Mechanism(s) of action of the novel immunoregulatory ......ii Mechanism(s) of action of the novel...

Mechanism(s) of action of the novel immunoregulatory

molecule, CD200

by

Kai (Gary) Yu

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy, Graduate Department of the Institute of Medical Sciences,

University of Toronto

© Copyright by Kai (gary) Yu 2011

ii

Mechanism(s) of action of the novel immunoregulatory molecule, CD200

Kai (Gary) Yu 2011

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Graduate

Department of the Institue of Medical Sciences, University of Toronto

Abstract

Both CD200 and its receptor(s), CD200R(s), are type I membrane glycoproteins belonging

to the immunoglobulin (Ig) supergene family. CD200:CD200R(s) interaction manipulates host

immunity in multiple models, including those exploring allograft rejection, autoimmune disease,

tumor development, spontaneous fetal loss, infection/inflammation, and virus infection. The

studies described in this thesis were focused on investigation possible mechanism(s) involved in

CD200-mediated regulation, using transgenic mice over-expressing CD200, and exploring

models of skin allograft rejection and LPS-induced abortion in mice.

A Tet-on system was chosen to create CD200tg mice (rtTA CD200tg animal line), in which

transgenic expression of CD200 is induced by the presence of doxycycline (Dox-treated mice).

Splenocytes from Dox-treated transgenic mice, used as either responder cells or stimulator cells

in mixed leukocyte cultures, showed antigen-specific suppressed lymphocyte proliferation and

induction of CTL. Although enhanced survival of skin allografts was achieved in Dox-treated

transplanted CD200tg mice (BALB/c to BL/6 Tg), all grafts were rejected by 28 days post

transplantation (see chapter 2).

A superior “second generation” Tet-on system was used to create a new CD200tg animal

referred to as rtTA2s-M2 CD200tg mice. Transgenic overexpression of CD200 in this mouse was

stably induced at much lower Dox concentrations, with less (or no) “leaky” expression of the

transgene in the absence of Dox. Using these mice in an LPS-induced murine abortion model,

iii

transgenic expression of CD200 was found to reduce the LPS-induced abortion rate from ~49%

to 6% (see chapter 3).

Long term increased survival of grafted tissues (of both cardiac and skin allografts) was

achieved using the rtTA2s-M2 CD200tg mice as recipients. To explore the potential molecular

mechanism(s) involved in this allograft tolerance, a commercial microarray kit focusing on

detecting altered expression of genes related with T-cell anergy/tolerance was used to

investigate the gene expression profile in grafted tissue of mice with transgenic expression of

CD200. Expression of genes associated with Foxp3+ regulatory T-populations (Foxp3, CTLA4

and GITR) and type 2 cytokine genes showed increased expression in CD200tg recipients. With

particular note in regards to Foxp3+ regulatory T cells, expression of the gene encoding

chemokine receptor CCR4, reported to play a key role in attracting Foxp3+ regulatory T cells to

grafted tissues and DLNs, was found to be increased in Dox-treated CD200tg recipients, along

with genes encoding chemokines CCL22/17, the ligands for CCR4. Immunochemistry staining

also showed increased numbers of Foxp3+ cells in both grafted skin tissues and the DLNs of

transplant at day 14 post transplantation. Using CCR4-shRNA lentivirus administered to

Dox-treated CD200tg recipients to block expression of CCR4, the transgene-induced increased

presence of regulatory T cell populations in grafted tissues and DLNs was attenuated, along

with loss of enhanced skin graft survival and the histological appearance of graft acceptance

(see chapter 4). These data provide support for a model suggesting that altered migration of

Treg mediated through a CCR4:CCL17/22 pathway is an important mechanism underlying

increased allograft acceptance following CD200tg expression.

iv

Acknowledgement

The research presented in this thesis is the result of the contributions of many individuals.

First I would like to extend my appreciation and sincere gratitude to my supervisor Professor

Reginald M. Gorczynski. He has being given me helpful advice in immunology, design of

experiments and analysis of results through the course of my Ph.D. studies. Without his

guidance it would have been impossible to complete those studies. Working in his lab has been

a positive experience in my life.

I am also very grateful to Professors David A. Clark and Alex Marks, members of my

advisory committee, for their helpful advice and comments during the course of my studies and

completion of this thesis.

I would like to extend my great thanks to my colleagues and friends, Dr. Zhiqi Chen, for his

continued friendship and sharing of his technical expertise, and Drs. Ismat Khatri and Jun Diao

for their kind assistance, and others in Dr. Gorczynski’s lab. The help of people in the

neighoring labs is also gratefully acknowledged. Numerous friendships established at the

University of Toronto, and particularly in the Institue of Medical Sciences (IMS) and Toronto

General Research Institute (TGRI) have made my studies easier.

Pursuit of this degree was made possible by financial support from grants to my supervisor

Dr. Gorczynski, and an Open Fellowship from the Institute of Medical Science (IMS),

University of Toronto.

Finally, I would like to extend my eternal appreciation to my dear wife Xiaochan Yang and

my son Bobby Yu for their enormous love, and to my parents and sisters for their continued

encouragement and emotional support.

v

Table of Contents

Thesis title: Mechanism(s) of action of the novel immunoregulatory molecule, CD200…………….…………………………………….........................i

Abstract………………………………………………………………………………………….ii

Acknowledgement……………………………………………………………………………...iv

Table of Contents………………………………………………………………………………..v

List of Figures and Figure legends………………………………..……………………….…xii

List of Tables…………………………………………………………………………...…...…xvi

List of Abbreviations………………………………………………………………………....xvii

Publications………………………………………………………………………………..…xxii

Chapter 1: General introduction/Current state of knowledge……………………………….1

1. Introduction……………………………………………………………………………………2

2. Immune tolerance and its mechanisms………………………………………………………..4

2.1. Immune tolerance……………………………………………………………………....4

2.2. Mechanisms for achieving tolerance…………………………………………………...4

2.2.1. “Recessive”/cell-intrinsic mechanisms for achieving tolerance…………………5

2.2.1.1. Central tolerance/clonal deletion…………………………...……………...5

2.2.1.2. Anergy and peripheral deletion………..…………………………………..6

2.2.2. Dominant/cell-extrinsic mechanisms…………………………………….………8

2.2.2.1. Suppression………………………………………………………….….….8

2.2.2.2. Basic mechanisms for suppression mediated by regulatory T cells…..……9

(1) Suppression by inhibitory cytokines…………………………………………....9

vi

(2) Suppression by cytolysis………………………………………………………11

(3) Suppression by metabolic disruption………………………………………….12

(4) Suppression by targeting dendritic cells and/or other cell types………………12

3. Important cellular components involved in achieving tolerance…………………………….13

3.1. Regulatory T cells……………………………………………………………….……..13

3.1.1. Naturally arising /occurring regulatory T cells (nTreg)…………………….…...14

3.1.2. Inducible regulatory T cells……………………………………………………..17

3.1.2.1. Inducible Foxp3+ regulatory T cells………………………………………17

3.1.2.2. IL-10 producing T regulatory 1 cells (Tr-1)………………………………19

3.1.2.3. TGF-β-producing T helper (Th3) cells…………………………………...19

3.2. Other regulatory/tolerogenic cells……………………………………………………..20

3.2.1. Myeloid derived suppressive cells (MDSC)…………………………………….21

3.2.1.1. Generation and subsets of MDSC..……………………………………….21

3.2.1.2. Expansion and activation of MDSC under pathological conditions……...23

3.2.1.3. Mechanisms of MDSC suppressive activity……………………………...23

3.2.2. Dendritic cells (DC) and tolerogenic DCs………………………………………24

3.2.2.1. Subsets and origins of DCs……………………………………………….25

3.2.2.2. Tolerogenic DCs………………………………………………………….26

3.2.2.3. Dendritic cells in skin………………………………………….…………30

3.3. Blockade of costimulators as a means of tolerance induction…………………………31

3.4. Cell surface regulatory receptors and their ligands……………………………………33

3.4.1. B7 family members (CD80/86(B7-1/2):CTLA-4 and PDL-1/2:PD-1)…………34

vii

3.4.2. CD200:CD200R ………….…………………………………………………….37

3.4.2.1. Early evidence for a role of CD200 in immune regulation……………….37

3.4.2.2. Biochemical characterization of CD200………………………………….38

3.4.2.3. Characterization of CD200R and its expression profile………………….40

3.4.2.4. The signalling pathway for CD200:CD200R interaction……………...…42

3.4.2.5. Other CD200Rs………………………………………………….………..42

4. Roles of CD200:CD200R(s) interaction in manipulation of immunity in clinical scenarios..44

4.1. CD200:CD200R(s) interaction in organ transplantation………………………………44

4.1.1. Allograft rejection………………….………………………………………...….44

4.1.2. Immunosuppressive agents currently used in transplantation………....………..45

4.1.3. The role of CD200:CD200R(s) interaction in allograft rejection……………….48

4.2. CD200:CD200R(s) interaction in spontaneous fetal loss……………………………...48

4.3. CD200:CD200R(s) interaction in other clinical scenarios…………………………….51

4.3.1. CD200:CD200R(s) interaction in autoimmune disease………………………...51

4.3.2. CD200:CD200R(s) interaction in tumor development…………………………52

5. Techniques to explore mechanism(s) of action of CD200 and summary of data in thesis…..52

6. Reference………………………………………………………………………………….…57

Chapter 2: Decreased alloreactivity using donor cells from mice expressing a CD200

transgene under control of a tetracycline-inducible promoter……….……...75

Abstract…………………………………………………………………………………………76

1. Introduction………………………………………………………………………………....77

2. Materials and Methods……………………………………………………………………...79

viii

2.1. Mice……………………………………………………………………………………79

2.2. Creation of TRE-CD200-GFP cDNA, and characterization of transgenic mice………79

2.3. Dox-induction of GFP and CD200 expression in F1 mice…………………………….81

2.4. Monoclonal antibodies for ELISA and FACS…………………………………………81

2.5. Cytotoxicity and cytokine assarys……………………………………………………..81

2.6. Statistics………………………………………………………………………………..82

3. Results………………………………………………………………………………………..83

3.1. Dual transgenic F1 mice drinking Dox-water show expression of CD200-GFP

in multiple tissues……………………………………………...………………………83 3.2. Responder cells from dual transgenic F1 mice drinking Dox-water show dreased induction of allospecific CTL and IFN-γ/IL-2 in vitro with continued Dox exposure..83 3.3. Suppression of induction of CTL and TNFα by splenocytes of dual-transgenic F1 mice………………………………………………………………………………...92 3.4. Suppression of induction of CTL in vivo following grafting with the tail skin from double-transgenic mice…………………………………………………………..92 3.5. Suppression of skin graft rejection in vivo in double-transgenic mice given Dox and Balb/c grafts………………………………………………………………….95

4. Discussion…………………………………..…………………………………………..…100

5. Reference……………………………………………………………………….…………102

Chapter 3: LPS-induced murine abortions require C5 but not C3, and are prevented by upregulating expression of the CD200 tolerance signalling molecule……………………………………………………………...105 Rationale for studies in chapter 3……………………………………………………………..106 Abstract………………………………………………………………………………………..109 1. Introduction……………...……………………...…………………………………………..110

ix

2. Materials and Methods..…………………………………………………………………….112

2.1. Mice……………………………………………………………………………….….112

2.2. Abortion model…………………………………………………………………….…113

2.3. Statistics……………………………………………………………………………... 113

3. Results………………………………………………………………………………………114

3.1. Effect of LPS treatment in C3-/- mated mice………………………………………....114

3.2. Effect of LPS (with progesterone) treatment of double transgenic mice of CD200…114

4. Discussion…………………………………………………………………………………..117

5. Reference……………………………………………………………………………….......120

Chapter 4: CCR4 dependent migration of Foxp3+ regulatory T cell to skin grafts and draining lymph nodes in grafted CD200tg mice is implicated in enhanced graft survival…………………………………………………………………....124

Abstract………………………………………………………………………………………..125

1. Introduction………………………………………………………………………………..126

2. Materials and Methods…………………………………………………………………….128

2.1. Mice…………………………………………………………………………………..128

2.2. Monoclonal antibodies……………………………………………………………….128

2.3. Flow cytometry………………………………………………….……………………128

2.4. Preparation of cells and cytotoxicity assays…………………………………….……129

2.5. Skin grafts in mice and graft survival study…….…………………………….……...130

2.6. Histology and Immunohistochemistry staining………………………………………130

2.7. Focused micro-array analysis………………………………………………...………130

x

2.8. Realtime PCR…………………………………………………….…………………..131

2.9. Blockade of CCR4 using lentivirus mediated gene specific shRNA………………...132

2.9.1. Purification of plasmids (vector pLOK.1) containing the shRNA constructs from bacterial glycerol stocks…………………………………....…133

2.9.2. Selection of the shRNA construct with the best efficiency of blockade……….133

2.9.3. Production (packaging) of CCR4 and control-shRNA lentivirus……… ……..133

2.9.4. Confirmation of CCR4 shRNA lentivirus function in vitro………………...…134

2.9.5. Titration of CCR4 and control shRNA stocks using a standard ELISA……….134

2.9.6. Concentration of CCR4 and control shRNA lentivirus …………………….…135

2.9.7. Use of CCR4 shRNA lentivirus in vivo…………………………….………….135

2.10. Statistics………………………………………………………………………….….135

3. Results………………………………………………………………………………………136

3.1. Increased skin allograft survival in Dox-treated rtTA2s-M2 CD200tg mice………….136

3.2. Increased skin allograft survival in rtTA2s-M2 CD200tg mice is associated with reduced donor-specific alloimmunity……………………………………………...…136 3.3. Differential gene expression in tissues harvested from control and CD200tg mice with allogeneic grafts……………………………………………………………...…136 3.4. Gene specific realtime PCR confirmation of increased expression of mRNAs for Foxp3 and CCR4 as well as its ligands CCL-17/22 genes in both grafted skin and DLNs from Dox-treated rtTA2s-M2 CD200tg mice……….….…….146 3.5. Immunohistochemistry staining by anti-Foxp3 monoclonal antibody provides additional evidence for an increase of Foxp3+ cell in both skin grafts and DLN from Dox-treated CD200tg mice……………………………………………………..150 3.6. Production of CCR4 shRNA lentivirus………………………………………………150 3.7. Infective/suppressive activity of the supernatants containing CCR4 and control shRNA lentivirus……………………………………………………………………..163

xi

3.8. Titration and concentration of CCR4 and control shRNA lentivirus supernatants…..163 3.9. Decrease presence of Foxp3+ Treg in skin grafts and DLNs following blockade of CCR4 in Dox-treated CD200tg mice…………………………………….168 3.10. Decreased Foxp3+ Treg following blockade of CCR4 expression attenuates skin graft protection as defined by histological analysis and gross measure of skin graft survival………………………………………………...168 4. Discussion………………………………………………………………………….…….…176 5. Reference…………………………………………………………………………………...182 Chapter 5: Summary and Future direction……………………………………..…………187 1. Summary………………………………………………………………………...………….188 2. Future directions…..………………………………………………………………………..192 2.1. A cardiac allograft model showing enhanced graft survival induced by transgenic overexpression of CD200…………………………………………………192 2.2. Altered gene expression in a cardiac allograft model………………………….……..193

2.3. Use of anti-CCR4 reagents to assess importance of interaction between CCL17/22 andCCR4 in enhanced graft survival………………………………….….193 2.4. Chemotaxis assay…………………………………………………………………….194 2.5. Use of Tregs to attenuate T cell proliferation in vitro………………………………..194 2.6. Exploration of the cellular source of CCR4 ligands CCL17/22……………………..195 2.7. ELISA to confirm production of CCL17/22 by DCs/others…………………………195

3. Reference………………………...………………………………………………………....196

xii

List of Figures and Figure legends

Chapter 1

Figure 1 Interactions between antigen presenting cells and heper T cells……………………..7

Figure 2 How regulatory T cells work………………………………………..………………10

Figure 3 Control of Treg-associated molecules in nTreg cells………………………………..16

Figure 4 Functionally-distinct CD4+ T-cell lineages……….....……...………………….........18

Figure 5 IL-2 receptor signal transduction and immune suppressive drugs…...……………..29

Figure 6 The B7 family and antigen presentation to T cells………………………………….35

Figure 7 The structure of full length cDNA of mouse CD200………………………………..39

Figure 8 The structure of CD200R family……………………………………………………41

Figure 9 Direct and indirect allorecognition………………………………………………….47

Figure 10 LPS-induced abortion……………………………………….…………………….50

Figure 11 Schematic representation of Tet-on system……………………………………….54

Figure 12 A model for CD200:CD200R modulated regulation of graft rejection…………....56

Chapter 2

Figure 1 Induction of CD200-EGFP in spleen of transgenic mice in presence of Dox………84

Legend to Figure 1……………………………………………………………………………...85

Figure 2 Suppression of CTL induction from splenocytes of dual-Tg mice receiving Dox….88

Legend to Figure 2……………………………………………………………………………...89

Figure 3 Modulation of cytokine production in MLCs of dual-Tg mice by Dox…………….90

Legend to Figure 3……………………………………………………………………………...91

xiii

Figure 4 Lack of CTL induction using splenocytes from transgenic mice…………………...93

Legend to Figure 4……………………………………………………………………………...94

Figure 5 Induction of anti-BL/6 (BALB/c) CTL in vivo by grafts from Tg (BALB/c)………96

Lengend to Figure 5…………………………………………………………………………….97

Figure 6 Increased BALB/c skin allograft survival in the transgenic mice given Dox………98

Legend to Figure 6……………………………………………………………………………...99

Chapter 3

Figure 1 LPS-triggered abortions……………………………………………………………107

Figure 2 Potential mechanism(s) of up-regulation of CD200 on LPS-triggered abortions…118

Chapter 4

Figure 1 Skin allograft survival in C57BL/6 and rtTA2s-M2 CD200tg mice±Dox……….....138 Legend to Figure 1……………………………………………………………………...……..139 Figure 2 Histology of skin grafts from Dox-treated CD200tg or control mice at day 14 Post grafting……………………………………………………………………….140 Legend to Figure 2…………………………………………………………………………….141 Figure 3 Donor-specific inhibition of proliferation in splenocytes taken from transgenic Mice with surviving allograft……………………………………………………...142 Legend to Figure 3…………………………………………………………………………….143 Figure 4 Donor-specific inhibition of CTL induction in splenocytes taken from transgenic Mice with surviving allograft……………………………………………………...144 Legend to Figure 4…………………………………………………………………………….145 Figure 5 Altered mRNA expression in skin graft tissue in CD200tg (vs control) mice at

xiv

day 14 post transplantation……………………………………………………...…148 Legned to Figure 5…………………………………………………………………………….149 Figure 6 Realtime PCR confirmation of altered mRNA expression of key molecules in tissues of CD200tg (vs control) transplanted mice at day 7 post transplantation…..151 Legend to Figure 6…………………………………………………………………………….152 Figure 7 Realtime PCR confirmation of altered mRNA expression of key molecules in tissues of CD200tg (vs control) transplanted mice at day14 post transplantation….153 Legend to Figure 7………………………………………………………………………..…...154 Figure 8 Foxp3+ stained cells in tissues of CD200tg (vs control) grafted mice at day 14 post skin graft…………………………………………………………………...…155 Legend to Figure 8………………………………………………………………………….....156 Figure 9 Quantitative analysis of increase in Foxp3+ cells in DLN of grafted mice………..157 Legend to Figure 9…………………………………………….…………………………..…..158 Figure 10 Comparation of expression of CCR4 in different cell lines (realtime PCR)……..159 Legend to Figure 10………………………………………………………………..………….160 Figure 11 Blockade of expression of CCR4 in CHO-K cells by transfection of shRNA plasmids……………………………………………………………………….….161 Legend to Figure 11………………………………………………………………...…………162 Figure 12 Puromycin selection of CHO-K cells infected with CCR4 shRNA letivirus...…..164 Legend to Figure 12…………………………………………………………………………...165 Figure 13 Blockade of CCR4 expression in CHO-K cells by shRNA lentivirus……………166 Legend to Figure 13………………………………………………………………………...…167 Figure 14 Blockade of CCR4 expression by shRNA lentivirus in vivo decreases Foxp3 expression in tissues of CD200tg mice at day 14 post transplantation…………...169 Legend to Figure 14…………………………………………………………………………...170

xv

Figure 15 Blockade of CCR4 expression in CD200tg mice is associated with histological changes typical of rejecting grafts (day 14 post transplantation)……….……..…171 Legend to Figure 15………………………………………………………………….………..172 Figure 16 Skin allgraft survival in CD200tg mice with/without blockade of CCR4 expression………………………………….…………………………………......174 Legend to Figure 16…………………………………………………………………….……..175 Figure 17 A model for CD200:CD200R modulated regulation of graft rejection…………..181

xvi

List of Tables

Chapter

Table 1: Co-stimulatory and inhibitory molecules of the immunoglobulin superfamily

and TNFR family………………………………………………………………………32 Table 2: Categories of rejection and their features……………………...………………………46 Chapter 2 Table 1: Cellular subsets in different tissues of transgenic mice (±Dox).....................................86 Table 2: %CD200+ cells in cell subsets of spleen of normal and transgenic mice (±Dox)……..87 Chapter 3 Table 1: Effect of genetic deletion of the C3 or C5 component of complement on LPS-induced murine abortions…………………………….…………………………115 Table 2: Effect of up-regulation of CD200 on LPS-triggered abortions………………………116 Chapter 4 Table 1: Widespread over-expression of a CD200-transgene in rtTA2s-M2 CD200tg

mice receiving Dox……………………………………………………..…………….137 Table 2: Focused microarray gene expression analysis in day 14 skin grafts in CD200tg recipients (compared with expression in control BL/6 mice)……………………...…147

xvii

List of Abbreviations

a.a.: Amino Acid

Ab: Antibody

Ag: Antigen

Aire: Autoimmune regulator

APC: Antigen presenting Cell

BM: Bone marrow

CCL: Chemokine ligand

CCR: Chemokine Receptor

CD: Cluster determinant of antigens used to characterize a cell (surface marker)

cDC: Conventional dendritic cells

pDC: Plasmacytoid dendritic cells

CIA: Collagen-induced anthritis

CLL: Chronic lymphocyte leukemia

Con A: Concanavalin A, a lectin original derived from the jackbean

CSF: Colony stimulating factor

CTL: Cytotoxic T lymphocyte

CTLA4: Cytotoxic T lymphocyte-associated antigen 4

DAMP: Damage associated molecular patterns

DC: Dendritic cell

DCp: Dendritic cell precursor

DTH: Delayed-type hypersensitivity

xviii

DST: Donor specific transfusion

Dox: Doxycycline

EAE: Experimental autoimmune encephalomyelitis

EAU: Experimental autoimmune Uveoretinitis

EGFP: Enhanced green fluorescent protein

FACS: Fluorescence activated cell sorter

FBS: Fetal bovine serum

f/f: flox/flox (for conditional knockout)

Fgl2: Fibrinogen-like protein 2

Flt: Fms-like tyrosine kinase

Foxp3: Forkhead box protein 3, a transcription factor

GITF: Glycocorticoid-induced TNF receptor

HLA: Human leukocyte antigen

HPRT: Hypoxanthine phosphoribosyltransferase

ICAM: Intercellular adhesive molecules

ICOS: Inducible costimulator

IDO: Indoleamine 2,3,-dioxygenase

IFN-γ: Interferon gamma

Ig: Immunoglobulin

IgSF: Immunoglobulin superfamily

IL-: Interleukin-

iTreg: Inducible regulatory T cells

xix

IRAK: IL-1 receptor associated kinase

ITAM: Immunoreceptor tyrosine-based activation motif

ITIM: Immunoreceptor tyrosine-based inhibitory motis

ITSM: Immunoreceptor tyrosine-based switch motif

ip: Intraperitoneal injectoin

iv: Intravenous injection

IVIG: Intravenous immunoglobulin

Jak: Janus kinase

KO: Knockout

LC: Langerhan cells

LFA: Leukocyte function associated antigen

LPS: Lipopolysaccharide

mAb: Monoclonal antibody

MAPK: Mitogen-activated protein kinase

MDSC: Myeloid derived suppressive cells

MEC: Medullary epithelial cells

MHC: Major histocompatibility complex

MS: Mutiple Sclerosis

nTreg: Naturally occurring regulatory T cells

NK: Natural killer cells

NO: Nitric oxide

NOS: Nitric oxide synthase

xx

iNOS/NOS2: Inducible nitric oxide synthase

OVA: Ovalbumin

OT-1: OVA-specific TCR Tg mice (CD8+ T cells)

OT-2: OVA-specific TCR Tg mice (CD4+ T cells)

ORF: Open reading frame

PAMP: Pathogen associated molecular patterns

PBMC: Peripheral blood mononeuclear cells

PBS: Phosphate-buffered saline

Pcmv: Human cytomegalovirus promoter

PCR: Polymerase chain reaction

PD-1: Programmed death-1

PDL: Programmed death ligand

PRR: Pattern recognition receptor

PTB: Phosphotyrosine binding domain

pv: Portal vein

RANTES: Regulated on activation and normal T cell expressed and secreted chemokine (CCL5)

rtTA: Reverse tetracycline-controlled transactivator

rtTA2s-M2: Second generation of rtTA

RPC: Resident peritoneal cell

SCF: Stem-cell factor

SDS: Sodium dodecyl sulphate

SEM: Standard error of the mean

xxi

SHIP: SH2-domain-containing inositol phosphatase

shRNA: Short hairpin RNA

SiRNA: Small interfering RNA

STAT: Signal transducer and activator of transcription

TCR: T cell receptor

Tet: Tetracycline

Tg: Transgenic

TGF-β: Transforming growth factor β

Th: T helper cells

TIM: T-cell immunoglobulin and mucin domain

TLR: Toll like receptor

TIR: Toll - IL-1 receptor domain

TNF-α: Tumor necrosis factor alpha

Tr-1 Type 1 regulatory T cells

TRAF: TNF receptor associated factor

Trail: TNF-related apoptosis-inducing ligand

Trance: TNF-related activation induced cytokine

TRE: Tetracycline response element

TREM: Triggering receptors expressed on myeloid cells

xxii

Publications (non-italicized publications are related to current thesis work):

1. Yu K, Gorczynski RM. Increased CCR4 expression is critical for enhanced skin allograft

survival modulated by CD200. (Manuscript in preparation). 2. Gorczynski RM, Chen Z, He W, Khatri I, Sun Y, Yu K, and Boudakov I. 2009. Expression

of a CD200 transgene is necessary for induction but not maintainence of tolerance to cardiac and skin allografts. J Immuno. 183 (3):1560-8.

3. Yu K (Yu G), Sun Y, Foerster K, Manue J, Molina H, Levy GA., Gorczynski RM, Clark DA. 2008. LPS-induced murine abortions require C5 but not C3, and are prevented by upregulating expression of the CD200 tolerance signalling molecule. Am J Reprod Immunol. 60 (2): 135 -140.

4. Yu K, Chen Z, Wang S, Gorczynski RM. 2006. Decreased alloreactivity using donor cells from mice expressing a CD200 transgene under control of doxycycline-inducible promoter. Transplantation. 80(3): 394-401.

5. Gorczynski RM, Chen Z, Diao J, Khatri I, Wong K, Yu K, Behnke J. Breast cancer cell CD200 expression regulates immune response to EMT6 tumor cells in mice. 2009. Breast Cancer Res Treat. 123(2): 405-15.

6. Gorczynski RM, Chen Z, Shivagnahnam S, Taseva A, Wong K, Yu K, Khatri I. 2010. Potent immunosuppression by bivalent molecule binding to CD200R and TGF-betaR. Transplantation. 90(2):150-9.

7. Chen Z, Cheng DX, Yu K (Kai Y), I Khatri, B Lamptey, and RM Gorczynski. 2008. Identification of an expressed truncated form of CD200, CD200tr, which is a physiological antagonist of CD200 induced suppression. Transplantation. 86:1116-1124.

8. Gorczynski RM, Yu K Y (Kai), Kensuke M. 2006. MD1 expression regulates development of regulatory T cells. J Immunol. 177: 1078-1084.

9. Gorczynski RM, Chen Z, Clark DA, Yu K (Kai Y), Lee L, Wong S, Marsden P. 2004. Structural and functional heterogeneity in the CD200R family of immunoregulatory molecules and their expression at the feto-maternal interface. Am J Reprod Immunol. 52(2): 147-156.

10. Gorczynski RM, Chen Z, Yu K (Kai Y), Lee L, Wong S, Marsden PA. 2004. CD200 is a ligand for all members of the CD200R family of immunoregulatory molecules. J Immuno. 172(12): 7744-9.

11. Gorczynski RM, Chen Z, Yu K (Kai Y), Wong S, Lee L. 2004. Induction of tolerance-inducing antigen-presenting cells in bone marrow cultures in vitro using monoclonal antibodies to CD200R. Transplantation 77(8): 1138-42.

12. Hu J, Chen Z, Gorczynski CP, Gorczynski LY, Yu K (Kai Y), Lee L, Manuel J, Gorczynski RM. 2003. Sleep-deprived mice show altered cytokine production manifest by perturbations in serum IL-l, TNFa, and IL-6 levels. Brain Behav Inunun. 17 (6): 498-504.

13. Clark DA, Yu K (Yu G), Arck PC, Levy GA, Gorczynski RM. 2003. MD-1 is a critical part of the mechanism causing Th1-cytokine-triggered murine fetal loss syndrome. Am J Reprod Immunol. 49(5): 297-307.

xxiii

14. Gorczynski RM, Chen Z, Lee L, Yu K, Hu J. 2002. Anti-CD200R ameliorates collagen-induced arthritis in mice. Clin Immunol. 104(3): 256-64.

15. Gorczynski RM, Hadidi S, Yu K (Yu G), Clark DA. 2002. The same immunoregulatory molecules contribute to successful pregnancy and transplantation. Am. J. Reprod Immunol. 48(1): 18-26.

16. Gorczynski RM, Hu J, Chen Z, Yu K (Kai Y), Lei J. 2002. A CD200:Fc immunoadhesin prolongs rat islet xenograft survival in mice. Transplantation 73(12): 1948-53.

17. Hadidi S, Chen Z, Phillips J, Yu K, Gorczynski RM. 2002. Antisense deoxyoligonucleotides or antibodies to murine MD-1 inhibit rejection of allogeneic and xenogeneic skin grafts in C3H mice. Transplantation 73(11): 1771-9.

18. Gorczynski RM, Chen Z, Yu K, Hu J. 2001. CD200 immunoadhesin suppresses collagen-induced arthritis in mice. Clin Immunol. 101(3): 328-34.

19. Gorczynski RM, Chen Z, Hu J, Yu K (Kai Y), Lei J. 2001. Evidence of a role for CD200 in regulation of immune rejection of leukamic tumour cells in C57BL/6 mice. Clin Exp Immunol. 126(2): 220-9.

20. Clark D, Yu K (Yu G), Levy GA, Gorczynski RM. 2001. Procoagulants in fetus rejection: the role of the OX-2 (CD200) tolerance signal. Semin Immunol. 13(4): 255-63. Review.

21. Hadidi S, Yu K, Chen Z, Gorczynski RM. 2001. Preparation and functional properties of polyclonal and monoclonal antibodies to murine MD-1. Immunol Lett. 77(2): 97-103.

22. David Clark, Jin-Wen Ding, Yu K (Yu G), Gary A. Levy, Gorczynski RM. 2001. Fg12 porthrombinase expression in mouse trophoblast and decidua triggers abortion but may be countered by OX-2. Molecular Human Reproduction l7(2): 185-194.

23. Gorczynski RM, Chen Z, Clark D, Hu J, Yu K (Kai Y), Li X, Tsang W, Hadidi S. 2001. Expression of murine MD-1 regulates T-cell activation/ cytokine production. Transplant Proc. 33(1-2): 1585-92.

24. Gorczynski RM, Yu K, Clark DA. 2000. Receptor engagement of cells expressing a ligand for the tolerance-inducing induces an immunoregulatory population that inhibits alloreactivity in vitro and vivo. J Immunol. 165(9): 4854-60.

25. Gorczynski GM, Chen Z, Clark DA, Hu J, Yu K (Yu G), Li W, Hadidi S. 2000. Regulation of gene expression murine MD-1 regulates subsequent T cell cytokine production. J Immunol. 165(4): 1925-32.

26. Gorczynski GM, Chen Z, Yu K (Kai Y), Lei J. 2000. Evidence for persistent expression of OX2 as a necessary component of preallograft survival following portal vein immunization. Clin Immunol. 97(1): 69-78.

27. Ragheb R, Abrahams S, Beecroft R, Hu J, Ramakrishna V, Yu K (Yu G), Gorczynski RM. 1999. Preparation and functional properties of monoclonal antibodies to human, mouse and rat OX-2. Immunology Letter 68(2-3): 311-5.

28. Gorczynski L, Chen Z, Hu J, Yu K (Kai Y), Ramakrishna V, Gorczynsiki RM. 1999. Evidence that an OX-2-positive cell can inhibit the stimulation of type 1 cytokine production by bone marrow-derived B7-1 (and B7-2)-positive dendritic cells. J Immuno1. 162(2): 774-81.

29. Gorczynski RM, Cattral MS, Chen Z, Hu J, Lei J, Min WP, Yu K (Yu G), Ni J. An immunoadhesin incorporating the molecule OX-2 is a potent immunosuppressant that prolongs all- and xenograft survival. J Immunol. 163(3):1654-60.

1

CHAPTER 1

General introduction/Current state of knowledge

2

1. Introduction

The immune system acts to provide host defense in multi-cellular organisms allowing host

organisms to detect and eliminate various invading pathogens and/or damaged tissues. In order

to respond to the molecular diversity of pathogens and their high replication and mutation rates,

vertebrates have evolved both an adaptive immune system and an innate system.

The innate immune system was first described by Metchnikoff over a century ago, and has

been considered as the first line of defence against invading microbial pathogens. The main

components of this system are cellular, including macrophages, dendritic cells (DCs),

neutrophils and natural killer cells (NKs), and a number of protein components of

cytokine/chemokine, complement, mannose binding lectin/protein (MBL/P) and lysozyme etc.

There are two key functional features for the innate system. The first is recognition of

pathogens and initiation of a host innate immune response (capturing/engulfing pathogens, and

producing inflammatory cytokines/chemokines). Under physiologic conditions, effectors of

innate immunity act as sentinels in peripheral tissues, continuously sampling the antigenic

environment. The second feature is its ability to activate the adaptive immune system.

Following antigen exposure, some effector cells, so-called antigen presenting cells (APCs) with

the capacity to engulf and process antigen, migrate to local draining lymph nodes and/or the

spleen to present antigen in the form of antigen specific peptides in association with MHC class

I/II molecules (peptide-MHC complex) to lymphocytes, with corresponding cognate receptors,

to initiate adaptive immunity. The innate system can distinguish non-self from self through

pattern recognition receptors (PRRs), which recognizes motifs for pathogens and “damaged self

tissue (i.e. pathogen associated molecular patterns (PAMPs) and damage associated molecular

3

patterns (DAMPs)).

The adaptive immune system in vertebrates has two branches: the T lymphocyte arm

(cellular immunity – targeting cellular/intracellular antigens) and the B lymphocyte arm

(humoral immunity – targeting soluble antigens). These protect the host from a broad range of

pathogenic microorganisms, while avoiding misguided or excessive immune reactions that

would be deleterious to the host (immune homeostasis). The two ‘arms’ of the adaptive

immunity function co-operatively and in distinct manners. Enormous diversity in antigen

recognition occurs through VD(J) recombination at the DNA level in T cell receptor (or B cell

receptor), TCR/BCR, gene rearrangement (1) . The resultant lymphocytes have exquisite

antigen specificity, potent effector activity, and long-lasting immunologic memory, all of which

are the hallmarks of adaptive immunity.

Immune responses of adaptive immunity can be further divided into primary and secondary

responses (mediated by naïve lymphocytes or memory lymphocytes separately). After

activation, antigen specific lymphocytes undergo rapid clonal expansion to produce both

primary effector cells and memory cells. Development of adaptive immune effectors generally

takes about 4-7 days, with T cell responses occurring earlier than B cell expands. A key feature

is the regulation of adaptive immunity to ensure that self-reactivity does not occur.

Understanding how unresponsiveness of the adaptive immune system to self-antigens

(self-tolerance) is established/maintained to avoid damage to the host (immune homeostasis)

has been a major challenge in immunology and medicine. In turn, being able to control this

immune regulation would be of benefit to improve immunity to tumor antigens in cancer

patients, or against microbial antigens in chronic infection, as well as to eliminate responses

4

contributing to graft rejection in transplantation

The projects which form the basis of this thesis mainly deal with regulation of immunity

achieved by the action of the molecular dyad, CD200:CD200R, a regulatory pair of cell surface

molecules belonging to the immunoglobulin gene family. Accordingly the discussions in this

chapter will focus on immune tolerance and CD200.

2. Immune tolerance and its mechanisms

2.1. Immune tolerance

Immune tolerance represents a state of specific unresponsiveness either to self antigens

(self-tolerance) or a specific foreign antigen (acquired immune tolerance) in the absence of

global immune system ablation. Self-tolerance is an inherent property of the immune system,

whereas acquired immune tolerance is actively acquired and highly regulated. Induction and/or

maintenance of acquired tolerance is a complex process involving multiple cellular components,

which may change over time (2).

Transplantation tolerance is one instance of acquired tolerance and is manifest as

acceptance of a specific donor graft in a host that retains the ability to response to infection and

to reject third party (MHC unrelated to that of tolerated graft) grafts (2).

Immune tolerance is classically divided into central tolerance and peripheral tolerance,

depending upon whether it is established primarily in central (e.g. the thymus for T-cell

tolerance) or peripheral tissues.

2.2. Mechanisms for achieving tolerance

There are two types of mechanisms for achieving immune tolerance and immune

5

homeostasis, namely “recessive” or cell-intrinsic mechanisms and “dominant” or cell-extrinsic

mechanisms.

2.2.1. “Recessive”/cell-intrinsic mechanisms for achieving tolerance

In the recessive or cell-intrinsic mechanism, the fate of antigen-exposed reactive

lymphocytes is determined in a cell-intrinsic manner such as:

(i) central/clonal deletion of reactive cells (apoptosis);

(ii) receptor editing (replacing self-reactive TCRs and BCRs with nonreactive ones); and

(iii) peripheral deletion of reactive cells and anergy (failure to response to antigen

stimulation).

2.2.1.1. Central tolerance/clonal deletion

Although it has been reported that the intravenous administration of foreign alloantigen can

cause apoptosis of mature T cells in the periphery of TCR-transgenic mice (3), central tolerance

in T cells generally refers to the tolerance established primarily in the thymus through clonal

deletion during ontogeny of developing antigen-reactive T cells (thymocytes). During T cell

development in the thymus negative selection leads to the deletion (apoptosis) of thymocytes

whose T cell receptors have high affinity for self-antigens (4-6). In experimental animals donor

hematopoietic cells seed the thymus with progenitor cells, and mature T cells reactive with the

recipient’s own antigens are deleted (7). Central deletion in mixed chimeras was reported using

a T cell receptor (TCR)-transgenic mouse model (8). The transcription factor encoded by the

autoimmune regulator gene (Aire) promotes constitutive synthesis and expression of many

peripheral tissue-specific antigens (self-antigens) in thymic medullary epithelial cells (TMECs)

and bone marrow-derived dendritic cells (BM-DCs), and furnishes those cells with the

6

apparatus for antigen presentation. This is thought to be crucial for thymic (central) deletion (9).

Mice or humans lacking Aire expression succumb to autoimmune diseases (10, 11).

Despite the evidence for tolerance caused by thymic (central) deletion, it is clear that

healthy individuals still have potentially autoreactive T cells in the periphery which generally

do not cause pathology. In part at least such cells exist because some self-reacting proteins are

never expressed in the thymus. Thymic deletion also cannot account for the acquired tolerance

which is often seen in the presence of an intact anti-recipient T cell repertoire in clinical bone

marrow (BM) transplant recipients. It is clear that mature donor reactive T cells can be rendered

unresponsive/tolerant to donor alloantigens in peripheral tissues (7), and thus other non-central

mechanisms for tolerance must exist.

2.2.1.2. Anergy and peripheral deletion

Three signals are now believed to be required for T cell activation. These are:

(i) binding T cell receptor to MHC-antigen peptide complexes on APCs;

(ii) the interaction of co-stimulatory molecules on T cells with their ligands/receptors on

APCs; and

(iii) an inflammatory cytokine environment provided by APCs (Figure 1).

Delivery of the first signal in the absence of others especially a signal from co-stimulatory

molecules leads to a state of anergy of effector T cells. Anergy is a state of functional

inactivation, in which antigen-specific T cells are present but unable to respond to antigen

challenge, even when this now takes place in the context of adequate co-stimulatory signals.

Under physiologic conditions, constitutively expressed antigens are presented to T cells

with low TCR avidity by quiescent APCs (no upregulation of MHC molecules and

7

Three signals are required for T-cell activation

7

Figure 1

Helper T cells

Signal 1

Signal 2

Signal 3

CD4

TCR

MHC II presenting antigen peptide

CD28B7

Signal 2

Antigen presenting cells (Macrophages,

DCs, and B cells)

Adapted from 9e.devbio.com/article.php?ch=22&id=215

8

co-stimulators). This presentation, in the absence of co-stimulatory signals, results in induction

of anergy in effector T cells. Failure of T cell proliferation and cytokine production in vitro (12)

and failure of clonal expansion in vivo (13) are measured in these states.

The mechanisms involved in anergy versus deletional tolerance are different. Deletion

represents a permanent disappearance of the effector cells. In contrast, anergic effector cells can

regain their ability to respond once they are allowed to rest in the absence of antigen (14, 15). In

general, lower doses of antigen presented in chronic (persistent) fashion promote effector T cell

anergy, whereas higher doses presented for a shorter time period produce deletion (14-17).

2.2.2. Dominant/cell-extrinsic mechanisms

In dominant or cell-extrinsic mechanisms, regulatory T cells actively keep in check the

activation and expansion of aberrant or overreactive effector lymphocytes as well as APCs. It is

now being appreciated that most adaptive immune responses involve recruitment and activation

of both effector T and B cells and also regulatory T cells. The balance between these

populations is critical for control of the quality and magnitude of adaptive immune responses

and for establishing or breaching tolerance to self- and non-self-antigens.

2.2.2.1. Suppression

Suppression mediated by regulatory T cells represents another mechanism of

immunological tolerance distinct from central/clonal deletion and anergy/peripheral deletion.

The existence of subpopulations of T cells that function as suppressors was originally

postulated in the early 1970s. However, the mechanisms responsible for their suppressive

properties were never clearly characterized at the molecular and biochemical level, primarily

because of the difficulty in isolating suppressor T cells at the single cell level (18). Interest in

9

suppressive T cells gradually dwindled. Focus on suppressive T cells has been reborn as the

study of regulatory T cells. Regulatory T cells comprise a class of lymphocytes which are

believed to be distinct from helper and cytolytic T lymphocytes. Details on the classification

and functional features of regulatory T cells are given below.

2.2.2.2. Basic mechanisms for suppression mediated by regulatory T cells

Many mechanisms for action of regulatory T cells have been proposed. From a functional

perspective, the potential suppression mechanisms can be grouped into four basic ‘modes’ of

action: suppression by inhibitory cytokines; suppression by cytolysis; suppression by metabolic

disruption; and suppression by modulation of dendritic cell maturation or function (Figure 2).

(1) Suppression by inhibitory cytokines

The general importance of IL-10 and TGF-β as suppressive mediators is undisputed. IL-10

is now considered a soluble factor that plays a central role in controlling inflammatory

processes, suppressing T cell responses, and maintaining immunological tolerance (19). IL-10

down-regulates the expression of MHC class II, co-stimulatory and adhesion molecules (20-22);

inhibits the release of inflammatory cytokines; and modulates the stimulatory capacity of

dentritic cells and other antigen presenting cells (23). Furthermore, IL-10 inhibits cytokine

production by T cells and moncytes/macrophages, and induces long-lasting antigen-specific

anergy in both CD4+ and CD8+ effector T cells (24-26), as well as inducing development of

regulatory T cells (27).

TGF-β also has multiple suppressive effects on T cells, B cells, and macrophages, and can

in addition down-regulate the adhesion of lymphocytes to endothelial walls (28-31). More

recently it is evident that TGF-β regulates development of regulatory T cells (32). The

10

Adopted from Dario A.A. Vignali, Lauren W. Collison & Creg J. Workman. Nature

Review, volume 8, 523-532, 2008

11

contributions of IL-10 and TGF-β to the function of thymus-derived, naturally occurring Treg

cells (nTreg) are still a matter of debate (33). Thus, in vitro studies using neutralizing antibodies

for IL-10 and TGF-β or T cells that are unable to produce or respond to IL-10 and TGF-β

suggested that these cytokines may not always be essential for nTreg-cell function (34-37). This

is in contrast with data from in vivo studies (37, 38). Collectively, the picture that appears to be

emerging is that the relative importance of IL-10 and TGF-β production by Treg cells as a

mechanism of Treg cell mediated suppression is dependent on the disease and/or the

experimental system under consideration. There has been more focus recently on the

importance of TGF-β in the development of induced Treg cells and in Treg cell maintenance in

general.

Recently, IL-35, a relative new inhibitory cytokine, has been described that is preferentially

expressed by Treg cells and is required for their maximal suppressive activity (39). IL-35 is a

new member of the IL-12 heterodimeric cytokine family (40). IL-35-/- Treg cells had

significantly reduced regulatory activity in vitro and failed to control homeostatic proliferation

of effector T cells and resolve inflammatory bowel disease (IBD) in vivo (39, 40). Importantly,

IL-35 was sufficient for Treg-cell activity, as ectopic expression of IL-35 conferred regulatory

activity on naïve T cells and recombinant IL-35 suppressed T-cell proliferation in vitro (39).

Although IL-35 is an exciting addition to the Treg-cell portfolio, there is clearly much that

remains to be defined about this cytokine and its contribution to Treg-cell function. It remains

unknown whether IL-35 suppresses the development and/or function of other cell types, such as

DCs and macrophages.

(2) Suppression by cytolysis

12

Cytolysis mediated through the secretion of granzymes had long been considered the forte

of natural killer (NK) cells and CD8+ cytotoxic T lymphocytes (CTLs) (41). It was surprising

when early gene expression arrays showed that the expression of granzyme B was upregulated

in mouse Treg cells (42, 43). Noelle and co-workers were the first to report that

granzyme-B-deficient mouse Treg cells had reduced suppressive activity in vitro.

Granzyme-B-dependent suppression appeared to depend upon Treg-cell-induced apoptosis of

effector T cells (perforin-independent) (44). In a transplantation tolerance model (CD40-CD54

blockade), Noelle showed that Treg cells mediating tolerance depended on granzyme B for their

suppressive activity. Activated human nTreg have also been shown to express granzyme A, and

the nTreg mediated target-cell killing was mediated by granzyme A following adhesion to CD18

(45). Recent studies have suggested that TNF-related apoptosis-inducing ligand-death receptor

5 (TRAIL-DR5) and galectin-1 are also involved in suppression mediated by Tregs through

inducing apoptosis of effector T cells (46, 47).

(3) Suppression by metabolic disruption

A long-standing debate in the Treg-cell field is whether the high expression level of CD25

empowers Treg cells to ‘consume’ local IL-2 and thus functionally limiting effector T cell

expansion. More work is clearly necessary to resolve this debate. Two new Treg-cell

mechanisms have recently been proposed that involve the intracellular or extracellular release

of adenosine nucleosides. Concordant expression of the ectoenzymes CD39 and CD73 was

shown to generate pericellular adenosine, which suppressed effector T-cell function through

activation of the adenosine receptor 2A (48-50).

(4) Suppression by targeting dendritic cells and/or other cell types

13

Except for the direct effect of Treg cells on T-cell function, Treg cells might also modulate

the maturation and/or function of DCs. The use of CTLA4-specific blocking antiboies or

CTLA-4-deficient Treg cells showed that in the absence of functional CTLA-4,

Treg-cell-mediated suppression of effector T cells via DCs was reduced (51, 52). Importantly, it

was also shown that Treg cells could condition DCs to express indoleamine 2,3-dioxygenase

(IDO-1), a potent regulatory molecule which is known to induce the production of pro-apoptotic

metabolities from the catabolism of tryptophan, resulting in the suppression of effector T cells

through a mechanism dependent on interactions between CTLA-4 and CD80 and/or CD86 (53,

54).

Treg cells can also modulate the recruitment and function of other cell types.

Treg-cell-derived IL-9 has been shown to recruit and activate mast cells, which were shown to

be essential regulatory intermediaries in the establishment of peripheral allograft tolerance (55).

3. Important cellular components involved in achieving tolerance

3.1 Regulatory T cells

Many cell subsets with regulatory activity have been described including CD4+,

CD8+CD28-, TCR+CD4-CD8-, and NK T cells. The CD4+ regulatory T cell is a well

characterized subpopulation, which is further classified into the following:

(i) thymically derived Foxp3+ Treg cells (i.e. naturally occurring/arising Treg cells

(nTregs)), and several subsets of peripheral inducible regulatory T cells including:

(ii) inducible Foxp3+ T cells (iTregs) (56);

(iii) interleukin-10 (IL-10)-producing T regulatory 1 cells (Tr1) (57); and

14

(iv) transforming growth factor-β (TGF-β)-producing T helper cells (Th3) (58).

A large body of studies provides evidence that such cells play a key role in the immune

tolerance network, controlling both autoaggressive T cells and effector cells in an adaptive

immune response to maintain host immune homeostasis (59-62).

3.1.1. Naturally arising/occurring regulatory T cells (nTregs)

Both early neonatal thymectomy (around day 3 after birth) and adult thymectomy of

selected strains of normal mice/rats followed by several rounds of sublethal x-ray-irradiation

can result in autoimmune damage to various organs (such as the thyroid, stomach, ovaries, and

testes)(63). Such studies suggested that normal animals harbour not only potentially pathogenic

self-reactive T cells but also T cells which suppress that autoimmunity, with the latter normally

controlling the former. These results also inferred that Treg cells are naturally generated in the

thymus (64, 65). Naturally arising regulatory T cells (nTregs) produced in the thymus (63)

comprise about 5-10% of peripheral CD4+ T cells in rodents and up to 13% in humans (66).

nTregs are characterized by co-expression of CD4 and CD25 molecules on their cell surface.

Their development and function depend on expression of the forkhead box 3 protein (Foxp3), a

member of the forkhead/winged-helix family of transcription factors (about 90% of

CD4+CD25+ T cells express Foxp3, whereas Foxp3+ cells occupy only 10% of CD4+ T cells)

(67). The Foxp3 gene was first identified as the defective gene in the mouse strain Scurfy.

Scurfy is an X-linked recessive mutant that is lethal in males within a month after birth,

exhibiting hyperactivation of CD4+T cells and overproduction of proinflammatory cytokines

(68). Mutations of the human gene Foxp3 are the cause of the genetic disease IPEX (immune

dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome), which is the human

15

counterpart of Scurfy (69). High-level expression of Foxp3 is sufficient to confer suppressive

activity to normal non-Treg cells (70). In addition, Foxp3 transduction in naïve T cells promotes

expression of CD25 (IL-2Ra) and other Treg associated cell-surface molecules, including

cytotoxic T cell associated antigen-4 (CTLA4/CD152), and glucocorticoid induced TNF

receptor family related gene/protein (GITR) (Figure 3). This helps characterize human and

mouse CD4+CD25+Foxp3+ nTregs (37, 71, 72). Recent studies have shown that Foxp3 directly

or indirectly controls expression of hundreds of genes (~700) (73). Nevertheless, some genes,

such as that encoding Granzyme B, which are highly specific to Tregs are apparently expressed

independently of Foxp3 (67, 74, 75).

The mechanisms that induce and regulate Foxp3 expression in developing thymocytes

remain incompletely understood. Many studies suggest that TGF-β signalling was critical for

development of natural CD4+CD25+Foxp3+ Treg cells in the thymus and that IL-2 was a

principal driving force promoting the proliferation of natural CD4+CD25+Foxp3+ Treg cells. It

was shown that conditional deletion of TGF-β receptor 1 (TβR1) in T cells blocked the

appearance of CD4+CD25+Foxp3+ thymocytes at postnatal days 3-5, with a complete lack of

Foxp3+ Treg cells in the peripheral lymphoid and nonlymphoid tissues of TGF-βr1f/f IL-2-/- mice

(76). The Treg marker CD25 is a component of the high affinity IL-2 receptor (IL-2Ra) and is

functionally essential for Treg development. It is well known that IL-2 has multiple targets, and

exerts pleiotropic functions with apparently contradictory effects on immune responses. It

facilitates differentiation of CD4+T cells to Th1 and Th2 cells and expands CD8+ memory T

cells, B cells and natural killer cells. On the other hand, IL-2 promotes apoptosis in

antigen-activated T cells. IL-2 also maintains Foxp3+ natural Tregs, expands them at high doses,

16

Control of Treg-associated molecules in nTreg cells

16

(GITR)(CD25)

Adopted from Shimon Sakaguchi. Nature immunology 6, 345-352 2005

Figure 3

Adopted from Shimon Sakaguchi. Nature immunology 6, 345-352 2005

17

and facilitates TGF-β dependent differentiation of naïve to Foxp3+ Tregs (77).

nTregs retain high expression of the T cell homing molecule CD62L, and play crucial roles

in maintaining immune homeostasis and peripheral tolerance. nTegs which have lost their

normal functions are described in many autoimmune diseases (78). Lee and colleagues provided

evidence that naturally occurring Treg cells were the source of intragraft Foxp3 expression, and

were required for allograft tolerance (60). In another allograft model, nTregs are reported to be

capable of promoting acceptance of the grafts after adoptive transfer into lymphopenic

recipients (79).

3.1.2. Inducible regulatory T cells

3.1.2.1. Inducible Foxp3+ regulatory T cells

Foxp3+ regulatory T cells can also be induced in peripheral lymph organs such as the spleen

and lymph nodes. Naïve T cells in the peripheral can also acquire Foxp3 expression and

consequently Treg function in several experimental settings, for example, following in vitro

antigenic stimulation of naïve T cells in the presence of TGF-β (56, 80). Interestingly this

stimulation in the additional presence of IL-6 facilitates T cell differentiation to Th17 cells, a

population now believed to be important in evolution/regulation of chronic inflammatory

conditions (81). In the presence of TGF-β, IL-2 and retinoic acid facilitates the differentiation of

naïve T cells to Foxp3+ Treg and inhibits IL-6 driven induction of Th17 cells at the same time

(77, 82) (Figure 4). However, it remains to be determined whether Tregs induced from naïve T

cells in the periphery are functionally stable in vivo and to what extent they contribute to the

peripheral pool of Foxp3+ Treg. Floess et al reported that in mice the regulatory regions of

Foxp3 gene are more widely demethylated in natural Tregs than in TGF-β induced Tregs,

18

IL-17, 21,22, IL-6, TNF-αααα

18

Functionally-distinct CD4 + T-cell lineages

Naïve CD4+

T cell

TH1

TH2Tr1

TH17

Treg

TH3

IL-4, GATA3

IFN-γγγγ

IL-4,5,13

TGFββββ

IL-10, TGF-ββββ

IL-10 highFoxp3 -

Figure 4

IL-10, IL-27?

Adapted from www.nature.com/.../ncurrent/full/cr200784a.html

Adapted from www.nature.com/.../ncurrent/full/cr200784a.html

19

suggesting a functional instability of the latter (83, 84).

3.1.2.2. IL-10 producing T regulatory 1(Tr-1) cells

IL-10 producing Tr-1 cells were first described from a severe combined immunodeficient

(SCID) patient (85). Since their discovery, it has been evident that understanding the cytokine

production profile of Tr1 cells was a key to understanding their function. Tr1 cells produce large

amounts of IL-10 with little IL-2 and IL-4, both of which are potent T cell growth factors (26).

TGF-β and IL-5, two anti-inflammatory cytokines, are also produced by Tr1 cells in some

experimental settings (26). Despite their low proliferative capacity upon TCR activation, Tr1

cell clones express normal levels of activation markers such as CD25, CD40L, CD69, HLA-DR,

and CTLA-4 (86).

Tr1 cells function mainly through IL-10. They migrate preferentially in response to I-309, a

ligand for CCR8 (87). Tr1 cells do not constitutively express Foxp3, although this can be

up-regulated after activation, similar to what has been documented in CD4+CD25- T cells (62,

88). To date Tr1 are still devoid of a unique cell surface marker which could significantly

improve their isolation, and further characterization.

Tr1 cells are inducible cells and for this reason, similar to Th1 and Th2 cells, they arise

from naïve precursors and can be differentiated both ex vivo and in vivo. IL-10 is considered

the driving force for Tr1 cell generation, as shown by experiments in which antigen-specific

murine Tr1 cells can be induced ex vivo by repeated TCR stimulation in the presence of high

doses of IL-10 (26). Neutralization of IL-10 in this culture significantly inhibits the

development of IL-10 producing T cells (89).

3.1.2.3. TGF-β-producing T helper (Th3) cells

20

Th3 CD4+ regulatory cells were identified during the course of investigating mechanisms

associated with oral tolerance. Oral tolerance is a long-recognized mechanism of tolerance

induction, and oral tolerance has classically been demonstrated by the specific suppression of

cellular and/or humoral immune responses to an antigen following the prior administration of

the antigen by the oral route. Th3 regulatory cells form a unique T-cell subset which primarily

secretes transforming growth factor (TGF)-β with various amounts of IL-4, IL-10; provides

help for IgA; and has suppressive properties acting on both Th1 and Th2 cells. Th3 type cells

are distinct from Th2 cells, as there was a general correlation between the secretion of IL-4 and

IL-10 in an individual clone, whereas this was dissociated for TGF-β and IL-4/IL-10 (90).

CD4+TGF-β-secreting cells with suppressive properties have been generated from

IL-4-deficient animals (91). In vitro differentiation of Th3 cells from Th precursors is enhanced

by culture with TGF-β, IL-4, IL-10, and anti-IL-12, whereas Th1 and Th2 need IL-12 and IL-4

respectively (92-95) (Figure 4). TGF-β-secreting regulatory cells have been reported to play a

critical role in models of donor transfusion-induced allograft tolerance (96) and in other

experimental systems including those studying autoimmune diseases such as experimental

autoimmune encephalomyelitis (EAE) and collagen-induced authritis (CIA) (97-103). Th3

regulatory cells are triggered in an antigen-specific fashion but apparently suppress in an

antigen-non-specific fashion, thus mediating “bystander suppression” (104).

3.2. Other regulatory/tolerogenic cells

Knowledge of other regulatory cells has been greatly expanded in recent years. Although

regulatory T cells at present are considered the central “player” in immune regulation, other

potentially important regulatory cells will be described below.

21

3.2.1. Myeloid derived suppressive cells (MDSC)

Although myeloid cells with immune suppressive activity were reported more than 20 years

ago (105-107), their functional importance in immune regulation has only recently been

appreciated. Myeloid-derived suppressor cells (MDSC) were characterized in tumour-bearing

mice and in patients with cancer (108-111). In these studies, a unique group of tumour

infiltrating cells (MDSCs) was distinguished from classical tumour-associated macrophages

(TAMs) by their high expression of the myeloid-cell lineage differentiation antigen GR1; by the

fact that a large proportion of MDSCs have a granulocytic morphology; and by the increased

expression of both arginase and inducible nitric oxide synthase (iNOS/NOS2), as well as their

production of nitric oxide (NO) and reactive oxygen species (ROS) (these are not expressed by

TAMs). Further studies indicated that MDSC are not a defined subset of myeloid cells, but

rather a heterogeneous population of activated immature myeloid cells (IMCs) that have been

prevented from fully differentiating into mature cells (84). The common features to MDSCs are

their myeloid origin, their immature state and a remarkable ability to suppress T-cell responses

(84).

3.2.1.1. Generation and subsets of MDSCs

In healthy individuals, myeloid progenitor cells and IMCs, including immature

macrophages, immature granulocytes and immature dendritic cells, are generated in the bone

marrow, and quickly differentiate into mature granulocytes, macrophages or dendritic cells.

These progenitor cells and IMCs do not have immune suppressive activity, and are not present

in the secondary lymphoid organs. However, in certain pathological conditions, including

cancer, infectious disease, trauma, organ transplantation, and in some autoimmune diseases, or

22

even following the use of certain immunoregulatory reagents, a partial block in the

differentiation of IMCs into mature myeloid cells causes activation and expansion of this

population. This promotes partial activation of IMCs, and drives their development into

MDSCs.

MDSCs do not express cell-surface markers that are characteristically expressed by

monocytes, macrophages or DCs, and comprise a mixture of myeloid cells that have the

morphology of granulocytes or monocytes (112). In mice, MDSCs are characterized by the

co-expression of the myeloid-cell lineage differentiation antigen GR1 and CD11b

(Mac-1/αM-integrin) (113). Normal mouse bone marrow contains 20-30% of cells with this

phenotype, but these cells make up only a small proportion (2-4%) of spleen cells and are

absent from the lymph nodes (113).

Two antibodies that are specific for the two epitopes (LY6G and LY6C) of GR1 have been

used to further characterize MDSCs. Use of these epitope-specific antibodies has led to the

identification of two MDSC subsets: granulocytic MDSCs (CD11b+LY6G+LY6Clow) and

monocytic MDSCs (CD11b+LYG-LYChi) (112, 114). The immune suppressive mechanisms for

these two subsets are different, and the ability to develop into mature DCs and/or macrophages

in vitro is restricted to monocytic MDSCs (112).

In humans, MDSCs are most commonly defined as CD14-CD11b+ cells or, more narrowly,

as cells that express the common myeloid marker CD33 but lack the expression of markers of

mature myeloid and lymphoid cells, and of the MHC class II molecule HLA-DR (108, 109).

MDSCs have also been identified within a CD15+ population in human peripheral blood (115).

In healthy individuals, IMCs constitute up to 0.5% of peripheral blood mononuclear cells (109).

23

3.2.1.2. Expansion and activation of MDSC under pathological conditions

Accumulating evidence shows that the population of MDSCs expands under pathological

conditions (cancer, inflammation and infection, transplantation, autoimmune diseases), and

these cells have the ability to suppress T-cell responses after activation (84). Expansion and

activation of MDSCs is influenced by several different factors, which can be divided into those

contributing to expansion and/or activation of MDSCs. IFNγ, ligands for Toll-like receptors

(TLRs), IL-4, IL-10, IL-13 and transforming growth factor-β (TGF-β), activate several different

signalling pathways in MDSCs that involved STAT6 and STAT1 and nuclear factor-κb.

Blockade of IFN-γ abolishes MDSC-mediated T-cell suppression (116). STAT1 is the main

transcription factor that is activated by IFNγ-mediated signalling and is involved in

upregulation of arginase 1 and iNOS expression by MDSCs (117).

3.2.1.3. Mechanisms of MDSC suppressive activity

Most studies have shown that the immunosuppressive activities of MDSCs require direct

cell-cell contact. They are believed to function either directly through their cell-surface

receptors or through the release of short-lived soluble mediators including agininase 1, iNOS,

reactive oxygen species (ROS) and peroxynitrite. Different subsets of MDSCs might use

different mechanisms to suppress T-cell proliferation.

Data suggest that there is a close correlation between the availability of L-arginine and the

regulation of T-cell proliferation (108, 118). The increased activity of agininase1 in MDSCs

leads to enhanced L-arginine catabolism, which inhibits T-cell proliferation. NO, the product of

iNOS, suppresses T-cell function through several different mechanisms including the inhibition

of JAK3 and STAT5 in T cells (119), the inhibition of MHC class II expression (120) and the

24

induction of T-cell apoptosis (121).

Recently, the ability of MDSCs to promote the de novo development of forkhead box P3

(Foxp3+) regulatory T (Treg) cells in vivo has been described (122, 123). The induction of Treg

cells by MDSCs was found to require the presence of INF-γ and IL-10, but was independent of

the production of nitric oxide (NO) (123). Other studies indicated that CTLA4 (CD152), or

arginase 1 (not TGF-β) is involved in Treg induction (122, 124). In contrast, another group

found that the percentage of Treg cells was invariably high throughout tumor growth and did

not relate to the kinetics of expansion of the MDSC population (116).

Numerous in vitro studies have documented the antigen-non-specific nature of

MDSC-mediated suppression of T cells (125, 126). Provided that MDSCs and T cells are in

close proximity, the factors that mediate the suppressive function of MDSCs (ROS, arginase 1

and NO) inhibit T-cell proliferation regardless of the antigen specificity of the T cells. However,

whether the situation is the same in vivo is not clear, and it seems that antigen-specific

interactions between antigen-presenting cells and T cells result in much more stable and more

prolonged cell-cell contact than antigen-non-specific interaction (127, 128).

3.2.2. Dendritic cells (DCs) and tolerogenic DCs

Dendritic cells (DCs) are a sparsely distributed, migratory group of heterogenous

populations of leukocytes. DCs are designated as sentinels of the innate immune system

because of their strategic position at all potential pathogen entry sites of the body. DCs are also

probably the most important antigen presenting cells involved in initiating/regulating an

adaptive immune primary response. It should be noted that while DCs promote immune

responses to foreign antigens by presentation of antigens and expression/secretion of

25

co-stimulators/cytokines, in general the same antigen-presenting cells that are involved in

immunity are also involved in peripheral immune tolerance.

3.2.2.1. Subsets and origins of DCs

Under steady-state conditions, both plasmacytoid DCs (pDCs) and at least three subsets

(CD8α+, CD8α-CD4+, CD8α-CD4-) of conventional DCs (cDCs) can be found in the spleen and

lymph nodes of mouse (the term ‘CD8α+ DCs’ applies only to mice, as human DCs do not

express CD8) (129). In addition the lymph nodes also contain a subset of so-called migratory

DCs that migrate from peripheral tissues. The phenotype of migratory DCs varies depending on

the site of drainage. The list of DC subsets discussed above represents an abbreviated one, with

many intricacies associated with particular tissues/situations.

Hematopoietic progenitor cells (Flt3+ for mouse (130, 131) and CD34+ for human (132)) in

the bone marrow give rise to circulating DC precursors (preDCs) that home to tissues, where

they reside as immature cells with high phagocytic capacity (133). DCs were initially thought to

be derived from committed progenitor cells of myeloid origin or lymphoid origin, leading to the

term ‘lymphoid’ DCs and ‘myeloid’ DCs. Subsequent data suggests both myeloid-restricted

precursors and lymphoid-restricted precursors could independently produce all mature DC

subsets (134-136).

Although the bone marrow is the main organ for dendritic cell development, there are many

exceptions. In inflammatory conditions such as infection, monocyte-derived DCs can also be

found in peripheral tissues. For skin-draining lymph nodes, the migratory population consists of

both epidermis-derived Langerhans cells and dermis-derived DCs. However, while DCs arise

from multiple lineages and have distinct stages of cell development, activation and maturation,

26

there are three feature characteristics to all DC populations:

(i) a capacity for antigen presentation;

(ii) the existence in peripheral tissues of both immature (quiescent, CD11c+MHCII -) cells

and mature (CD11c+MHCII +) subpopulations;

(iii) an ability to migrate between peripheral tissues and lymph organs following antigen

encounter.

3.2.2.2. Tolerogenic DCs

After phagocytosis of antigens and exposure to proinflammatory cytokines (IL-1, TNF-α,

IL-6 produced by macrophages), immature/quiescent DCs are activated to develop into mature

subpopulations, characterized by increased expression of MHC II molecules, co-stimulators

(CD40, CD80/86 et al), and increased cytokine production (IL-1, TNF-α, IL-12). At the same

time, these maturing DCs migrate to T cell areas in peripheral lymphoid tissues to prime/initiate

adaptive immunity by presenting antigens as MHC-peptide complexes to T cells. The priming

capacity of DCs is strictly dependent on activation mediated by antigens and proinflammatory

cytokines such as Toll-like receptor-activating products (137), IL-1, TNF-α, IL-6 and

prostaglandins (138) at the site of infection/inflammation.

In the absence of inflammatory signals, resident tissue specific DCs remain in an immature

or resting state, with low expression of MHC II complexes, co-stimulatory molecules and

cytokines (139, 140). Immature DCs show weak migratory activity and T-cell priming

properties. More importantly, they induce antigen-specific T-cell tolerance. Under resting

physiologic conditions, constitutively expressed antigens are presented to T cells with low TCR

avidity by quiescent DCs. This antigen presentation, in the absence of costimulatory signals,

27

results in peripheral clonal deletion or anergy of effector T cells (see earlier). The tolerogenic

capacity of immature DC is restricted to non-inflammatory situations and is changed under

inflammatory or infectious situations (141).

Maturation of immature DCs in the presence of immunosuppressive agents induces an

alternative differentiation pathway to produce tolerance-inducing DC. IL-10 is an important

immunosuppressive factors which blocks the immunostimulatory function of DC and induces

tolerogenic DCs (25, 61, 142, 143). Local production of this anti-inflammatory cytokine in the

skin inhibits the T-cell stimulatory properties of Langerhans cells, whereas pro-inflammatory

cytokines, such as IL-1 and TNF-α, enhance the immunogenicity of Langerhans cells.

Tolerogenic IL-10-modulated DCs are able to convert differentiated peripheral CD4+ and CD8+

T cells into anergic induced regulatory T cells (iTreg) (24, 25, 142, 143).

Many cells can be driven to produce IL-10, including lymphocytes and myeloid cells. One

molecule known to drive the production of IL-10 is ICOS. Interaction of ICOS on CD4+ T cells

and its ligand on DCs increases the production of IL-10. Accordingly, ICOS is thought to play

an essential role in the induction of iTreg by DCs. Immature DCs express low amounts of CD28

ligand, which is required for the induction of effector T cells, while high amounts of ICOS

ligand might significantly influence the induction of IL-10-producing iTreg. A recent study

demonstrated that ICOS-deficient CD4+T helper cells were insensitive to the tolerogenic effects

of immature DCs, supporting the hypothesis that ICOS plays an essential role in the induction

of iTreg by tolerogenic DC (144). Non-differentiated immature DCs are unable to convert T

effector cells into iTreg. Their tolerogenic potential is limited and restricted to naïve/resting T

cells (139, 145). Only the combination of proinflammatory cytokines with defined

28

immunosuppressive agents results in a functionally locked, maturation-resistant tolerogenic DC

phenotype, an important criterion for their clinical application. Further analysis of the signals

and transcription factors which control differentiation of immature DC to tolerogenic cells

remains to be performed.

Rapamycin is a potent immunosuppressive drug that, when complexed with its intracellular

receptor FK506-binding protein 12, inhibits the downstream signalling from mTOR

(mammalian target of rapamycin) proteins (Figure 5) and impairs the maturation and T-cell

allostimulatory function of DCs (146). Rapamycin-conditioned myeloid DCs are poor

producers of the cytokines IL-12p70 and tumour-necrosis factor (TNF) and are resistant to

maturation induction by Toll-like receptor (TLR) ligands or by signalling through CD40. When

infused systemically into mice, they render allogeneic T cells hyporesponsive to further stimuli

with donor antigen. Rapamycin-conditioned myeloid DCs can expand naturally occurring

forkhead box p3 (Foxp3+) CD4+CD25+ regulatory T (nTreg) cells, whereas their ability to

expand CD4+ effector T cells is markedly impaired (147). Moreover rapamycin-conditioned

host DCs that are pulsed with donor antigen and administered to the host before transplantation,

followed by a short post-operative course of minimally effective rapamycin, prolongs

heart-graft survival indefinitely. This is associated with the infiltration of the graft by Treg cells

and with the absence of graft vessel disease (147).

Data from our lab has also suggested that a CD200R2 agonist antibody can influence DCs

to differentiate into tolerogenic DCs which further expand regulatory T cells (see 3.3.3.4).

Tolerance induction by tolerogenic DC includes several mechanisms: silencing of differentiated

29

IL-2 receptor signal transduction and immune suppressive drugs

(+ FKBP12)

29

• Rapamycin is a macrolide antibiotic produced by Streptomyces hygroscopicus. Unlike FK506 (Tacrolimus) and CsA (Cyclosporin), Rapamycin does not inhibit T-cell receptor-induced calcineurin activity. Rather, the RAPA-FKBP12 complex inhibits the serine/threonineprotein kinase called mammalian target of rapamycin (mTOR). Therefore RAPA is able to inhibit T- , B-cell and DC function (all are positive for IL-2R), whereas FK506 and CsAinhibit Tcell’s function only.

• Another negative regulator for IL-2/PI3K pathway is a phosphoinositol 3,4,5-triphosphatase (phosphatase and tensin homolgdeleted on chromosome 10 - PTEN) which catalyzes the reverse reaction of PI3K. Nockdown PTEN can partially remove/reduce the resistance of mTOR to RAPA.

JAK3

mTORFoxp3

p70S6/4E-BP1

RAPA

PTEN

Figure 5Adapted from Nature Reviews Immunology 4, 665-674 (September 2004)

Adapted from Nature Review Immunolgy 4, 665-647 2004

30

antigen-specific T cells (133, 148); transfer of regulatory properties to effector T cells (133,

149); activation and expansion of naturally occurring CD25+ regulatory T cells (nTregs) (133,

150); enhancement of foxp3+ regulatory T cells migration (133); and the differentiation of naïve

CD4+ T cells into regulatory T cells (133, 145).

3.2.2.3. Dendritic cells in skin

Although a number of skin DC subsets have been identified, data addressing the specific

functions of them is limited. Traditionally, Langerhans cell (LC, langerin+), a special type of

DC found in stratified epithelium of the epidermis, cornea, oral cavity, esophagus, vagina and

uterine cervix, was considered to be a main population in the regulation of skin immunity by

capturing and processing antigens in the epidermis in order to activate T cells in the

skin-draining LN (151-154). However, this traditional view is facing a challenge with the

advent of new LC markers which has improved characterization of LCs. Two proteins are

currently used as LC markers, the C-type lectin langerin (which contributes to the formation of

LC’s characteristic Birbeck granules) and epithelial cell adhesion molecule (EpCAM) (155).

EpCAM is expressed in LC, but not in other DC subsets (156), whereas langerin is also

expressed in a subset of dermal DC (dDC) and in some CD8α+ DC in LN (155, 157, 158).

Several studies (158-160) reported a new skin-associated population of langerin positive cells

that, unlike LCs, are radiosensitive and, in contrast to other skin-derived DC populations,

express the intergrin CD103. This cell population can also be found in both skin and the

draining LN. Migratory DCs are critical for trafficking antigen from peripheral sites to the

lymph nodes. Based on the expression of the cell surface markers langerin (CD207/205),

EpCAM (CD326), CD103 (aE-integrin), DCs in skin can be divided into at least 3

31

subpopulations: LC (langerinhi, EpCAM+), classical dermal DC (langerinint, EpCAM-), and

CD103+ dermal DC (langerinint, EpCAM-, CD103+). Examination of the contribution of the

migratory CD103+DC to immunity in the skin showed that despite the presence of three distinct

DC subsets, it was the CD103+ DCs which dominated in importance in the MHC class

1-restricted cross-presentation of both pathogen and self antigens (161). This provides new

insight into the specialization of DC subsets in the skin and suggests that the CD103+ DC subset,

present in various tissues, may be broadly responsible for generating CTL immunity and

tolerance to tissue-associated pathogens and antigens, respectively.

3.3. Blockade of costimulators as a means of tolerance induction

As discussed before (see three-signal model for T cell activation) in addition to specific

antigen, costimulatory signals are a ‘key’ factor for initiating naïve T-cell activation.

Accordingly, blockade of costimulatory signals has been considered as one possibble

mechanism to achieve antigen specific tolerance. A number of membrane molecules deliver

costimulatory signals between APCs and naïve T cells, although the issue is significantly

clouded by independent analysis which showed that some costimulatory molecules also deliver

regulatory signals. Based on molecular structure, costimulators (and their ligands/receptors) can

be generally divided into two families, namely the B7:CD28 family (belong to immunoglobulin

superfamily) and TNFR family (Table 1).

B7-1/2 (CD80/CD86):CD28/CTLA-4 and CD40L (CD154):CD40 are the best

characterized pairs of costimulatory molecules of the B7:CD28 family (162, 163). Prolonged

allograft survival in rodent models is observed after transient blockade of B7:CD28

costimulation by monoclonal antibodies (164). CTLA-4 is expressed in delayed form following

32

Adapted from Kenneth M. Murphy, Christopher A. Nelson and John R. Sedy. Nature review immuno 6, 671 2006

33

T cell activation, with a higher affinity for both B7-1 and B7-2 than constitutively expressed

CD28 (165), and CTLA4 blockade also induces tolerance. However, CTLA-4 may have another

more complex mechanism of action which involves induction of indoleamine dioxygenase

(IDO) in APCs.

Of the multiple forms of costimulation blockade, only targeting of CD40-CD154

interactions (+DST) has proven widely successful in promoting donor specific tolerance

(166-168). In the case of CD154 mAb-linked tolerance, well-functioning allografts consistently

show host mononuclear cell infiltration with an absence of target organ injury, suggesting a

potentially active process of regulation within the graft (169). Another allograft tolerant model

induced by blockade of CD40:CD154 costimulation concluded that recruitment of Foxp3+ Treg

cells to an allograft tissue was a contributing factor, dependent in turn upon expression of the

chemokine receptor, CCR4 (60). The overall failure of costimulatory blockade as a routine

means to induce tolerance may reflect the redundancy in expression/function of costimulatory

molecules, such that tolerance depends upon silencing of multiple signaling pathways.

Identification of dominant regulatory silencing pathways (below) would be predicted to be

more advantageous.

3.4. Cell surface regulatory receptors and their ligands

APCs, especially DCs, link the evolutionarily conserved pattern-recognition receptor

system (PRRs) of the innate immune system to the highly variable recognition receptor

repertoire on lymphocytes of the adaptive immune system, and are involved in providing all

signals required for T cell activation. The functional status of APCs (DCs), including the

expression of cell surface molecules and cytokines, determines whether immunity or tolerance

34

will develop.

The failure of blockade of costimulatory molecules to induce tolerance across multiple

systems focussed attention on those ligand-receptor pairs which can directly deliver a regulatory

signal to APCs or antigen activated T cells. These include members of the B7:CD28 family such

as B7-1/2:CTLA-4 and PD-L1(B7-H1)/PD-L2 (B7-DC):PD-1, and the important immune

regulatory pair of CD200-CD200R (170-174).

3.4.1. B7 family members (CD80/86 (B7-1/2):CTLA-4 and PDL-1/2:PD-1)

All members of this family are type 1 transmembrane glycoproteins which belong to the

immunoglobulin (Ig) supergene family (Figure 6). Despite the low homology (20-35% identity)

in primary amino acid composition between B7 members, all molecules share a similar

secondary structure. They have a single Ig V- and Ig C-like extracellular domain, and four

highly conserved cysteine residues which are involved in the formation of disulfide bonds

within/between the IgV and IgC domains. The receptors for the B7 members possess a single Ig

V-like extracellular domain, while their cytoplasmic tails contain putative PI3k motif and PP2A

or SH2/3-motifs thought to be involved in signal transduction (175).

Although the primary role of B7-1/2:CTLA-4 interactions was thought to reside in

promoting T cell activation (162, 163), a number of immunoregulatory functions for

B7-1/2:CTLA-4 interactions have been reported, including:

(i) a role in delivery of immune suppressive signals to effector T cells (blocking

CD28-PI3k-Akt pathway) (176) and a role in induction of CD4+CD25+ Treg (APCs to T cells

through CTLA-4) (177);

(ii) a direct immunoregulatory role for B7-1/2 expressed on T cells themselves (T cells to T

35

The B7 family and antigen presentation to T cells

Figure 635

Adopted from Weiping Zou & Lieping Chen. Nature Reviews Immunology 8, 467-477 2008

Adapted from Weiping Zou & Lieping Chen Nature Review Immunology 8, 467-477 2008

36

cells through B7-1/2) (178); and

(iii) an immune regulatory role of B7-1/2 expressed on APCs acting via CTLA-4 (T cells to

APCs through B71/2) (179).

The PDL-1/2:PD1 (programmed death-1) is also known to provide important regulatory

signals (180). PD-1 is monomeric, and has two tyrosines in its cytoplasmic domain, comprising

an immunoreceptor tyrosine-based inhibitory motif (ITIM) and an immunoreceptor

tyrosine-based switch motif (ITSM) separately. Mutagenesis studies suggested that the ITSM

motif is required for the inhibitory activity of PD-1. Moreover, expression even of low levels of

PD-1 suffices to induce potent inhibition of the earliest stages of T cell activation. Upregulated

PD-1 in Tregs was also reported by many studies, and based on whether expression of PD-1,

CD4+CD25+Tregs could be further divided into two subgroups (181, 182).

Many mechanisms are involved in the tolerance induced by the regulatory receptors in the

extended B7 family. Both CTLA-4 and PD-1 can block the CD28-PI3k-Akt pathway (176),

although the targets mediating inhibition by CTLA4 and PD-1 are different. CTLA-4 is thought

to inhibit Akt activation via protein phosphatase 2a (PP2A), whereas PD-1 blocks PI3k activity

via the Src homology phosphatase 2/1 (SHP-2/1) (176). In addition, PD-1 has a much wider

expression pattern than CTLA4 (which is relatively restricted to expression on activated T cells).

A recent study reported that PD-1 expressed on monocyte could induce IL-10 production which

impairs CD4+ T cell activation during HIV infection (183).The expression patterns of the PD-

ligands are also distinct from those of B7-1/B7-2. PD-L1 is expressed relatively ubiquitously,

on resting B, T, myeloid, and dendritic cells- its expression is increased on all these cells

37

following their activation. In contrast, PD-L2 is induced by cytokines only on macrophages and

DCs (184).

3.4.2. CD200 and CD200R(s)

3.4.2.1. Early evidence for a role of CD200 in immune regulation

The first evidence that CD200 might represent another molecule with immunoregulatory

function came from our lab in 1998 in studies in a murine renal allo-graft model (185). The

molecule CD200 (originally called MRC OX-2) was first described by Barclay’s group (Oxford

University) (186) in 1979. To identify new antigens potentially related with immunity,

McMaster and William precipitated and purified proteins from lysate of rat thymus using

monoclonal antibodies, which were developed by fusing spleen cells of a mouse immunized

with partially purified rat thymocyte membrane glycoprotein with the mouse myeloma cell line

(NS-1). The antigen specifically bound by monoclonal antibody MRC OX-2 was referred to as

MRC OX-2 (now CD200). We showed using a substractive hybridization approach,

over-expression of CD200 was detected in mice showing increased graft survival after portal

vein (pv) immunization with donor spleen or bone marrow derived dendritic cells, as compared

to control groups that had received intravenous immunization. Increased survival was reversed

following neutralization of CD200 by mAbs and restored by adding CD200:Fc fusion protein

(185).

Splenic cells taken from CD200:Fc treated mice showed polarized cytokine production to

type 2 cytokines (187-190). F4/80+CD200R+ splenic cells, admixed with CD200:Fc, were a

potent immune suppressive population causing more profound inhibition of alloreactivity in

vitro or in vivo (skin-graft) than that seen using either CD200:Fc or CD200R+ cells alone.

38

Immunoregulation by this F4/80+CD200R+ population occured in an MHC-restricted fashion

(191).

3.4.2.2. Biochemical characterization of CD200

Ongoing studies by Barclay’s group at Oxford show that CD200 was a type I membrane

glycoprotein broadly expressed on a variety of cells (192-194), including neurons as well as

those important in inflammation and immunity (dendritic cells, B cells, activated T cells,

endothelial cells (188)). CD200 in different tissues undergoes differential glycosylation (CD200

has 6 N-linked glycosylation sites), and thus CD200 from brain/thymus (containing 24% and

33% carbohydrate respectively) had different molecular weights, of 41 Kda and 47 Kda (195).

The gene coding for CD200 is localized on mouse chromosome 16 and human chromosome 3

(196, 197). CD200 does not show sequence polymorphism (198).

cDNA sequencing indicated that CD200 belonged to the immunoglobulin (Ig) supergene

family, and shares homology with many important immune molecules such as the α- and

β-chain of the T cell receptor, T cell co-receptor CD4, and Ig light chain (199). Among the six

exons of CD200, exon 1 and 2 encoded the hydrophobic signal/leader peptide (31a.a.); exon 3

and 4 encoded the extracellular domain (both Ig V-like and C-like regions, total 201a.a.); exon 5

encoded both the trans-membrane domain (28a.a.) and the cytoplasmic domain (19a.a.); and

exon 6 encoded the 3’-UTR (Figure 7). CD200 had significant homology with B7-1/2

(CD80/86) (up to 50% at amino acid level), yet failed to bind either CD28 or CTLA4 (197).

The broad cellular distribution, and the presence of a short cytoplasmic region (19a.a.)

devoid of known signalling motifs or adaptor sites for other signaling molecules, implied that

CD200 would function by binding to another molecule, a CD200 receptor (s) (188, 199).

39

The structure of full length The structure of full length cDNAcDNA of mouse of mouse CD200CD200

CD200 is a type I membrane glycoprotein, preferenti ally expressed on cells important in inflammation and immunity. It possesses two Ig domai ns (V and C domains) and belongs to the immunoglobulin supergene family.

Leader(31) V region (110a.a.) C region (91a.a.) TM (28)

Extracellular domain (696bp-232aa)

full length cDNA of Mouse CD200 (837bp-279aa)

Cyto(19)

Figure 7

40

40

3.4.2.3. Characterization of CD200R and its expression profile

Resident peritoneal cells (RPCs) and splenic macrophages were defined as CD200R+ cells

by the Barclay group and our lab independently (200, 201). Interaction between CD200 and

CD200R was demonstrated in an elegant experiment. A monoclonal antibody OX102 (IgG1)

which could stain CD200R expressing cells (RPCs) and block the binding of CD200-coated

fluorescent beads to those cells (RPCs) was selected for immune precipitation of the receptor

protein from rat splenic lysates (202). Like CD200, CD200R is a type I transmembrane

glycoprotein (978bp/326a.a. and 7 exons) with two Ig-like domains. The gene coding for

CD200R is localized on chromosome 16 for mouse and chromosome 3 for human respectively.

Mouse CD200R possesses 10 potential N-linked glycosylation sites compared to 6 in mouse

CD200. Most importantly, CD200R has a longer cytoplasmatic tail (67a.a.) with 3 tyrosine

residues (Y286, 289, 297) (Figure 8A). One of the residues (Y297) is located within an NPxY

motif, which, like the immune receptor inhibitory motif (ITIM), is a well-characterized target

for signal adaptor proteins containing phosphotyrosine-binding (PTB) domains (203-205). This

implies that CD200 regulates immune responses through delivering immunoinhibitory signals

to CD200R+ cells. For clarity, this CD200R, the first to be cloned, is referred to as CD200R1.

CD200R1 expression is largely restricted to cells of the myeloid lineage, including

monocytes/macrophages, dendritic cells, neutrophils and mast cells/basophils. Our lab reported

that T lymphocytes could also express CD200R1 (201) with 27% of ConA activated splenic T

cells, and the majority (>80%) of γδTCR+ T cells from Peyer’s patches (PP) stained by FITC

labeled CD200:Fc. Using both quantitative RT-PCR and FACS, Wright and colleagues reported

that the distribution of mouse and human CD200R1 was similar, with strongest labelling of

41

The structure of CD200R family

Figure 8

Figure 8A and 8C: Schematic showing essential structural features which distinguish CD200R isoforms. Figure 8B: Genomic organization of different CD200R isoforms.

Fig. 8A Fig. 8B

Fig. 8C R4

41

Adapted from Gorczynski RM et al Am J Reprod Immunol. 2004 Aug; 52(2):147-63.

42

macrophages and neutrophils, but with evidence for expression also on other leukocytes,

including monocytes, mast cells, T cells, and NKT cells, and even some B cells. However,

fibroblasts, endothelial cells, and NK cells did not express CD200R1 (206). FACS analysis

indicated that CD200R1 was expressed by human peripheral blood leukocyte derived DC,

murine plasmacytoid DC, and murine Langerhans cells (196). The expression of CD200R1 on

γδT cell was increased after activation (anti CD3/CD28) in vitro (207). Another independent

study reported that in both mouse and human, CD4+ T cells express higher amounts of

CD200R1 than CD8+ T cells, and memory T cells express higher amounts than naïve or effector

T cells. CD200R1 expression is up-regulated on both CD4+ and CD8+ T cells after stimulation

with anti-CD3 and/or anti-CD28 in vitro (205).

3.4.2.4. The signalling pathway for CD200:CD200R interaction

A study from Phillip’s group (208) focused on CD200R1 signalling pathways which

control degranulation of mouse bone marrow-derived mast cells. Upon binding to CD200, the

tyrosine in the NPxY motif of CD200R1 was phosphorylated, becoming a target for the

phosphotyrosine-binding domain (PTB)-containing inhibitory adaptor proteins Dok1/2. These

adaptors subsquently bound to SH2-containing inositol phosphatase (SHIP) and recruited

RasGAP, leading eventually to the inhibition of the Ras/MAPK pathways and inhibition of

cytokine production and mast cell function (activation of ERK, JNK, and p38 MAPK were all

inhibited by CD200R engagement) (208).

3.4.2.5. Other CD200Rs

Subsequent cloning and data mining revealed the existence of a family of CD200Rs, as

reported independently by Wright et al and Gorczynski et al (206, 209, 210). Based on cDNA

43

sequence analysis, extensive gene duplication was identified in the CD200R genes, with up to

five related genes in mice and two genes in human. Both murine and human CD200Rs share the

same chromosome with CD200. In mouse, CD200Rs are localized as an R1/5/R4/R2/R3 gene

cluster (R5 is a psuedogene), and oriented in a head-to-tail configuration with respect to the

centromere (209) (Figure 8B). Murine CD200R2, R3, R4, and human CD200R2 are distinct

from CD200R1 in that they only contain a short cytoplasmic tail lacking any putative signalling

motifs. However, they do contain positively charged lysine residues within their

membrane-spanning domains which can serve as docking sites for adapter molecules (e.g.

DAP-10/DAP-12) (Figure 8C). Expression of these receptor isoforms at the cell surface may

even require their association with the adaptor molecules DAP-10/DAP-12 (206, 209, 211).

DAP-12 contains a consensus immunoreceptor tyrosine-based activation motif (ITAM) in the

cytoplasmic tail and recruits protein tyrosine kinases, such as ZAP-70 and/or Syk (212), when

phosphorylated.

The expression profiles of these alternate CD200Rs and whether they all use CD200 as a

ligand remains controversial. We have suggested that the interactions of alternate CD200Rs

(201, 206) with CD200 can produce immunoregulation by a mechanism different from that

induced by CD200:CD200R1 interaction. This hypothesis was supported by data indicating that

triggering of anti-CD200R2 promotes development of “tolerogenic” dendritic cells (213) which

subsequently induce a population of CD4+CD25+ Treg (214). An alternate hypothesis,

advanced by Barclay et al, is that these alternate CD200Rs use an as yet unidentified ligand for

induction of their activity (215).

44

4. Roles of CD200:CD200R interaction in manipulation of immunity in clinical scenarios

4.1. CD200:CD200R interaction in organ transplantation

Organ transplantation is a key therapeutic modality for patients with end-stage organ failure.

Survival rates of grafts have been improved with the help of various immunosuppressive drug

regimens. However non-specific immunosuppressive drug therapy brings with it the problems

of drug toxicity, increased susceptibility to opportunistic infection, and increased risk of

malignancy. Induction of specific organ tolerance would obviate these risks.

4.1.1. Allograft rejection

Donor MHC molecules (HLA/H2) expressed on donor DCs in nonvascular organs e.g.

skin or expressed on recipient’s APCs in vascular organs e.g. heart are presented as foreign

antigens to host effector lymphocytes (direct or indirect antigen presentation respectively).

About 0.1-10% of T cells can bind and respond to allogeneic major histocompatibility complex

(MHC/HLA) molecules which are highly polymorphic (216). To date, hundreds of different

alleles have been identified for the five major human leukocyte antigen (HLA) loci (HLA-A, B,

C, DR and DQ). The chance of find a completely matched unrelated organ graft is rare.

Polymorphisms associated with ‘minor’ histocompatibility antigens (miH) (not encoded in the

MHC) can produce multiple ‘minor’ mismatched histocompatibilty reactivity often leading to

rejection as aggressively as MHC reactivity (217). Following initial allorecognition and T cell

activation the rejection response is amplified in a process involving activation/migration of

APCs (DCs), expansion of effector T cells/B cells and DTH macrophages, and production of

multiple effector molecules, including chemokines, cytokines, complement, and antibody (218,

219). The net result (without pharmaceutical intervention) is graft rejection.

45

Rejection is categorized as hyperacute, acute and chronic. The characteristics of these

processes are summarized in Table 2. Preexisting host antibodies that bind to donor (MHC)

antigens present on graft endothelium cause hyperacute rejection (antibody-mediated rejection).

Acute cellular rejection involves either direct T-cell recognition by recipient T cells of foreign

MHC molecules expressed on donor-derived APCs (direct recognition), or recognition of

donor-derived alloantigen peptides processed and presented by recipient APCs to host T cells

(indirect recognition) (217) (Figure 9). Chronic rejection is a slow, irreversible process, the

immunobiology of which is less well understood. This process produces scars by deposition of

collagen, fibronectin, and proteoglycans that lead to progressive graft dysfunction and loss

(194).

4.1.2. Immunesuppressive agents currently used in transplantation

Immunosuppressive drugs used in the clinic to prevent allograft rejection target a cascade

of events, ranging from antigen recognition, processing and presentation to the clonal

proliferation of immune effector cells. Commonly, these reagents inhibit T-cell responses

directly or through their effects on other cells, including:

(i) inhibiting the development and maturation of APCs (deoxyspergualin,

corticosteroids);

(ii) blockade of production of IL-2 and other cytokines via TCR signalling pathway

(cyclosporine, tacrolimus-FK506);

(iii) blockade of leukocyte responses to growth factors i.e. blockade of IL-2R signalling

pathway (Rapamycin, IL-2 receptor a-chain-specific antibody); and

(iv) inhibition of DNA synthesis (Azathioprine, Mycophenolate mofetil) (217).

46

Table 2: Categories of rejection and their features

Type Cause Occurance Feature Effector Note

HyperacuteExisting Ab onendothelial cells

Within 24h, minutesto hours

Thrombotic occlusionComplement,nuetrophil,

endothelial cell and platelet Ischemia

AcuteMismatched HLA

antigensThe first week to

weeksCytolysis, necrosis

T and B, cytokines,inflammatory cells

Endothelial cell is the earlisttarget

Chronic

The result ofcontinued

prolonged multipleacute rejections

Months to yearsGraft arterial occlusions,

arteriosclerosisMono/macrophages,

neutrophils

Proliferation of smooth musclecells and production of collagen

by fibroblasts.

Acutevascularrejection

α-gal antigen 4-8 days

Endothelial activation andcoagulation, causing celldamage, thrombosis andeventual graft rejection

Returning/residual anti-α-galantibodies, complement?

Xenotransplatation only, althoughhyperacute had been avoided by

KO of α-gal

46

47

Adopted from P.Toby H. Coates, Bridget L. Colvin, Holger Hackstein and Angus W. Thomson. Expert

reviews in molecular medicine Cambridge University press 2002

48

Although improved immunosuppressive drug regimens have contributed to improved organ

allograft survival over the past decades, the problems referred to before (toxicity; malignancy;

and the risk of opportunistic infection) still remain.

4.1.3. The role of CD200:CD200R(s) interaction in allograft rejection

We showed that animals treated to show prolonged acceptance of vascular and non-vascular

grafts had elevated levels of expression of CD200, and that anti CD200 antibodies abolished

graft prolongation in rats with intestinal transplants (187) and in mice with skin or renal

allografts (185). Blockade of CD200 expression led to abrupt termination of graft survival,

regardless of the time post-transplant at which infusion of anti-CD200 mAb began (220).

Addition of CD200:Fc (IgG2a), an immunoadhesin, to allostimulated cells in vitro inhibited

proliferation, CTL induction and type 1 cytokine production. Infusion of the immunoadhesin

into animals receiving skin, renal or islet allo or xenografts significantly increased graft survival

(187). Rosenblum's group (221) reported that CD200 could also attenuate the rejection of male

skin grafts by syngeneic female recipients.

Antagonist antibodies to CD200R1 blocked increased graft survival in mice

over-expressing CD200, or receiving CD200:Fc (222, 223). Agonist antibodies to CD200R2/R3

favoured development of “tolerogenic” DCs and regulatory T cells that were independently

implicated in enhancing allograft survival (224). In mice lacking the CD200R1 receptor,

infusion of CD200:Fc was not able to prevent rejection of tissue allografts in comparison to

wild-type controls (225).

4.2. CD200:CD200R interaction in spontaneous fetal loss

The fetus has long been considered a “natural” allograft which is not rejected by its host.

49

Mechanisms offered to explain this failure of rejection include:

(i) immune privilege;

(ii) failure of trophoblast cells to express paternal MHC/HLA Class Ia and II antigen (226);

(iii) expression of nonclassical MHC/HLA-Ib and HLA-G by trophoblast cells, which

inhibits both CTL and NK cells (227-230), and facilitates the generation of

CD4+CD25+ Treg cells (231-233);

(iv) expression of inhibitory receptors by uterine NK cells (uNK) (234, 235);

(v) expression of indolamine 2,3-dioxygenase (IDO) by trophoblast cells, leading to

degradation of trypophan in maternal T cells (55, 236-238).

We reported that failure of expression (or functional blockade) of CD200 in the trophoblast

results in rapid fetal loss (239, 240).

Infection, inflammation and stress have also been reported to cause spontaneous and/or

cytokine-boosted abortion. Thus spontaneous and cytokine boosted abortion rates have been

linked to exposure to LPS (lipopolysaccharide) in the environment. Bacteria entering the uterus

with ejaculate are thought to provide one source of LPS, while intestinal absorption has been

suggested to provide another important route. LPS is a prototypical endotoxin, binding the

CD14/TLR4/M2 recptor complex leading to secretion of pro-inflammatory cytokines (such as

TNF-α, IL-1, IFN-γ), inflammation and subsequent fetal loss (Figure 10).

We have shown that CD200 is expressed on human trophoblast isolated from term placenta

(successful human pregnancies) where it alters maternal immune responses in a favourable

(Th2>Th1) direction (239). Using quantitative PCR and immunohistochemistry staining,

CD200 R1 expression on trophoblast and other decidual cells has also been reported (210).

50

Adapted from Science.ngfu.de/dateien/NIE-S14T31_chakraborty.pdf

51

Engagement of CD200R on plasmacytoid DCs with a CD200:Fc fusion protein resulted in the

induction of IDO activity which subsequently initiated tolerogenisis(241). Administration of

Poly I:C (polyinosinic-polycytidylic acid), a synthetic double-stranded RNA capable of

activating macrophages and NK cells via toll-like receptor 3 (TLR3), increased the embryo

resorption rate, and reduced the percentage of CD200+CK+ cells (cytokeratin 7 is a trophoblast

cell marker) at day 13.5 of gestation (242-244). Taken together these data support the

hypothesis that CD200 expression is important in regulation of both spontaneous and induced

fetal loss.

4.3 CD200:CD200R(s) interaction in other clinical scenarios

4.3.1. CD200:CD200R(S) interaction in autoimmune disease

Collagen-induced arthritis, a murine model of human rheumatoid arthritis (RA), is

suppressed by CD200:Fc treatment in DBA/1 mice (245), with mice having decreased

anti-collagen antibodies and decreased inflammatory (type-1) cytokine production (TNF-α and

IFN-γ). Similarly treatment of mice with agonist anti-CD200Rs also resulted in a significant

decrease in arthritic joint scores (246). Hoek et al independently reported a cumulative

incidence of CIA over 59% in CD200-/- mice compared with <10% in normal control mice, with

5 days earlier of CIA onset in CD200-/- mice (247).

Experimental autoimmune encephalomyelitis (EAE), induced by immunization with brain

derived peptides, is an experimental model sharing many clinical and pathological features with

human multiple sclerosis. EAE onset in CD200-/- mice occurred 3 days earlier than that in

normal controls, with a concomitant increase of CD200R+ cells and enhancement in their

activity (247). EAE was attenuated by CD200:Fc (248). Lack of CD200 accelerated the onset of

52

experimental autoimmune uveoretinitis (EUE), a CD4+ T mediated autoimmune disease (249).

4.3.2. CD200:CD200R(s) interaction in tumor development

Malignancy remains an important cause morbidity and mortality in humans worldwide.

Possible mechanism(s) whereby tumors evade host immunity include:

(i) natural tolerance to tumor antigens established in ontogeny;

(ii) nonself antigens expressed by tumor cells (tumor associated antigen TAA) are weakly

immunogenic;

(iii) tumor cells down-regulate expression of MHC , and produce immunosuppressive

cytokines/factors (TGF-β, IL-10, Fas ligand and PD-1);

(iv) rapid growth of tumor cells occurs before immunity is fully developed (250, 251).

(v) recruitment of immunoregulatory host cells (Tregs and MDSC).

Elevated expression of CD200 has been reported in many tumors. McWhirter and

colleagues reported increased expression on B cells from 87 (100%) patients with chronic

lymphocyte leukemia (CLL), compared with that in normal controls (252). The presence of

CD200 on tumor cells was reported to prevented killing of tumor cells by human PBMCs (253).

Overexpression of CD200 in human myeloma and leukemia patients is correlated with a poorer

survival rate (252, 254). CD200 overexpression is now also reported on solid tumors (255, 256).

Our lab has shown a correlation between CD200 expression and disease severity in both

CLL(257) and breast cancer (258).

5. Techniques to explore mechanism(s) of action of CD200 and outline of data in thesis:

We hypothesized several years ago that improved understanding of the mechanism(s) of

action of CD200 would come from studies with two types of genetically derived animals, those

53

overexpressing CD200 (CD200tg) and those lacking either CD200 (CD200KO) or its receptor(s),

CD200R1KO. The CD200KO mouse was derived by Hoek and collaborators in 2000 (247) -

regrettably all requests for use of such mice in our studies have been refused. The CD200R1KO

mouse was generated and characterized by our group in 2005. Subsequent studies using these

mice have confirmed the predicted importance of CD200R1 in the delivery of CD200-derived

immunosuppressive signals in transplantation and autoimmune diseases (225).

Chapter 2 of this thesis describes my work to construct and characterize a CD200tg mouse

generated with the Tet-on inducible expression system. During these studies it became apparent

that the initial construct we used to derive the CD200tg was rapidly becoming outdated by

newer technologies in transgene expression systems. The Tet-on system consists of three crucial

factors: a regulatory unit/vector (pTet-on) allowing constitutive expression of a reverse

tetracycline-controlled transactivator (rtTA); a responsive unit/vector (pTRE2) coding a target

gene (i.e. a transgene) under the control of a functionally impaired promoter (PminiCMV) with

a tetracycline responsive element (TRE); and an inducing agent (inducer) Doxycycline (Dox).

Binding of rtTA to TRE in the presence of Dox activates the promoter PminiCMV, which

initiates the target gene expression (Figure 11). In the case of dual transgenic mouse (pTet-on

encoding rtTA and pTRE2 carrying a target gene), the presence or absence of inducer Dox in

drinking water is the ‘key’ for initiating target gene expression. However; three important

disadvantages for rtTA protein exist which greatly affects the efficiency of the system: the rtTA

protein is not stable by itself in mammalian cells (the coding sequence for it comes from E. coli);

the rtTA protein is too large to enter certain tissues with low sensitivity to Dox (target gene can

not be induced in certain tissues such as the brain); and the rtTA protein can bind to TRE in

54

Adapted from Tet systems user manual. www.clontech.com

55

absence of Dox, resulting in so-called leaky expression. Aiming to solve those problems, a

second generation of rtTA, rtTA2s-M2, was developed by Stefanie Urlinger et al (259).

rtTA2s-M2 functions at a 10-fold lower Dox concentration than rtTA; its expression is more

stable (by some 4-5 orders of magnitude); and background expression(“leakiness”) in the

absence of Dox is dramatically reduced. Accordingly, as an addendum, after the creation of the

first CD200tg line, I independently developed a second generation CD200tg line. Reports of

studies using these mice in a mouse transplant model were published in 2009 (260).

In chapter 3, I describe the use of these mice in studies to characterize the role of CD200

expression in regulation of LPS-induced fetal loss in mice.

In chapter 4, data are presented showing further detailed analysis of factors contributing to

the mechanism(s) of action of CD200tg overexpression in graft rejection in mice receiving skin

allografts. These studies highlight the hitherto under-appreciated role of CD200:CD200R

interactions in regulating cell migration, likely through altered chemokine:chemokine receptor

expression, as at least one of the features of increased graft survival in mice overexpressing the

CD200 transgene, or in normal mice receiving CD200tg grafts.

Finally, chapter 5 consists of a brief summary and a short discussion for future directions.

The data documented in the thesis which follows support a model for CD200:CD200R

modulated regulation of graft rejection shown in Figure 12 (see also chapter 4).

56

+ DoxUp-regulation of CD200 expression

Stimulationof CD200R+

cells

Cytokines

Chemokines

Grafted tissues/DLN

IL-1, IL-6,

TNF-a

IL-10, 13, 4, TGF-β?

PD-1, CTLA4, GITR, Foxp3, CCR4

CCL-22/17,

CCR4

No Dox

Cytokines

Chemokines

Graft rejection

Costimulators/Signal transducers


CCL-3 (MIP1a)

Graft acceptance

T reg

No triggering

of CD200R+

cells

T naive

T naive

Inflammatory stimulus (skin graft)

OX-40, Light

Jak-1, Jak-3, Jun, Fos, Trail

Grafted tissues/DLNMigration

Migration 56

Figure 12

A model for CD200:CD200R modulated regulation of graft rejection

T effector

57

6. Reference

1. Mombaerts, P., J. Iacomini, R. S. Johnson, K. Herrup, S. Tonegawa, and V. E. Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68:869-877.

2. Hadeiba, H., T. Sato, A. Habtezion, C. Oderup, J. Pan, and E. C. Butcher. 2008. CCR9 expression defines tolerogenic plasmacytoid dendritic cells able to suppress acute graft-versus-host disease. Nat Immunol 9:1253-1260.

3. Tanchot, C., and B. Rocha. 1995. The peripheral T cell repertoire: independent homeostatic regulation of virgin and activated CD8+ T cell pools. Eur J Immunol 25:2127-2136.

4. Anderson, M. S., E. S. Venanzi, L. Klein, Z. Chen, S. P. Berzins, S. J. Turley, H. von Boehmer, R. Bronson, A. Dierich, C. Benoist, and D. Mathis. 2002. Projection of an immunological self shadow within the thymus by the aire protein. Science 298:1395-1401.

5. Bjorses, P., J. Aaltonen, N. Horelli-Kuitunen, M. L. Yaspo, and L. Peltonen. 1998. Gene defect behind APECED: a new clue to autoimmunity. Hum Mol Genet 7:1547-1553.

6. Kappler, J. W., N. Roehm, and P. Marrack. 1987. T cell tolerance by clonal elimination in the thymus. Cell 49:273-280.

7. Sayegh, M. H., N. Perico, and G. Remuzzi. 2005. Transplantation tolerance. A complex scenario awaiting clinical applicability. Contrib Nephrol 146:95-104.

8. Manilay, J. O., D. A. Pearson, J. J. Sergio, K. G. Swenson, and M. Sykes. 1998. Intrathymic deletion of alloreactive T cells in mixed bone marrow chimeras prepared with a nonmyeloablative conditioning regimen. Transplantation 66:96-102.

9. Starr, T. K., S. C. Jameson, and K. A. Hogquist. 2003. Positive and negative selection of T cells. Annu Rev Immunol 21:139-176.

10. Goldrath, A. W., and S. M. Hedrick. 2005. Central tolerance matters. Immunity 23:113-114.

11. Gallegos, A. M., and M. J. Bevan. 2006. Central tolerance: good but imperfect. Immunol Rev 209:290-296.

12. Schwartz, R. H. 1990. A cell culture model for T lymphocyte clonal anergy. Science 248:1349-1356.

13. Chen, W., S. Issazadeh, M. H. Sayegh, and S. J. Khoury. 1997. In vivo mechanisms of acquired thymic tolerance. Cell Immunol 179:165-173.

14. Schwartz, R. H. 2003. T cell anergy. Annu Rev Immunol 21:305-334. 15. Rocha, B., C. Tanchot, and H. Von Boehmer. 1993. Clonal anergy blocks in vivo growth

of mature T cells and can be reversed in the absence of antigen. J Exp Med 177:1517-1521.

16. Fuchs, E. J., and P. Matzinger. 1992. B cells turn off virgin but not memory T cells. Science 258:1156-1159.

17. Jenkins, M. K., D. M. Pardoll, J. Mizuguchi, T. M. Chused, and R. H. Schwartz. 1987. Molecular events in the induction of a nonresponsive state in interleukin 2-producing helper T-lymphocyte clones. Proc Natl Acad Sci U S A 84:5409-5413.

18. Battaglia, M., S. Gregori, R. Bacchetta, and M. G. Roncarolo. 2006. Tr1 cells: from discovery to their clinical application. Semin Immunol 18:120-127.

58

19. Moore, K. W., R. de Waal Malefyt, R. L. Coffman, and A. O'Garra. 2001. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 19:683-765.

20. Willems, F., A. Marchant, J. P. Delville, C. Gerard, A. Delvaux, T. Velu, M. de Boer, and M. Goldman. 1994. Interleukin-10 inhibits B7 and intercellular adhesion molecule-1 expression on human monocytes. Eur J Immunol 24:1007-1009.

21. Fiorentino, D. F., A. Zlotnik, T. R. Mosmann, M. Howard, and A. O'Garra. 1991. IL-10 inhibits cytokine production by activated macrophages. J Immunol 147:3815-3822.

22. de Waal Malefyt, R., J. Haanen, H. Spits, M. G. Roncarolo, A. te Velde, C. Figdor, K. Johnson, R. Kastelein, H. Yssel, and J. E. de Vries. 1991. Interleukin 10 (IL-10) and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class II major histocompatibility complex expression. J Exp Med 174:915-924.

23. Allavena, P., L. Piemonti, D. Longoni, S. Bernasconi, A. Stoppacciaro, L. Ruco, and A. Mantovani. 1998. IL-10 prevents the differentiation of monocytes to dendritic cells but promotes their maturation to macrophages. Eur J Immunol 28:359-369.

24. Steinbrink, K., E. Graulich, S. Kubsch, J. Knop, and A. H. Enk. 2002. CD4+ and CD8+ anergic T cells induced by interleukin-10-treated human dendritic cells display antigen-specific suppressor activity. Blood 99:2468-2476.

25. Steinbrink, K., M. Wolfl, H. Jonuleit, J. Knop, and A. H. Enk. 1997. Induction of tolerance by IL-10-treated dendritic cells. J Immunol 159:4772-4780.

26. Groux, H., A. O'Garra, M. Bigler, M. Rouleau, S. Antonenko, J. E. de Vries, and M. G. Roncarolo. 1997. A CD4+ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature 389:737-742.

27. Zheng, S. G., J. H. Wang, J. D. Gray, H. Soucier, and D. A. Horwitz. 2004. Natural and induced CD4+CD25+ cells educate CD4+CD25- cells to develop suppressive activity: the role of IL-2, TGF-beta, and IL-10. J Immunol 172:5213-5221.

28. Letterio, J. J., and A. B. Roberts. 1998. Regulation of immune responses by TGF-beta. Annu Rev Immunol 16:137-161.

29. Prud'homme, G. J., and C. A. Piccirillo. 2000. The inhibitory effects of transforming growth factor-beta-1 (TGF-beta1) in autoimmune diseases. J Autoimmun 14:23-42.

30. Gorelik, L., and R. A. Flavell. 2000. Abrogation of TGFbeta signaling in T cells leads to spontaneous T cell differentiation and autoimmune disease. Immunity 12:171-181.

31. Cautain, B., J. Damoiseaux, I. Bernard, H. van Straaten, P. van Breda Vriesman, B. Boneu, P. Druet, and A. Saoudi. 2001. Essential role of TGF-beta in the natural resistance to experimental allergic encephalomyelitis in rats. Eur J Immunol 31:1132-1140.

32. Tang, Q., and J. A. Bluestone. 2008. The Foxp3+ regulatory T cell: a jack of all trades, master of regulation. Nat Immunol 9:239-244.

33. Shevach, E. M. 2006. From vanilla to 28 flavors: multiple varieties of T regulatory cells. Immunity 25:195-201.

34. Takahashi, T., Y. Kuniyasu, M. Toda, N. Sakaguchi, M. Itoh, M. Iwata, J. Shimizu, and S. Sakaguchi. 1998. Immunologic self-tolerance maintained by CD25+CD4+ naturally anergic and suppressive T cells: induction of autoimmune disease by breaking their anergic/suppressive state. Int Immunol 10:1969-1980.

59

35. Thornton, A. M., and E. M. Shevach. 1998. CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188:287-296.

36. Dieckmann, D., H. Plottner, S. Berchtold, T. Berger, and G. Schuler. 2001. Ex vivo isolation and characterization of CD4+CD25+ T cells with regulatory properties from human blood. J Exp Med 193:1303-1310.

37. Jonuleit, H., E. Schmitt, M. Stassen, A. Tuettenberg, J. Knop, and A. H. Enk. 2001. Identification and functional characterization of human CD4+CD25+ T cells with regulatory properties isolated from peripheral blood. J Exp Med 193:1285-1294.

38. Hawrylowicz, C. M., and A. O'Garra. 2005. Potential role of interleukin-10-secreting regulatory T cells in allergy and asthma. Nat Rev Immunol 5:271-283.

39. Collison, L. W., C. J. Workman, T. T. Kuo, K. Boyd, Y. Wang, K. M. Vignali, R. Cross, D. Sehy, R. S. Blumberg, and D. A. Vignali. 2007. The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature 450:566-569.

40. Gavin, M. A., J. P. Rasmussen, J. D. Fontenot, V. Vasta, V. C. Manganiello, J. A. Beavo, and A. Y. Rudensky. 2007. Foxp3-dependent programme of regulatory T-cell differentiation. Nature 445:771-775.

41. Lieberman, J. 2003. The ABCs of granule-mediated cytotoxicity: new weapons in the arsenal. Nat Rev Immunol 3:361-370.

42. McHugh, R. S., M. J. Whitters, C. A. Piccirillo, D. A. Young, E. M. Shevach, M. Collins, and M. C. Byrne. 2002. CD4+CD25+ immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16:311-323.

43. Herman, A. E., G. J. Freeman, D. Mathis, and C. Benoist. 2004. CD4+CD25+ T regulatory cells dependent on ICOS promote regulation of effector cells in the prediabetic lesion. J Exp Med 199:1479-1489.

44. Gondek, D. C., L. F. Lu, S. A. Quezada, S. Sakaguchi, and R. J. Noelle. 2005. Cutting edge: contact-mediated suppression by CD4+CD25+ regulatory cells involves a granzyme B-dependent, perforin-independent mechanism. J Immunol 174:1783-1786.

45. Grossman, W. J., J. W. Verbsky, B. L. Tollefsen, C. Kemper, J. P. Atkinson, and T. J. Ley. 2004. Differential expression of granzymes A and B in human cytotoxic lymphocyte subsets and T regulatory cells. Blood 104:2840-2848.

46. Ren, X., F. Ye, Z. Jiang, Y. Chu, S. Xiong, and Y. Wang. 2007. Involvement of cellular death in TRAIL/DR5-dependent suppression induced by CD4+CD25+ regulatory T cells. Cell Death Differ 14:2076-2084.

47. Garin, M. I., C. C. Chu, D. Golshayan, E. Cernuda-Morollon, R. Wait, and R. I. Lechler. 2007. Galectin-1: a key effector of regulation mediated by CD4+CD25+ T cells. Blood 109:2058-2065.

48. Deaglio, S., K. M. Dwyer, W. Gao, D. Friedman, A. Usheva, A. Erat, J. F. Chen, K. Enjyoji, J. Linden, M. Oukka, V. K. Kuchroo, T. B. Strom, and S. C. Robson. 2007. Adenosine generation catalyzed by CD39 and CD73 expressed on regulatory T cells mediates immune suppression. J Exp Med 204:1257-1265.

49. Borsellino, G., M. Kleinewietfeld, D. Di Mitri, A. Sternjak, A. Diamantini, R. Giometto, S. Hopner, D. Centonze, G. Bernardi, M. L. Dell'Acqua, P. M. Rossini, L. Battistini, O.

60

Rotzschke, and K. Falk. 2007. Expression of ectonucleotidase CD39 by Foxp3+ Treg cells: hydrolysis of extracellular ATP and immune suppression. Blood 110:1225-1232.

50. Kobie, J. J., P. R. Shah, L. Yang, J. A. Rebhahn, D. J. Fowell, and T. R. Mosmann. 2006. T regulatory and primed uncommitted CD4 T cells express CD73, which suppresses effector CD4 T cells by converting 5'-adenosine monophosphate to adenosine. J Immunol 177:6780-6786.

51. Oderup, C., L. Cederbom, A. Makowska, C. M. Cilio, and F. Ivars. 2006. Cytotoxic T lymphocyte antigen-4-dependent down-modulation of costimulatory molecules on dendritic cells in CD4+ CD25+ regulatory T-cell-mediated suppression. Immunology 118:240-249.

52. Serra, P., A. Amrani, J. Yamanouchi, B. Han, S. Thiessen, T. Utsugi, J. Verdaguer, and P. Santamaria. 2003. CD40 ligation releases immature dendritic cells from the control of regulatory CD4+CD25+ T cells. Immunity 19:877-889.

53. Fallarino, F., U. Grohmann, K. W. Hwang, C. Orabona, C. Vacca, R. Bianchi, M. L. Belladonna, M. C. Fioretti, M. L. Alegre, and P. Puccetti. 2003. Modulation of tryptophan catabolism by regulatory T cells. Nat Immunol 4:1206-1212.

54. Mellor, A. L., and D. H. Munn. 2004. IDO expression by dendritic cells: tolerance and tryptophan catabolism. Nat Rev Immunol 4:762-774.

55. Lu, L. F., E. F. Lind, D. C. Gondek, K. A. Bennett, M. W. Gleeson, K. Pino-Lagos, Z. A. Scott, A. J. Coyle, J. L. Reed, J. Van Snick, T. B. Strom, X. X. Zheng, and R. J. Noelle. 2006. Mast cells are essential intermediaries in regulatory T-cell tolerance. Nature 442:997-1002.

56. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, and S. M. Wahl. 2003. Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+

regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med 198:1875-1886.

57. Braat, H., P. McGuirk, F. J. Ten Kate, I. Huibregtse, P. J. Dunne, D. W. Hommes, S. J. Van Deventer, and K. H. Mills. 2007. Prevention of experimental colitis by parenteral administration of a pathogen-derived immunomodulatory molecule. Gut 56:351-357.

58. Faria, A. M., and H. L. Weiner. 2005. Oral tolerance. Immunol Rev 206:232-259. 59. Fontenot, J. D., M. A. Gavin, and A. Y. Rudensky. 2003. Foxp3 programs the

development and function of CD4+CD25+ regulatory T cells. Nat Immunol 4:330-336. 60. Lee, I., L. Wang, A. D. Wells, M. E. Dorf, E. Ozkaynak, and W. W. Hancock. 2005.

Recruitment of Foxp3+ T regulatory cells mediating allograft tolerance depends on the CCR4 chemokine receptor. J Exp Med 201:1037-1044.

61. Levings, M. K., R. Bacchetta, U. Schulz, and M. G. Roncarolo. 2002. The role of IL-10 and TGF-beta in the differentiation and effector function of T regulatory cells. Int Arch Allergy Immunol 129:263-276.

62. Levings, M. K., S. Gregori, E. Tresoldi, S. Cazzaniga, C. Bonini, and M. G. Roncarolo. 2005. Differentiation of Tr1 cells by immature dendritic cells requires IL-10 but not CD25+CD4+ Tr cells. Blood 105:1162-1169.

63. Jordan, M. S., A. Boesteanu, A. J. Reed, A. L. Petrone, A. E. Holenbeck, M. A. Lerman, A. Naji, and A. J. Caton. 2001. Thymic selection of CD4+CD25+ regulatory T cells induced by an agonist self-peptide. Nat Immunol 2:301-306.

61

64. Fowell, D., and D. Mason. 1993. Evidence that the T cell repertoire of normal rats contains cells with the potential to cause diabetes. Characterization of the CD4+ T cell subset that inhibits this autoimmune potential. J Exp Med 177:627-636.

65. Sakaguchi, S., T. Takahashi, and Y. Nishizuka. 1982. Study on cellular events in post-thymectomy autoimmune oophoritis in mice. II. Requirement of Lyt-1 cells in normal female mice for the prevention of oophoritis. J Exp Med 156:1577-1586.

66. Sakaguchi, S. 2005. Naturally arising Foxp3-expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non-self. Nat Immunol 6:345-352.

67. Fontenot, J. D., J. P. Rasmussen, L. M. Williams, J. L. Dooley, A. G. Farr, and A. Y. Rudensky. 2005. Regulatory T cell lineage specification by the forkhead transcription factor foxp3. Immunity 22:329-341.

68. Brunkow, M. E., E. W. Jeffery, K. A. Hjerrild, B. Paeper, L. B. Clark, S. A. Yasayko, J. E. Wilkinson, D. Galas, S. F. Ziegler, and F. Ramsdell. 2001. Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat Genet 27:68-73.

69. Ochs, H. D., S. F. Ziegler, and T. R. Torgerson. 2005. FOXP3 acts as a rheostat of the immune response. Immunol Rev 203:156-164.

70. Sakaguchi, S., T. Yamaguchi, T. Nomura, and M. Ono. 2008. Regulatory T cells and immune tolerance. Cell 133:775-787.

71. Takahashi, T., T. Tagami, S. Yamazaki, T. Uede, J. Shimizu, N. Sakaguchi, T. W. Mak, and S. Sakaguchi. 2000. Immunologic self-tolerance maintained by CD25+CD4+

regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med 192:303-310.

72. Kingsley, C. I., M. Karim, A. R. Bushell, and K. J. Wood. 2002. CD25+CD4+ regulatory T cells prevent graft rejection: CTLA-4- and IL-10-dependent immunoregulation of alloresponses. J Immunol 168:1080-1086.

73. Marson, A., K. Kretschmer, G. M. Frampton, E. S. Jacobsen, J. K. Polansky, K. D. MacIsaac, S. S. Levine, E. Fraenkel, H. von Boehmer, and R. A. Young. 2007. Foxp3 occupancy and regulation of key target genes during T-cell stimulation. Nature 445:931-935.

74. Sugimoto, N., T. Oida, K. Hirota, K. Nakamura, T. Nomura, T. Uchiyama, and S. Sakaguchi. 2006. Foxp3-dependent and -independent molecules specific for CD25+CD4+ natural regulatory T cells revealed by DNA microarray analysis. Int Immunol 18:1197-1209.

75. Hill, J. A., M. Feuerer, K. Tash, S. Haxhinasto, J. Perez, R. Melamed, D. Mathis, and C. Benoist. 2007. Foxp3 transcription-factor-dependent and -independent regulation of the regulatory T cell transcriptional signature. Immunity 27:786-800.

76. Liu, Y., P. Zhang, J. Li, A. B. Kulkarni, S. Perruche, and W. Chen. 2008. A critical function for TGF-beta signaling in the development of natural CD4+CD25+Foxp3+ regulatory T cells. Nat Immunol 9:632-640.

77. Yao, Z., Y. Kanno, M. Kerenyi, G. Stephens, L. Durant, W. T. Watford, A. Laurence, G. W. Robinson, E. M. Shevach, R. Moriggl, L. Hennighausen, C. Wu, and J. J. O'Shea. 2007. Nonredundant roles for Stat5a/b in directly regulating Foxp3. Blood 109:4368-4375.

62

78. Chatenoud, L., B. Salomon, and J. A. Bluestone. 2001. Suppressor T cells--they're back and critical for regulation of autoimmunity! Immunol Rev 182:149-163.

79. Graca, L., A. Le Moine, C. Y. Lin, P. J. Fairchild, S. P. Cobbold, and H. Waldmann. 2004. Donor-specific transplantation tolerance: the paradoxical behavior of CD4+CD25+ T cells. Proc Natl Acad Sci U S A 101:10122-10126.

80. Apostolou, I., P. Verginis, K. Kretschmer, J. Polansky, J. Huhn, and H. von Boehmer. 2008. Peripherally induced Treg: mode, stability, and role in specific tolerance. J Clin Immunol 28:619-624.

81. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, and V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441:235-238.

82. Benson, M. J., K. Pino-Lagos, M. Rosemblatt, and R. J. Noelle. 2007. All-trans retinoic acid mediates enhanced T reg cell growth, differentiation, and gut homing in the face of high levels of co-stimulation. J Exp Med 204:1765-1774.

83. Floess, S., J. Freyer, C. Siewert, U. Baron, S. Olek, J. Polansky, K. Schlawe, H. D. Chang, T. Bopp, E. Schmitt, S. Klein-Hessling, E. Serfling, A. Hamann, and J. Huehn. 2007. Epigenetic control of the foxp3 locus in regulatory T cells. PLoS Biol 5:e38.

84. Gabrilovich, D. I., and S. Nagaraj. 2009. Myeloid-derived suppressor cells as regulators of the immune system. Nat Rev Immunol 9:162-174.

85. Bacchetta, R., M. Bigler, J. L. Touraine, R. Parkman, P. A. Tovo, J. Abrams, R. de Waal Malefyt, J. E. de Vries, and M. G. Roncarolo. 1994. High levels of interleukin 10 production in vivo are associated with tolerance in SCID patients transplanted with HLA mismatched hematopoietic stem cells. J Exp Med 179:493-502.

86. Bacchetta, R., C. Sartirana, M. K. Levings, C. Bordignon, S. Narula, and M. G. Roncarolo. 2002. Growth and expansion of human T regulatory type 1 cells are independent from TCR activation but require exogenous cytokines. Eur J Immunol 32:2237-2245.

87. Sebastiani, S., P. Allavena, C. Albanesi, F. Nasorri, G. Bianchi, C. Traidl, S. Sozzani, G. Girolomoni, and A. Cavani. 2001. Chemokine receptor expression and function in CD4+ T lymphocytes with regulatory activity. J Immunol 166:996-1002.

88. Vieira, P. L., J. R. Christensen, S. Minaee, E. J. O'Neill, F. J. Barrat, A. Boonstra, T. Barthlott, B. Stockinger, D. C. Wraith, and A. O'Garra. 2004. IL-10-secreting regulatory T cells do not express Foxp3 but have comparable regulatory function to naturally occurring CD4+CD25+ regulatory T cells. J Immunol 172:5986-5993.

89. Barrat, F. J., D. J. Cua, A. Boonstra, D. F. Richards, C. Crain, H. F. Savelkoul, R. de Waal-Malefyt, R. L. Coffman, C. M. Hawrylowicz, and A. O'Garra. 2002. In vitro generation of interleukin 10-producing regulatory CD4+ T cells is induced by immunosuppressive drugs and inhibited by T helper type 1 (Th1)- and Th2-inducing cytokines. J Exp Med 195:603-616.

90. Chen, Y., V. K. Kuchroo, J. Inobe, D. A. Hafler, and H. L. Weiner. 1994. Regulatory T cell clones induced by oral tolerance: suppression of autoimmune encephalomyelitis. Science 265:1237-1240.

91. Nakamura, K., A. Kitani, and W. Strober. 2001. Cell contact-dependent immunosuppression by CD4+CD25+ regulatory T cells is mediated by cell surface-bound

63

transforming growth factor beta. J Exp Med 194:629-644. 92. Ivars, F. 1992. T cell subset-specific expression of antigen receptor beta chains in alpha

chain-transgenic mice. Eur J Immunol 22:635-639. 93. Schumacher, A., P. O. Wafula, A. Z. Bertoja, A. Sollwedel, C. Thuere, I. Wollenberg, H.

Yagita, H. D. Volk, and A. C. Zenclussen. 2007. Mechanisms of action of regulatory T cells specific for paternal antigens during pregnancy. Obstet Gynecol 110:1137-1145.

94. Mann, M. K., K. Maresz, L. P. Shriver, Y. Tan, and B. N. Dittel. 2007. B cell regulation of CD4+CD25+ T regulatory cells and IL-10 via B7 is essential for recovery from experimental autoimmune encephalomyelitis. J Immunol 178:3447-3456.

95. Piccirillo, C. A., J. J. Letterio, A. M. Thornton, R. S. McHugh, M. Mamura, H. Mizuhara, and E. M. Shevach. 2002. CD4+CD25+ regulatory T cells can mediate suppressor function in the absence of transforming growth factor beta1 production and responsiveness. J Exp Med 196:237-246.

96. Josien, R., P. Douillard, C. Guillot, M. Muschen, I. Anegon, J. Chetritt, S. Menoret, C. Vignes, J. P. Soulillou, and M. C. Cuturi. 1998. A critical role for transforming growth factor-beta in donor transfusion-induced allograft tolerance. J Clin Invest 102:1920-1926.

97. Kosiewicz, M. M., P. Alard, and J. W. Streilein. 1998. Alterations in cytokine production following intraocular injection of soluble protein antigen: impairment in IFN-gamma and induction of TGF-beta and IL-4 production. J Immunol 161:5382-5390.

98. Chen, L. Z., G. M. Hochwald, C. Huang, G. Dakin, H. Tao, C. Cheng, W. J. Simmons, G. Dranoff, and G. J. Thorbecke. 1998. Gene therapy in allergic encephalomyelitis using myelin basic protein-specific T cells engineered to express latent transforming growth factor-beta1. Proc Natl Acad Sci U S A 95:12516-12521.

99. Chen, W., W. Jin, and S. M. Wahl. 1998. Engagement of cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) induces transforming growth factor beta (TGF-beta) production by murine CD4+ T cells. J Exp Med 188:1849-1857.

100. Seddon, B., and D. Mason. 1999. Regulatory T cells in the control of autoimmunity: the essential role of transforming growth factor beta and interleukin 4 in the prevention of autoimmune thyroiditis in rats by peripheral CD4+CD45RC- cells and CD4+CD8-

thymocytes. J Exp Med 189:279-288. 101. Garside, P., M. Steel, E. A. Worthey, A. Satoskar, J. Alexander, H. Bluethmann, F. Y.

Liew, and A. M. Mowat. 1995. T helper 2 cells are subject to high dose oral tolerance and are not essential for its induction. J Immunol 154:5649-5655.

102. Russo, M., S. Jancar, A. L. Pereira de Siqueira, J. Mengel, E. Gomes, S. M. Ficker, and A. M. Caetano de Faria. 1998. Prevention of lung eosinophilic inflammation by oral tolerance. Immunol Lett 61:15-23.

103. van Halteren, A. G., M. J. van der Cammen, D. Cooper, H. F. Savelkoul, G. Kraal, and P. G. Holt. 1997. Regulation of antigen-specific IgE, IgG1, and mast cell responses to ingested allergen by mucosal tolerance induction. J Immunol 159:3009-3015.

104. Neurath, M. F., I. Fuss, B. L. Kelsall, D. H. Presky, W. Waegell, and W. Strober. 1996. Experimental granulomatous colitis in mice is abrogated by induction of TGF-beta-mediated oral tolerance. J Exp Med 183:2605-2616.

105. Young, M. R., M. Newby, and H. T. Wepsic. 1987. Hematopoiesis and suppressor bone

64

marrow cells in mice bearing large metastatic Lewis lung carcinoma tumors. Cancer Res 47:100-105.

106. Buessow, S. C., R. D. Paul, and D. M. Lopez. 1984. Influence of mammary tumor progression on phenotype and function of spleen and in situ lymphocytes in mice. J Natl Cancer Inst 73:249-255.

107. Seung, L. P., D. A. Rowley, P. Dubey, and H. Schreiber. 1995. Synergy between T-cell immunity and inhibition of paracrine stimulation causes tumor rejection. Proc Natl Acad Sci U S A 92:6254-6258.

108. Ochoa, A. C., A. H. Zea, C. Hernandez, and P. C. Rodriguez. 2007. Arginase, prostaglandins, and myeloid-derived suppressor cells in renal cell carcinoma. Clin Cancer Res 13:721s-726s.

109. Almand, B., J. I. Clark, E. Nikitina, J. van Beynen, N. R. English, S. C. Knight, D. P. Carbone, and D. I. Gabrilovich. 2001. Increased production of immature myeloid cells in cancer patients: a mechanism of immunosuppression in cancer. J Immunol 166:678-689.

110. Mirza, N., M. Fishman, I. Fricke, M. Dunn, A. M. Neuger, T. J. Frost, R. M. Lush, S. Antonia, and D. I. Gabrilovich. 2006. All-trans-retinoic acid improves differentiation of myeloid cells and immune response in cancer patients. Cancer Res 66:9299-9307.

111. Diaz-Montero, C. M., M. L. Salem, M. I. Nishimura, E. Garrett-Mayer, D. J. Cole, and A. J. Montero. 2009. Increased circulating myeloid-derived suppressor cells correlate with clinical cancer stage, metastatic tumor burden, and doxorubicin-cyclophosphamide chemotherapy. Cancer Immunol Immunother 58:49-59.

112. Youn, J. I., S. Nagaraj, M. Collazo, and D. I. Gabrilovich. 2008. Subsets of myeloid-derived suppressor cells in tumor-bearing mice. J Immunol 181:5791-5802.

113. Kusmartsev, S., Y. Nefedova, D. Yoder, and D. I. Gabrilovich. 2004. Antigen-specific inhibition of CD8+ T cell response by immature myeloid cells in cancer is mediated by reactive oxygen species. J Immunol 172:989-999.

114. Hestdal, K., F. W. Ruscetti, J. N. Ihle, S. E. Jacobsen, C. M. Dubois, W. C. Kopp, D. L. Longo, and J. R. Keller. 1991. Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells. J Immunol 147:22-28.

115. Schmielau, J., and O. J. Finn. 2001. Activated granulocytes and granulocyte-derived hydrogen peroxide are the underlying mechanism of suppression of t-cell function in advanced cancer patients. Cancer Res 61:4756-4760.

116. Movahedi, K., M. Guilliams, J. Van den Bossche, R. Van den Bergh, C. Gysemans, A. Beschin, P. De Baetselier, and J. A. Van Ginderachter. 2008. Identification of discrete tumor-induced myeloid-derived suppressor cell subpopulations with distinct T cell-suppressive activity. Blood 111:4233-4244.

117. Kusmartsev, S., S. Nagaraj, and D. I. Gabrilovich. 2005. Tumor-associated CD8+ T cell tolerance induced by bone marrow-derived immature myeloid cells. J Immunol 175:4583-4592.

118. Rodriguez, P. C., C. P. Hernandez, D. Quiceno, S. M. Dubinett, J. Zabaleta, J. B. Ochoa, J. Gilbert, and A. C. Ochoa. 2005. Arginase I in myeloid suppressor cells is induced by COX-2 in lung carcinoma. J Exp Med 202:931-939.

119. Bingisser, R. M., P. A. Tilbrook, P. G. Holt, and U. R. Kees. 1998. Macrophage-derived nitric oxide regulates T cell activation via reversible disruption of the Jak3/STAT5

65

signaling pathway. J Immunol 160:5729-5734. 120. Harari, O., and J. K. Liao. 2004. Inhibition of MHC II gene transcription by nitric oxide

and antioxidants. Curr Pharm Des 10:893-898. 121. Rivoltini, L., M. Carrabba, V. Huber, C. Castelli, L. Novellino, P. Dalerba, R. Mortarini,

G. Arancia, A. Anichini, S. Fais, and G. Parmiani. 2002. Immunity to cancer: attack and escape in T lymphocyte-tumor cell interaction. Immunol Rev 188:97-113.

122. Yang, R., Z. Cai, Y. Zhang, W. H. t. Yutzy, K. F. Roby, and R. B. Roden. 2006. CD80 in immune suppression by mouse ovarian carcinoma-associated Gr-1+CD11b+ myeloid cells. Cancer Res 66:6807-6815.

123. Huang, B., P. Y. Pan, Q. Li, A. I. Sato, D. E. Levy, J. Bromberg, C. M. Divino, and S. H. Chen. 2006. Gr-1+CD115+ immature myeloid suppressor cells mediate the development of tumor-induced T regulatory cells and T-cell anergy in tumor-bearing host. Cancer Res 66:1123-1131.

124. Serafini, P., S. Mgebroff, K. Noonan, and I. Borrello. 2008. Myeloid-derived suppressor cells promote cross-tolerance in B-cell lymphoma by expanding regulatory T cells. Cancer Res 68:5439-5449.

125. Kusmartsev, S. A., Y. Li, and S. H. Chen. 2000. Gr-1+ myeloid cells derived from tumor-bearing mice inhibit primary T cell activation induced through CD3/CD28 costimulation. J Immunol 165:779-785.

126. Watanabe, S., K. Deguchi, R. Zheng, H. Tamai, L. X. Wang, P. A. Cohen, and S. Shu. 2008. Tumor-induced CD11b+Gr-1+ myeloid cells suppress T cell sensitization in tumor-draining lymph nodes. J Immunol 181:3291-3300.

127. Stoll, S., J. Delon, T. M. Brotz, and R. N. Germain. 2002. Dynamic imaging of T cell-dendritic cell interactions in lymph nodes. Science 296:1873-1876.

128. Miller, M. J., O. Safrina, I. Parker, and M. D. Cahalan. 2004. Imaging the single cell dynamics of CD4+ T cell activation by dendritic cells in lymph nodes. J Exp Med 200:847-856.

129. Murdoch, C., M. Muthana, S. B. Coffelt, and C. E. Lewis. 2008. The role of myeloid cells in the promotion of tumour angiogenesis. Nat Rev Cancer 8:618-631.

130. D'Amico, A., and L. Wu. 2003. The early progenitors of mouse dendritic cells and plasmacytoid predendritic cells are within the bone marrow hemopoietic precursors expressing Flt3. J Exp Med 198:293-303.

131. Karsunky, H., M. Merad, A. Cozzio, I. L. Weissman, and M. G. Manz. 2003. Flt3 ligand regulates dendritic cell development from Flt3+ lymphoid and myeloid-committed progenitors to Flt3+ dendritic cells in vivo. J Exp Med 198:305-313.

132. Young, J. W., P. Szabolcs, and M. A. Moore. 1995. Identification of dendritic cell colony-forming units among normal human CD34+ bone marrow progenitors that are expanded by c-kit-ligand and yield pure dendritic cell colonies in the presence of granulocyte/macrophage colony-stimulating factor and tumor necrosis factor alpha. J Exp Med 182:1111-1119.

133. Banchereau, J., and R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245-252.

134. Traver, D., K. Akashi, M. Manz, M. Merad, T. Miyamoto, E. G. Engleman, and I. L. Weissman. 2000. Development of CD8alpha-positive dendritic cells from a common

66

myeloid progenitor. Science 290:2152-2154. 135. Manz, M. G., D. Traver, T. Miyamoto, I. L. Weissman, and K. Akashi. 2001. Dendritic

cell potentials of early lymphoid and myeloid progenitors. Blood 97:3333-3341. 136. Wu, L., A. D'Amico, H. Hochrein, M. O'Keeffe, K. Shortman, and K. Lucas. 2001.

Development of thymic and splenic dendritic cell populations from different hemopoietic precursors. Blood 98:3376-3382.

137. Geijtenbeek, T. B., S. J. van Vliet, A. Engering, B. A. t Hart, and Y. van Kooyk. 2004. Self- and nonself-recognition by C-type lectins on dendritic cells. Annu Rev Immunol 22:33-54.

138. Jonuleit, H., U. Kuhn, G. Muller, K. Steinbrink, L. Paragnik, E. Schmitt, J. Knop, and A. H. Enk. 1997. Pro-inflammatory cytokines and prostaglandins induce maturation of potent immunostimulatory dendritic cells under fetal calf serum-free conditions. Eur J Immunol 27:3135-3142.

139. Kubach, J., C. Becker, E. Schmitt, K. Steinbrink, E. Huter, A. Tuettenberg, and H. Jonuleit. 2005. Dendritic cells: sentinels of immunity and tolerance. Int J Hematol 81:197-203.

140. Mahnke, K., E. Schmitt, L. Bonifaz, A. H. Enk, and H. Jonuleit. 2002. Immature, but not inactive: the tolerogenic function of immature dendritic cells. Immunol Cell Biol 80:477-483.

141. Reis e Sousa, C. 2006. Dendritic cells in a mature age. Nat Rev Immunol 6:476-483. 142. Adler, H. S., and K. Steinbrink. 2007. Tolerogenic dendritic cells in health and disease:

friend and foe! Eur J Dermatol 17:476-491. 143. Steinbrink, K., H. Jonuleit, G. Muller, G. Schuler, J. Knop, and A. H. Enk. 1999.

Interleukin-10-treated human dendritic cells induce a melanoma-antigen-specific anergy in CD8+ T cells resulting in a failure to lyse tumor cells. Blood 93:1634-1642.

144. Tuettenberg, A., E. Huter, M. Hubo, J. Horn, J. Knop, B. Grimbacher, R. A. Kroczek, S. Stoll, and H. Jonuleit. 2009. The role of ICOS in directing T cell responses: ICOS-dependent induction of T cell anergy by tolerogenic dendritic cells. J Immunol 182:3349-3356.

145. Jonuleit, H., E. Schmitt, G. Schuler, J. Knop, and A. H. Enk. 2000. Induction of interleukin 10-producing, nonproliferating CD4+ T cells with regulatory properties by repetitive stimulation with allogeneic immature human dendritic cells. J Exp Med 192:1213-1222.

146. Hackstein, H., T. Taner, A. F. Zahorchak, A. E. Morelli, A. J. Logar, A. Gessner, and A. W. Thomson. 2003. Rapamycin inhibits IL-4--induced dendritic cell maturation in vitro and dendritic cell mobilization and function in vivo. Blood 101:4457-4463.

147. Turnquist, H. R., G. Raimondi, A. F. Zahorchak, R. T. Fischer, Z. Wang, and A. W. Thomson. 2007. Rapamycin-conditioned dendritic cells are poor stimulators of allogeneic CD4+ T cells, but enrich for antigen-specific Foxp3+ T regulatory cells and promote organ transplant tolerance. J Immunol 178:7018-7031.

148. Hawiger, D., K. Inaba, Y. Dorsett, M. Guo, K. Mahnke, M. Rivera, J. V. Ravetch, R. M. Steinman, and M. C. Nussenzweig. 2001. Dendritic cells induce peripheral T cell unresponsiveness under steady state conditions in vivo. J Exp Med 194:769-779.

149. Roncarolo, M. G., M. K. Levings, and C. Traversari. 2001. Differentiation of T

67

regulatory cells by immature dendritic cells. J Exp Med 193:F5-9. 150. Yamazaki, S., K. Inaba, K. V. Tarbell, and R. M. Steinman. 2006. Dendritic cells expand

antigen-specific Foxp3+ CD25+ CD4+ regulatory T cells including suppressors of alloreactivity. Immunol Rev 212:314-329.

151. Heath, W. R., G. T. Belz, G. M. Behrens, C. M. Smith, S. P. Forehan, I. A. Parish, G. M. Davey, N. S. Wilson, F. R. Carbone, and J. A. Villadangos. 2004. Cross-presentation, dendritic cell subsets, and the generation of immunity to cellular antigens. Immunol Rev 199:9-26.

152. Jakubzick, C., M. Bogunovic, A. J. Bonito, E. L. Kuan, M. Merad, and G. J. Randolph. 2008. Lymph-migrating, tissue-derived dendritic cells are minor constituents within steady-state lymph nodes. J Exp Med 205:2839-2850.

153. Wakim, L. M., J. Waithman, N. van Rooijen, W. R. Heath, and F. R. Carbone. 2008. Dendritic cell-induced memory T cell activation in nonlymphoid tissues. Science 319:198-202.

154. Itano, A. A., S. J. McSorley, R. L. Reinhardt, B. D. Ehst, E. Ingulli, A. Y. Rudensky, and M. K. Jenkins. 2003. Distinct dendritic cell populations sequentially present antigen to CD4 T cells and stimulate different aspects of cell-mediated immunity. Immunity 19:47-57.

155. Udey, M. C., and K. Nagao. 2008. Characteristics and functions of murine cutaneous dendritic cells: a synopsis of recent developments. Mucosal Immunol 1:470-474.

156. Borkowski, T. A., A. J. Nelson, A. G. Farr, and M. C. Udey. 1996. Expression of gp40, the murine homologue of human epithelial cell adhesion molecule (Ep-CAM), by murine dendritic cells. Eur J Immunol 26:110-114.

157. Kaplan, D. H., A. Kissenpfennig, and B. E. Clausen. 2008. Insights into Langerhans cell function from Langerhans cell ablation models. Eur J Immunol 38:2369-2376.

158. Bursch, L. S., L. Wang, B. Igyarto, A. Kissenpfennig, B. Malissen, D. H. Kaplan, and K. A. Hogquist. 2007. Identification of a novel population of Langerin+ dendritic cells. J Exp Med 204:3147-3156.

159. Poulin, L. F., S. Henri, B. de Bovis, E. Devilard, A. Kissenpfennig, and B. Malissen. 2007. The dermis contains langerin+ dendritic cells that develop and function independently of epidermal Langerhans cells. J Exp Med 204:3119-3131.

160. Ginhoux, F., M. P. Collin, M. Bogunovic, M. Abel, M. Leboeuf, J. Helft, J. Ochando, A. Kissenpfennig, B. Malissen, M. Grisotto, H. Snoeck, G. Randolph, and M. Merad. 2007. Blood-derived dermal langerin+ dendritic cells survey the skin in the steady state. J Exp Med 204:3133-3146.

161. Bedoui, S., P. G. Whitney, J. Waithman, L. Eidsmo, L. Wakim, I. Caminschi, R. S. Allan, M. Wojtasiak, K. Shortman, F. R. Carbone, A. G. Brooks, and W. R. Heath. 2009. Cross-presentation of viral and self antigens by skin-derived CD103+ dendritic cells. Nat Immunol 10:488-495.

162. June, C. H., J. A. Bluestone, L. M. Nadler, and C. B. Thompson. 1994. The B7 and CD28 receptor families. Immunol Today 15:321-331.

163. Salomon, B., and J. A. Bluestone. 2001. Complexities of CD28/B7: CTLA-4 costimulatory pathways in autoimmunity and transplantation. Annu Rev Immunol 19:225-252.

68

164. Linsley, P. S., W. Brady, M. Urnes, L. S. Grosmaire, N. K. Damle, and J. A. Ledbetter. 1991. CTLA-4 is a second receptor for the B cell activation antigen B7. J Exp Med 174:561-569.

165. Suresh, M., J. K. Whitmire, L. E. Harrington, C. P. Larsen, T. C. Pearson, J. D. Altman, and R. Ahmed. 2001. Role of CD28-B7 interactions in generation and maintenance of CD8 T cell memory. J Immunol 167:5565-5573.

166. Hancock, W. W., M. H. Sayegh, X. G. Zheng, R. Peach, P. S. Linsley, and L. A. Turka. 1996. Costimulatory function and expression of CD40 ligand, CD80, and CD86 in vascularized murine cardiac allograft rejection. Proc Natl Acad Sci U S A 93:13967-13972.

167. Graca, L., K. Honey, E. Adams, S. P. Cobbold, and H. Waldmann. 2000. Cutting edge: anti-CD154 therapeutic antibodies induce infectious transplantation tolerance. J Immunol 165:4783-4786.

168. Jarvinen, L. Z., B. R. Blazar, O. A. Adeyi, T. B. Strom, and R. J. Noelle. 2003. CD154 on the surface of CD4+CD25+ regulatory T cells contributes to skin transplant tolerance. Transplantation 76:1375-1379.

169. Hancock, W. W., R. Buelow, M. H. Sayegh, and L. A. Turka. 1998. Antibody-induced transplant arteriosclerosis is prevented by graft expression of anti-oxidant and anti-apoptotic genes. Nat Med 4:1392-1396.

170. Harada, H., H. Ishikura, I. Nakagawa, J. Shindou, M. Murakami, T. Uede, T. Koyanagi, and T. Yoshiki. 2000. Abortive alloantigen presentation by donor dendritic cells leads to donor-specific tolerance: a study with a preoperative CTLA4lg inoculation. Urol Res 28:69-74.

171. Kishimoto, K., V. M. Dong, S. Issazadeh, E. V. Fedoseyeva, A. M. Waaga, A. Yamada, M. Sho, G. Benichou, H. Auchincloss, Jr., M. J. Grusby, S. J. Khoury, and M. H. Sayegh. 2000. The role of CD154-CD40 versus CD28-B7 costimulatory pathways in regulating allogeneic Th1 and Th2 responses in vivo. J Clin Invest 106:63-72.

172. Najafian, N., and M. H. Sayegh. 2000. CTLA4-Ig: a novel immunosuppressive agent. Expert Opin Investig Drugs 9:2147-2157.

173. Shevach, E. M., R. S. McHugh, C. A. Piccirillo, and A. M. Thornton. 2001. Control of T-cell activation by CD4+ CD25+ suppressor T cells. Immunol Rev 182:58-67.

174. Gorczynski, R. M. 2001. Transplant tolerance modifying antibody to CD200 receptor, but not CD200, alters cytokine production profile from stimulated macrophages. Eur J Immunol 31:2331-2337.

175. Carreno, B. M., and M. Collins. 2002. The B7 family of ligands and its receptors: new pathways for costimulation and inhibition of immune responses. Annu Rev Immunol 20:29-53.

176. Chemnitz, J. M., R. V. Parry, K. E. Nichols, C. H. June, and J. L. Riley. 2004. SHP-1 and SHP-2 associate with immunoreceptor tyrosine-based switch motif of programmed death 1 upon primary human T cell stimulation, but only receptor ligation prevents T cell activation. J Immunol 173:945-954.

177. Tang, Q., K. J. Henriksen, E. K. Boden, A. J. Tooley, J. Ye, S. K. Subudhi, X. X. Zheng, T. B. Strom, and J. A. Bluestone. 2003. Cutting edge: CD28 controls peripheral homeostasis of CD4+CD25+ regulatory T cells. J Immunol 171:3348-3352.

69

178. Paust, S., L. Lu, N. McCarty, and H. Cantor. 2004. Engagement of B7 on effector T cells by regulatory T cells prevents autoimmune disease. Proc Natl Acad Sci U S A 101:10398-10403.

179. Grohmann, U., C. Orabona, F. Fallarino, C. Vacca, F. Calcinaro, A. Falorni, P. Candeloro, M. L. Belladonna, R. Bianchi, M. C. Fioretti, and P. Puccetti. 2002. CTLA-4-Ig regulates tryptophan catabolism in vivo. Nat Immunol 3:1097-1101.

180. Zha, Y., C. Blank, and T. F. Gajewski. 2004. Negative regulation of T-cell function by PD-1. Crit Rev Immunol 24:229-237.

181. Wang, W., R. Lau, D. Yu, W. Zhu, A. Korman, and J. Weber. 2009. PD1 blockade reverses the suppression of melanoma antigen-specific CTL by CD4+ CD25Hi regulatory T cells. Int Immunol 21:1065-1077.

182. Saresella, M., I. Marventano, R. Longhi, F. Lissoni, D. Trabattoni, L. Mendozzi, D. Caputo, and M. Clerici. 2008. CD4+CD25+FoxP3+PD1- regulatory T cells in acute and stable relapsing-remitting multiple sclerosis and their modulation by therapy. Faseb J 22:3500-3508.

183. Said, E. A., F. P. Dupuy, L. Trautmann, Y. Zhang, Y. Shi, M. El-Far, B. J. Hill, A. Noto, P. Ancuta, Y. Peretz, S. G. Fonseca, J. Van Grevenynghe, M. R. Boulassel, J. Bruneau, N. H. Shoukry, J. P. Routy, D. C. Douek, E. K. Haddad, and R. P. Sekaly. 2010. Programmed death-1-induced interleukin-10 production by monocytes impairs CD4+ T cell activation during HIV infection. Nat Med 16:452-459.

184. Greenwald, R. J., G. J. Freeman, and A. H. Sharpe. 2005. The B7 family revisited. Annu Rev Immunol 23:515-548.

185. Gorczynski, R. M., Z. Chen, X. M. Fu, and H. Zeng. 1998. Increased expression of the novel molecule OX-2 is involved in prolongation of murine renal allograft survival. Transplantation 65:1106-1114.

186. McMaster, W. R., and A. F. Williams. 1979. Identification of Ia glycoproteins in rat thymus and purification from rat spleen. Eur J Immunol 9:426-433.

187. Gorczynski, R. M., M. S. Cattral, Z. Chen, J. Hu, J. Lei, W. P. Min, G. Yu, and J. Ni. 1999. An immunoadhesin incorporating the molecule OX-2 is a potent immunosuppressant that prolongs allo- and xenograft survival. J Immunol 163:1654-1660.

188. Gorczynski, R. M., Z. Cohen, X. M. Fu, and J. Lei. 1999. Anti-rat OX-2 blocks increased small intestinal transplant survival after portal vein immunization. Transplant Proc 31:577-578.

189. Gorczynski, L., Z. Chen, J. Hu, Y. Kai, J. Lei, V. Ramakrishna, and R. M. Gorczynski. 1999. Evidence that an OX-2-positive cell can inhibit the stimulation of type 1 cytokine production by bone marrow-derived B7-1 (and B7-2)-positive dendritic cells. J Immunol 162:774-781.

190. Gorczynski, R. M., J. Bransom, M. Cattral, X. Huang, J. Lei, L. Xiaorong, W. P. Min, Y. Wan, and J. Gauldie. 2000. Synergy in induction of increased renal allograft survival after portal vein infusion of dendritic cells transduced to express TGFbeta and IL-10, along with administration of CHO cells expressing the regulatory molecule OX-2. Clin Immunol 95:182-189.

191. Kenick, S., R. P. Lowry, R. D. Forbes, and R. Lisbona. 1987. Prolonged cardiac allograft

70

survival following portal venous inoculation of allogeneic cells: what is "hepatic tolerance"? Transplant Proc 19:478-480.

192. Barclay, A. N. 1981. Different reticular elements in rat lymphoid tissue identified by localization of Ia, Thy-1 and MRC OX 2 antigens. Immunology 44:727-736.

193. Cobbold, S. P. 2005. T cell tolerance induced by therapeutic antibodies. Philos Trans R Soc Lond B Biol Sci 360:1695-1705.

194. Duncan, M. D., and D. S. Wilkes. 2005. Transplant-related immunosuppression: a review of immunosuppression and pulmonary infections. Proc Am Thorac Soc 2:449-455.

195. Barclay, A. N., and H. A. Ward. 1982. Purification and chemical characterisation of membrane glycoproteins from rat thymocytes and brain, recognised by monoclonal antibody MRC OX 2. Eur J Biochem 129:447-458.

196. McCaughan, G. W., M. J. Clark, J. Hurst, F. Grosveld, and A. N. Barclay. 1987. The gene for MRC OX-2 membrane glycoprotein is localized on human chromosome 3. Immunogenetics 25:133-135.

197. Borriello, F., R. Tizard, E. Rue, and R. Reeves. 1998. Characterization and localization of Mox2, the gene encoding the murine homolog of the rat MRC OX-2 membrane glycoprotein. Mamm Genome 9:114-118.

198. Clark, M. J., J. Gagnon, A. F. Williams, and A. N. Barclay. 1985. MRC OX-2 antigen: a lymphoid/neuronal membrane glycoprotein with a structure like a single immunoglobulin light chain. EMBO J 4:113-118.

199. Barclay, A. N., M. J. Clark, and G. W. McCaughan. 1986. Neuronal/lymphoid membrane glycoprotein MRC OX-2 is a member of the immunoglobulin superfamily with a light-chain-like structure. Biochem Soc Symp 51:149-157.

200. Preston, S., G. J. Wright, K. Starr, A. N. Barclay, and M. H. Brown. 1997. The leukocyte/neuron cell surface antigen OX2 binds to a ligand on macrophages. Eur J Immunol 27:1911-1918.

201. Gorczynski, R. M., K. Yu, and D. Clark. 2000. Receptor engagement on cells expressing a ligand for the tolerance-inducing molecule OX2 induces an immunoregulatory population that inhibits alloreactivity in vitro and in vivo. J Immunol 165:4854-4860.

202. Wright, G. J., M. J. Puklavec, A. C. Willis, R. M. Hoek, J. D. Sedgwick, M. H. Brown, and A. N. Barclay. 2000. Lymphoid/neuronal cell surface OX2 glycoprotein recognizes a novel receptor on macrophages implicated in the control of their function. Immunity 13:233-242.

203. Kavanaugh, W. M., and L. T. Williams. 1994. An alternative to SH2 domains for binding tyrosine-phosphorylated proteins. Science 266:1862-1865.

204. Kavanaugh, W. M., C. W. Turck, A. Klippel, and L. T. Williams. 1994. Tyrosine 508 of the 85-kilodalton subunit of phosphatidylinositol 3-kinase is phosphorylated by the platelet-derived growth factor receptor. Biochemistry 33:11046-11050.

205. Rijkers, E. S., T. de Ruiter, A. Baridi, H. Veninga, R. M. Hoek, and L. Meyaard. 2008. The inhibitory CD200R is differentially expressed on human and mouse T and B lymphocytes. Mol Immunol 45:1126-1135.

206. Wright, G. J., H. Cherwinski, M. Foster-Cuevas, G. Brooke, M. J. Puklavec, M. Bigler, Y. Song, M. Jenmalm, D. Gorman, T. McClanahan, M. R. Liu, M. H. Brown, J. D.

71

Sedgwick, J. H. Phillips, and A. N. Barclay. 2003. Characterization of the CD200 receptor family in mice and humans and their interactions with CD200. J Immunol 171:3034-3046.

207. Rosenblum, M. D., J. E. Woodliff, N. A. Madsen, L. J. McOlash, M. R. Keller, and R. L. Truitt. 2005. Characterization of CD 200-receptor expression in the murine epidermis. J Invest Dermatol 125:1130-1138.

208. Zhang, S., and J. H. Phillips. 2006. Identification of tyrosine residues crucial for CD200R-mediated inhibition of mast cell activation. J Leukoc Biol 79:363-368.

209. Gorczynski, R. M., Z. Chen, D. A. Clark, Y. Kai, L. Lee, J. Nachman, S. Wong, and P. Marsden. 2004. Structural and functional heterogeneity in the CD200R family of immunoregulatory molecules and their expression at the feto-maternal interface. Am J Reprod Immunol 52:147-163.

210. Gorczynski, R., Z. Chen, Y. Kai, L. Lee, S. Wong, and P. A. Marsden. 2004. CD200 is a ligand for all members of the CD200R family of immunoregulatory molecules. J Immunol 172:7744-7749.

211. Voehringer, D., D. B. Rosen, L. L. Lanier, and R. M. Locksley. 2004. CD200 receptor family members represent novel DAP12-associated activating receptors on basophils and mast cells. J Biol Chem 279:54117-54123.

212. Tomasello, E., C. Cant, H. J. Buhring, F. Vely, P. Andre, M. Seiffert, A. Ullrich, and E. Vivier. 2000. Association of signal-regulatory proteins beta with KARAP/DAP-12. Eur J Immunol 30:2147-2156.

213. Gorczynski, R. M., Z. Chen, Y. Kai, S. Wong, and L. Lee. 2004. Induction of tolerance-inducing antigen-presenting cells in bone marrow cultures in vitro using monoclonal antibodies to CD200R. Transplantation 77:1138-1144.

214. Gorczynski, R. M., L. Lee, and I. Boudakov. 2005. Augmented Induction of CD4+CD25+

Treg using monoclonal antibodies to CD200R. Transplantation 79:1180-1183. 215. Hatherley, D., H. M. Cherwinski, M. Moshref, and A. N. Barclay. 2005. Recombinant

CD200 protein does not bind activating proteins closely related to CD200 receptor. J Immunol 175:2469-2474.

216. Suchin, E. J., P. B. Langmuir, E. Palmer, M. H. Sayegh, A. D. Wells, and L. A. Turka. 2001. Quantifying the frequency of alloreactive T cells in vivo: new answers to an old question. J Immunol 166:973-981.

217. Lechler, R. I., M. Sykes, A. W. Thomson, and L. A. Turka. 2005. Organ transplantation--how much of the promise has been realized? Nat Med 11:605-613.

218. Lindenfeld, J., G. G. Miller, S. F. Shakar, R. Zolty, B. D. Lowes, E. E. Wolfel, L. Mestroni, R. L. Page, 2nd, and J. Kobashigawa. 2004. Drug therapy in the heart transplant recipient: part II: immunosuppressive drugs. Circulation 110:3858-3865.

219. Thorsby, E., P. Pfeffer, and T. Leivestad. 2004. Role of HLA molecules in the induction of alloimmune responses: clinical significance in the cyclosporine era. Transplant Proc 36:16S-21S.

220. Gorczynski, R. M., Z. Chen, Y. Kai, and J. Lei. 2000. Evidence for persistent expression of OX2 as a necessary component of prolonged renal allograft survival following portal vein immunization. Clin Immunol 97:69-78.

221. Rosenblum, M. D., E. B. Olasz, K. B. Yancey, J. E. Woodliff, Z. Lazarova, K. A. Gerber,

72

and R. L. Truitt. 2004. Expression of CD200 on epithelial cells of the murine hair follicle: a role in tissue-specific immune tolerance? J Invest Dermatol 123:880-887.

222. Gorczynski, R. M., J. Hu, Z. Chen, Y. Kai, and J. Lei. 2002. A CD200FC immunoadhesin prolongs rat islet xenograft survival in mice. Transplantation 73:1948-1953.

223. Yu, K., Z. Chen, S. Wang, and R. Gorczynski. 2006 Decreased alloreactivity using donor cells from mice expressing a CD200 transgene under control of a tetracycline-inducible promoter. Transplantation 80:394-401.

224. Gorczynski, R. M. 2006. Thymocyte/splenocyte-derived CD4+CD25+Treg stimulated by anti-CD200R2 derived dendritic cells suppress mixed leukocyte cultures and skin graft rejection. Transplantation 81:1027-1034.

225. Boudakov, I., J. Liu, N. Fan, P. Gulay, K. Wong, and R. M. Gorczynski. 2007. Mice lacking CD200R1 show absence of suppression of lipopolysaccharide-induced tumor necrosis factor-alpha and mixed leukocyte culture responses by CD200. Transplantation 84:251-257.

226. King, A., T. D. Burrows, S. E. Hiby, J. M. Bowen, S. Joseph, S. Verma, P. B. Lim, L. Gardner, P. Le Bouteiller, A. Ziegler, B. Uchanska-Ziegler, and Y. W. Loke. 2000. Surface expression of HLA-C antigen by human extravillous trophoblast. Placenta 21:376-387.

227. Kapasi, K., S. E. Albert, S. Yie, N. Zavazava, and C. L. Librach. 2000. HLA-G has a concentration-dependent effect on the generation of an allo-CTL response. Immunology 101:191-200.

228. Contini, P., M. Ghio, A. Poggi, G. Filaci, F. Indiveri, S. Ferrone, and F. Puppo. 2003. Soluble HLA-A,-B,-C and -G molecules induce apoptosis in T and NK CD8+ cells and inhibit cytotoxic T cell activity through CD8 ligation. Eur J Immunol 33:125-134.

229. Perez-Villar, J. J., I. Melero, F. Navarro, M. Carretero, T. Bellon, M. Llano, M. Colonna, D. E. Geraghty, and M. Lopez-Botet. 1997. The CD94/NKG2-A inhibitory receptor complex is involved in natural killer cell-mediated recognition of cells expressing HLA-G1. J Immunol 158:5736-5743.

230. Sasaki, Y., M. Sakai, S. Miyazaki, S. Higuma, A. Shiozaki, and S. Saito. 2004. Decidual and peripheral blood CD4+CD25+ regulatory T cells in early pregnancy subjects and spontaneous abortion cases. Mol Hum Reprod 10:347-353.

231. Zenclussen, A. C., K. Gerlof, M. L. Zenclussen, A. Sollwedel, A. Z. Bertoja, T. Ritter, K. Kotsch, J. Leber, and H. D. Volk. 2005. Abnormal T-cell reactivity against paternal antigens in spontaneous abortion: adoptive transfer of pregnancy-induced CD4+CD25+ T regulatory cells prevents fetal rejection in a murine abortion model. Am J Pathol 166:811-822.

232. Chang, C. C., R. Ciubotariu, J. S. Manavalan, J. Yuan, A. I. Colovai, F. Piazza, S. Lederman, M. Colonna, R. Cortesini, R. Dalla-Favera, and N. Suciu-Foca. 2002. Tolerization of dendritic cells by T(S) cells: the crucial role of inhibitory receptors ILT3 and ILT4. Nat Immunol 3:237-243.

233. Guleria, I., and M. H. Sayegh. 2007. Maternal acceptance of the fetus: true human tolerance. J Immunol 178:3345-3351.

234. Lopez-Botet, M., and T. Bellon. 1999. Natural killer cell activation and inhibition by

73

receptors for MHC class I. Curr Opin Immunol 11:301-307. 235. Mellor, A. L., and D. H. Munn. 2000. Immunology at the maternal-fetal interface:

lessons for T cell tolerance and suppression. Annu Rev Immunol 18:367-391. 236. Erlebacher, A. 2001. Why isn't the fetus rejected? Curr Opin Immunol 13:590-593. 237. Lob, S., A. Konigsrainer, D. Zieker, B. L. Brucher, H. G. Rammensee, G. Opelz, and P.

Terness. 2009. IDO1 and IDO2 are expressed in human tumors: levo- but not dextro-1-methyl tryptophan inhibits tryptophan catabolism. Cancer Immunol Immunother 58:153-157.

238. Clark, D. A., A. Keil, Z. Chen, U. Markert, J. Manuel, and R. M. Gorczynski. 2003. Placental trophoblast from successful human pregnancies expresses the tolerance signaling molecule, CD200 (OX-2). Am J Reprod Immunol 50:187-195.

239. Clark, D. A., G. Yu, G. A. Levy, and R. M. Gorczynski. 2001. Procoagulants in fetus rejection: the role of the OX-2 (CD200) tolerance signal. Semin Immunol 13:255-263.

240. Clark, D. A., J. W. Ding, G. Yu, G. A. Levy, and R. M. Gorczynski. 2001. Fgl2 prothrombinase expression in mouse trophoblast and decidua triggers abortion but may be countered by OX-2. Mol Hum Reprod 7:185-194.

241. Gorczynski, R. M. 2001. Evidence for an immunoregulatory role of OX2 with its counter ligand (OX2L) in the regulation of transplant rejection, fetal loss, autoimmunity and tumor growth. Arch Immunol Ther Exp (Warsz) 49:303-309.

242. Clark, D. A., and G. Chaouat. 2005. Loss of surface CD200 on stored allogeneic leukocytes may impair anti-abortive effect in vivo. Am J Reprod Immunol 53:13-20.

243. Fallarino, F., C. Asselin-Paturel, C. Vacca, R. Bianchi, S. Gizzi, M. C. Fioretti, G. Trinchieri, U. Grohmann, and P. Puccetti. 2004. Murine plasmacytoid dendritic cells initiate the immunosuppressive pathway of tryptophan catabolism in response to CD200 receptor engagement. J Immunol 173:3748-3754.

244. de Fougerolles, A. R., and M. G. Baines. 1987. Modulation of the natural killer cell activity in pregnant mice alters the spontaneous abortion rate. J Reprod Immunol 11:147-153.

245. Gorczynski, R. M., Z. Chen, K. Yu, and J. Hu. 2001. CD200 immunoadhesin suppresses collagen-induced arthritis in mice. Clin Immunol 101:328-334.

246. Gorczynski, R. M., Z. Chen, L. Lee, K. Yu, and J. Hu. 2002. Anti-CD200R ameliorates collagen-induced arthritis in mice. Clin Immunol 104:256-264.

247. Hoek, R. M., S. R. Ruuls, C. A. Murphy, G. J. Wright, R. Goddard, S. M. Zurawski, B. Blom, M. E. Homola, W. J. Streit, M. H. Brown, A. N. Barclay, and J. D. Sedgwick. 2000. Down-regulation of the macrophage lineage through interaction with OX2 (CD200). Science 290:1768-1771.

248. Liu, Y., Y. Bando, D. Vargas-Lowy, W. Elyaman, S. J. Khoury, T. Huang, K. Reif, and T. Chitnis. CD200R1 agonist attenuates mechanisms of chronic disease in a murine model of multiple sclerosis. J Neurosci 30:2025-2038.

249. Broderick, C., R. M. Hoek, J. V. Forrester, J. Liversidge, J. D. Sedgwick, and A. D. Dick. 2002. Constitutive retinal CD200 expression regulates resident microglia and activation state of inflammatory cells during experimental autoimmune uveoretinitis. Am J Pathol 161:1669-1677.

250. Zou, W. 2005. Immunosuppressive networks in the tumour environment and their

74

therapeutic relevance. Nat Rev Cancer 5:263-274. 251. Mapara, M. Y., and M. Sykes. 2004. Tolerance and cancer: mechanisms of tumor

evasion and strategies for breaking tolerance. J Clin Oncol 22:1136-1151. 252. McWhirter, J. R., A. Kretz-Rommel, A. Saven, T. Maruyama, K. N. Potter, C. I.

Mockridge, E. P. Ravey, F. Qin, and K. S. Bowdish. 2006. Antibodies selected from combinatorial libraries block a tumor antigen that plays a key role in immunomodulation. Proc Natl Acad Sci U S A 103:1041-1046.

253. Kretz-Rommel, A., F. Qin, N. Dakappagari, E. P. Ravey, J. McWhirter, D. Oltean, S. Frederickson, T. Maruyama, M. A. Wild, M. J. Nolan, D. Wu, J. Springhorn, and K. S. Bowdish. 2007. CD200 expression on tumor cells suppresses antitumor immunity: new approaches to cancer immunotherapy. J Immunol 178:5595-5605.

254. Tonks, A., L. Pearn, M. Musson, A. Gilkes, K. I. Mills, A. K. Burnett, and R. L. Darley. 2007. Transcriptional dysregulation mediated by RUNX1-RUNX1T1 in normal human progenitor cells and in acute myeloid leukaemia. Leukemia 21:2495-2505.

255. Siva, A., H. Xin, F. Qin, D. Oltean, K. S. Bowdish, and A. Kretz-Rommel. 2008. Immune modulation by melanoma and ovarian tumor cells through expression of the immunosuppressive molecule CD200. Cancer Immunol Immunother 57:987-996.

256. Petermann, K. B., G. I. Rozenberg, D. Zedek, P. Groben, K. McKinnon, C. Buehler, W. Y. Kim, J. M. Shields, S. Penland, J. E. Bear, N. E. Thomas, J. S. Serody, and N. E. Sharpless. 2007. CD200 is induced by ERK and is a potential therapeutic target in melanoma. J Clin Invest 117:3922-3929.

257. Wong, K. K., I. Khatri, S. Shaha, D. E. Spaner, and R. M. Gorczynski. The role of CD200 in immunity to B cell lymphoma. J Leukoc Biol 88:361-372.

258. Gorczynski, R. M., Z. Chen, J. Diao, I. Khatri, K. Wong, K. Yu, and J. Behnke. Breast cancer cell CD200 expression regulates immune response to EMT6 tumor cells in mice. Breast Cancer Res Treat 123:405-415.

259. Urlinger, S., U. Baron, M. Thellmann, M. T. Hasan, H. Bujard, and W. Hillen. 2000. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci U S A 97:7963-7968.

260. Gorczynski, R. M., Z. Chen, W. He, I. Khatri, Y. Sun, K. Yu, and I. Boudakov. 2009. Expression of a CD200 transgene is necessary for induction but not maintenance of tolerance to cardiac and skin allografts. J Immunol 183:1560-1568.

75

CHAPTER 2

Decreased alloreactivity using donor cells from mice expressing a CD200 transgene under control of a

tetracycline-inducible promoter

Transplantation 80:394-401

76

Abstract

CD200 delivers an immunsuppressive signal which augments allograft survival following

interaction with its receptor, CD200R1. We hypothesized that mice over-expressing CD200 as a

transgene would show a diminished alloresponsiveness, and decreased allograft rejection.

A transgenic mouse on a C57BL/6 background, expressing a murine CD200 cDNA genetically

linked to a green fluorescent protein tag (GFP) under control of a tetracycline response element

(TRE), was mated with a commercial transgenic mouse carrying the reverse tetracycline regulated

transactivator gene under control of a human CMV promoter. F1 mice were examined for induction

of alloimmunity in vivo/in vitro, and for their ability to reject skin allografts in vivo. The F1 hybrid

expressed CD200 after exposure to Doxycyline (DOX), as assessed both by enhanced GFP

expression in multiple organs and CD200-GFP expression. Splenocytes from F1 mice stimulated

with LPS or allogeneic cells in vitro in the presence of DOX showed reduced production of TNFα,

and of allospecific cytotoxic T lymphocyte (CTL). Splenocytes from F1 mice used as stimulator

cells in allogeneic mixed lymphocyte culture (MLC) in the presence of DOX were inefficient at

induction of cytokines or CTL in vitro from normal allogeneic responder cells. Skin grafts from

transgenic mice were inefficient at induction of CTL in vivo. Transgenic mice receiving DOX

showed prolonged acceptance of skin allografts, which was abolished by infusion of anti-CD200

mAb. Our data confirmed that overexpression of CD200 in transgenic mice, or in skin grafts from

these mice, decreases alloimmunity and LPS responsiveness. This has potential clinical utility in

transplantation and other diseases.

77

1. Introduction

Intense interest has centred on the need for development of novel immunosuppressant

agents and/or regimens which might have clinical utility in multiple disorders (1). Efficient

induction of T cell immunity depends upon the existence of accessory signals provided by a variety

of costimulatory molecules (and their natural ligands) (2-6). However, trials both in experimental

animals and man, using costimulator blockade alone have not provided evidence for consistent

inhibition of immunity (7-9). Other receptor:ligand molecules which deliver regulatory

(suppressive signals) directly to antigen activated T cells have been described (10-16). At least for

CTLA4, there is evidence that the same molecule may deliver either positive or negative

costimulatory signals under different conditions (17, 18).

CD200 and CD200R are members of the immunoglobulin supergene family, which we have

implicated in the direct delivery of suppressive responses (19, 20). Animals receiving foreign allo-

or xeno-grafts or immunized with bovine collagen in the presence of soluble CD200 (CD200:Fc),

or an agonist anti-CD200R show diminished graft rejection and development of collagen-induced

arthritis (CIA) (19, 21- 23). Hoek et al also reported that CD200 KO mice showed increased

susceptibility to both CIA and experimental allergic encephalomyelitis, along with evidence for

increased proliferation of CD200R+ cells (24), implying a role for CD200 in the regulation of

activation of CD200R+ cells of the monocyte/myeloid lineage (24). CD200R is expressed in

addition on cells of T lymphocyte origin (25-27), and we have documented that CD200 can exert

both direct and indirect roles in T cell activation (28, 29).

“Proof-of-principle” for an important role for CD200:CD200R interactions in regulation of

immunity would come from studies using an animal with inducible overexpression of CD200. We

78

have created a CD200 transgenic mouse (CD200tg/tg) following injection of embryonic stem cells

with cDNA encoding mouse CD200 linked to cDNA encoding the reporter green fluorescent

protein (GFP), the whole construct being under the control of a tetracycline response element

(TRE: thus TRE-CD200-GFP). A Tet-On transactivator, provided by mating homozygous TRE-

CD200-GFPTg/tg with a commercial transgenic mouse carrying the rtTA transactivator under a

CMV promoter, was used to drive transcription from the TRE promoter of the CD200 transgene in

the presence of Doxycycline (DOX) (30, 31). In the absence of DOX the transactivator does not

bind to the TRE promoter and transcription is repressed. Data herein characterize the immune

response to allostimulation of cells from such mice; the response induced using cells/tissue from

these mice as antigen; and skin graft survival in transgenic mice receiving DOX.

79

2. Materials and Methods

2.1. Mice

Male C57BL/6 mice, along with NMRI breeder mice carrying a reverse tetracycline

regulated transactivator gene ((TgN(rtTAhCMV)4Uh)-abbreviated hereafter as rtTAtg), were

purchased from the Jackson laboratories, Bar Harbour, ME. Mice were housed 5/cage and allowed

food and water ad libitum. All mice were used at 8-12 weeks of age. Genotyping of progeny from

further backcrosses of rtTAtg to C57BL/6 mice used the following primer pairs.

Control primer pairs for rtTA transgene:

Tcrd forword primer, 5’-CAAATGTTGCTTGTCTGGTG-3’

Tcrd reverse primer, 5’GTCAGTCGAGTGCACAGTTT3’

Primer pairs for rtTA transgene:

Tet sense primer, 5’-CGCTGTGGGGCATTTTACTTTAG-3’

Tet antisense primer, 5’CATGTCCAGATCGAAATCGTC3’

2.2. Creation of TRE-CD200-GFP cDNA, and characterization of transgenic mice

cDNA encoding green fluorescent protein (GFP) was cut from pEGFP-N2 (Clonetech),

linked in frame downstream of a tetracycline response element (TRE) gene. Sequence verification

used the primer pairs (5’-ACATGAATTTTACAATAGCG-3’) and GFP primer (5’-

AACCGTCAGATCGCCTGGAG-3’); sequences were analyzed using software from Hitachi

Software Engineering America Ltd, USA. The CD200 gene was ligated into this TRE-GFP

construct using SacII and BamH1 sites. Sequencing confirmed in-frame ligation of TRE-CD200-

GFP. Co-transfection of CHO cells with both the TRE-CD200-GFP cDNA and hCMV-rtTA cDNA

led to a DOX-inducible increase in both GFP (assessed by fluorescence) and CD200-GFP (Western

80

gels using anti-CD200 mAb, 10A5 (32) and commercial anti-GFP (BD Biosciences, San Diego,

CA)). CHO cells transfected with this TRE-CD200-GFP construct and stimulated with DOX

expressed CD200 at the cell surface, and caused inhibition of MLC reactivity (see (33)).

Purified TRE-CD200-GFP cDNA was used for microinjection of fertilized eggs of FVB mice

(University Health Network Transgenic facility), the fertilized eggs transferred to pseudopregnant

foster mothers, and subsequent progeny typed for wild-type and transgenic CD200 using the same

forward primer (from the V-region exon of CD200) and two different 3’ primer pairs to distinguish

the endogenous germline CD200 and the transgenic CD200-GFP genes.

Sense primer for both endogenous and transgenic CD200 (from V-region exon 3):

5’- GAAGTGGTGACCCAGGATGA -3’

Antisense primer for endogenous CD200 (from 5’ end of the intron immediately downstream of

exon 3):

5’-TGCTGGCTGTACCCTTAGAA-3’

Antisense primer for transgenic CD200-GFP (from 3’ end of GFP cDNA):

5’-TCGTGCTGCTTCATGTGGTC-3’

Of 25 progeny screened (9 males and 16 females) positive transmission of CD200-GFP was

detected in 15 (4 males and 11 females), and germline transmission (PCR) in 6 (2 males and 4

females). First generation transgenic progeny were backcrossed onto a C57BL/6 (H2b/b)

background, typed at each generation, and 3 founder lines of each continued through further

backcross generations with C57BL/6. Following the tenth backcross, brother-sister mating of

heterozgotes produced independent transgenic (F10) homozygous mice for either rtTAhCMV and

CD200-GFP transgenes. Mating of the two transgenic lines produced dual-transgenic progeny.

81

2.3. DOX- induction of GFP and CD200 expression in F1 mice

Drinking water for doubly transgenic F1 mice was either plain water or water with 2 mg/ml

Doxycycline hydrochloride (Sigma Chemicals, St.Louis, MO) with 5% sucrose (DOX-water) for a

minimum of 7 days- DOX-water was replaced at 3 day intervals. Spleen, skin and heart tissues

were isolated. An aliquot was used for protein extraction and Western analysis. Splenocytes were

isolated and used in cultures with/without ongoing DOX treatment (3 µg/ml) (see below). Skin

from dual transgenic mice was used for skin grafts (21).

2.4. Monoclonal antibodies for ELISA and FACS

Strepavidin horse radish peroxidase and the following monoclonal antibodies (mAbs) were

obtained from Pharmingen (San Diego, CA) unless stated otherwise: anti-IL-2 (S4B6, ATCC;

biotinylated JES6-5H4); anti-IL-4 (11B11, ATCC; biotinylated BVD6-24G2); anti-IFNγ (R4-6A2,

ATCC; biotinylated XMG1.2); anti-IL-10 (JES5-2A5; biotinylated, SXC-1); anti-TNFα (G281-

2626; biotinylated MP6-XT3); rat anti-mouse CD200 (10A5) is described elsewhere (32).

PE-coupled mAbs for FACS analysis of cell subsets in mice (+DOX) were purchased from

Cedarlane Laboratories (Hornby, Ontario). A FITC goat anti-rat Ig was used as secondary antibody

to stain CD200+ cells.

2.5. Cytotoxicity and cytokine assays

In allogeneic mouse mixed leukocyte cultures (MLC) used to assess cytokine production,

nylon wool purified splenic T cells (1.5 x 106 ) from dual-transgenic F1 responder cells (H2b/b)

were stimulated with equal numbers of mitomycin-C treated BALB/c spleen stimulator cells in

triplicate in F10 (with/without DOX at 3 mg/ml) in a round-bottom 96 well plate with total

volume of 250 µl/well. Supernatants were pooled at 40 hr from replicate wells and assayed in

82

triplicate in ELISA assays as described above and elsewhere (21-23). Assay sensitivity was in the

range 40 to 4,000 pg/ml.

Where cytotoxicity was assayed, cells were harvested from MLC cultures at 5 days and

titrated at different effector:target ratios for killing (4 hrs at 37oC) of 51Cr-labeled P815 tumor

target cells.

2.6. Statistics

Groups within different experiments were compared by ANOVA. Comparisons of graft

survival in different groups used Mann-Whitney U-tests.

83

3. Results

3.1. Dual transgenic F1 mice drinking DOX-water showed expression of CD200-GFP in

multiple tissues

Figure 1 show results from a Western analysis of protein extracts from spleen tissue of dual

transgenic F1 mice drinking either plain water (control) or DOX-water. Blots were developed with

a commercial anti-GFP antibody. Without DOX no CD200-GFP was detected and only low level

expression of endogenous CD200 was seen-not shown. Following DOX exposure CD200-GFP was

detected, with variable expression in different mice. Cellular subsets in the spleen, PLN and bone

marrow, analyzed by flow cytometry, showed no significant differences in transgenic mice treated

with or without Dox (Table 1). When we assessed the CD200 expression in different cell subsets of

wild type v transgenic mice in spleen in the presence/absence of DOX it was apparent that there

was no significant change in CD200 expression on subsets of transgenic mice in the absence of

DOX. In animals treated with DOX, all subsets showed markedly increased CD200 expression

(from background staining of ~15% to 53%) (Table 2).

3.2. Responder cells from dual transgenic F1 mice drinking DOX-water show decreased

induction of allospecific CTL and IFNγ/IL-2 in vitro with continued DOX exposure

Spleen T cells were isolated by nylon wool enrichment from individual dual-transgenic F1

mice derived from each of 3 founder lines of TRE-CD200:GFP following exposure of F1 mice to

DOX-water. Control cells from each founder group were from F1 mice not exposed to DOX-water,

or non-transgenic BL/6 mice (+ DOX-water). Cells were cultured in the presence/absence of DOX

(3 µg/ml), along with mitomycin-c treated BALB/c spleen stimulator cells. Cytokines were assayed

by ELISA, and CTL against P815 tumor targets (Figures 2 and 3 - one of 3 studies).

84

Induction of CD200-EGFP in spleen of transgenic mice in presence of Doxycycline

10

Mice B61 B62 EGFP Tg1 Tg2 Tg3 Tg4 Tg5

+ Dox no Dox + Dox

36kD

48kD

62kDa

79kD

Lanes: 1 2 3 4 5 6 7 8

Figure 1

85

Legend to Figure 1: Induction of CD200-EGFP in spleen of transgenic mice in presence of

Doxycycline

Western blot showing induction of CD200-GFP in dual transgenic mice (4 mice from

Founder 15) receiving DOX-water for 7 days, with no such induction in the absence of DOX.

Control B6 mice show (as expected) no CD200-GFP even with DOX.

86

Table 1: Cellular subsets (%) in different tissues of transgenic mice (+DOX)

MAb used in FACSa Spleen PLN BMb

DOX - + - + - +

Anti-CD3 26+3.5 27+3.8 82+7.4 76+8.3 8.5+2.0 9.0+2.2

Anti-CD4 22+3.0 23+4.1 65+7.0 63+8.1 7.4+3.1 6.9+2.3

Anti-CD8 12+1.9 12+2.2 26+4.3 25+3.1 2.2+0.7 1.8+0.7

Anti-CD19 46+6.9 42+6.7 18+2.9 20+3.4 35+5.5 33+4.9

Anti-MAC-1 12+2.4 11+3.8 7.6+3.2 7.9+3.1 26+3.2 25+3.1

Anti-MAC-3 9.2+3.0 10+2.7 6.8+2.2 6.6+2.3 29+3.0 25+2.5

F4/80 8.5+2.1 7.4+2.9 5.0+1.9 5.1+2.4 34+4.9 33+3.1

Anti-CD205 8.2+3.5 8.0+3.0 5.9+3.0 6.0+2.3 12+3.5 12+2.9

Footnotes: a. Cells were stained using commercial PE-mAbs as described in Materials and Methods. b. Data represent arithmetic mean (+SD) for triplicate measurements from 4 mice/group. DOX transgenic mice received

DOX in the drinking supply for 7 days before sacrifice.

87

Table 2: Percentage of C200+ cells in cell subsets of spleen of wild type and transgenic mice

(+DOX)

MAb used in FACSa Control Tg Control Tgb

% positive (%CD200+) - No DOX % positive (%CD200+) + DOX

Anti-CD45 46+5.5 (11) 51+6.0 (12) 47+4.8 (11) 48+5.3 (28)*

Anti-MAC-1 9.0+2.4 (30) 8.6+3.2 (28) 9.1+1.8 (29) 10+1.8 (88)*

Anti-MAC-3 8.5+2.0 (29) 8.8+2.2 (30) 8.9+1.7 (30) 8.4+2.0 (86)*

F4/80 7.9+1.5 (35) 8.0+1.9 (32) 7.5+1.9 (33) 8.1+2.4 (84)*

Anti-CD205 6.8+1.5 (55) 6.3+2.0 (50) 6.6+2.0 (51) 6.7+1.3 (94)*

Anti-CD3 25+2.5 (6.5) 27+3.0 (6.2) 26+3.2 (6.0) 28+2.7 (31)*

Anti-CD200 17.4± 2.0 18.2±2.2 17.9±2.3 53±5.9*

Footnotes: a. Cells were stained using commercial PE-mAbs and FITC anti-CD200 as described in Materials and Methods. b. Data represent arithmetic mean (+SD) for triplicate measurements from 3 mice/group. DOX transgenic mice received DOX in the drinking supply for 7 days before sacrifice. Data in parentheses indicates % dual stained cells (i.e. %CD200+ in the subset shown) * p<0.05 compared with no DOX controls

88

14

89

Legend to Figure 2: Suppression of CTL induction from splenocytes of dual-Tg mice

receiving doxycycline in vivo/in vitro

Inhibition of induction of CTL using cells from dual transgenic F1 mice exposed to DOX in

vivo/in vitro. MLC cultures used T-depleted BALB/c spleen stimulator cells, and nylon wool

enriched T cells from individual responder spleen cells from 8/group of the three different founder

lines (Fo2, Fo14 and Fo15). 4 mice/group received DOX in vivo (followed by ongoing DOX added to

cultures). Control mice were stock BL/6 mice. Data show arithmetic mean (+SD) specific lysis at

an effector:target ratio of 100:1.

Note that lysis of EL4 targets from any of the cultures following stimulation was

<0.5+0.2%.

* p<0.05, compared with data from all individual control, mice (ANOVA).

90

Figure 3

91

Legend to Figure 3: Modulation of cytokine production in MLCs of dual-Tg mice by Dox

Altered induction of cytokine production (increased IL-4 and decreased IFNγ) measured by

ELISA in 40hr cultures of cells from mice shown in Figure 2. Qualitatively equivalent patterns (to

IFNγ, IL-4) were seen for IL-2 and IL-10 respectively (data not shown for clarity).

* p<0.05, compared with data from all individual control, mice (ANOVA).

92

In the absence of DOX, CTL induction from dual transgenic mice was equivalent to non-

transgenic mice (Figure 2). For control mice CTL induction was the same with/without DOX-

exposure, unlike dual transgenic mice, where DOX caused suppression of CTL induction from

individuals of all founder lines tested (Figure 2). Similarly, cytokine production from dual-

transgenic mice given DOX showed decreased IL-2/IFNγ and increased IL-4/IL-10 production (see

also references 20, 21).

3.3. Suppression of induction of CTL and TNF by splenocytes of dual-transgenic F1 mice

To assess whether CD200 over-expression impaired other function in splenocytes we

harvested cells from mice treated as in Figures 2 and 3 with/without DOX, and used them as APC

for MLCs with C3H responder spleen cells. After 5 days in culture CTL were assayed using EL4

tumor target cells (data in Figure 4, panel a). Control C3H cultures were stimulated (+DOX) with

mitomycin c-treated BALB/c APC, and CTL v P815 assayed. In addition, adherent splenocytes

from different groups of mice, or, as control, normal BALB/c mice, were isolated by adherence to

plastic culture dishes twice for 45 min at 37oC, stimulated with LPS in vitro (+DOX), and TNF in

culture supernatants assayed at 40hrs (see Figure 4, panel b).

Following CD200:GFP induction (DOX in vivo and in vitro), splenic APCs showed both a

decreased ability to induce CTL in allogeneic responder cells in vitro (panel a), and reduced TNF-α

production after LPS stimulation (panel b).

3.4. Suppression of induction of CTL in vivo following grafting with tail skin from double-

transgenic mice

To assess the effect of CD200-transgene expression in a non-lymphoid tissue (skin) on

allosensitization in vivo dual-transgenic mice referred to in Figures 2-4 above were used as tail skin

93

19

Source of splenocytes used in assays (CTL/TNFα production)

94

Legend to Figure 4

Panel a): Lack of CTL induction using splenocytes from transgenic mice

Inhibition of induction of CTL in vitro using spleen cells from dual transgenic F1 mice

(+DOX in vivo/in vitro as in Figures 2 and 3) as mitomycin c-treated stimulator APC. CTL assays

used 51Cr EL4 targets. APC from mice labeled C1 to C4 were from stock C57BL/6 mice. No lysis

was observed from any of these cultures vs P815 cells. Additional control APC (far right of Figure)

were derived from normal BALB/c mice. CTL in this case were assayed vs P815 targets (no lysis

vs EL4 targets).

Panel b): Suppression of TNFα production from LPS-stimulated splenocytes

Altered induction of TNFα production following LPS stimulation (1µg/ml) for 40hr of

adherent splenocytes from individual mice shown in panel a) (no mitomycin-c treatment),

with/without DOX as indicated. Data show arithmetic mean (+SD) for triplicate cultures.

* p<0.05, compared with data for all individual control mice (ANOVA).

95

donors at the time of sacrifice. 3 C3H recipients were used for each skin graft donor. All mice also

received 1cm2 BALB/c skin grafts on the opposite flank. Spleen cell suspensions were prepared at

14 days from individual mice, and tested at a 100:1 effector:target ratio for lysis of EL4 or P815

target cells (Figure 5). DOX suppressed induction of CTL (v EL4 targets) using grafts from

transgenic mice. All mice were sensitized by BALB/c skin grafts (lysis of P815 targets). Control

studies (PCR-data not shown) confirmed CD200:GFP mRNA expression in transgenic grafts.

3.5. Suppression of skin graft rejection in vivo in double-transgenic mice given DOX and

BALB/c grafts

Dual-transgenic mice (7/group) from Fo15, and control C57BL/6, received BALB/c skin

grafts with/without DOX-water. Some transgenic mice drinking DOX also received intravenous

injections with 100 µg/mouse anti-CD200 (10A5) at 60 hr intervals. Graft survival is shown in

Figure 6.

Over-expression of CD200 in F1 dual-transgenic mice in vivo prolonged survival of skin

allografts, and neutralization of expressed CD200 (using anti-CD200 mAb) abolished this

enhancement.

96

22

97

Legend to Figure 5: Induction of anti-BL/6 (BALB/c) CTL in vivo by grafts from Tg

(BALB/c) mice ±±±± Dox exposure

Inhibition of induction of CTL in vivo following engraftment of 4/group C3H mice with tail

skin from 3 donors/group dual transgenic F1 mice in the presence/absence of DOX (donors

received DOX for 7 days before graft harvest-recipients received DOX following grafting). Tail

skin from transgenic mice not exposed to DOX, or from non-transgenic normal BL/6 donors were

used as controls. All dual-transgenic mice were from founder 15. Control BALB/c grafts were

applied to the opposite flank. All mice were sacrificed at 14 days.

* p<0.05 compared with all control mice, or transgenic mice without DOX (ANOVA).

98

24

99

Legend to Figure 6: Increased BALB/c skin allograft survival in Fo15 transgenic mice given

Dox

Inhibition of BALB/c skin allograft rejection in vivo following engraftment of 6/group

normal BL/6 or Fo15 transgenic mice with tail skin from normal BALB/c mice. Groups received

DOX, as shown, throughout the study after engraftment; a separate group (◆), also received DOX

and intravenous injections with anti-CD200 mAb (10A5) at 60 hr interval (100 µg/mouse).

*p<0.05 compared with all other groups, Mann-Whitney U-test.

100

4. Discussion

We have documented a role for increased expression of naturally-expressed CD200, or

infused CD200Fc, in immunosuppression (20, 21, 28, 34). Figure 1 confirms over-expression of

CD200 in the presence of DOX in an artificial system, namely DOX-inducible transgenic mice. We

found no evidence for tissue restricted expression of rtTA protein (data not shown). Inducibility of

CD200:GFP depends upon penetration of tissues by DOX and the stability of the DOX-rtTA

protein (35). This likely causes the variability in expression of CD200:GFP (Figure 1), reflecting

differences in DOX concentration in tissues of individual mice (and their relative DOX-water

ingestion). A “second-generation” rtTAS2M2-transgenic on a BL/6 background (35, 36) induces

more widespread tissue- expression of CD200:GFP in dual-transgenic mice (Yang: MSc thesis, U

of T, 2006). Note, however, CD200 over-expression did not alter the cellular phenotypic profile of

cells in transgenic mice (Table 1), and indeed in transgenic mice given DOX, there was a 2-3 fold

increase in CD200+ cells seen across all subsets (Table 2).

Figures 2 and 3 show that in 3 independent founders DOX-inducible expression of

CD200:GFP in splenocytes decreased CTL induction and type-1 cytokine production, analogous to

results reported using soluble CD200:Fc (or anti-CD200R) in MLC responses (19, 21). DOX-

induced expression of CD200 in splenocytes also reduced their allostimulatory capacity (Figure 4,

panel a), and decreased TNFα production (Figure 4, panel b). This is consistent with reduced

TNFα production by CD200:Fc (22), and observations by Foster-Cuevas et al, using a viral

homologue of CD200 to suppress macrophage activation (37). DOX-inducible CD200:GFP

expression occurred in tail skin, and indeed, using dual transgenic mice expressing CD200-GFP as

tail skin donors, their grafts failed to induce allosensitization in vivo (Figure 5). Dual transgenic

101

mice over-expressing CD200 after DOX induction showed a prolongation of skin allograft survival

(Figure 6). Thus, regardless of whether donor tissue or recipient over-express CD200, the net result

(in terms of immune reactivity versus graft antigens) is operationally the same, namely a decreased

response.

Suppression mediated by CD200 follows engagement of CD200R. A family of CD200Rs

exist, expressed in a tissue-restricted fashion (26, 27, 39). We have shown that all family members

can bind CD200 (26, 34), though the avidity for CD200R1 is far greater than for other CD200Rs

(27). We have not yet investigated whether it is necessary, for graft prolongation, that CD200R

engagement be local (occurring within the graft) or systemic. In addition, we have yet to examine

the binding of the CD200:GFP transgenic product to different CD200R isoforms, and the functional

outcome of such binding. This analysis has begun using soluble decoy receptors (CD200R1:Fc,

R2:Fc etc.) in vivo following DOX-inducible CD200:GFP expression. The effect of DOX-

inducible CD200:GFP expression in multiple tissues on the use of those tissues as allografts (skin,

cardiac, renal, islet grafts), and on general autoimmune reactivity remains to be explored, along

with the biological mechanism(s) whereby any suppression observed is produced.

102

5. Reference

1. Mackay IR. Science, medicine, and the future - Tolerance and autoimmunity. Brit Med J 2000; 321: 93.

2. Fischbein MP, Ardehali A, Yun J, et al. CD40 signaling replaces CD4+ lymphocytes and its blocking prevents chronic rejection of heart transplants. J Immunol 2000; 165: 7316.

3. Ozkaynak E, Gao W, Shemmeri N, et al. Importance of ICOS-B7RP-I costimulation in acute and chronic allograft rejection. Nat Immunol 2001; 2: 591.

4. Salomon B, Bluestone JA. Complexities of CD28/B7: CTLA-4 costimulatory pathways in autoimmunity and transplantation. Annu Rev Immunol 2001; 19: 225.

5. Wang SD, Zhu GF, Chapoval AI, et al. Costimulation of T cells by B7-H2, a B7-like molecule that binds ICOS. Blood 2000; 96: 2708.

6. Greenwald RJ, Boussiotis VA, Lorsbach RB, Abbas AK, Sharpe AH. CTLA-4 regulates induction of anergy in vivo. Immunity 2001; 14: 145.

7. Trambley J, Bingaman AW, Lin A, et al. Asialo GM1+CD8+ T cells play a critical role in costimulation blockade-resistant allograft rejection. J Clin Invest 1999; 104: 1715.

8. Trambley J, Lin A, Elwood E, et al. FasL is important in costimulation blockade-resistant skin graft rejection. Transplantation 2001; 71: 537.

9. Yamada A, Salama AD, Sayegh MH. The role of novel T cell costimulatory pathways in autoimmunity and transplantation. J Amer Soc Nephrol 2002; 13: 559.

10. Petroff MG, Chen L, Phillips TA, Hunt JS. B7 family molecules: Novel immunomodulators at the maternal-fetal interface. Placenta 2002; 23: S95.

11. Prasad DVR, Nguyen T, Li Z, et al. Murine B7-H3 is a negative regulator of T cells. J Immunol 2004; 173: 2500.

12. Tsushima F, Iwai H, Otsuki N, et al. Preferential contribution of B7-H1 to programmed death-1-mediated regulation of hapten-specific allergic inflammatory responses. Eur J Immunol 2003; 33: 2773.

13. Han P, Goularte OD, Rufner K, Wilkinson B, Kaye J. An inhibitory Ig superfamily protein expressed by lymphocytes and APCs is also an early marker of thymocyte positive selection. J Immunol 2004; 172: 5931.

14. Kuchroo VK, Umetsu DT, DeKruyff DT, Freeman GJ. The TIM gene family: emerging roles in immunity and disease. Nat Rev Immunol 2003; 3: 454.

15. Malm H, Corbascio M, Osterholm C, et al. CTLA4Ig induces long-term graft survival of allogeneic skin grafts and totally inhibits T-cell proliferation in LFA-1-deficient mice. Transplantation 2002; 73: 293.

16. Gorczynski RM. Evidence for an immunoregulatory role of OX2 with its counter ligand (OX2L) in regulation of transplant rejection, fetal loss, autoimmunity and tumor growth. Arch Immunol Therap Experim 2001; 49: 303.

17. Lee RS, Rusche JR, Maloney ME, Sachs DH, Sayegh MH, Madsen JC. CTLA4Ig-induced linked regulation of allogeneic T cell responses. J Immunol 2001; 166: 1572.

18. Linsley PS, Greene JL, Tan P, et al. Coexpression and functional cooperation of CTLA-4 and CD28 on activated T lymphocytes. Journal of Experimental Medicine 1992; 176: 1595.

103

19. Gorczynski RM. Transplant tolerance modifying antibody, to CD200 receptor, but not CD200, alters cytokine production profile from stimulated macrophages. Eur J Immunol 2001; 31: 2331.

20. Gorczynski RM, Chen Z, Fu XM, Zeng H. Increased expression of the novel molecule Ox-2 is involved in prolongation of murine renal allograft survival. Transplantation 1998; 65: 1106.

21. Gorczynski RM, Cattral MS, Chen ZG, et al. An immunoadhesin incorporating the molecule OX-2 is a potent immunosuppressant that prolongs allo- and xenograft survival. J Immunol 1999; 163: 1654.

22. Gorczynski RM, Chen ZQ, Yu K, Hu J. CD200 immunoadhesin suppresses collagen-induced arthritis in mice. Clin Immunol 2001; 101: 328.

23. Gorczynski RM, Chen Z, Lee L, Yu K, Hua J. Anti-CD200R ameliorates collagen-induced arthritis in mice. Clin Immunol 2002; 104: 256.

24. Hoek RM, Ruuls SR, Murphy CA, et al. Down-regulation of the macrophage lineage through interaction with OX2 (CD200). Science 2000; 290: 1768.

25. Gorczynski RM, Yu K, Clark D. Receptor engagement on cells expressing a ligand for the tolerance- inducing molecule OX2 induces an immunoregulatory population that inhibits alloreactivity in vitro and in vivo. J Immunol 2000; 165: 4854.

26. Gorczynski R, Chen ZQ, Kai Y, Lee L, Wong S, Marsden PA. CD200 is a ligand for all members of the CD200R family of immunoregulatory molecules. J Immunol 2004; 172: 7744.

27. Wright GJ, Cherwinski H, FosterCuevas M, et al. Characterization of the CD200 receptor family in mice and humans and their interactions with CD200. J Immunol 2003; 171: 3034.

28. Gorczynski RM, Hu J, Chen Z, Kai Y, Lei J. A CD200Fc immunoadhesin prolongs rat islet xenograft survival in mice. Transplantation 2002; 73: 1948.

29. Gorczynski RM, Chen ZQ, Kai Y, Wong S, Lee L. Induction of tolerance-inducing antigen-presenting cells in bone marrow cultures in vitro using monoclonal antibodies to CD200R. Transplantation 2004; 77: 1138.

30. Gossen M, Freundlieb S, Bender G, Muller G, Hillen W, Bujard H. Transcriptional activation by tetracyclines in mammalian cells. Science 1995; 268: 1766.

31. Harding TC, Geddes BJ, Murphy D, Knight D, Uney JB. Switching transgene expression in the brain using an adenoviral tetracycline-regulatable system. Nature Biotech 1998; 16: 553.

32. Chen D-X, Gorczynski RM. Discrete MAbs define functionally important epitopes in the CD200 molecule responsible for immunosuppression function. Transplantation 2004: in press

33. Gorczynski RM, Bransom J, Cattral M, et al. Synergy in induction of increased renal allograft survival after portal vein infusion of dendritic cells transduced to express TGF beta and IL-10, along with administration of CHO cells expressing the regulatory molecule OX-2. Clin Immunol 2000; 95: 182.

34. Gorczynski RM, Chen Z, Clark DA, et al. Structural and functional heterogeneity in the CD200R family of immunoregulatory molecules at the feto-maternal interface. American Journal of Reproductive Immunology 2004; 52: 147

35. Corbel SY, Rossi FMV. Latest developments and in vivo use of the Tet system: ex vivo and in vivo delivery of tetracycline-regulated genes. Curr Opin Biotechnol 2002; 13: 448.

104

36. Urlinger S, Baron U, Thellmann M, Hasan MT, Bujard H, Hillen W. Exploring the sequence space for tetracycline-dependent transcriptional activators: Novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci USA 2000; 97: 7963.

37. Foster-Cuevas M, Wright GJ, Puklavec MJ, Brown MH, Barclay NA. Human herpesvirus 8 K14 protein mimics CD200 in down-regulating macrophage activation through CD200 receptor. J Virol 2004; 78: 7667.

38. Gorczynski RM, Lee L, Boudakov I. Augmented induction of CD4+CD25+ Treg using mAbs to CD200R. Transplantation 2005; 79:488-491

39. Vieites JM, delaTorre R, Ortega MA, et al. Characterization of human cd200 glycoprotein receptor gene located on chromosome 3q12-13. Gene 2003; 311: 99.

105

CHAPTER 3

LPS-induced murine abortions require C5 but not C3, and are prevented by upregulating expression of the

CD200 tolerance signaling molecule

Am. J. Reprod. Immuno. 60: 135-140

106

Rationale for studies in Chapter 3

The fetus has long been considered a “natural” allograft which is not rejected by its host. As

discussed earlier multiple mechanisms have been offered to explain this failure of rejection

including:

(i) immune privilege;

(ii) failure of trophoblast cells to express paternal MHC/HLA Class Ia and II antigen (1);

(iii) expression of nonclassical MHC/HLA-Ib and HLA-G by trophoblast cells, which

inhibits both CTL and NK cells (2-5), and facilitates the generation of CD4+CD25+ Treg

cells (6-8);

(iv) expression of inhibitory receptors by uterine NK cells (uNK)(9, 10);

(v) expression of indolamine 2,3-dioxygenase (IDO) by trophoblast cells, leading to

degradation of trypophan in maternal T cells (11-14).

Failure of expression (or functional blockade) of CD200 in the trophoblast has been

reported to produce rapid fetal loss in both human and murine (15, 16).

Infection, inflammation and stress also cause spontaneous and/or cytokine-boosted abortion.

Bacteria entering the uterus with ejaculate may provide a source of LPS, while intestinal absorption

may provide another important route. LPS is a prototypical endotoxin, binding the CD14/TLR4/M2

receptor complex leading to secretion of pro-inflammatory cytokines (such as TNF-α, IL-1, IFN-γ),

inflammation and subsequent fetal loss (Figure 1).

CD200 is expressed on human trophoblast isolated from term placenta (successful human

pregnancies) where it alters maternal immune responses in a favourable (Th2>Th1) direction (15).

107

LPS-triggered abortion

107

Figure 1

(+)

Inflammation/Abortion

Pro-inflammatory cytokines (IL-1, IL-6, IL-8, MBL, TNF-a, IFN-γ)

Activation of coagulation pathway (Mac-fgl2)

Activation of complement pathway

Blood clotting

C5a

PMNLs

thrombin

Macrophages/DCs

EC

-IL8

Adapted from Science.ngfu.de/dateien/NIE-S14T31_chakraborty.pdf

108

Using quantitative PCR and immunohistochemistry staining, CD200R1 expression on trophoblast

and other decidual cells has also been reported (17). Engagement of CD200R on plasmacytoid DCs

with a CD200:Fc fusion protein resulted in the induction of IDO activity which induced

immunoregulation (18). Administration of Poly I:C (polyinosinic-polycytidylic acid), a synthetic

double-stranded RNA capable of activating macrophages and NK cells via toll-like receptor 3

(TLR3), increased the embryo resorption rate, and reduced the percentage of CD200+CK7+cells

(cytokeratin7 is a trophoblast cell marker) at day 13.5 of gestation (19-21). Taken together these

data support the hypothesis that CD200 expression is important in regulation of both spontaneous

and induced fetal loss. This chapter describes studies to address this issue further by exploring LPS

induced fetal loss in pregnant CD200tg mice.

109

ABSTRACT

Lipopolysaccaride (LPS) acts via Toll like receptor 4 (TLR4) to promote Th1 cytokine

secretion and abortions. LPS is an essential co-factor in spontaneous abortion in F1 mice

(CBAxDBA/2) and in stress-triggered abortions. In (CBAxDBA/2) F1 mice, C3a, C5a, and

fibrinogen-like protein 2 (FGL2) participate in triggering inflammation that terminates embryo

viability. As LPS-driven abortions also require FGL2, and can generate C5a (via thrombin), it was

predicted that the abortion driven by LPS would be independent of C3. CD200:Fc can prevent

abortions in the CBAxDBA/2 model, but an action through Fc versus CD200 cannot be excluded.

C3-/- and C5-/- knock-out mice on a B6 background were syngeneically mated and Salmonella

enteritidis LPS was administered ip on day 6.5 of pregnancy along with 2 mg progesterone in

sesame oil sc. The total number of implants and number of resorbing embryos was counted on day

13.5 of pregnancy. CD200-rtTA2s-M2 double transgenic homozygous males mated to B6+/+ females

were similarly treated. To up-regulate CD200 expression in embryonic trophoblasts, doxycylcine

was added to the drinking water from the time of mating. LPS boosted the abortion rate from 15.2

% (control) to 42.0 % in C3-/- mice (χ2 9.28, P<0.005). In C5-/- mice, there was no increase in

abortion rate with LPS compared to progesterone-treated controls (22.8 % versus 26.3 %, P = NS).

LPS-treated transgenic mice given LPS plus progesterone had a 49 % abortion rate, but when the

mice were given doxycycline to induce expression of CD200, the abortion rate was only 6 % (χ2

13.68 P < 0.005, Fisher’s Exact Test P=0.00006). C5, but not C3 appears necessary for LPS-

driven abortions. Up-regulation of placental CD200 can prevent LPS-driven abortions, possibly by

altering dendritic cells to promote Treg cell development, or by an action on macrophages or mast

cells or γδT cells that also express CD200 receptors.

110

1. Introduction

Spontaneous abortions in the CBAxDBA/2 model are triggered by the pro-inflammatory

Th1 cytokines tumor necrosis factor (TNF)-α and interferon (IFN)-γ, but depend upon presence of

a Toll like receptor (TLR) ‘danger’ signal, such as bacterial lipopolysaccharide (LPS) (22). LPS

acts via TLR4 to up-regulate expression of receptors for IFN-γ and TNF-α (22). Post-implantation

stress can augment abortions, up-regulates Th1 cytokines, and may increase intestinal permeability

and absorption of LPS (22, 23). In mating combinations with low abortion rates, LPS can directly

up-regulate Th1 cytokines and cause abortions (24). The Th1 cytokines in turn up-regulate

expression of a prothrombinase, FGL2, and thrombin that is generated triggers local inflammation

with infiltration of polymorphonuclear leukocytes (PMNLs) (25, 26). In the CBAxDBA/2 model,

abortions can be countered as late as gestation day 9.5 by depletion of NK lineage cells that

produce Th1 cytokines, by depletion of PMNLs, or by administration of a soluble construct of the

CD200 tolerance signaling molecule (CD200:Fc) (27). This construct was made using an Fc

mutated to prevent binding of complement component C1 and to prevent binding to FcR1 (27). An

important role for CD200 has been further supported by augmentation of abortions following

injection of monoclonal anti-CD200 antibody (6). Further, protection against abortions by

immunotherapy with BALB/c splenocytes is blocked if the cells are treated with anti-CD200

antibody (29).

Recently, Girardi et al have suggested the immune system in DBA/2-mated CBA/J mice

activates complement soon after mating and prior to implantation (30). Antagonizing factor B (a

monocyte/macrophage-derived enhancer of complement activation), C3a, or C5a prevented

abortions. A link between complement activation and Th1 cytokine-driven macrophage activation

111

which up-regulates expression of membrane-bound FGL2 prothrombinase that leads to thrombin-

triggered inflammation has been provided by the finding that thrombin can directly generate C5a

from C5 (31). As LPS-driven abortions in non-abortion prone matings in strain 129 and C57Bl/6-

background mice requires the fgl2 gene (32, 33), we were interested in testing the hypothesis that

complement, specifically C5, was involved in these losses. We further wanted to test the role of

CD200. As the Fc on CD200:Fc may bind the inhibitory FcγRII receptor, we exploited a recently

developed transgenic mouse where CD200 expression could be induced (34, 35).

112


2.1. Mice

Homozygous breeding pairs of C3-/- mice on a B6 background (originally developed by

Colten et al) were kindly provided by Dr. HR Colten (36, 37).

B10.D2-H2dH2-T18cHco/o2Sn (C5-/-) male and female mice were obtained from the Jackson

Laboratories (Bar Harbor, ME).

Founder generation 14 and 15 TRE-mCD200-EGFP transgenic mice on a C57Bl/6

background and rtTA2S-M2 transgenic mice (B6 background) were produced at the Ontario Cancer

Institute animal facility at the University of Toronto (34, 35). Briefly, the cDNA vector (plasmid)

was linearized, diluted to 2 ng/ml in microinjection buffer, and injected into FVB fertilized oocytes

which were then implanted into the uteri of pseudopregnant FVB females. Progeny were genotyped

using transgene-specific primers. The positive progeny (founders) were backcrossed onto B6 mice

for 10 generations before use. The plasmid containing the rtTA2s-M2 gene (modified from 1106

down to 756 bp to remove irrelevant sequences that could be methylated or lead to splicing, and to

increase sensitivity to doxycycline) was a kind gift from Dr. AGH Bujar (University of Heidelbery,

Germany). The plasmid containing TRE2-mCD200-EGFP contained the TRE promoter inducible

by the activated rtTA2s-M2 gene. Dual heterozygote F1 (TRE-mCD200-EGFP x rtTA2s-M2) hybrid

mice were generated by incrossing the two transgenic strains. Mating of the F1 mice generated dual

homogeneous embryos with the genotype TRE-mCD200-EGFP + rtTA2s-M2. The rtTA2s-M2

transgene is turned on by tetracycline, specifically doxycycline, and the gene product activates the

TRE-mCD200-EGFP transgene. Both CD200 and the green fluorescent protein (EGFP) are then

expressed. The mice were housed in a barrier colony, with a 12 hour light-dark cycle in filter-top

cages and were given autoclaved mouse chow and water ad libitum.

113

2.2. Abortion model

Syngeneically mated mice were identified by a vaginal plug, and the day of sighting the

plug was denoted as day 0.5 of pregnancy. On day 6.5 of pregnancy, some of the mice were

injected intraperitoneally (ip) with 2 or 5 µg of LPS from Salmonella enteritidis (Sigma, St. Louis,

MO) (22). It has been suggested that one mechanism of abortion produced by ‘danger’ signals can

be suppression of ovarian hormone production, and these losses can be prevented by administration

of progesterone (38). Therefore, all LPS-injected mice also received 2 mg progesterone (Sigma) in

sesame oil subcutaneously (sc). On day 13.5 of pregnancy, the mice were sacrificed and the

number of healthy and resorbing implantation sites were counted. In experiments with the

transgenic embryos, some of the mice were given 1 mg/ml doxycycline in their drinking water

starting on the day of sighting the vaginal plug.

2.3. Statistics

The resorption rate was calculated from the number of resorptions divided by the total

number of implantations (R/T). The significance of differences between groups was determined

using χ2 with Yate’s correction, or, where abortion rates were < 6 % in one of the groups, by

Fisher’s Exact Test.

114

3. Results

3.1. Effect of LPS treatment in C3-/- x C3-/- mated mice

Table 1A shows the effect of LPS (with progesterone) treatment in C3-/- x C3-/- mated mice.

LPS boosted the abortion rate from 15.2 % (control) to 42.0 % (χ2 9.28, P < 0.005). In contrast,

Table 1B shows that LPS (with progesterone) treatment of C5-/- x C5-/- matings did not increase the

abortion rate compared to progesterone treatment alone (22.8 % compared to 26.3 %, P not

significant).

3.2. Effect of LPS (with progesterone) treatment of double transgenic mice of CD200

Table 2 shows the effect of LPS (with progesterone) treatment of double transgenic F1xF1

matings. In the control group, the abortion rate was 49 %, but when the mice were receiving

doxycyline to induce expression of CD200 in the embryo and its trophoblasts, the abortion rate was

only 6 % (χ2 13.68 P < 0.005, Fisher’s Exact Test P = 0.00006).

115

Table 1: Effect of genetic deletion of the C3 or C5 component of complement on LPS-induced

murine abortions

-----------------------------------------------------------------------------------------------------------------------

Group Mating Treatment Resorption rate Significance

--------- ------------------ ------------------------------ ---------------------- -----------

A C3-/- x C3-/- Nil 11/71(15.5%) ---

“ “ LPS1 + progesterone 21/50(42.0%) P < 0.005

B C5-/- x C5-/- progesterone 10/38(26.3%) ---

“ “ LPS2 + progesterone 13/57(22.8%) NS

-----------------------------------------------------------------------------------------------------------------------

Footnote:

1. Nine mice received 5 µg LPS and one had implantations at day 13.5 of pregnancy; 9 received 2 µg LPS and 5 had implantations.

2. Ten mice received 5 µg and 8 had implantations. In the progesterone-only control group, 6 mice received progesterone and 5 had implantations.

116

Table 2: Effect of up-regulation of CD200 on LPS-triggered abortions

-----------------------------------------------------------------------------------------------------------------------

Mating Doxycycline LPS + progesterone Abortions rate Significance

--------- ------------------ --------------------------- --------------------- ----------------------

B6 x B6 Yes Yes 17/35 (49%) ---

B6 x TG1 Yes Yes 2/34 (6%) P < 0.005

Footnote:

1. TG males were homozygous for both the TRE-mCD200-GFP and the rtTA2s-M2 transgenes so each embryo received 1 copy of each gene.

117

4. Discussion

The data in this paper show that the C3 component of complement is not required for LPS-

induced abortions. In contrast, in the absence of C5, LPS did not increase the abortion rate. In

double-transgenic male mice (rtTA2s-M2 CD200tg), up-regulation of CD200 in the embryos with

the doxycycline inducer abrogated LPS-triggered fetal losses. It has been previously shown that

fgl2-/- x fgl2-/- matings (mixed 129/B6 chimeric background, and on an inbred B6 background) are

resistant to pregnancy loss induced by LPS (32, 33). As CD200 antagonizes FGL2-dependent

abortions in the CBAxDBA/2 model and is expressed both by trophoblasts and by cells in maternal

deciduas (27), we deduced that increasing expression of CD200 on embryonic trophoblasts likely

reduced the abortion rate by antagonizing FGL2 through suppression of CD200R+ cell functions

(Figure 2). We do not know the exact mechanism by which increasing expression of CD200 by

trophoblasts prevented abortions. CD200 acting via CD200R2 can alter dendritic cells (present in

the uterine lining and elsewhere) to promote generation of regulatory T cells (39) that act very

early in pregnancy (40), possibly to prevent activation of complement (30), but in the

preimplantation stages of pregnancy, these Treg cells would have no contact with the embryonic

trophoblast, and in the syngeneic matings used in the present studies, there were no paternal

antigens foreign to the mother. CD200 can suppress mast cells that can produce abortogenic Th1

cytokines (41), and trophoblast CD200 would be in contact with maternal blood cells in the

developing placenta. Indeed, CD200 can achieve an inhibitory effect by binding to CD200

receptors on a variety of myeloid cells (including mast cells) and possibly even on NKT cells

and/or γδT cells (42). CD200 is also expressed by the placental trophoblasts in successful human

pregnancies, suggesting the data in this paper may apply to the human as well as the mouse (29).

118

Potential mechanism(s) of up-regulation of CD200 onLPS-triggered abortions

(+)

Inflammation/Abortion

Pro-inflammatory cytokines (IL-1, IL-6, IL-8, MBL, TNF-a, IFN-γ)

Activation of coagulation pathway (Mac-fgl2)

Activation of complement pathway

Blood clotting

C5a

PMNLs

thrombin

Macrophages/DCs

EC

-IL8

CD200(-)

Figure 2118Adapted from Science.ngfu.de/dateien/NIE-S14T31_chakraborty.pdf

119

The control abortion rate in the C5-/- mice was slightly higher than one might have expected,

but these mice proved to be poor breeders and it took several months to acquire enough matings.

The spontaneous abortion rate is known to rise as mice age, and a significant component of that

increase is thought to be an increased frequency of chromosomally abnormal embryos (43, 44).

In the CBAxDBA/2 model, factor B, C3a, and C5a are all required for the triggering or

abortions (30), whereas in the studies reported in this current paper, C3 was not required. While a

sufficient dose of LPS can directly cause abortions, the mechanism differs from what occurs in the

CBAxDBA/2 model where a maternal γδ NKT cell response against paternal antigen(s) results in

an initial up-regulation of TNF-α and IFN-γ that up-regulates FGL2 (45). Although complement

activation appears to begin much earlier than the γδ NKT cell response (30, 45), the latter is

essential for abortions (45), so it may be deduced that both complement activation and FGL2 are

required to initiate resorption. Both lead to activation of PMNLs (25, 46, 47). From the data in this

paper, it is clear that LPS in a sufficient dose can bypass the need for C3a (and factor B that

activates C3), most likely by augmenting the level of FGL2 activity beyond what occurs in

spontaneous losses in the CBAxDBA/2 model. It follows that the spontaneous loss in CBAxDBA/2

is not directly caused by LPS even though LPS is an essential facilitator acting via tlr4 to up-

regulate the receptors for the Th1 cytokines that increase expression of FGL2 and thrombin

required for pregnancy failure (22, 46, 47).

120

5. Reference 1. Hunt, J. S., G. K. Andrews, and G. W. Wood. 1987. Normal trophoblasts resist induction of class I HLA. J Immunol 138:2481-2487. 2. King, A., T. D. Burrows, S. E. Hiby, J. M. Bowen, S. Joseph, S. Verma, P. B. Lim, L. Gardner, P. Le Bouteiller, A. Ziegler, B. Uchanska-Ziegler, and Y. W. Loke. 2000. Surface expression of HLA-C antigen by human extravillous trophoblast. Placenta 21:376-387. 3. Kapasi, K., S. E. Albert, S. Yie, N. Zavazava, and C. L. Librach. 2000. HLA-G has a concentration-dependent effect on the generation of an allo-CTL response. Immunology 101:191-200. 4. Contini, P., M. Ghio, A. Poggi, G. Filaci, F. Indiveri, S. Ferrone, and F. Puppo. 2003. Soluble HLA-A,-B,-C and -G molecules induce apoptosis in T and NK CD8+ cells and inhibit cytotoxic T cell activity through CD8 ligation. Eur J Immunol 33:125-134. 5. Perez-Villar, J. J., I. Melero, F. Navarro, M. Carretero, T. Bellon, M. Llano, M. Colonna, D. E. Geraghty, and M. Lopez-Botet. 1997. The CD94/NKG2-A inhibitory receptor complex is involved in natural killer cell-mediated recognition of cells expressing HLA-G1. J Immunol 158:5736-5743. 6. Sasaki, Y., M. Sakai, S. Miyazaki, S. Higuma, A. Shiozaki, and S. Saito. 2004. Decidual and peripheral blood CD4+CD25+ regulatory T cells in early pregnancy subjects and spontaneous abortion cases. Mol Hum Reprod 10:347-353. 7. Zenclussen, A. C., K. Gerlof, M. L. Zenclussen, A. Sollwedel, A. Z. Bertoja, T. Ritter, K. Kotsch, J. Leber, and H. D. Volk. 2005. Abnormal T-cell reactivity against paternal antigens in spontaneous abortion: adoptive transfer of pregnancy-induced CD4+CD25+ T regulatory cells prevents fetal rejection in a murine abortion model. Am J Pathol 166:811- 822. 8. Chang, C. C., R. Ciubotariu, J. S. Manavalan, J. Yuan, A. I. Colovai, F. Piazza, S. Lederman, M. Colonna, R. Cortesini, R. Dalla-Favera, and N. Suciu-Foca. 2002. Tolerization of dendritic cells by T(S) cells: the crucial role of inhibitory receptors ILT3 and ILT4. Nat Immunol 3:237-243. 9. Guleria, I., and M. H. Sayegh. 2007. Maternal acceptance of the fetus: true human

tolerance. J Immunol 178:3345-3351. 10. Lopez-Botet, M., and T. Bellon. 1999. Natural killer cell activation and inhibition by receptors for MHC class I. Curr Opin Immunol 11:301-307. 11. Mellor, A. L., and D. H. Munn. 2000. Immunology at the maternal-fetal interface: lessons for T cell tolerance and suppression. Annu Rev Immunol 18:367-391. 12. Mellor, A. L., and D. H. Munn. 2004. IDO expression by dendritic cells: tolerance and tryptophan catabolism. Nat Rev Immunol 4:762-774. 13. Erlebacher, A. 2001. Why isn't the fetus rejected? Curr Opin Immunol 13:590-593. 14. Lob, S., A. Konigsrainer, D. Zieker, B. L. Brucher, H. G. Rammensee, G. Opelz, and P. T erness. 2009. IDO1 and IDO2 are expressed in human tumors: levo- but not dextro-1- methyl tryptophan inhibits tryptophan catabolism. Cancer Immunol Immunother 58:153- 157. 15. Clark, D. A., A. Keil, Z. Chen, U. Markert, J. Manuel, and R. M. Gorczynski. 2003. Placental trophoblast from successful human pregnancies expresses the tolerance signaling molecule, CD200 (OX-2). Am J Reprod Immunol 50:187-195.

121

16. Clark, D. A., G. Yu, G. A. Levy, and R. M. Gorczynski. 2001. Procoagulants in fetus rejection: the role of the OX-2 (CD200) tolerance signal. Semin Immunol 13:255-263. 17. Gorczynski, R. M., Z. Chen, D. A. Clark, Y. Kai, L. Lee, J. Nachman, S. Wong, and P. Marsden. 2004. Structural and functional heterogeneity in the CD200R family of immunoregulatory molecules and their expression at the feto-maternal interface. Am J Reprod Immunol 52:147-163. 18. Fallarino, F., C. Asselin-Paturel, C. Vacca, R. Bianchi, S. Gizzi, M. C. Fioretti, G. Trinchieri, U. Grohmann, and P. Puccetti. 2004. Murine plasmacytoid dendritic cells initiate the immunosuppressive pathway of tryptophan catabolism in response to CD200 receptor engagement. J Immunol 173:3748-3754. 19. de Fougerolles, A. R., and M. G. Baines. 1987. Modulation of the natural killer cell activity in pregnant mice alters the spontaneous abortion rate. J Reprod Immunol 11:147-153. 20. Cavanaugh, P. F., Jr., Y. K. Ho, and T. J. Bardos. 1996. The activation of murine macrophages and natural killer cells by the partially thiolated double stranded RNA poly(I)- mercapto poly(C). Res Commun Mol Pathol Pharmacol 91:131-147. 21. Devendra, D., and G. S. Eisenbarth. 2004. Interferon alpha--a potential link in the pathogenesis of viral-induced type 1 diabetes and autoimmunity. Clin Immunol 111:225- 233.

22. Clark DA, Manuel J, Lee L, Chaouat G, Gorczynski RM, Levy GA. 2004. Ecology of danger-dependent cytokine-boosted abortion in the CBA x DBA/2 mouse model. 1. Synergistic effect of LPS and (TNF-α + IFN-γ) on pregnancy loss. Am J Reprod Immunol 52:370-378. 23. Qiu BS, Vallance BA, Blenerhasset PA, Collins SM. 1999. The role of CD4+ lymphocytes in the susceptibility of mice to stress-induced reactivation of experimental colitis. Nature Med 5:1178-1182. 24. Clark DA, Yu G, Arck PC, Levy GA, Gorczynski RM. 2003. MD-1 is a critical part of the mechanism causing Th-1 cytokine-triggered murine fetal loss syndrome. Am J Reprod Immunol 49:297-307. 25. Clark DA, Chaouat G, Arck PC, Mittruecker HW, Levy GA. 1998. The Cutting Edge: Cytokine-dependent abortion in CBA X DBA/2 mice is mediated by the procoagulant FGL2 prothrombinase. J Immunol 160:545-549. 26. Clark DA, Ding JW, Chaouat G, Coulam CB, August C, Levy GA. 1999. The emerging role of immunoregulation of fibrinogen-related procoagulant fgl2 in the success or spontaneous abortion of early pregnancy in mice and humans. Am J Reprod Immunol 43:37-43. 27. Clark DA, Ding J, Yu G, Levy GA, Gorczynski RM. 2001. FGL2 prothrombinase expression in mouse trophoblast and decidua triggers abortion but may be countered by OX-2. Molec Human Reprod 7:185-194. 28. Zheng XX, Steele AW, Nickerson PW, Streurer W, Steiger J, Strom TB. 1995. Administration of a noncytolytic IL-10/Fc in murine models of lipopolysaccharide-induced septic shock and islet cell transplantation. J Immunol 154:5550-5600. 29. Clark DA, Chaouat G. 2005. Loss of surface CD200 on stored allogeneic leukocytes may impair antiabortive effect in vivo. Am J Reprod Immunol 53:13-20.

122

30. Girardi G, Yarilin D, Thurman JM, Hollers VM, Salmon JE. 2006. Complement activation induces Dysregulation of angiogenic factors and causes fetal rejection and growth restriction. J Exp Med 203:2165-2175. 31. Huber-Lang M, Sarma JV, Zetoune FS, Rittirsch D, Neff TA, McGuire SR, Lambris JD, Warner RK, Flieri MA, Hoesel LM, Gebhard F, Younger JG, Droun SM, Wetsel RA, Ward PA. 2006. Generation of C5a in the absence of C3: a new complement activation pathway. Mature Med 206:682-687. 32. Clark DA, Foerster K, Fung L, He W, Lee L, Mendicino M, Markert U, Gorczynski RM, Marsden PA, Levy GA. 2004. The FGL2 prothrombinase/fibroleukin gene is required for LPS-triggered abortions and for normal hemostasis during murine reproduction. Molec Human Reprod 10:99-108. 33. Foerster K, He W, Manuel J, Martczak A, Lu MF, Markert U, Levy GA, Clark DA. 2007. LPS-induced occult loss in mice requires FGL2. Am J Reprod Immunol 58:524-529. 34. Yu K. 2006. Development of a doxycyline-inducible, CD200 transgenic mouse, and preliminary characterization of altered immunological functions following doxycycline exposure. MSc Thesis, University of Toronto. 35. Yang S. 2007. Establishing a superior tetracycline-inducible gene expression system for mouse CD200, a potential therapeutic immunosuppressive model. MSc Thesis, University of Toronto. 36. Xu C, Mao D, Holers VM, Cheng PB, Molina H. 2000. A critical role for murine complement regulator crry in fetomaternal tolerance. Science 287:498-501. 37. Circolo A, Garnier G, Fukada W, Wang X, Hidvegi T, Szalai AJ, Briles DE, Volkanis JE, Westel RA, Colten HR. 1999. Genetic disruption of the murine complement C3 promotor region generates deficient mice with extrahepatic expression of C3 mRNA. Immunophamacol 42:135-149. 38. Erlenbacher A, Zhang D, Parlow AF, Glimcher LH. 2004. Ovarian insufficiency and early pregnancy loss induced by activation of the innate immune system. J Clin Invest 114:39-48. 39. Gorczynski RM, Lee L, Boudakov I. 2005. Augmented induction of CD4+ CD25+ Treg using monoclonal antibodies to CD200R. Transplantation 79:1180-1183. 40. Zenclussen AC, Gerlof K, Zenclussen ML, Sollwedel A, Bertoja AZ, Ritter T, Kotsch K, Leber J, Volk H-D. 2005. Abnormal T-cell reactivity against paternal antigens in spontaneous abortion: adoptive transfer of pregnancy-induced CD4+CD25+ regulatory cells prevents fetal rejection in a murine abortion model. Am J Pathol 166:811-822. 41. Cherwinski HM, Murphy CA, Joyce BL, Bigler ME, Song YS, Zurawski SM, Moshrefi MM, Gorman DM, Miller KL, Zhang S, Sedgwick JD, Phillips JH: 2005. The CD200 receptor is a novel and potent regulator of murine and human mast cell function. J Immunol 174:1348-1356. 42. Wright GJ, Cherwinski H, Foster-Cuevas M, Brooke G, Puklavec MJ, Bigler M, Song Y, Jenmalm M, Gorman D, McClanahan T, Liu M-R, Brown MH, Sedgewick JD, Phillips JH, Barclay N. 2003. Characterization of the CD200 receptor family in mice and humans and their interaction with CD200. J Immunol 171:3034-3046. 43. Eichenlab-Ritter U, Chandley R, Gosden RG.1988. The CBA mouse as a model for age- related aneuploidy in man. Studies of oocyte maturation, spindle formation, and chromosome alignment during meiosis. Chromosoma 96:220-226.

123

44. Basler A, Buselmaier R, Rohrborn G.1976. Elimination of spontaneous and chemically- induced chromosome aberration in mice during early embryogenesis. Human Genetics 33:121-130. 45. Arck PC, Ferrick DA, Steele-Norwood D, Croitoru K, Clark DA. 1997. Murine T cell determination of pregnancy outcome. I. Effects of strain, αβ T cell receptor, γδ T cell receptor, and γδ T cell subsets. Am J Reprod Immunol 37:492-502. 46. Clark DA. 2005. Altered fertility seen as a problem in immunoregulation. In Gorczynski RM (ed), Altered Immunoregulation and Human Disease, Research Signpost, Kerala, India, pp 353-367. 47. Clark DA. 2008. Immunologic factors in pregnancy wastage: fact or fiction. Am J Reprod Immunol 59: 277-300.

124

CHAPTER 4

CCR4 dependent migration of Foxp3+ regulatory T cell to skin grafts and draining lymph nodes in grafted

CD200tg mice is implicated in enhanced graft survival

125

Abstract

Transgenic expression of CD200 in ‘second generation’ CD200tg mice (rtTA2s-M2

CD200tg) significantly enhances skin allograft survival. Using a commercial focused microarray

kit (detecting genes implicated in T cell anergy/tolerance), we explored differential gene

expression in skin allografts to CD200tg and control mice at day 14 post transplantation.

Expression of Foxp3, GITR, CTLA-4 and CCR4 mRNA, all genes related to regulatory T cell

induction/function, was increased in CD200tg mice with prolonged graft survival, implying that

Foxp3+ regulatory T cells play an important role in graft survival afforded by transgenic

expression of CD200. Increased expression of Gata3, IL-4, IL-5, IL-13, and somewhat

surprisingly, of T-bet, IFN-γ and granzyme b, along with decreased expression of genes

encoding the signalling molecules Jak, fos, and Jun, as well as the inflammatory cytokines IL-1

and IL-6, indicated a complexity in the mechanism (s) potentially involved in the enhanced

graft-survival seen. That expression of Foxp3 and CCR4 was simultaneous up-regulated spurred

us to investigate a role for CCR4 in the recruitment of Foxp3+ regulatory T cells to target organs,

and the importance of this recruitment to the enhanced survival of grafted skin. Gene specific

quantitative real-time PCR and immunohistochemistry analysis provided confirmation of the

increase in Foxp3+ regulatory T cells in both the skin grafts and DLNs of CD200tg mice.

Blockade of expression of CCR4 using lentivirus-mediated shRNA treatment of Dox-treated

CD200tg mice diminished the localization of regulatory T cells in skin/DLN of recipients, and

reversed enhanced graft survival. These data suggest that enhanced CCR4 dependent migration

of Foxp3+ regulatory T cell populations to the graft tissue is an essential step in graft

prolongation offered by overexpression of CD200.

126

1. Introduction

Organ transplantation is a key therapeutic modality for patients with end-stage organ failure.

However its clinical success still critically depends on the long-term use of combinations of

immunosuppressive drugs, which results in numerous side-effects including drug toxicity;

increased susceptibility to opportunistic/secondary infection; and increased risk of malignancy

(1, 2). Chronic rejection remains an additional problem yet to be resolved (3).

Intense interest has been centred on the need to develop novel immunosuppressant agents

and/or regimens which can induce antigen specific immune tolerance without causing general

immune suppression. The identification and characterization of regulatory T cells that control

immune responses to self-antigens and non-self-antigens is a focus of contemporary research

(4-6). Blockade of accessory signals provided by a variety of costimulatory molecules has been

another route used to study regulation of effector T-cell function in organ transplantation. In

addition, other receptor:ligand molecules which can directly deliver suppressive signals

between APCs and antigen activated T cells have now been identified (7-9), including members

of the B7:CD28 family (B7-1/2:CTLA-4, PD-L1/2:PD1), and their use in regulation of graft

rejection is also under investigation (10). CD200 can directly deliver a regulatory signal to

CD200R+ cells. We have focused on the immune regulation exerted by CD200:CD200R

interaction as a method of regulating transplant rejection.

Both CD200 and CD200R are members of the immunoglobulin supergene family (11-13).

Their interaction plays an important role in regulation of spontaneous fetal loss (14, 15);

autoimmunity (11, 16); allergy (17, 18); cancer (19, 20); and renal/skin/intestine and cardiac

graft survival (21-25). In a recent report using a “second generation” CD200tg mouse line,

127

rtTA2s-M2CD200tg mice, with higher specific inducible CD200 transgenic expression, we

showed that transgenic expression of CD200 during the “induction phase” of graft tolerance

was necessary for prolonging graft survival (22). We also presented a preliminary analysis of

some changes in gene expression of grafts on day 14 post transplantation which occurred

concomitant with increased survival of grafts (22). However, changes of gene expression in

grafts at earlier stages post transplantation, and altered gene expression in the draining lymph

nodes (DLN) of grafted CD200tg mice were not previously investigated. No direct analysis of

the mechanisms involved in the enhanced survival of skin allografts in CD200tg mice exists.

In the studies described below, we use the same skin graft model (22) to explore differential

gene expression in both skin grafts and DLNs of CD200tg mice, and their potential role in

enhanced graft survival. These data confirmed the previously reported increased expression of

genes related with regulatory T cell induction/function, namely Foxp3, GITR, and CTLA-4 in

CD200tg recipients. In addition they highlight a role for altered expression of mRNA for a

chemokine receptor, CCR4, known to play a key role in migration of regulatory T cells (26-28),

and its ligands CCL22/17, in the enhanced skin graft survival induced by CD200tg expression.

128


2.1. Mice

Stock mice: C3H/HeJ (C3H-H2k), BALB/c (H2d) and C57BL/6 (BL/6-H2b) mice were

purchased from the Jackson laboratory (Bar Harbour, ME). Mice were housed 5/cage and

allowed food and water ad libitum. All mice were used at 8-12 weeks of age. All animal

experimentation was performed following guidelines of an accredited animal care committee

(Protocol No. AUP.1.6). Derivation and characterization of homozygous rtTA2s-M2 CD200tg

mice (on a C57BL/6-H2b background) was described elsewhere (22, 29). Mice receiving Dox in

their drinking water (1 µg/ml) for 7 days showed ubiquitous over-expression of CD200 (22, 25)

(see Table 1- later). In the experiments described below, both CD200tg and control BL/6 were

used as recipients of skin allografts. Mice in Dox-treated groups were given Dox-water (1

µg/ml) for 7 day before use.

2.2. Monoclonal antibodies

PE-labeled monoclonal antibodies (mAbs) to mouse CD11b, CD205, F4/80, CD45 and

CD3 were obtained from Pharmingen (San Diego, CA, USA). FITC-conjugated rat anti-mouse

CD200 antibody (MAC-1958) was obtained from Serotec (Raleigh, NC, USA). In addition,

custom large scale preparation of a previously described rat anti-mouse CD200 (10A5) was

performed by Cedarlane Labs (Hornby, Ontario, Canada). Monoclonal anti-mouse Foxp3

antibody (#14-5773) used for immunohistochemistry staining was purchased from eBioscience

(San Diego, CA, USA).

2.3. Flow cytometry

Flow cytometry was performed on a Cytomics instrument using Cytomeics software

129

(Beckman Coulter, Brea, CA, USA) as described previously (22). Briefly, splenic cell

suspensions were preincubated with anti-CD16/32 to block FcRs, then washed and incubated

with the indicated mAb conjugates for 30 min at 4°C in a final volume of 100 µl of PBS

containing 0.5% BSA and 2 mM EDTA. In all experiments, appropriate control

isotype-matched mAbs were included to determine the level of background staining.

2.4. Preparation of cells and cytotoxicity assays

Single cell spleen suspensions were prepared aseptically from pools of stock mice and after

centrifugation cells were resuspended in α-Minimal Essential Medium supplemented with

2-mercaptoethanol and 10% fetal bovine serum (αF10). In allogeneic mouse mixed leukocyte

cultures (MLC) used to assess proliferation and/or induction of CTL, 1.5x106 C57BL/6

responder cells were stimulated with equal numbers of irradiated (2,000 rads) C3H spleen

stimulator cells in triplicate in αF10. The triplicate cultures were pulsed with 1 µCi of 3H

thymidine (3H TdR)/well (Amersham) for 14 hrs at 72 hrs of culture, and subsequently collected

onto glass fiber filters (Millipore). 3H thymidine incorporation was quantified using a Beckman

scintillation counter (β-counting). Background controls with spleen cells or stimulator cells

alone were included in all experiments and were always <500 cpm. Results are expressed as the

mean cpm (±SD) of triplicate cultures. Where cytotoxicity was assayed, triplicate cultures

were harvested and pooled (replicate wells) at 5 days and titrated at different effector:target

ratios for killing (4hr at 37°C) of 51Cr-labeled 72hr-ConA activated C3H spleen target cells.

Release of 51Cr in supernatants was evaluated using a TopCount γ-counter. Percent lysis was

calculated as: (Test 51Cr release –51Spontaneous Cr release) / (Maximum 51Cr release –

Spontaneous 51Cr release) x 100.

130

2.5. Skin grafts in mice and graft survival study

Groups of C57BL/6 controls or rtTA2s-M2 CD200tg mice received 1 cm2 allogeneic (C3H or

BALB/c) tail skin grafts on the shaved dermis as described elsewhere (22). All recipients

received low-dose rapamycin (0.5 mg/kg – Wyeth, D/N: 02243237), at 36 hr intervals for 12

days post transplantation – a dose without significant effect on the function of Treg (30) or cell

subset distribution (22). Groups of control C57BL/6 mice and rtTA2s-M2 CD200tg received

either doxycycline (Dox, 1 µg/ml) in the water supply or plain drinking water. Graft survival

was followed daily by an investigator blinded to the different groups. Rejection was recorded

by percent of total graft area, and when < 20% of the graft remained, it was considered rejected

(Current Protocols in Immunology 4.4.1-2). Artificial lesions, e.g. by the suture or suture

material, or exogenous trauma was excluded for evaluation (31).

2.6. Histology and immunohistochemistry staining

Grafted skins and DLNs from different groups were collected at different times post

transplantation. Aliquots of tissues were fixed for subsequent histological analysis and

immunohistochemistry staining, or were placed directly into liquid nitrogen (snap-frozen) for

isolation of total RNA. All tissue blocks were sized (2-3 mm thick) before placing into buffered

formalin to facilitate good penetration. Tissue blocks were fixed in 20x volume 10% neutral

buffered formalin for at least 24 hrs, and then transferred into 70% ethanol before loading into a

tissue processor. The same tissue blocks used for haematoxylin eosin (H&E) stain were also

used for immunohistochemistry staining for Foxp3 expression (overnight incubation at 4°C

with 1:100 diluted rat anti-mouse Foxp3 monoclonal antibody, eBioscience, #14-5773).

2.7. Focused micro-array analysis

131

Microarray analysis was performed on total RNA isolated from snap-frozen tissues

harvested from transplanted mice. Total RNA was isolated using Trizol reagent (Invitrogen;

#661618), and purified using an RNeasy Mini Kit (Qiagen; #74104) before performing reverse

trancription. To remove contaminating genomic DNA, a high efficiency cDNA synthesis kit

(SuperArray RT First Strand cDNA Synthesis Kit, SABioscience # C-03, in which a genomic

DNA eliminating reagent is included) was used to produce cDNA from 3 µg of purified RNA.

Commercial micro-array plates of 384 wells pre-loaded with a total of 84 pairs of primers

focused on T cell anergy and tolerance were purchased from SABioscience (RT2 Profile PCR

Array #PAMM-074G) and used for characterization/comparison of the gene expression profiles

in different groups. The experimental cocktail (1,100 ul), including 102 µl of 6 x diluted cDNA,

550 µl of 2 x SuperArray Master Mix (#PA-010-12) (SABioscience, Frederick, MD, USA), and

448 µl dH2O, was loaded onto each plate using a loading robot (BeckMan Coulture, Brea, CA,

USA). Loaded plates were then run on a Roche LightCycler 480 384-well Block. Results were

analyzed using software provided on-line in the manufacture’s website:

http://www.sabiosciences.com/pcr/arrayanalysis.php. Controls for negative genomic DNA

contamination, reverse transcription efficiency, and PCR reaction efficiency were included in

each analysis.

2.8. Realtime PCR

The methodology for realtime PCR was described elsewhere (30). In brief, total RNA from

snap-frozen skin grafts and DLNs harvested from different groups was isolated using Trizol

(Invitrogen) as per the manufacture’s instructions. RNA was resuspended in RNase-free water

and treated with DNase 1 (RNase-free; Invitrogen Life Technologies) to remove any

132

contaminating genomic DNA. Before reverse transcription (RT), DNase 1 in all samples was

inactivated by addition of EDTA followed by incubation at 65°C for 10 min or direct incubation

at 90°C for 10 min. First strand cDNA was synthesized from 3 µg of total RNA using a First

Strand Synthesis Kit (GE, USA). Target cDNA was diluted 1:10 and quantified using an ABI

7900HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA) with SYBR

green methodology.� The fold change (or relative quantity) of gene expression between groups

was calculated using the ∆∆Ct method or the relative quantity method. The primers for the

different genes used in the experiments described were as follows:

Murine Foxp3 Forward Primer, 5’-AGTCTGCAAGTGGCCTGGTT-3’

Murine Foxp3 Reverse Primer, 5’-GGGCCTTGCCTTTCTCATC-3’

Murine CCR-4 Forward Primer, 5’-AGACTGTCCTCAGGATCACTTTCA-3’

Murine CCR-4 Reverse primer, 5’-CCGGGTACCAGCAGGAGAA-3’

Murine CCL-17 Forward Primer, 5’-ATGCCATCGTGTTTCTGACTGT-3’

Murine CCR-17 Reverse Primer, 5’-GCCTTGGGTTTTTCACCAATC-3’

Murine CCL-22 Forward Primer, 5’-AAGCCTGGCGTTGTTTTGAT-3’

Murine CCL-22 Reverse Primer, 5’-TCCCTAGGACAGTTTATGGAGTAGCT-3’

Murine HPRT Forward Primer, 5’-CAAGCTTGCTGGTGAAAAGGA-3’

Murine HPRT Reverse Primer, 5’-TGAAGTACTCATTATAGTCAAGGGCATATC-3’

2.9. Blockade of CCR4 expression using modified lentivirus mediated gene specific shRNA

Four CCR4-shRNA bacterial glycerol stocks (#26085, #26109, #26118, and #26128), along

with a negative control shRNA glycerol stock (SHC002), were purchased from Sigma-Aldrich

(St. Louis, MO, USA). Each stock contains an independent shRNA construct, which was cloned

133

into a shRNA expression vector pLKO.1 under control of u6 promoter.

2.9.1. Purification of plasmids (vector pLOK.1) containing the shRNA constructs from

bacterial glycerol stocks

The 5 shRNA glycerol stocks were separately streaked onto freshly prepared LB plates with

appropriate antibiotics (Amp/puromycin) to obtain cloned cell lines (single bacterial colony).

Single bacterial colonies from different stocks were grown in 3 ml of LB with appropriate dose

of Amp for 6-8 hr at 250 rpm as ‘seeds’. The ‘seeds’ were then separately transferred into a

flask with 250 ml of fresh LB to grow for a further16-18 hr. The plasmids (vector pLKO.1)

containing CCR4-shRNA constructs and the negative control were isolated from the cultures

using an EndoFree Plasmid Maxi Purification Kit (Qiagen) as per manufacturer’s instruction.

2.9.2. Selection of the shRNA construct with the best efficiency of blockade

A cell line (CHO-k) with constitutive expression of CCR4 was selected as a positive control

for examination of the blocking efficiency of the shRNA constructs (see Figure 10).

The 5 purified plasmids were transfected separately into CHO-k cells using lipofectamine

2000 (Invitrogen) and/or CaCl2 to examine if they could block CCR4 expression in vitro. The

efficiency of blockade was quantified by realtime PCR at 48/72 hr after transfection. The

plasmid with the best efficiency of blockade was selected.

2.9.3. Production (packaging) of CCR4 or control shRNA lentivirus

CCR4-shRNA lentivirus was produced by co-transfection (CaCl2 method) of the selected

plasmid with the best supression efficiency or the control plasmid, along with a packaging

vector (psPAX2 #12260) and an envelop vector (pMD2.G #12259), into HEK 293 cells

(GeneHunter #Q401).

134

A total of 10 µg of the selected blocking/control plasmid, along with 7.5 µg of packaging

vector and 3 µg of envelope vector, was mixed with 25 µl of 2 mM CaCl2 totalling 200 µl was

added to each well of a 6 well plate with 70% confluence of HEK 293 cells cultured in 3 ml of

medium (DMEM Invitrogen: 11960-044). After 16/24 hr incubation, the transfection medium

was replaced by 3 ml of fresh medium. Supernatants collected at 48 and 72 hr post transfection

contained the CCR4-/control shRNA lentiviruses.

2.9.4. Confirmation of CCR4 shRNA lentivirus function in vitro

To confirm that the shRNA lentiviruses contained in the supernatants possessed functional

activity, 0.1 ml, 0.2 ml and 0.4 ml of the lentiviral supernatants were added to CHO-k cells.

After 24 hr of incubation, the infected CHO-k cells were incubated with puromycin (8 µg/ml) at

37°C for a further 48/72 hr. Total RNA was isolated from the CHO-k cells, and reverse

transcribed into cDNAs as templates for CCR4 gene specific realtime PCR analysis.

2.9.5. Titration of CCR4 and control-shRNA lentiviral stocks using a standard ELISA

The lenti-X p24 ELISA Titer Kit (Zepto Metrix; # 0801111) was applied to titrate the

CCR4/control-shRNA lentiviral stock. The wells of the microtiter plate were coated with an

anti-lentivirus p24 (an abundant lentivirus core/capsid protein) capture antibody, which

quantitatively binds the lentivirus p24 protein in the test CCR4 shRNA lentiviral stock.

Supernatants were collected at 48 and 72 hr after puromycin selection and filtered through a

0.45 µm filter to remove any HEK293 packaging cells. Specifically-bound p24 was detected in

a typical “sandwich” ELISA format using a biotinylated anti-p24 secondary antibody, a

streptavidin-HRP conjugate, and a color producing substrate. Color intensity was measured

spectrophotometrically to quantitate the level of p24 in the filtered supernatants using a p24

135

standard curve. P24 values were correlated with the virus titer of the filtered supernatants (1 pg

of p24 = 30 (10 to 100) transducing units (Tu) of lentivirus).

2.9.6. Concentration of CCR4 and control-shRNA lentivirus

The shRNA lentivirus containing supernatants were concentrated to a 45:1 ratio. 45 ml

aliquots of supernatant were collected from 48/72hr cultures and filtered (0.45 µm filter) into a

50 ml fresh centrifuge tube. Tubes were spun at 50,000g for 90 min at 4°C in a JA-20 Beckman

ultra centrifuge. Media was aspirated carefully and the pellet resuspended in 1 ml of fresh

media. Aliquots of shRNA lentivirus (either CCR4 or the control) were pooled and titrated, and

aliquots of concentrated supernatants frozen at -80°C for later use.

2.9.7. Use of CCR4 shRNA lentivirus in vivo

A total of 800 µl of concentrated CCR4 shRNA lentiviruses (200 µl/injection x 4

injections/mouse), as well as the same dose of negative control, were administered via the tail

vein on day -3, day 0, day +3 and day +6 post grafting in an attempt to block Foxp3+ Treg cell

migration to target organs in skin grafted mice. mRNAs from the grafted skin and DLNs were

used to evaluate the efficiency of the blockade using realtime PCR. The effect of shRNAs on

recruitment of Foxp3+ Treg and graft survival in Dox-treated rtTA2s-M2 CD200tg mice was

examined by realtime PCR, histological analysis and graft survival.

2.10. Statistics

Comparison between groups was performed using one-way ANOVAs. Differential

expression of genes between two groups used a non-parametric test Mann-Whitney U-test, or

student t-test. P values of 0.05 or less were considered significant.

136

3. Results

3.1. Increased skin allograft survival in Dox-treated rtTA2s-M2 CD200tg mice

Data in Table 1 confirm that in homozygous rtTA2s-M2 CD200tg mice, exposure to Dox

causes increased expression of CD200 across multiple cell subsets. As shown in previous

publications (22), skin allografts to CD200tg mice receiving Dox in the drinking supply survived

significantly longer than allografts to wild type BL/6 or CD200tg mice without Dox-treatment

(Figure 1). Histological analysis (H&E stain) confirmed that grafted skins at day 14 post

transplantation in Dox-treated rtTA2s-M2 CD200tg mice maintained an intact tissue structure

with clear cellular strata and less infiltration of leukocytes, compared with grafts of control

groups (Figure 2).

3.2. Increased skin allograft survival in rtTA2s-M2 CD200tg mice is associated with reduced

donor-specific alloimmunity

Spleen cells from mice described in Figure 1 were assessed at day 14 post transplant for

responses to irradiated (2,000 rads) donor-specific (C3H) or third party (BALB/c) spleen cells

in vitro (analyzing proliferation at 72 hr or CTL induced at day 5 of culture). Both

donor-antigen-specific proliferation and induction of CTL in the group with prolonged survival

were inhibited (Figures 3 and 4) with persistence of responses to a third party antigens,

confirming earlier reports (22, 25).

3.3. Differential gene expression in tissues harvested from control and CD200tg mice with

allogeneic grafts

In an earlier study, we reported preliminary investigation of differential gene expression in

both vascular and non-vascular tissue allografts transplanted into Dox-treated CD200tg mice or

137

Table 1: Widespread over-expression of CD200-transgenic in rtTA2s-M2 CD200tg mice receiving Dox

----------------------------------------------------------------------------------------------------------------------------------

MAb in FACS Control rtTA2s-M2 CD200tg Control rtTA2s-M2 CD200tg

%positive (%CD200+) – no Dox %positive (%CD200+) + Dox

-------------------------------------------------------------------------------------------------------------------

Anti-CD45 44+5.9 (11) 48+5.6 (10) 46+5.4 (12) 44+6.0 (38)*

Anti-CD11b 8.1+2.6 (25) 8.0+3.0 (22) 8.4+2.8 (27) 9.0+2.8 (91)*

F4/80 7.0+1.9 (30) 7.4+2.2 (26) 7.3+2.2 (28) 7.7+2.6 (88)*

Anti-CD205 5.2+1.7 (44) 5.3+2.1 (49) 5.6+2.0 (49) 4.9+2.3 (92)*

Anti-CD3 27+2.9 (4.2) 25+3.0 (4.6) 27+3.8 (4.3) 26+3.4 (33)*

Anti-CD200 13.2+2.8 12.5+2.8 12.9+2.5 52+6.8*

-------------------------------------------------------------------------------------------------------------------

Footnotes:

Splenic cells were stained using commercial PE-mAbs and FITC anti-CD200 as described in Materials and

Methods. All data represent arithmetic mean (+SD) for triplicate measurements from 3 control or transgenic

mice/group. Where shown mice received DOX in the drinking supply for 7 days before sacrifice. Data in parentheses

indicates % dual stained cells (i.e. %CD200+ in the subset)

* p<0.05 compared with no DOX controls

138

10 15 20 250

25

50

75

100

ControlControl+DoxrtTA2s -M 2 CD200tg

rtTA2s -M 2 CD200tg+Dox

40 80

*

Days post skin transplantation

% s

urvi

val in

gro

upSkin allograft survival in C57BL/6 and rtTA2s-M2CD200tg

mice with/without Dox

Figure 1138

139

Legend to Figure 1: Skin allograft survival in C57BL/6 and CD200tg mice with/without

Dox

Groups of 8 C57BL/6 control or rtTA2s-M2 CD200tg mice received 1 cm2 allogeneic (C3H)

tail skin grafts on the shaved dermis, low-dose rapamycin (0.5 mg/Kg) at 36 hr intervals for 12

days post transplantation, and either doxycycline (Dox, 1ug/ml) in the water supply or plain

drinking water. Graft survival was followed daily by an investigator blinded to the different

groups. Rejection was recorded by percent of total graft area, and when < 20% of the graft

remained, it was considered rejected (Current Protocols in Immunology 4.4.1-2).

* P<0.05, compared with all other groups, One-way ANOVA.

140

140

CD200tg mice no-Dox (400x) CD200tg mice + Dox (400x)

Figure 2

Histology of skin grafts from Dox-treated CD200tg or control mice at day 14 post grafting

141

Legend to Figure 2: Histology of skin grafts from Dox-treated CD200tg or control mice at

day 14 post grafting

Groups of C57BL/6 control or rtTA2s-M2 CD200tg mice received 1 cm2 allogeneic (C3H)



drinking water. Skin grafts from different groups were harvested at day 14 post transplantation.

Fixation was performed immediately after harvest to avoid autolysis. Tissue blocks were fixed

and stained (H&E stain) as described in Methods and Materials.

142

Day 7 Day 140

500

1000

1500

2000

2500

3000

3500

4000

4500No Dox: C3H

Dox: C3H

No Dox: BALB/c

Dox: BALB/c

Days post skin grafting

3HT

dR

in

corp

ora

tio

n

Figure 3

Donor-specific inhibition of proliferation in splenocytes taken from transgenic mice with surviving C3H allografts

142

* *

*P<0.05

143

Legend to Figure 3: Donor-specific inhibition of proliferation in slenocytes taken from

transgenic mice with surviving C3H allografts




drinking water. Grafted mice in different groups were sacrificed at either day 7 or day 14 post

grafting. Spleen cells from those mice were assessed for proliferation in response to stimulation

with irradiated (2000 rads) donor-specific (C3H) or third party (Balb/c) spleen cells in vitro.

Data show arithmetic mean (±SD) of triplicate cultures.

*P<0.05, compared with all other groups of same day of harvest.

144

Day 7 Day 140

5

10

15

20

25

30

35

40

45No Dox: C3H

Dox: C3H

No Dox: BALB/c

Dox: BALB/c

Days post skin grafing

% s

pec

ific

lys

is

Figure 4

Donor-specific inhibition of CTL induction in splenocytes taken from transgenic mice with surviving C3H allografts

144

* *

*P<0.05

145

Legend to Figure 4: Donor-specific inhibition of CTL induction in splenocytes taken from

transgenic mice with surviving C3H allografts




drinking water. CTL responses were assayed from cultures described in Figure 3. Cells from

triplicate wells were harvested and pooled at 5 days, and titrated at different effector:target

ratios for killing (4 hr at 37°C) of 51Cr-labeled 72 hr-ConA activated C3H spleen target cells.

The results shown in the figure are for effector:target ratios of 100:1.

*P<0.05, compared with all other groups of same day of harvest.

146

control mice (22). No data were reported on gene expression in lymph nodes draining the grafts

(DLN); and no detailed exploration of potential mechanism(s) responsible for the enhanced

survival was performed. We next explored differential gene expression in tissue (skin/DLN)

harvested from grafted Dox-treated CD200tg mice or control mice at day 14 post transplantation,

using a commercial microarray kit focusing on genes implicated in T cell anergy/tolerance.

Genes showing reproducibly altered expression (over or under expression ≥ 2-fold,

comparing Dox-treated CD200tg with control mice:4 mice/group) are listed in Table 2. Elevated

expression of type-1 and type-2 cytokines (T-bet, Gata-1, IL-4, IL-5, IL-13 and IFN-γ),

costimulatory and inhibitory genes (41-BB, Icos and PD-1) was seen. In addition, we observed

diminished expression of IL-1, IL-6, ICAM-1, Light, OX40, JAK-1, Fos and Jun (Figure 5). In

terms of understanding the potential mechanism(s) involved in increased graft survival, we

noted, in addition to enhanced expression of genes associated with Treg populations (Foxp3,

GITR, CTLA-4 and IL-10), a significantly enhanced expression of a chemokine receptor CCR4

(Figure 5), reported to play a key role in attraction of regulatory T cell populations to

transplanted organs and/or secondary lymph organs (26, 28).

3.4. Gene specific realtime PCR confirmation of increased expression of mRNAs for Foxp3

and CCR4 as well as its ligands CCL-17/22 in both grafted skins and DLNs from

Dox-treated rtTA2s-M2 CD200tg recipients

We obtained skin grafts and DLNs from both day 7 and day 14 transplanted recipients and

performed gene-specific quantitative real-time PCR analysis using primers for Foxp 3, CCR4

and the ligands for CCR4, CCL-17/CCL-22. Results from this gene-specific real-time PCR

analysis provided supporting evidence confirming the microarray analysis, with enhanced

147

Table 2: Comparison of gene expression (focused microarray) in skin grafts from

Dox-treated rtTA2s-M2CD200tg mice compared to controls

Footnote:

Skin grafts were harvested at day 14 post transplantation (4 donors/groups) from Dox-treated CD200tg and control

mice. cDNAs were prepared and analyzed using a focused microarray kit as described in the Materials and Methods.

Genes showing reproducibly altered expression (over or under expression ≥ 2x in Dox-treated CD200tg vs control mice)

are listed (MEAN±SD).

Up-regulationUp-regulationUp-regulationUp-regulation Down-regultionDown-regultionDown-regultionDown-regultion Up-regulationUp-regulationUp-regulationUp-regulation Down-regulationDown-regulationDown-regulationDown-regulation

Ccl3 2.89±0.90 IL-4 6.96±5.34Ccr4 4.87±1.90 IL-5 2.91±1.07CD28 2.98±1.80 IL-6 0.21±0.14CD40 2.98±0.65 Ing4 3.90±0.74CD70 13.92±19.66 Itch 3.08±0.91Cdk2 0.12±0.04 Itga1 2.66±1.33

Cma1 0.12±0.04 Jak1 0.07±0.04Csf1 0.38±0.16 Jak3 0.34±0.45Ctla4 2.21±0.75 Lep 0.27±0.10

Dgka 4.47±2.10 Mef2a 0.24±0.07Dgkz 2.44±0.46 Nfntc2 5.67±3.86Egr2 0.18±0.38 Notch 0.31±0.04Fos 0.2±0.19 Pdcd1 (PD-1) 3.22±1.57

Foxp3 2.21±0.48 Prkcc 15.61±12.22Gata3 2.26±1.17 Ptgs2 0.16±0.03Hdac9 2.21±0.75 Rnf128 0.28±0.27Icam1 0.04±0.05 Stat6 0.16±0.15Icos 3.16±1.50 Tgf-beta 0.23±0.10Ifng 6.08±3.51 Tnfrsf14(HVEM) 2.49±1.31IL-10 3.29±1.93 Tnfrsf18(GITR) 3.13±0.99IL-13 20.52±24.24 Tnfrsf4(OX40) 0.14±0.10IL-15 3.38±1.55 Tnfrsf9(4-1BB) 5.20±2.36

IL-1a 0.17±0.04 Tnfsf10(Trail) 0.41±0.07IL-2 2.21±1.01 Tnfsf14(Light) 0.2±0.07

GenesGenesGenesGenes

Fold changes (Day 14)Fold changes (Day 14)Fold changes (Day 14)Fold changes (Day 14)

GenesGenesGenesGenes

Fold changes (Day 14)Fold changes (Day 14)Fold changes (Day 14)Fold changes (Day 14)

148

Altered mRNA expression in skin grafts in CD200tg vs control mice at day 14 post transplantation

Gat

a3

T-b

et

INF

-r

IL-4

IL-5

IL-1

3

Ico

s

4-1B

B

PD

-1

Fo

xp3

CT

LA

-4

GIT

R

IL-1

0

CC

R4

TG

Fb

IL-1 IL6

Lig

ht

OX

-40

Icam Ja

k

Jun

Fo

s

-30-27-24-21-18-15-12

-9-6-30369

1 21 51 82 12 42 73 0

G enes

Fol

d ch

ange

s in

mR

NA

148

Figure 5

149

Legend to Figure 5: Altered mRNA expression in skin grafts in CD200tg vs control mice at

day 14 post transplantation




drinking water. Skin grafts were harvest at day 14 post transplantation (4 donors/group) from

mice in all groups. Focused microarray analysis was performed as described in the Materials

and Methods and Table 2.

150

expression of Foxp3, CCR4 and CCL-17/22 in both skin and DLNs from Dox-treated

rtTA2s-M2 CD200tg recipients. Figures 6(a) and 6(b) show the results at day 7 post grafting, and

Figures 7(a) and 7(b) showed the results at day 14 post grafting.

3.5. Immunohistochemistry staining by anti-Foxp3 monoclonal antibody provides

additional evidence for an increase of Foxp3+ cell in both skin grafts and DLN from

Dox-treated CD200tg mice

Increased Foxp3+ cells in tissue from both skin grafts (Figure 8(a)) and draining lymph

nodes (Figure 8(b)) were also observed using anti-Foxp3 antibody immunohistochemistry

staining in Dox-treated CD200tg mice. Foxp3+ cells in a total of 20 high power fields of draining

lymph nodes for each group (4 mice/group) were enumerated, showing a 3x increase of Foxp3+

cells in CD200tg mice compared to control groups (Figure 9).

3.6. Production of CCR4 shRNA lentivirus

As “proof-of-principle” of the proposed role for CCR4 in the enhanced recruitment of

Foxp3+ regulatory T cells to skin grafts and DLNs of CD200tg mice blockade of expression of

CCR4 was explored, using shRNA-mediated suppression. Small interfering RNAs (siRNAs)

processed from short hairpin RNA (shRNA) constructs directed to CCR4 were purchased from

Sigma, along with negative control shRNA constructs, each independently cloned into the

shRNA expression vector pLKO.1.

To determine which CCR4-shRNA construct gave optimal suppression of CCR4 mRNA, 4

different CCR4-shRNA constructs and a control shRNA construct were independently

transfected into CHO-k cell line which constitutively expresses CCR4 (Figure 10) and was used

as a control. Data in Figure 11 are from studies comparing the different CCR4-shRNA

151

Realtime PCR confirmation of altered mRNA expression of key molecules in tissues of CD200tg (vs control) transplanted mice at day 7 post transplantation

Figure 6

Foxp3 CCR4 CCL-17 CCL-220

1

2

3

4

55

10

15

20

25

30

Genes

Fol

d ch

ange

in m

RN

A


1

2

3

4

5

Genes

Fol

d ch

ange

s in

mR

NA

(a): Skin (b): DLNs

*

*P<0.05

*

*

**

*

*

*P<0.05

151

152

Legend to Figure 6: Realtime PCR confirmation of altered mRNA expression of key

molecules in tissues of CD200tg (vs control) transplanted mice at day 7 post

transplantation




drinking water. Gene-specific real-time PCR analysis of genes identified using focused

microarray (Fig.5) in skin graft tissue (6a) and DLNs (6b) (5mice/group). The fold change on

the ordinate show the differential expression in Dox-treated CD200tg mice vs control grafted

mice at day 7 post transplantation.

* P<0.05, Mann-Whitney U-test.

153

Realtime PCR confirmation of altered mRNA expression of key molecules in tissues of CD200tg (vs control) transplanted mice at day 14 post transplantation

Figure 7


1

2

3

4

55

10

15

20

Genes

Fol

d ch

ange

s in

mR

NA

*P<0.05

*

*

*


1

2

3

4

55

15

25

Genes

Fol

d ch

ange

in m

RN

A

*P<0.05

*

**

*

(a): Skin (b): DLNs

153

154

Legend to Figure 7: Realtime PCR confirmation of altered mRNA expression of key

molecules in tissues of CD200tg (vs control) transplanted mice at day 14 post

transplantation




drinking water. As per Figure 6, using tissues (grafted skins and DLNs from 5 mice/each group)

harvested at day 14 from transplanted mice.

* P<0.05, Mann-Whitney U-test.

155

Foxp3+ stained cells in tissues of CD200tg (vs control) grafted mice (day 14 post skin graft)

(b): DLN from CD200tg mice (no Dox, 400x) DLN from CD200tg mice (+ Dox, 400x)

(a): Skin graft from CD200tg mice (no Doc, 400x ) Skin graft from CD200tg mice (+ Dox, 400x)

155Figure 8

156

Legend to Figure 8: Foxp3+ stained cells in tissues of CD200tg (vs control) grafted mice

(day 14 post skin graft)




drinking water. Skin grafts and DLNs from mice in different groups were collected at day 14

post transplantation, and processed and stained with the monoclonal antibody for foxp3 (see

Materials and Methods for details). Foxp3+ cells are shown in brown - all pictures shown are in

400x magnification.

157

Figure 9

Quantitative analysis of increase in Foxp3+ cells in DLN of grafted mice from Fig. 8b

157

0102030405060708090

100110120130140

CD200tg no DoxCD200tg + Dox

Mice

Nu

mb

er o

f fo

xp3+

cel

ls

*

*P<0.05

158

Legend to Figure 9: Quantitative analysis of increase in Foxp3+ cells in DLN of grafted

mice from Fig. 8b

Quantification of Foxp3+ cells in DLN from Dox-treated CD200tg vs control mice (see

Fig.8b). Data represent arithmetic means (+SD) from 20 high power fields of view (HPF), 5

HPF/mouse, with 4 mice/group.

* P<0.05, compared to control (CD200tg no Dox).

159

Figure 10

CHO DC2.4 Raw J5580.00.51.01.52.02.53.03.54.04.55.05.5

Cell lines

Fo

ld c

han

ges

in

mR

NA

Comparison of expression of CCR4 in different cell lines(realtime PCR)

159

*

*

*

*P<0.05

160

Legend to Figure 10: Comparison of expression of CCR4 in different cell lines

(realtime PCR)

Constitutive expression of CCR4 in different cell lines was analyzed by real-time PCR.

Fold changes in mRNA expression were calculated based on the cell line (Raw cell) with the

lowest expression (arbitrarily scored as 1).

* P<0.05, compared to control (Raw cells).

161

Blockade of expression of CCR4 in CHO-K cells by transfection of shRNA plasmids (48/72hr)

161

1 2 3 40.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0

1.1CHO-K only

Control shRNA/CHO-K only

CCR4 shRNA/CHO-K only

CCR4 shRNA/Control shRNA

shRNA plasmids (48hr post transfection)

Fold

cha

nges

in m

RN

A

Figure 11

c-shRNA s-shRNA0.00

0.25

0.50

0.75

1.00c-shRNAs-shRNA

shRNA plasmids (72hr post transfection)F

old

cha

nge

in m

RN

A

Figure 11 Figure 11 (inset)

* *

*

*P<0.05

162

Legend to Figure 11: Blockade of expression of CCR4 in CHO-K cells by transfection of

shRNA plasmids (48/72 hr)

Comparison of the ability of different CCR4 shRNAs to suppress CCR4 mRNA expression

in CHO cells. Plasmids (pLKO.1) with different CCR4 shRNA constructs were separately

transfected into CHO-k cells. Suppression was evaluated 48/72 hr post transfection. Clone 1

(#26085) in Figure 11 showed optimal efficiency for suppression, and was chosen for further

studies of suppression at 72 hr post transfection. Figure 11-inset show results of this study (s-

shRNA = suppressive (CCR4) -shRNA (clone 1); c-shRNA = control-shRNA). Data are

expressed from quantitative real-time PCR analysis.

* P<0.05, compared with controls.

163

constructs for their efficiency of suppression of CCR4 expression. The construct #26085 (clone

1) was chosen for all subsequent studies.

To produce CCR4/control shRNA lentivirus, the purified plasmid pLKO.1-CCR4/control

shRNA (#26085/SHC002) was transfected into HEK 293 cells, along with a packaging vector

and an envelope vector. Supernatants from co-transfected cultures were collected at 48 and 72hr

after transfection and were pooled. A total of 180 ml of supernatant for each shRNA construct

was collected, for further analysis and concentration.

3.7. Infective/suppressive activity of the supernatants containing CCR4/control shRNA

lentivirus

Different doses (0.1 ml, 0.2 ml and 0.4 ml) of the supernatants were added to CHO-K cells.

Only cells successfully infected by the CCR4 shRNA virus could survive under puromycin

selection (8 µg/ml). Cell survival increased in a dose dependent fashion as expected (Figure

12).

48/72 hr after adding puromycin to CHO-k cells with the CCR4/control shRNA lentivirus

surviving CHO-k cells were harvested. Total RNA was isolated and reverse transcribed into

cDNA. Gene-specific real-time PCR was used to determine the efficiency of suppression of

CCR4 expression by the lentivirus. > 80% suppression was seen compared with cells infected

by the control shRNA (Figure 13).

3.8. Titration and concentration of CCR4-shRNA lentivirus supernatants

The CCR4-shRNA lentivirus supernatant, as well as the control, was titrated using a

standard ELISA analysis (p24 Titer kit – ZeptoMetrix-see Materials and Methods). The

concentration of p24 (the core protein of lentivirus) in the CCR4 shRNA lentivirus supernatant

164

Puromycin selection of CHO-K cells infected with CCR4 shRNA lentivirus (48hr after puromycin selection)

CHO-k only CHO-k + puro CHO-k + puro + 0.1ml of the virus

CHO-k + puro + 0.2ml of the virus CHO-k + puro + 0.4ml of the virus

Figure 12

164

165

Legend to Figure 12: Puromycin selection of CHO-K cells infected with CCR4 shRNA

lentivirus (48 hr after puromycin selection)

Puromycin selection of CHO cells infected with CCR4 shRNA lentivirus (72 hr incubation

with different doses (0.1, 0.2, and 0.4 ml) of lentivirus contained supernatants). Only cells

successfully infected by the virus survive under the selective conditions (48 hr incubation with

8 µg puromycin /ml).

166

Blockade of CCR4 expression in CHO-K cells by CCR4 shRNA lentivirus (48/72hr after puromycin selection)

166

c-shRNA s-shRNA0.00

0.25

0.50

0.75

1.00

shRNA lentivirus

Fol

d ch

ange

in m

RN

A

Figure 13

*

*P<0.05

c-shRNA s-shRNA0.00

0.25

0.50

0.75

1.00

shRNA lentivirus

Fo

ld c

hang

e in

mR

NA

*

*P<0.05

48hr 72hr

167

Legend to Figure 13: Blockade of CCR4 expression in CHO-K cells by CCR4 shRNA

lentivirus (48/72 hr after puromycin selection)

CHO-K cells successfully infected by CCR4 shRNA lentivirus (selected by puromycin, 8

µg/ml - see Fig.12) were analyzed for expression of CCR4 at 48/72 hr after puromycin selection

by real-time PCR (s-shRNA = suppressive (CCR4)-shRNA; c-shRNA = control-shRNA).

* P<0.05, compared with control.

168

was 1.41x105 pg/ml (1.33x105 pg/ml for the control virus). Based on a formula provided in the

manual with the kit [1 pg/ml of p24 ≈ 30 (10 -100) transducing unit (Tu)], the titer of the

CCR4-shRNA supernatant is 4.2 x 106 Tu (4.0 x 106 for the control).

To increase the viral titre supernatants were concentrated ~45-fold by ultracentrifugation. A

total of 4 ml of concentrated stock for either CCR4-shRNA lentivirus or the control virus was

obtained form 180 ml of the supernatant. The titer of the concentrated stock was 1.56 x 108/ml

for CCR4-shRNA lentivirus and 1.62 x 108/ml for the control.

3.9. Decreased presence of Foxp3+ Treg in skin grafts and DLNs following blockade of

CCR4 in Dox-treated CD200tg mice

A total of 1.25 x 108 Tu of CCR4 shRNA lentivirus or control shRNA lentivirus were

infused into each (of 5) recipients in one of the following groups: CD200tg; CD200tg + control

shRNA or CD200tg + CCR4-shRNA . All recipients (BL/6 background) received Dox-water for

7 day before receiving skin allografts (C3H). The concentrated viral stock was divided into 4

portions (200 µl/each portion) and injected intravenously (tail vein) on each of days -3, 0, +3

and +6 post skin graft. Mice were sacrificed at day 14. Aliquots of skin grafts and DLNs were

snap-frozen to explore gene expression using gene-specific real-time PCR, or were fixed in

10% buffered formalin for histology analysis. Data in Figure 14 show that blockade of CCR4

expression was correlated with decreased Foxp3 mRNA expression in both skin tissue and DLN

of CD200tg mice compared to that in CD200tg mice receiving control shRNA lentivirus.

3.10. Decreased Foxp3+ Treg following blockage of CCR4 expression attenuates skin graft

protection as defined by histological analysis and gross measure of skin graft survival

Figure 15 shows tissue histology in grafted skins of CD200tg mice receiving CCR4-shRNA

169

Tg only

Tg + c-shRNA

Tg + s-shRNA

CCR4 Foxp30.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0

Genes

Rel

ativ

e ex

pre

ssio

n in

mR

NA

CCR4 Foxp30.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0

1.1

1.2

Genes

Rel

ativ

e ex

pre

ssio

n in

mR

NA

Tg only

Tg + c-shRNA

Tg + s-shRNA

(a). Skin (b). DLN

Figure 14

*

*P<0.05

* *

*

Blockade of CCR4 expression by shRNA lentivirus in vivo decreases Foxp3 expression in tissues of CD200tg mice

(day 14 post transplantation)

169

170

Legend to Figure 14: Blockade of CCR4 expression by shRNA lentivirus in vivo decreases

Foxp3 expression in tissues of CD200tg mice (day 14 post transplantation)




drinking water. A total of 1.25 x 108 TU of CCR4-shRNA/control-shRNA lentivirus was

injected iv into each recipient at different time points post transplantation (3.15 x 107 x 4, on

day -3, 0, 3, 6). On d14 tissues were harvested and aliquoted for realtime PCR and histology

studies separately. Suppression of mRNA expression for CCR4 and Foxp3 in both skin grafts (a)

and DLNs (b) in CD200tg mice following injection of lentivirus expressing shRNA for CCR4

(s-shRNA = suppressive (CCR4)-shRNA ; c-shRNA = control-shRNA). Data shown are from

5mice/group, with grafts harvested at day 14 post transplantation.

* P<0.05, compared with mRNA expression in untreated CD200tg or Tg + c-shRNA.

171

Blockade of CCR4 expression in CD200tg mice is associated with histological changes typical of rejecting

grafts (day 14 post transplantion)

Figure 15

CD200tg mice+Dox CD200tg+Contl-shRNA+Dox CD200tg+CCR4-shRNA+Dox

171

(a) (b) (c)

172

Legend to Figure 15: Blockade of CCR4 expression in CD200tg mice is associated with

histological changes typical of rejecting grafts (day 14 post transplantion)

Histological changes in grafted skin in CD200tg mice following injection of CCR4-shRNA

(mice in Figure 14). Note: increased infiltration of cells in graft tissue following infusion of

CCR4-shRNA into Dox-treated CD200tg mice (compare (c) with (a)). Control shRNA in

CD200tg mice produced no such change in graft infiltration.

173

lentivirus reflects a typical rejection response, with leukocyte infiltration, unlike grafts from

CD200tg mice or CD200tg mice receiving control-shRNA.

In a separate study, skin allografts were performed using BALB/c donor grafts and 3

independent groups of recipients: Dox-treated CD200tg mice receiving CCR4-shRNA;

Dox-treated CD200tg mice receiving control shRNA; and BL/6 mice receiving control-shRNA.

Skin grafts were evaluated daily for rejection beginning at day 7 post graft. The results (Figure

16) confirm the abolition of protection in CD200tg mice which follows infusion of CCR4

specific shRNA, with all grafts in these CD200tg mice rejected by day 12 post grafting (>80%

survival in CD200tg receiving control shRNA at this time).

174

either lenti-shRNA for CCR4 or control lenti-shRNA

0 2 4 6 8 10 12 140

10

20

30

40

50

60

70

80

90

100

110BL/6 + contl-shRNA

Tg + contl-shRNA

Tg + ccr4-shRNA

15 30 45 60 75

Days post skin graft

Per

cen

t su

rviv

alSurvival of grafted skin in recipients receiving either CCR4

lenti-shRNA or control lenti-shRNA

Tg +

CC

R4 -shR

NA

Tg + contl-shR

NA

*

*P<0.05, compared to all other groups, One-way ANOVA

174

Figure 16

175

Legend to Figure 16: Survival of grafted skin in recipients receiving either CCR4 lenti-shRNA or control lenti-shRNA

Groups of C57BL/6 control or rtTA2s-M2 CD200tg mice received 1 cm2 allogeneic

(BALB/c) tail skin grafts on the shaved dermis, low-dose rapamycin (0.5 mg/Kg) at 36 hr

intervals for 12 days post transplantation, and either doxycycline (Dox, 1ug/ml) in the water

supply or plain drinking water. A total of 1.25 x 108 TU of CCR4-shRNA/control-shRNA

lentivirus was injected iv into each recipient at different time points post transplantation (3.15 x

107 x 4, on day -3, 0, 3, 6). Graft survival was followed daily by an investigator blinded to the

different groups. Rejection was recorded by percent of total graft area, and when < 20% of the

graft remained, it was considered rejected (Current Protocols in Immunology 4.4.1-2).

The pictures to the right are of the grafted skin in the different groups at day 12 post graft.

* P<0.05, compared with all other groups, One-way ANOVA.

176

4. Discussion

Transplant tolerance is defined as the acceptance of a specific donor graft in a host that

retains the ability to response to infection and to reject third party grafts (with MHC unrelated

to that of the tolerated graft) (32). Induction and/or maintenance of transplant tolerance are

complex processes involving different mechanisms and multiple cellular components, which

may change over time (32).

In a previous study (22), we showed that transgenic over-expression of CD200 in

Dox-treated rtTA2s-M2 CD200tg mice was associated with increased survival of grafted tissues

from both cardiac and skin allografts. In this study, we used the same CD200tg recipients to

investigate in detail the mechanism(s) behind graft allotolerance. Consistent with preliminary

data published elsewhere (22), using a T-cell anergy/tolerance focused microarray to explore

differential gene expression in graft tissue from Dox-treated CD200tg v control mice at day 14

post transplantation, we found increased mRNAs for regulatory T-cells (Foxp3, GITR, CTLA-4,

IL-10); type 2 cytokines (Gata3, IL-4, IL-5, IL-13); and decreased expression of mRNAs for

signalling molecules of T cell activation (Jak, fos, Jun); inflammatory cytokines (IL-1, IL-6);

and some co-stimulatory genes (light, OX-40). Interestingly, mRNAs for some type 1 cytokines

(T-bet, IFN-γ, Gmzb), and co-stimulatory molecules (4-1BB, Icos) were also increased, as well

as mRNA for the co-inhibitory molecule, PD-1.

Exploration of gene expression signatures associated with tolerance v active rejection of

allografts has been described by others. In such studies, reduced costimulatory signalling,

immune quiescence, apoptosis, and altered memory T cell responses have been shown to

correlate with long-term acceptance in a renal transplant population compared with a gene

177

signature reflecting DC activation in acute rejection (33, 34). Using an approach to explore a

signature for the “tolerant state” in a mouse TCR transgenic model of experimental autoimmune

encephalomyelitis (EAE) following intranasal administration of the N-terminal peptide of

myelin basic protein, a model in which tolerance is attributable to a population of IL-10

secreting regulatory T cells, evidence for overexpression of the Th1 determining gene T-bet was

also observed in Tregs (35-37). Over-expression of granzyme b (Gzmb), thought to be

functionally relevant for CTL effectors, was also reported in the same populations. One

interpretation of these data is that considerable overlap exists in gene expression profile among

multiple populations of Tregs, and even between Th1 and Th2 cells, and that regulatory activity

is potentially a common feature of all activated T cells (38). Cobbold concluded that the

defining feature of a Treg might be the lack of effector functions as a result of either partial or

incomplete differentiation to either Th1 or Th2, rather than a positive function attributed to this

cell population per se (38).

Although many factors/components may be involved in the mechanisms regulating

allograft tolerance, current dogma suggested that Foxp3+ Treg cells play a key role during the

process of induction of allograft tolerance (28, 39, 40). The mechanisms used by these Treg

cells include the secretion of regulatory/suppressive cytokines such as TGF-βand IL-10 and

direct cell-cell contact depending upon binding of CTLA-4 (41-43), resulting in

down-modulation of both effector T cell and APC functions. Foxp3+ Treg cells have also been

reported to lyse target cells directly via IFN-γ and Gzmb (38, 44), and induce apoptosis of

effector T cells by deprivation of cytokines (IL-2) (45).

IL-10 and TGF-β function as important immune regulators (46-50). However the

178

contribution of IL-10 and TGF-β to the function of thymus-derived, naturally occurring Treg

cells (Treg) is a controversial issue (51). Data from studies using neutralizing antibodies for

IL-10 and TGF-β or T cells that are unable to produce or respond to IL-10 and TGF-β,

suggested that these cytokines may not always be essential for Treg-cell function (52-55). In a

CD154 mAb-linked allograft tolerance model, lower levels of TGF-β and IL-10 were detected

in tolerant recipients (26). It seems that the relative importance of IL-10 and TGF-β

production by Treg cells as a mechanism of Treg cell mediated suppression is dependent on the

disease and/or the experimental system under consideration.

Treg cells are now believed to modulate the activities of cellular components of both the

innate and the adaptive immune systems. This depends on their ability to come into physical

proximity with their targets by migrating to specific tissues and microenviroments. Treg cells

express an array of adhesion molecules and chemoattractant receptors that enable them to target

both lymphoid and non-lymphoid sites (56). Recent studies have revealed the importance of

several homing receptors for the appropriate tissue distribution and function of Treg cells such

as αE integrin (CD103) and CCR4 for Tregs migrating to skin. Deletion of these molecules on

Treg cells results in the development of skin-specific autoimmunity (57, 58) . In addition to

their constitutive recirculation, Treg recruitment to both lymphoid- and non-lymphoid tissues is

substantially enhanced during inflammation. Closed contact of Treg cells with Teff cells, either

directly or through an APC intermediate, is also thought to be essential for exerting their

regulatory function (59). In an inflammatory bowel disease (IBD) model, CCR4 plays an

important role in Treg cell trafficking to LNs which is critical for Treg cell suppressive function

in vivo (27). Similarly, in a cardiac allograft tolerance model induced with CD154 (CD40L)

179

monoclonal antibody, tolerance was associated with increased expression of CCR4 and one of

its ligands, macrophage-derived chemokine (CCL22) in the graft tissue, and tolerance induction

was not achieved in CCR4-/- recipients (26).

Studies in our CD200tg model were consistent with a role for Foxp+ regulatory T cell

subpopulations in increased graft acceptance. Increased Foxp3+ Treg populations and increased

mRNA expression for a chemokine receptor CCR4, as well as its ligands (CCL22/17), reported

to play a key role in homing of Foxp3+ regulatory T cells to grafted tissues and/or DLN, were

seen in Dox-treated recipients (in both grafted tissues and DLN). This supports the hypothesis

that CCR4 controls migration of Foxp3+ regulatory T cells to both grafted skin and/or DLN, and

Tregs exert suppressive function in these locals are critical for induction of allo-tolerance in the

model. Further evidence for a role for CCR4 dependent migration of Foxp3+ populations in

grafted CD200tg mice came from experiments in which expression of CCR4 was blocked by a

gene specific shRNA directed to CCR4. Lentivirus mediated shRNA targeting CCR4

diminished the increased presence of Foxp3+ regulatory T cell populations in grafted tissue and

DLNs, and reversed both skin graft acceptance and histological changes previously observed

with graft acceptance. In grafted CD200tg mice, upregulation of CCL22 was more evident than

CCL17. This suggests that CCL22 may play a more important role in the trafficking of Foxp3+

regulatory T cells in Dox-treated CD200tg mice, a result in accord with other studies using a

cardiac allograft model (26) and an inflammatory bowel disease model (27).

These data disclose a positive association between transgenic over-expression of CD200

and upregulation of a chemokine receptor CCR4 and its ligands CCL17/22. They provide

support for a model suggesting that CCR4 dependent, enhanced migration of Foxp3+ regulatory

180

populations to both grafted skins and DLNs is a crucial step in increased survival following

CD200 over-expression. A model which best fits our current understanding of how

CD200:CD200R interactions might regulate allograft rejection is shown in Figure 17.

181

+ DoxUp-regulation of CD200 expression

Stimulationof CD200R+

cells

Cytokines

Chemokines

Grafted tissues/DLN

IL-1, IL-6,

TNF-a

IL-10, 13, 4, TGF-β?

PD-1, CTLA4, GITR, Foxp3, CCR4

CCL-22/17,

CCR4

No Dox

Cytokines

Chemokines

Graft rejection



CCL-3 (MIP1a)

Graft acceptance

T reg

No triggering

of CD200R+

cells

T naive

T naive

Inflammatory stimulus (skin graft)

OX-40, Light

Jak-1, Jak-3, Jun, Fos, Trail

Grafted tissues/DLNMigration

Migration181

Figure 17

A model for CD200:CD200R modulated regulation of graft rejection

T effector

182

5. Reference

1. Denton, M. D., C. C. Magee, and M. H. Sayegh. 1999. Immunosuppressive strategies in transplantation. Lancet 353:1083-1091.

2. Kramer, B. K., C. Zulke, M. C. Kammerl, C. Schmidt, C. Hengstenberg, M. Fischereder, and J. Marienhagen. 2003. Cardiovascular risk factors and estimated risk for CAD in a randomized trial comparing calcineurin inhibitors in renal transplantation. Am J Transplant 3:982-987.

3. Duncan, M. D., and D. S. Wilkes. 2005. Transplant-related immunosuppression: a review of immunosuppression and pulmonary infections. Proc Am Thorac Soc 2:449-455.

4. Sakaguchi, S. 2005. Naturally arising Foxp3-expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non-self. Nat Immunol 6:345-352.

5. Faria, A. M., and H. L. Weiner. 2005. Oral tolerance. Immunol Rev 206:232-259. 6. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, and S. M.

Wahl. 2003. Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med 198:1875-1886.

7. Petroff, M. G., L. Chen, T. A. Phillips, and J. S. Hunt. 2002. B7 family molecules: novel immunomodulators at the maternal-fetal interface. Placenta 23 Suppl A:S95-101.

8. Tsushima, F., H. Iwai, N. Otsuki, M. Abe, S. Hirose, T. Yamazaki, H. Akiba, H. Yagita, Y. Takahashi, K. Omura, K. Okumura, and M. Azuma. 2003. Preferential contribution of B7-H1 to programmed death-1-mediated regulation of hapten-specific allergic inflammatory responses. Eur J Immunol 33:2773-2782.


10. Morita, M., M. Fujino, G. Jiang, Y. Kitazawa, L. Xie, M. Azuma, H. Yagita, S. Nagao, A. Sugioka, Y. Kurosawa, S. Takahara, J. Fung, S. Qian, L. Lu, and X. K. Li. PD-1/B7-H1 interaction contribute to the spontaneous acceptance of mouse liver allograft. Am J Transplant 10:40-46.


12. Wright, G. J., H. Cherwinski, M. Foster-Cuevas, G. Brooke, M. J. Puklavec, M. Bigler, Y. Song, M. Jenmalm, D. Gorman, T. McClanahan, M. R. Liu, M. H. Brown, J. D. Sedgwick, J. H. Phillips, and A. N. Barclay. 2003. Characterization of the CD200 receptor family in mice and humans and their interactions with CD200. J Immunol 171:3034-3046.

13. Wright, G. J., M. J. Puklavec, A. C. Willis, R. M. Hoek, J. D. Sedgwick, M. H. Brown, and A. N. Barclay. 2000. Lymphoid/neuronal cell surface OX2 glycoprotein recognizes a novel receptor on macrophages implicated in the control of their function. Immunity 13:233-242.

183


15. Clark, D. A., G. Yu, G. A. Levy, and R. M. Gorczynski. 2001. Procoagulants in fetus rejection: the role of the OX-2 (CD200) tolerance signal. Semin Immunol 13:255-263.

16. Gorczynski, R. M., Z. Chen, L. Lee, K. Yu, and J. Hu. 2002. Anti-CD200R ameliorates collagen-induced arthritis in mice. Clin Immunol 104:256-264.

17. Aoki, T., Y. Matsumoto, K. Hirata, K. Ochiai, M. Okada, K. Ichikawa, M. Shibasaki, T. Arinami, R. Sumazaki, and E. Noguchi. 2009. Expression profiling of genes related to asthma exacerbations. Clin Exp Allergy 39:213-221.

18. Gorczynski, R. M. 2005. CD200 and its receptors as targets for immunoregulation. Curr Opin Investig Drugs 6:483-488.

19. Clasper, S., D. Royston, D. Baban, Y. Cao, S. Ewers, S. Butz, D. Vestweber, and D. G. Jackson. 2008. A novel gene expression profile in lymphatics associated with tumor growth and nodal metastasis. Cancer Res 68:7293-7303.

20. Gorczynski, R. M., Z. Chen, J. Hu, Y. Kai, and J. Lei. 2001. Evidence of a role for CD200 in regulation of immune rejection of leukaemic tumour cells in C57BL/6 mice. Clin Exp Immunol 126:220-229.

21. Gorczynski, R. M., M. S. Cattral, Z. Chen, J. Hu, J. Lei, W. P. Min, G. Yu, and J. Ni. 1999. An immunoadhesin incorporating the molecule OX-2 is a potent immunosuppressant that prolongs allo- and xenograft survival. J Immunol 163:1654-1660.


23. Gorczynski, R. M., Z. Chen, Y. Kai, and J. Lei. 2000. Evidence for persistent expression of OX2 as a necessary component of prolonged renal allograft survival following portal vein immunization. Clin Immunol 97:69-78.

24. Gorczynski, R. M., Z. Cohen, X. M. Fu, and J. Lei. 1999. Anti-rat OX-2 blocks increased small intestinal transplant survival after portal vein immunization. Transplant Proc 31:577-578.

25. Yu, K., Z. Chen, S. Wang, and R. Gorczynski. 2006. Decreased alloreactivity using donor cells from mice expressing a CD200 transgene under control of a tetracycline-inducible promoter. Transplantation 80:394-401.

26. Lee, I., L. Wang, A. D. Wells, M. E. Dorf, E. Ozkaynak, and W. W. Hancock. 2005. Recruitment of Foxp3+ T regulatory cells mediating allograft tolerance depends on the CCR4 chemokine receptor. J Exp Med 201:1037-1044.

27. Yuan, Q., S. K. Bromley, T. K. Means, K. J. Jones, F. Hayashi, A. K. Bhan, and A. D. Luster. 2007. CCR4-dependent regulatory T cell function in inflammatory bowel disease. J Exp Med 204:1327-1334.

28. Dijke, I. E., W. Weimar, and C. C. Baan. 2008. Regulatory T cells after organ transplantation: where does their action take place? Hum Immunol 69:389-398.

29. Yu, G., Y. Sun, K. Foerster, J. Manuel, H. Molina, G. A. Levy, R. M. Gorczynski, and D. A. Clark. 2008. LPS-induced murine abortions require C5 but not C3, and are prevented

184

by upregulating expression of the CD200 tolerance signaling molecule. Am J Reprod Immunol 60:135-140.

30. Qu, Y., B. Zhang, L. Zhao, G. Liu, H. Ma, E. Rao, C. Zeng, and Y. Zhao. 2007. The effect of immunosuppressive drug rapamycin on regulatory CD4+CD25+Foxp3+T cells in mice. Transpl Immunol 17:153-161.

31. Schwoebel, F., J. Barsig, A. Wendel, and J. Hamacher. 2005. Quantitative assessment of mouse skin transplant rejection using digital photography. Lab Anim 39:209-214.

32. Hadeiba, H., T. Sato, A. Habtezion, C. Oderup, J. Pan, and E. C. Butcher. 2008. CCR9 expression defines tolerogenic plasmacytoid dendritic cells able to suppress acute graft-versus-host disease. Nat Immunol 9:1253-1260.

33. Brouard, S., E. Mansfield, C. Braud, L. Li, M. Giral, S. C. Hsieh, D. Baeten, M. Zhang, J. Ashton-Chess, C. Braudeau, F. Hsieh, A. Dupont, A. Pallier, A. Moreau, S. Louis, C. Ruiz, O. Salvatierra, J. P. Soulillou, and M. Sarwal. 2007. Identification of a peripheral blood transcriptional biomarker panel associated with operational renal allograft tolerance. Proc Natl Acad Sci U S A 104:15448-15453.

34. Bradley, S. P., B. Banner, G. Elias, M. P. Pahari, M. Brown, C. Rastellini, and L. Cicalese. 2008. Genetic expression profile during acute cellular rejection in clinical intestinal transplantation. Transplantation 86:998-1001.

35. Mix, E., S. Ibrahim, J. Pahnke, D. Koczan, C. Sina, T. Bottcher, H. J. Thiesen, and A. Rolfs. 2004. Gene-expression profiling of the early stages of MOG-induced EAE proves EAE-resistance as an active process. J Neuroimmunol 151:158-170.

36. Whitney, L. W., S. K. Ludwin, H. F. McFarland, and W. E. Biddison. 2001. Microarray analysis of gene expression in multiple sclerosis and EAE identifies 5-lipoxygenase as a component of inflammatory lesions. J Neuroimmunol 121:40-48.

37. Lisak, R. P., J. A. Benjamins, B. Bealmear, L. Nedelkoska, D. Studzinski, E. Retland, B. Yao, and S. Land. 2009. Differential effects of Th1, monocyte/macrophage and Th2 cytokine mixtures on early gene expression for molecules associated with metabolism, signaling and regulation in central nervous system mixed glial cell cultures. J Neuroinflammation 6:4.

38. Cobbold, S. P. 2006. The hidden truth about gene expression in Tregs: is it what you don't see that counts? Eur J Immunol 36:1360-1363.

39. Wood, K. J., S. Luo, and A. Akl. 2004. Regulatory T cells: potential in organ transplantation. Transplantation 77:S6-8.

40. Yong, Z., L. Chang, Y. X. Mei, and L. Yi. 2007. Role and mechanisms of CD4+CD25+ regulatory T cells in the induction and maintenance of transplantation tolerance. Transpl Immunol 17:120-129.

41. Takahashi, T., T. Tagami, S. Yamazaki, T. Uede, J. Shimizu, N. Sakaguchi, T. W. Mak, and S. Sakaguchi. 2000. Immunologic self-tolerance maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med 192:303-310.

42. Annacker, O., R. Pimenta-Araujo, O. Burlen-Defranoux, T. C. Barbosa, A. Cumano, and A. Bandeira. 2001. CD25+ CD4+ T cells regulate the expansion of peripheral CD4 T cells through the production of IL-10. J Immunol 166:3008-3018.

43. Nakamura, K., A. Kitani, I. Fuss, A. Pedersen, N. Harada, H. Nawata, and W. Strober.

185

2004. TGF-beta 1 plays an important role in the mechanism of CD4+CD25+ regulatory T cell activity in both humans and mice. J Immunol 172:834-842.

44. Gondek, D. C., L. F. Lu, S. A. Quezada, S. Sakaguchi, and R. J. Noelle. 2005. Cutting edge: contact-mediated suppression by CD4+CD25+ regulatory cells involves a granzyme B-dependent, perforin-independent mechanism. J Immunol 174:1783-1786.

45. Pandiyan, P., L. Zheng, S. Ishihara, J. Reed, and M. J. Lenardo. 2007. CD4+CD25+Foxp3+ regulatory T cells induce cytokine deprivation-mediated apoptosis of effector CD4+ T cells. Nat Immunol 8:1353-1362.

46. Letterio, J. J., and A. B. Roberts. 1998. Regulation of immune responses by TGF-beta. Annu Rev Immunol 16:137-161.

47. Prud'homme, G. J., and C. A. Piccirillo. 2000. The inhibitory effects of transforming growth factor-beta-1 (TGF-beta1) in autoimmune diseases. J Autoimmun 14:23-42.

48. Gorelik, L., and R. A. Flavell. 2000. Abrogation of TGFbeta signaling in T cells leads to spontaneous T cell differentiation and autoimmune disease. Immunity 12:171-181.

49. Cautain, B., J. Damoiseaux, I. Bernard, H. van Straaten, P. van Breda Vriesman, B. Boneu, P. Druet, and A. Saoudi. 2001. Essential role of TGF-beta in the natural resistance to experimental allergic encephalomyelitis in rats. Eur J Immunol 31:1132-1140.

50. Zheng, S. G., J. H. Wang, J. D. Gray, H. Soucier, and D. A. Horwitz. 2004. Natural and induced CD4+CD25+ cells educate CD4+CD25- cells to develop suppressive activity: the role of IL-2, TGF-beta, and IL-10. J Immunol 172:5213-5221.

51. Shevach, E. M. 2006. From vanilla to 28 flavors: multiple varieties of T regulatory cells. Immunity 25:195-201.

52. Takahashi, T., Y. Kuniyasu, M. Toda, N. Sakaguchi, M. Itoh, M. Iwata, J. Shimizu, and S. Sakaguchi. 1998. Immunologic self-tolerance maintained by CD25+CD4+ naturally anergic and suppressive T cells: induction of autoimmune disease by breaking their anergic/suppressive state. Int Immunol 10:1969-1980.

53. Thornton, A. M., and E. M. Shevach. 1998. CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 188:287-296.


55. Jonuleit, H., E. Schmitt, M. Stassen, A. Tuettenberg, J. Knop, and A. H. Enk. 2001. Identification and functional characterization of human CD4+CD25+ T cells with regulatory properties isolated from peripheral blood. J Exp Med 193:1285-1294.

56. Campbell, D. J., and M. A. Koch. Phenotypical and functional specialization of FOXP3+ regulatory T cells. Nat Rev Immunol 11:119-130.

57. Sather, B. D., P. Treuting, N. Perdue, M. Miazgowicz, J. D. Fontenot, A. Y. Rudensky, and D. J. Campbell. 2007. Altering the distribution of Foxp3+ regulatory T cells results in tissue-specific inflammatory disease. J Exp Med 204:1335-1347.

58. Dudda, J. C., N. Perdue, E. Bachtanian, and D. J. Campbell. 2008. Foxp3+ regulatory T cells maintain immune homeostasis in the skin. J Exp Med 205:1559-1565.

59. von Boehmer, H. 2005. Mechanisms of suppression by suppressor T cells. Nat Immunol

186

6:338-344.

187

CHAPTER 5

Summary and future directions

188

1. Summary

Statistics from UNOS (United Network for Organ Sharing) show that in the US alone the

number of people on the organ transplantation wait list currently stands at over 100,000.

However, whether organ transplantation is successful or not still depends upon the long term

use of combinations of immunosuppressive drugs. These drugs suppress immunity wholesale

and not the small population of antigen specific effector cells. Accordingly many unwanted

side-effects ensue, including increased susceptibility to opportunistic infection, an increased

risk of malignancy, and drug toxicity itself. Importantly, these drugs are unable to eradicate

alloimmune responses, and chronic rejection continues to remain a long-term problem.

A major goal in organ transplantation is to achieve true transplant tolerance, which would

be manifest as acceptance of a specific donor graft with the retention of overall immune

functioning, without the need for immunosuppressive drugs. Induction and/or maintenance of

transplant tolerance are a complex process likely involving multiple mechanisms and multiple

pathways which may even change over time.

A major effort in tolerance studies has been placed into looking for cells with immune

regulatory function and/or molecules which could themselves deliver regulatory signals to their

target cells. Naturally occurring Foxp3+ regulatory T population has been reported to be crucial

both for maintaining immune homeostasis and controlling various immune responses (1-4).

Other regulatory cell subsets include T-cells such as peripherally-induced Foxp3+, Tr-1, Th3,

CD8+, double negative (CD4-CD8-), NKT and γδT cells (4-12); myeloid derived suppressor

cells (MDSC)(13-16); and tolerogenic dendritic cells (10, 17-20). Amongst the molecules which

have been described to deliver immune suppressive signals to target cells are CTLA-4 and PD-1,

both of which belong to the B7 family (21-27), and CD200 (28-33). The studies formed this

189

thesis focus on the important role and mechanism(s) of CD200 in regulating acquired tolerance

to allografts and LPS-induced abortion.

Our laboratory was the first to demonstrate a regulatory role for CD200 from studies in a

murine renal allo-graft model (34). Subsequent work established an important role for the

receptor, CD200R(s) in transmission of CD200-induced regulation (34-37). These studies have

been confirmed by multiple other groups working in fields as diverse as allergy (38-40),

autoimmunity (31, 41-43) and infection (44-46).

Proof-of-principle studies demonstrating that increased expression of CD200 enhanced

survival of allografts came from use of a mouse model in which transgenic overexpression of

CD200 was achieved. These studies used a commercial Tet-on system, in which transgenic

expression of CD200 was increased in the presence of doxycycline (Dox) in the animal’s

drinking water. Responder cells (as wee as stimulator cells) from transgenic mice exposed to

Dox showed attenuated induction of CTL in vivo/in vitro, along with polarization of cytokine

production towards type-2 expression (IL-4/TGFβ) and away from type-1 (IL-2, IFNγ).

Although enhanced survival of grafted skins was achieved in transplanted CD200tg mice all

mice eventually rejected their grafts within 28 days of transplantation (see chapter 2 for details).

One of the main reasons for the failure to achieve more prolonged survival was felt to be

associated with inherent disadvantages in the Tet-on system used, as follows:

(i) The sequence of the reverse tetroxycline controlled transactivator (rtTA), which is

key to the induction of transgenic expression, is derived from prokaryotic organisms

(E. coli.), and is handled differently in mammalian cells than mammalian DNA.

(ii) The molecular size (1116 bp) limits the ability of rtTA to enter some organs (such as

the brain et al) to enable tissue expression of the transgene in such locations.

190

(iii) Transgene expression in the absence of Dox (so-called ‘leaky’ expression) is higher

using this prokaryotic version of rtTA.

Studies to eliminate most of these drawbacks led to the development of a second generation

of rtTA (rtTA2s-M2), which was used to create a new CD200tg animal line referred to as

rtTA2s-M2 CD200tg mouse.

This new CD200tg strain was used to explore LPS-induced abortion in mice (see chapter 3

for details). LPS-treated transgenic mice given LPS + progesterone had a 49% abortion rate, but

when the mice were given doxycycline to induce expression of transgene CD200, the abortion

rate declined to ~6%. Thus up-regulation of CD200 prevented LPS-driven abortions, possibly

through regulating cytokine production (IL-1, IL-6, TNF-α) and/or enhancing development of

regulatory T cells. Neither of these mechanism(s) has been studied in any detail, and this issue

remains for further investigation.

As predicted, longer-term survival of both cardiac and skin allografts was achieved in

rtTA2s-M2 CD200tg mice, along with inhibition of allo-antigen specific effector T-cell

proliferation and induction of CTL (36). Initial studies on the mechanisms responsible for

enhancement were described in chapter 4. These data showed that increased expression of genes

associated with Foxp3+ regulatory T-populations (Foxp3, CTLA4 and GITR), as well as type 2

cytokine genes, was seen in CD200tg recipients, suggesting that these regulatory cells/molecules

might be involved in regulation of the allotolerance. Of particular interest in regards to the

Foxp3+ regulatory T cells, the data showed consistently that expression of genes encoding a

chemokine receptor CCR4 and its ligands (CCL17/22), reported to play a key role in attracting

Foxp3+ regulatory T cells to both grafted tissues and their DLNs (47-50), was increased in

Dox-treated CD200tg recipients. Immunohistochemistry staining provided further evidence for

191

an increased number of Foxp3+ cells in both grafted skin tissues and the corresponding DLNs.

These data were consistent with a model in which CD200 transgene expression afforded

increased graft survival through enhanced CCR4 dependent migration of Foxp3+ regulatory

T-cell populations to their target organs (both grafted skin tissues and their DLNs). This

hypothesis was tested in an experiment in which blockade of expression of CCR4 was achieved

using CCR4-shRNA lentivirus to attenuated expression of CCR4 in vivo. The effects of

blockade of CCR4 expression on gene expression of both CCR4 and Foxp3 were analyzed

quantitatively using gene specific real-time PCR. Lentivirus mediated shRNA targeting of

CCR4 diminished the increased presence of Foxp3+ regulatory T-cell populations in both grafted

tissues and DLNs of CD200tg mice, and reversed both increased skin graft acceptance and the

histological changes previously observed with graft acceptance. These data provide support for

the hypothesis that enhanced CCR4 dependent migration of Foxp3+ regulatory cells to both

grafted skins and DLNs is an important step in the induction of allotolerance following

transgenic overexpression of CD200.

192

2. Future directions

Chemokines within organ allografts and draining lymph organs may influence the outcome

of transplant survival both by altering migration of cells important in facilitating rejection (DCs

or alloAg-specific T cells) and/or by recruiting cells implicated in suppression of rejection

(regulatory T cells or tolerogenic DCs) (51). We have speculated that targeting interaction of

those chemokines with their receptors may regulate graft survival. The chemokines CCL22 and

CCL17 interacting with their receptor CCR4 has been posited as a target in many studies (48,

49), with CCR4 expressed on CD4+CD25+Foxp3+ Tregs, and CCL17 and CCL22 being

produced by DCs and other cells. Data in this thesis suggest that CCR4 dependent recruitment

of Foxp3+ regulatory populations to both grafted skin tissue and DLNs is an essential step in the

induction of skin graft allotolerance following transgenic overexpression of CD200. We

reported enhanced survival of cardiac allografts in recipients with transgenic overexpression of

CD200 (36) and now hypothesize that:

(1) CCR4 dependent migration of Foxp3+ Tregs to cardiac allografts and/or DLN/spleen

will play a key role in this enhanced survival of grafted hearts induced by transgenic

overexpression of CD200;

(2) Transgenic overexpression of CD200 promotes induction of CCR4 ligands CCL17/22,

the chemotactic agents for recruiting CCR4+ Foxp3+Tregs, from CD200R+ cells.

These hypotheses will be tested as follows.

2.1. A cardiac allograft model showing enhanced graft survival induced by transgenic

overexpression of CD200

The rtTA2s-M2 CD200tg mice used in our previous report (36) and in the experiments

forming chapter 4 of this thesis will be used as recipients for cardiac allografts. To investigate

193

whether CD200 may function through binding to other than CD200R1, CD200R1-/- mice

(except for rtTA2s-M2 CD200tg mice) will also be used as an independent group of recipients.

All groups of recipients will receive C3H heart allografts (heterotopic) and be exposed to plain

water or Dox-water. Loss of graft function within 48 hr of transplant will be considered a

technical failure, and these animals will be omitted from further analysis. Graft

survival/function will be assessed daily by palpation and will be further confirmed with

pathology study.

2.2. Altered gene expression in this cardiac allograft model

Using a T cell anergy/tolerance focused microarray we reported increased expression of

Foxp3 in transplanted hearts in recipients with transgenic overexpression of CD200 (36). We

propose to broaden the microarray analysis to investigate altered expression of other genes

(confirming by real-time PCR). Grafted hearts and DLNs/spleens from recipients in the

different groups will be harvest at day 7, 14 and 28 post-transplantation. Further studies will use

immunohistochemistry staining (e.g. for CCR4) and/or ELISA (tissue homogenates analysed for

e.g. CCL17/22) to confirm upregulation of potentially interesting genes

2.3. Use of anti-CCR4 reagents to assess importance of interaction between CCL17/22 and

CCR4 in enhanced graft survival

Although neutralizing antibodies for CCL17/22 are commercially available (BD

Bioscience), given the redundancy of the ability of these chemokines to attract CCR4+ Treg, we

prefer an approach using anti-CCR4 reagents to block the interaction between CCL17/22 (DCs)

and CCR4 (Tregs). Either lentivirus mediated CCR4-shRNA or anti-CCR4 antibodies can be

used to achieve this goal. Longer-term we also propose to backcross the CD200tg mouse onto

the commercially available CCR4KO strain. We will inject CD200tg grafted mice with 100µg

194

anti-CCR4 (or isotype control) antibody at early days (0, 3 and 7 post-transplantation), harvest

grafted hearts and DLNs/spleens at day 7, 14 and 28 as before, and investigate (at the

cellular/molecular level) evidence for altered allo-immunity and gene expression.

Immunohistochemistry staining will also be used to assess the effects of this blockade on

recruitment of Foxp3+ Tregs. Daily palpation and pathology using day 14 grafts will be used to

assess the effects of the blockade on graft survival.

2.4. Chemotaxis assay

To investigate whether CCL17 or CCL22 is crucial for in chemotaxis of Tregs in our model,

chemotaxis of purified/sorted CD4+CD25+Tregs isolated from CD200tg, control and

CD200tgCCR4KO mice will be evaluated by measuring their migration through 5-um pore

polycarbonate filters in 48-well/24-well transwell chambers (Nuclepore, Germany or costar,

Cambridge, MA). Media with or without chemokines will be added into the lower compartment

wells (RPMI 1640 with 0, 0.01, 0.1, 1, 10, 100 nM of CCL17, CCL22 or the mixture of CCL17

and CCL22 (R & D). Thereafter a 10 um polycarbonate membrane with a pore size of 5 um is

placed over the wells. CD4+CD25+Tregs from the different groups are added to the upper

compartment and incubated at 37℃for 60 min/2 hr in 5% CO2. After removing the cells from

the upper side of the membrane, migrated Tregs on the lower side of the membrane are fixed in

methanol and stained with haematoxylin. Migrated Tregs are counted in five randomly chosen

high-power (400x) fields and a mean value for each sample calculated. Results will be

expressed as the percentage of migrated cells.

2.5. Use of Tregs to attenuate T cell proliferation in vitro

The ability of chemokine-recruited Tregs to express antigen-specific suppressive function

will be analyzed by measuring T cell proliferation in vitro. CD4+T cells from C57BL/6 mice

195

will be labelled with CFSE and then stimulated in vitro with DCs from C3H or third-party

(BALB/c) mice in the presence/absence of purified Tregs from recipients with enhanced

survival of cardiac allografts. Suppressive efficiency will be analyzed by FACS.

2.6. Exploration of the cellular source of CCR4 ligands CCL17/22

Grafted hearts and DLN/spleen sections prepared from control/CD200tg recipients will be

stained separately with FITC-anti mouse CD11c, and biotinylated anti-mouse CCL17/22

followed by streptavidin-Qdot 525. Evidence that CD11c+DCs cells produce CCL17/22 will be

obtained by merging the staining of sections stained with the different antibodies.

2.7. ELISA to confirm production of CCL17/22 by DCs/other cells

Cell preparations from spleen and DLN of recipients in different groups will be depleted of

CD11c+ cells using magnetic sorting (Stem Cell Technologies). Control and CD11c-depleted

preparations will be cultured for 12-24 hr in medium at 37oC and supernatants assayed for

CCL17/22 expression by ELISA (sensitivity of detection 10 pg/ml). Evidence that non-CD11c+

cells are responsible for a significant component of CCL17/22 production will be followed by

co-staining of tissue sections with chemokine antibodies and reagents specific for other stromal

cells (macrophages/B cells/T cells etc).

196

3. Reference

1. Annacker, O., R. Pimenta-Araujo, O. Burlen-Defranoux, T. C. Barbosa, A. Cumano, and A. Bandeira. 2001. CD25+ CD4+ T cells regulate the expansion of peripheral CD4 T cells through the production of IL-10. J Immunol 166:3008-3018.


3. Dijke, I. E., W. Weimar, and C. C. Baan. 2008. Regulatory T cells after organ transplantation: where does their action take place? Hum Immunol 69:389-398.

4. Fontenot, J. D., M. A. Gavin, and A. Y. Rudensky. 2003. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol 4:330-336.

5. Apostolou, I., P. Verginis, K. Kretschmer, J. Polansky, J. Huhn, and H. von Boehmer. 2008. Peripherally induced Treg: mode, stability, and role in specific tolerance. J Clin Immunol 28:619-624.

6. Battaglia, M., S. Gregori, R. Bacchetta, and M. G. Roncarolo. 2006. Tr1 cells: from discovery to their clinical application. Semin Immunol 18:120-127.

7. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, and S. M. Wahl. 2003. Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med 198:1875-1886.

8. Faria, A. M., and H. L. Weiner. 2005. Oral tolerance. Immunol Rev 206:232-259. 9. Gavin, M. A., J. P. Rasmussen, J. D. Fontenot, V. Vasta, V. C. Manganiello, J. A. Beavo,

and A. Y. Rudensky. 2007. Foxp3-dependent programme of regulatory T-cell differentiation. Nature 445:771-775.

10. Gorczynski, R. M., L. Lee, and I. Boudakov. 2005. Augmented Induction of CD4+CD25+ Treg using monoclonal antibodies to CD200R. Transplantation 79:1180-1183.

11. Levings, M. K., S. Gregori, E. Tresoldi, S. Cazzaniga, C. Bonini, and M. G. Roncarolo. 2005. Differentiation of Tr1 cells by immature dendritic cells requires IL-10 but not CD25+CD4+ Tr cells. Blood 105:1162-1169.

12. Steinbrink, K., E. Graulich, S. Kubsch, J. Knop, and A. H. Enk. 2002. CD4+ and CD8+ anergic T cells induced by interleukin-10-treated human dendritic cells display antigen-specific suppressor activity. Blood 99:2468-2476.

13. Allavena, P., L. Piemonti, D. Longoni, S. Bernasconi, A. Stoppacciaro, L. Ruco, and A. Mantovani. 1998. IL-10 prevents the differentiation of monocytes to dendritic cells but promotes their maturation to macrophages. Eur J Immunol 28:359-369.

14. Bingisser, R. M., P. A. Tilbrook, P. G. Holt, and U. R. Kees. 1998. Macrophage-derived nitric oxide regulates T cell activation via reversible disruption of the Jak3/STAT5 signaling pathway. J Immunol 160:5729-5734.

15. Gabrilovich, D. I., and S. Nagaraj. 2009. Myeloid-derived suppressor cells as regulators of the immune system. Nat Rev Immunol 9:162-174.

16. Kusmartsev, S. A., Y. Li, and S. H. Chen. 2000. Gr-1+ myeloid cells derived from tumor-bearing mice inhibit primary T cell activation induced through CD3/CD28 costimulation. J Immunol 165:779-785.

17. Adler, H. S., and K. Steinbrink. 2007. Tolerogenic dendritic cells in health and disease: friend and foe! Eur J Dermatol 17:476-491.

197

18. Banchereau, J., and R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245-252.

19. Chang, C. C., R. Ciubotariu, J. S. Manavalan, J. Yuan, A. I. Colovai, F. Piazza, S. Lederman, M. Colonna, R. Cortesini, R. Dalla-Favera, and N. Suciu-Foca. 2002. Tolerization of dendritic cells by T(S) cells: the crucial role of inhibitory receptors ILT3 and ILT4. Nat Immunol 3:237-243.

20. Gorczynski, R. M., Z. Chen, Y. Kai, S. Wong, and L. Lee. 2004. Induction of tolerance-inducing antigen-presenting cells in bone marrow cultures in vitro using monoclonal antibodies to CD200R. Transplantation 77:1138-1144.

21. Carreno, B. M., and M. Collins. 2002. The B7 family of ligands and its receptors: new pathways for costimulation and inhibition of immune responses. Annu Rev Immunol 20:29-53.

22. Chen, W., W. Jin, and S. M. Wahl. 1998. Engagement of cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) induces transforming growth factor beta (TGF-beta) production by murine CD4+ T cells. J Exp Med 188:1849-1857.


24. Morita, M., M. Fujino, G. Jiang, Y. Kitazawa, L. Xie, M. Azuma, H. Yagita, S. Nagao, A. Sugioka, Y. Kurosawa, S. Takahara, J. Fung, S. Qian, L. Lu, and X. K. Li. PD-1/B7-H1 interaction contribute to the spontaneous acceptance of mouse liver allograft. Am J Transplant 10:40-46.

25. Najafian, N., and M. H. Sayegh. 2000. CTLA4-Ig: a novel immunosuppressive agent. Expert Opin Investig Drugs 9:2147-2157.

26. Petroff, M. G., L. Chen, T. A. Phillips, and J. S. Hunt. 2002. B7 family molecules: novel immunomodulators at the maternal-fetal interface. Placenta 23 Suppl A:S95-101.

27. Zha, Y., C. Blank, and T. F. Gajewski. 2004. Negative regulation of T-cell function by PD-1. Crit Rev Immunol 24:229-237.

28. Gorczynski, R. M. 2005. CD200 and its receptors as targets for immunoregulation. Curr Opin Investig Drugs 6:483-488.

29. Gorczynski, R. M. 2006. Thymocyte/splenocyte-derived CD4+CD25+Treg stimulated by anti-CD200R2 derived dendritic cells suppress mixed leukocyte cultures and skin graft rejection. Transplantation 81:1027-1034.

30. Gorczynski, R. M., Z. Chen, K. Yu, and J. Hu. 2001. CD200 immunoadhesin suppresses collagen-induced arthritis in mice. Clin Immunol 101:328-334.


32. Kretz-Rommel, A., F. Qin, N. Dakappagari, E. P. Ravey, J. McWhirter, D. Oltean, S. Frederickson, T. Maruyama, M. A. Wild, M. J. Nolan, D. Wu, J. Springhorn, and K. S. Bowdish. 2007. CD200 expression on tumor cells suppresses antitumor immunity: new approaches to cancer immunotherapy. J Immunol 178:5595-5605.

33. Rosenblum, M. D., E. Olasz, J. E. Woodliff, B. D. Johnson, M. C. Konkol, K. A. Gerber, R. J. Orentas, G. Sandford, and R. L. Truitt. 2004. CD200 is a novel p53-target gene involved in apoptosis-associated immune tolerance. Blood 103:2691-2698.

198

34. Gorczynski, R. M., Z. Chen, X. M. Fu, and H. Zeng. 1998. Increased expression of the novel molecule OX-2 is involved in prolongation of murine renal allograft survival. Transplantation 65:1106-1114.



37. Gorczynski, R. M., Z. Chen, J. Hu, Y. Kai, and J. Lei. 2001. Evidence of a role for CD200 in regulation of immune rejection of leukaemic tumour cells in C57BL/6 mice. Clin Exp Immunol 126:220-229.

38. Aoki, T., Y. Matsumoto, K. Hirata, K. Ochiai, M. Okada, K. Ichikawa, M. Shibasaki, T. Arinami, R. Sumazaki, and E. Noguchi. 2009. Expression profiling of genes related to asthma exacerbations. Clin Exp Allergy 39:213-221.

39. Kojima, T., K. Obata, K. Mukai, S. Sato, T. Takai, Y. Minegishi, and H. Karasuyama. 2007. Mast cells and basophils are selectively activated in vitro and in vivo through CD200R3 in an IgE-independent manner. J Immunol 179:7093-7100.

40. Torrero, M. N., D. Larson, M. P. Hubner, and E. Mitre. 2009. CD200R surface expression as a marker of murine basophil activation. Clin Exp Allergy 39:361-369.

41. Griffiths, M. R., J. W. Neal, M. Fontaine, T. Das, and P. Gasque. 2009. Complement factor H, a marker of self protects against experimental autoimmune encephalomyelitis. J Immunol 182:4368-4377.

42. Penberthy, W. T., and I. Tsunoda. 2009. The importance of NAD in multiple sclerosis. Curr Pharm Des 15:64-99.

43. Taylor, N., K. McConachie, C. Calder, R. Dawson, A. Dick, J. D. Sedgwick, and J. Liversidge. 2005. Enhanced tolerance to autoimmune uveitis in CD200-deficient mice correlates with a pronounced Th2 switch in response to antigen challenge. J Immunol 174:143-154.

44. Holt, P. G., and D. H. Strickland. 2008. The CD200-CD200R axis in local control of lung inflammation. Nat Immunol 9:1011-1013.

45. Chitnis, T., J. Imitola, Y. Wang, W. Elyaman, P. Chawla, M. Sharuk, K. Raddassi, R. T. Bronson, and S. J. Khoury. 2007. Elevated neuronal expression of CD200 protects Wlds mice from inflammation-mediated neurodegeneration. Am J Pathol 170:1695-1712.

46. Copland, D. A., C. J. Calder, B. J. Raveney, L. B. Nicholson, J. Phillips, H. Cherwinski, M. Jenmalm, J. D. Sedgwick, and A. D. Dick. 2007. Monoclonal antibody-mediated CD200 receptor signaling suppresses macrophage activation and tissue damage in experimental autoimmune uveoretinitis. Am J Pathol 171:580-588.

47. Sebastiani, S., P. Allavena, C. Albanesi, F. Nasorri, G. Bianchi, C. Traidl, S. Sozzani, G. Girolomoni, and A. Cavani. 2001. Chemokine receptor expression and function in CD4+

T lymphocytes with regulatory activity. J Immunol 166:996-1002. 48. Lee, I., L. Wang, A. D. Wells, M. E. Dorf, E. Ozkaynak, and W. W. Hancock. 2005.

Recruitment of Foxp3+ T regulatory cells mediating allograft tolerance depends on the CCR4 chemokine receptor. J Exp Med 201:1037-1044.

49. Yuan, Q., S. K. Bromley, T. K. Means, K. J. Jones, F. Hayashi, A. K. Bhan, and A. D. Luster. 2007. CCR4-dependent regulatory T cell function in inflammatory bowel disease.

199

J Exp Med 204:1327-1334. 50. Szanya, V., J. Ermann, C. Taylor, C. Holness, and C. G. Fathman. 2002. The

subpopulation of CD4+CD25+ splenocytes that delays adoptive transfer of diabetes expresses L-selectin and high levels of CCR7. J Immunol 169:2461-2465.

51. Colvin, B. L., A. E. Morelli, A. J. Logar, A. H. Lau, and A. W. Thomson. 2004. Comparative evaluation of CC chemokine-induced migration of murine CD8alpha+ and CD8alpha- dendritic cells and their in vivo trafficking. J Leukoc Biol 75:275-285.

Mechanism(s) of action of the novel immunoregulatory ......ii Mechanism(s) of action of the novel...

Documents

Transcript of Mechanism(s) of action of the novel immunoregulatory ......ii Mechanism(s) of action of the novel...