physical examination
![Page 17: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/17.jpg)
Karyotype, FISH, low-resolution CGH
Molecular tests (sequencing, specific mutation testing)
CHG arrays, SNP arrays, MLPA
![Page 18: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/18.jpg)
Chromosomal tests
![Page 19: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/19.jpg)
Subtelomeric regions
Subtelomeric regions
Chromosomal structure
![Page 20: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/20.jpg)
Cytogenetic tests - karyotype
![Page 21: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/21.jpg)
Cytogenetic tests - karyotype
Indications:
Mental retardation
Dysmorphic features
Major anomaly
Recurrent spontaneous abortions
Family history of multiple affected individuals with MR/malformations
5-10 Mb resolution (300-600 cytogenetic bands)
![Page 22: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/22.jpg)
ECARUCA
![Page 23: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/23.jpg)
Cytogenetic tests – high resolution karyotype
Indications: High suspicion of chromosomal anomaly
![Page 24: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/24.jpg)
Microdeletions and microduplications
Wolf-Hirshhorn
Williams DiGeorge/VCFS
Miller-Dieker lissencephalyRubinstein-Taybi
Smith-Magenis
![Page 25: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/25.jpg)
Fluorescence in situ hybridization (FISH)
Need to suspect a specific diagnosis!
Cytogenetic tests – FISH (Fluorescent in situ
hybridization)
![Page 26: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/26.jpg)
Cytogenetic tests – FISH
![Page 27: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/27.jpg)
Cytogenetic tests – FISH
Indications:
• Detects specific microdeletions/microduplications
• Quick test for detection of abnormal chromosome number (pregnancy)
![Page 28: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/28.jpg)
Di George/VCFS
Aortic arch abnormalities
Hypocalcemia
Cleft palate
Immunodeficiency
Developmental delay
Psychiatric disorders
![Page 29: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/29.jpg)
Williams syndrome
Characteristic facies
Supravalvular AS
Hypercalcemia
Microcephaly
Kidney abnormalities
Musculoskeletal problems
Developmental delay
![Page 30: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/30.jpg)
Prader Willi/Angelman syndromePrader Willi/Angelman syndrome
![Page 31: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/31.jpg)
Cytogenetic tests – subtelomeric FISH
![Page 32: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/32.jpg)
Cytogenetic tests – subtelomeric FISH
Indications:
Mental retardation/dysmorphic features/congenital anomalies
Familial cases (especially if variable clinical features
Detects deletions/duplications of the subtelomeric regions
![Page 33: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/33.jpg)
Cytogenetic tests – subtelomeric FISH
![Page 34: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/34.jpg)
SKY – spectral karyotyping
Indications:
Unidentified chromosomal marker
Multiple chromosomal translocations
![Page 35: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/35.jpg)
Molecular cytogenetic techniques
Array CGH
SNP array
![Page 36: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/36.jpg)
Array CGH
Genomic rearrangements detectable by array CGH: 10-15% in patients with syndromic MR
Depends on the stringency of the clinical criteria
Molecular cytogenetic techniques
![Page 37: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/37.jpg)
Targeted array
1 Mb resolution (aCGH with 3,000-3,500 BAC clones)
10-100 kb resolution (aCGH with 32,447 BACs/oligos)
Exon aCGH (all ~250,000 exons in human genome)
Array CGH – resolution
Various levels of resolution: the higher the resolution, the higher the detection rate
![Page 38: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/38.jpg)
Indications:
Mental retardation/dysmorphic features/congenital anomalies
Detection of microdeletions, microduplications
No need for specific diagnosis
Array CGH
![Page 39: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/39.jpg)
Copy number variants (CNVs)
How much copy number variations (CNVs) exist ?
What is the contribution of copy number variation to genetic disease?
What role has copy number variation played in recent human evolution?
![Page 40: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/40.jpg)
SNP array
CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACCCCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTTGCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCGGCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAGGCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAAAAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTCTAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAAAGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCTTCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCAGGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTGTTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCATTTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAAGGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATCCCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTGCTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTTGTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAATAAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATGTGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAACACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAATTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCTGTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAGTGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAGAAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTATAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTTGTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAGGGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGGAGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCCTGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGATCTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC
CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACCCCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTTGCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCGGCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAGGCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAAAAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTCTAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAAAGAATGTTAACTATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCTTCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCAGGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTGTTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCATTTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAAGGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATCCCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTGCTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTTGTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAATAAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATGTGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAACACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAATTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCTGTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAGTGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAGAAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTATAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGCTCCAAAGCTCTTGCTTTGTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAGGGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGGAGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCCTGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGATCTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC
![Page 41: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/41.jpg)
SNP array
Density – 10K, 50/100K, 500K
![Page 42: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/42.jpg)
![Page 43: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/43.jpg)
DNA tests
![Page 44: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/44.jpg)
DNA tests
• Direct mutation analysis– DNA sequencing– Specific mutation analysis– Deletion analysis
• Linkage analysis – utilization of traceable gene markers
next to the gene of interest
![Page 45: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/45.jpg)
Testing for the specific mutation
![Page 46: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/46.jpg)
Sequencing
![Page 47: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/47.jpg)
Deletion testing – MLPA (Multiplex Ligation-dependent Probe
Amplification )
![Page 49: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/49.jpg)
Linkage analysis
Looks for pattern of DNA markers near gene of interest that segregate with disease
Requires DNA analysis of multiple family members
1, 21, 2 3, 43, 4
1, 31, 3 1, 41, 4 2, 32, 3 2, 42, 4
11223344
![Page 50: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/50.jpg)
0/100 %
50/50 %
X inactivation
![Page 51: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/51.jpg)
Genetic testing in the fetus
Non-disclosing prenatal testing
The parent is at 50% risk and is not showing symptoms. In this case, to find
that the fetus carries the gene for Huntington's disease automatically
reveals that the parent is a gene-carrier as well
![Page 52: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/52.jpg)
Ill grandparent
parent
fetus
Non-disclosing prenatal testing
![Page 53: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/53.jpg)
Sequencing of all the genes– laborious…
How do we diagnose children with heterogeneic conditions?
hearing loss
HMSN
mental retardation
hereditaryataxia
spastic paraplegia
![Page 54: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/54.jpg)
MR: etiology
![Page 55: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/55.jpg)
Resequencing microarray
Recently, a resequencing microarray has been developed for XLMR genes
On this chip 17 XLMR genes are represented, including frequently mutated genes such as ARX, JARID1C and PQBP1
Together they account for approximately 40% of all mutations in MR genes on the X chromosome
![Page 56: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/56.jpg)
Genetic testing
Identification
of molecular
defect
in the affected
individual
Research lab
- no costs
- might take a long time
- need to confirm the test in the clinical lab
Clinical lab
- usually quick/reliable
- expensive
![Page 57: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/57.jpg)
![Page 58: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/58.jpg)
Attitude of different populations towards
prenatal testing
Non religious Jews: prenatal testing by CVS or amniocentesis (pregnancy interruption possible up to birth, even at 40 weeks of pregnancy); preimplantation genetic diagnosis
Orthodox Jews: preimplantation genetic diagnosis (pregnancy interruption possible up to 40 days only – no prenatal testing possible)
Muslim Arabs: prenatal testing by CVS or amniocentesis; (pregnancy interruption possible up to 120 days of pregnancy); preimplantation genetic diagnosis
![Page 59: Medical genetics](https://reader037.fdocuments.us/reader037/viewer/2022102522/56812b33550346895d8f3f95/html5/thumbnails/59.jpg)
If mutation in the affected individual found – molecular
testing of the fetus by CVS or amniocenthesis
Or:
Preimplantation genetic diagnosis (PGD)
If gene unknown for X-linked diseases – fetal
sexing
Prenatal testing