Proc. Natl. Acad. Sci. USAVol. 91, pp. 7995-7999, August 1994Genetics

Mechanism of interferon action: Structure of the mouse PKR geneencoding the interferon-inducible RNA-dependent protein kinaseHIDEo TANAKA AND CHARLES E. SAMUEL*Department of Biological Sciences, Division of Molecular, Cellular and Developmental Biology, and Interdepartmental Biochemistry and Molecular BiologyGraduate Program, University of California, Santa Barbara, CA 93106

Communicated by W. K. Joklik, April 11, 1994

ABSTRACT The gene for the RNA-dependent eIF-2a pro-tein kinase (PKR) was isolated from mouse genomic DNA andcharacterized. The mouse PKR gene contains 16 exons andspans about 28 kilobase pairs. Exon 1 is untranslated; the AUGtranslation initiation site is located early in the second exon.Exon 16 includes the UAG translation termination site, AT-TAAA polyadenylylation signal, and a putative TA rather thanCA 3' cleavage site. Primer extension analysis determined onemajor as well as multiple minor transcription initiation sites;the major site was 159 bp upstream of the translation initiationsite. The complete cDNA of mouse PKR is, therefore, 2334 bpin length excluding the 3' poly(A)+ tail. The PKR gene 5'flanking region was a functional promoter in interferon-treated, transfected cells as measured with chloramphenicolacetyltransferase as the reporter gene. Sequence analysis of the5' flanking region disclosed numerous potential binding sitesfor transcription factors including both an ISRE element anda GAS element involved in interferon inducibility; Ets, Myb,MyoD, and E2F sites commonly associated with growth controlregulation and differentiation; and NF-ucB-like sites as well assites for two types of interleukin 6-activated factors, NF-IL6and APRF, often associated with acute-phase, immune, andinflammatory response genes.

Among the enzymes induced by interferon (IFN) is a RNA-dependent, cAMP-independent protein serine/threonine ki-nase designated PKR (1). PKR in earlier literature is vari-ously known as DAI; dsl; P1 kinase; p65, p67, or TIK for themouse kinase; and p68 or p69 for the human kinase (1). Thesubstrate of the PKR kinase is the a subunit of proteinsynthesis initiation factor eIF-2. Phosphorylation of eIF-2aon serine-51 leads to an inhibition of translation (1, 2).PKR plays a central role in the regulation of protein

synthesis in virus-infected and IFN-treated cells (3, 4). Inaddition, PKR has also been implicated in the control of cellproliferation and tumor suppression (5-7). Molecular cDNAclones of PKR have been isolated from human (8, 9) andmouse (10-12) cells. The mouse TIK protein isolated from amurine pre-B-cell library (10) was shown to be PKR based onsimilarity, both structural (9) and functional (11, 12), with thehuman PKR cDNA product. Structure-function analysesrevealed that the PKR protein possesses at least two func-tional domains. As an enzyme, the catalytic subdomainscharacteristic of all protein serine/threonine kinases arelocated in the C-terminal halfofthe PKR protein (1, 8, 9). ThePKR protein acquires enzymic activity following autophos-phorylation, a process mediated by an RNA-dependent con-formational change affecting the kinase catalytic subdomains(13, 14). The RNA-binding subdomains ofPKR are located inthe N-terminal half of the protein (1, 15). Genes encodingPKR have been mapped to a single locus, human chromo-some 2p21-22 and mouse chromosome 17E2, by in situ

hybridization analyses (16, 17). The level of enzymicallyactive PKR is regulated minimally at three levels in the cell:at the transcriptional level by IFN treatment (8, 9), at thetranslational level by an autoregulatory mechanism (18, 28),and at the posttranslational level by the RNA-mediatedautophosphorylation (1, 14).As an extension of our studies of the regulation and

function ofPKR, we have isolated and characterized genomicclones of the mouse PKR gene.t These results reveal asurprisingly complex organization of 16 exons for the PKRgene and provide insights regarding the regulation of expres-sion of PKR.

EXPERIMENTAL PROCEDURESMaterials. Unless otherwise specified, materials and re-

agents were as described (9, 19). A mouse genomic libraryprepared from adult mouse DBA/2J liver was from Clontech.Human a interferon (IFN-aA/D) and murine y interferon(IFN-y) were generously provided by S. Pestka (Piscataway,NJ) and by Genentech, respectively. pCAT-Basic and pCAT-Control plasmid vectors were from Promega; pRSV2-fOgalplasmid was provided by J. Nevins (Durham, NC). Lipofec-tin reagent was from GIBCO/BRL. Custom PKR oligonu-cleotide primers were obtained commercially from eitherOperon Technologies (Alameda, CA) or BioSynthesis (Lew-isville, TX).

Cell Maintenance and IFN Treatment. Mouse L fibroblastcells were grown in Dulbecco's modified Eagle mediumsupplemented with 5% fetal bovine serum, 100 units ofpenicillin per ml, and 100 pg of streptomycin per ml. IFNtreatment was with 1 x 103 units of IFN-aA/D per ml for 6hr, unless otherwise indicated.

Preparation of Mouse PKR cDNA Probes. The cDNAencoding mouse PKR has been reported (9-12). cDNAclones corresponding to the complete protein coding regionof mouse PKR were prepared by the reverse transcriptionPCR approach. Poly(A)+ RNA isolated from IFN-a-treatedmouse L cells (20) was reverse transcribed using randomhexamer primer (21) and the resulting first-strand cDNA wasamplified by PCR (22). Four PCR primers were used: com-binations of primer A (sense nt -69 to -52, where the A ofthe putative ATG translation start corresponds to nt + 1) withprimer B (antisense nt +1000 to + 1017); and primer C (sense,nt +952 to +969) with primer D (antisense nt +1598 to+1615). The resulting PCR products were digested witheither BamHI-EcoRI (pA-B) or EcoRI-Pst I (pC-D); thefragments were then purified and ligated into the pBluescriptvector to generate the mouse pBlue-PKR(BamHI-Pst I)

Abbreviations: IFN, interferon; UTR, untranslated region; PKR,RNA-dependent protein kinase; CAT, chloramphenicol acetyltrans-ferase.*To whom reprint requests should be addressed.tThe sequences reported in this paper have been deposited in theGenBank data base (accession nos. U09913-U09928).

7995

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

7996 Genetics: Tanaka and Samuel

construction, which includes the complete PKR proteincoding region.

Screening of Genomic Library. The mouse genomic libraryin the EMBL-3SP6/T7 A phage vector was screened by filterhybridization (9, 19) using random-primed 32P-labeled cDNAfragments of the mouse PKR cDNA as probes. Phage DNAwas prepared from twice-rescreened plaques and genomicinserts were characterized by restriction mapping and South-ern blot analysis (23). Restriction fragments from A genomicclones were then subcloned into the pBluescript plasmid fordetailed restriction mapping and DNA sequencing.

Sequence Analysis ofGenomic Clones. Plasmid subclones ofthe genomic DNA were sequenced by the Sanger dideoxy-nucleotide procedure (24) using the Sequenase protocolsfrom United States Biochemical. Universal primer sites in thepBluescript plasmid together with 24 custom PKR primerswere used. Sequences were analyzed using the University ofWisconsin Genetics Computer Group programs on a SiliconGraphics IRIS 4D/340VGX computer. The FINDPATTERNSprogram from the Genetics Computer Group and the tran-scription factor recognition site data bases (releases 7.3 and6.5) were used to identify transcription factor motifs withinthe 5' flanking region of PKR.

Southern Gel-Blot Analysis. High molecular weight ge-nomic DNA isolated from mouse L cells was digested withrestriction endonucleases, fractionated, and transferred toHybond-N filter membranes by the method of Southern (25);filters were probed (23) using the 32P-labeled BamHI-Pst Ifragment (1 x 106 cpm/ml) of mouse PKR cDNA.Primer Extension Analysis. A primer complementary to

bases -94 to -70 of the mouse PKR cDNA was end-labeled(1 x 108 cpm/,ug) with T4 polynucleotide kinase and thenannealed to RNA isolated (20) from either untreated orIFN-a-treated L cells. Primer extension with Moloney mu-rine leukemia virus reverse transcriptase and analysis of theextended product on a 6% DNA sequencing gel containing 7M urea were by standard protocols (23).

S1 Nuclease Mapping. S1 nuclease protection assays werecarried out as described (19). A 355-base probe was synthe-sized using an antisense custom primer complementary tobases -94 to -70 of the mouse PKR cDNA and the pBlue-script-5'PKR plasmid (PKR nt -423 to -32) as the template.

Transfection and Chloramphenicol Acetyltransferase (CAT)Assay. Transfection of L cells (60-mm dishes) with 10 pg ofeach reporter plasmid was performed by the Lipofectionmethod (26), using the Lipofectin reagent protocol fromGIBCO/BRL. Cells were harvested at 48 hr after transfec-tion. CAT and ,3-galactosidase assays were carried out asdescribed (23).

RESULTSIsolation ofGenomic Clones and Determination of the Struc-

tural Organization ofthe Mouse PKR Gene. A mouse genomiclibrary in the A vector EMBL3 was screened using fragmentsof the mouse PKR cDNA as probes. Overlapping phageclones containing the mouse PKR gene were isolated (Fig.1C). These clones were characterized by restriction mappingand Southern blot analysis. A composite map ofthe gene wasdetermined (Fig. 1B). The precise exon-intron organizationof the PKR gene was determined by sequencing plasmidsubclones. The mouse PKR gene contains 16 exons and spansabout 28 kb (Fig. 1A).Table 1 summarizes the complete exon-intron boundaries

of the mouse PKR gene. Exons range in size from 35 to 750bp, while introns range from 80 bp to 5.3 kbp in size; the splicesites all conform to the GT--AG rule (27). Exon 1 (143 bp)and part of exon 2 (16 bp) encode the 5' untranslated region(UTR) of the major (2.4 kb) PKR transcript. Exon 2 includesthe AUG translation initiation codon for the 515-amino acid

A1 2 3 4 567 8 9 10 11 12

I i i ii i i a

ATGBEE B

B Y'

13 14 1516

ES S E BES E BE B SX BS,, lY , Y

STOPES

C _ A 24 11A1 A,2 11

0 5 10 15 20 25 30kbI

FIG. 1. Physical map of the mouse PKR gene. (A) The structureofthe gene is represented with regard to the organization ofthe exonsand introns. Exons are indicated to scale by filled boxes numbered1-16; introns and the 5' and 3' flanking regions are indicated by thesolid lines. The entire gene spans about 28 kb in length and contains16 exons. Translation initiates in exon 2 and terminates in exon 16 asindicated. (B) The restriction map shows cleavage sites for endonu-cleases BamHI (B), EcoRI (E), Sac I (S), andXho I (X). (C) The fouroverlapping phage clones, 8, 1, 24, and 2, isolated from a A EMBL-3mouse genomic library, are shown to scale.

PKR protein. The N-terminal half of the mouse PKR mRNAthat encodes the RNA binding subdomains is composed of 8exons; exons 3 and 5 contain the two copies of the RNAbinding motif R core, R1 (exon 3) and R2 (exon 5), respec-tively (1, 15). The C-terminal half of the PKR mRNA thatencodes the kinase catalytic subdomains is composed of 7exons; exon 10 contains the catalytic subdomain II, the siteof the K296R mutation (1, 28). Exon 16 includes the UAGtranslation termination site and the 3' UTR.The structural organization of the mouse PKR gene deter-

mined from phage genomic clones (Fig. 1) was confirmed byrestriction mapping and Southern blot comparison with di-gests of genomic DNA isolated from mouse L cells. Therestriction map (Fig. 1) was consistent with the Southernpattern (data not shown). Furthermore, the pattern of bandswas consistent with the presence of a single copy of the PKRgene in the mouse haploid genome.

Nucleotide Sequence of the 5' Flanking Region. The 5'flanking region of the PKR gene was sequenced (Fig. 2). Thesequence is (G+C)-rich, 61%, and includes 23 CpG pairs.Computer analysis of the sequence revealed numerous po-tential binding sites for transcription factors. [Note that theA of the ATG translation initiation codon corresponds to nt+ 1 of the cDNA sequence (9, 10), and thus of the PKR exonsequence (Table 1, Fig. 2); this numbering system is usedthroughout the manuscript.]Among the factor motifs identified were several potentially

relevant to the regulation of the PKR gene expression,including two motifs involved in the transcriptional regula-tion of IFN-stimulated genes. An IFN-a/3-stimulated re-sponse element, ISRE (29), is present at nt -172 to -160, anda IFN-y-activated sequence, GAS (30), is present at nt -367to -359. A site for the interleukin 6 (IL-6)-activated acute-phase response factor (APRF) is present at -366 to -361(reverse) (31, 32). Interestingly, the APRF binding motif andthe GAS motif overlap with each other. Potential NF-KB (33)and NF-IL6 (34) sites are present in a tandemly arrangedorganization.

Motifs for factors commonly associated with growth con-trol regulation and differentiation are also present; theseinclude tandem sites for PEA3 of the Ets family (35), tandemMyb sites (31), the cytokine-specific sequence CK2 observedfirst in the promoter of the granulocyte/macrophage colony-stimulating factor (GM-CSF) gene (36), an E2F site (37), anda MyoD site (31). A retinoblastoma control element (RCE)site is also present (38).The 5' Flanking Region Is a Functional Promoter in Trans-

fected Cells. To examine whether the 5' flanking region ofthePKR gene was capable of functioning as a promoter, thepCAT-5'PKR vector was constructed by fusing the PKRgene

Proc. Natl. Acad. Sci. USA 91 (1994)

-I

Proc. Natl. Acad. Sci. USA 91 (1994) 7997

Table 1. Exon-intron sizes and junction sequences of the mouse PKR gene

Exon Intron

Size Junction Size Junction ExonNo. (base) (cDNA position) No. (kb) (cDNA position) No.1 143 ACTTTGgtaagacctgag I 4.1 cttcctttgcagGCCACT 2

-17 -162 132 CAGAAGgtaggctgccat II 1.8 cttttaaaccagGTTTAC 3

116 1173 121 AACAAGgtgagtgactgc III 2.0 ttttctttgtagGTGGAT 4

237 2384 137 TCAAAGgtgagagacttc IV 2.6 aatttttcctagATTTAT 5

374 3755 121 CCGCCGgtatgtgttgcc V 0.6 cccttctttcagAAAACT 6

495 4966 80 TAATGGgtgagcttgggt VI 0.12 cttttcttgtagTGTTTC 7

575 5767 49 TTTACGgtaggataccag VII 0.9 cttttgttgcagAACGGT 8

624 6258 35 AGGAGTgtgagtatcatt VIII 0.6 tctcaattttagAAAAGT 9

659 6609 51 CGCCAGgtaagcggagtt IX 2.2 aatcttatctagGTTTAA 10

710 71110 123 CACGGAgtgagtacctgt X 0.9 tcctttaaatagGAAGGC 11

833 83411 120 AAGTCGgtaagaagaaat XI 1.2 ttttgtatccagATACAA 12

953 95412 181 CTTAAGgtaagtaggaaa XII 5.3 ttttttctatagCCAGGT 13

1134 113513 132 GAACAGgtaaagcccttt XIII 1.8 ttcgcctttcagTTATTT 14

1266 126714 102 ATAAAGgtaaagacgcca XIV 1.2 gtggtatttcagTTTTTC 15

1368 136915 57 AAAGAAgtaagtccttga XV 0.080 tatcattaacagAAAAGC 16

1425 142616 750 ATTAAACACCAAGCAGGACTGCLaaaactctgcaata atttttttttcctgttacttcaaaagcaatcttac

2158 2175

(polyadenylylation signal) (G/T cluster)

The A of the ATG initiation codon, present in exon 2, corresponds to + 1 of the cDNA nucleotide sequence.For exon 16, the proposed polyadenylylation signal sequence ATTAAA, 3' cleavage, and polyadenylylation siteTA are shown along with 3' flanking sequence. For exon 1, the 5' nt of the major transcription start sitecorresponds to nt -159.

5' flanking BamHI fragment (nt -935 to -28) upstream ofthe CAT reporter gene in the pCAT-Basic plasmid vector.CAT activity values, calculated as percent conversion of[14C]chloramphenicol to the acetylated derivatives, werenormalized by f-galactosidase activity to control for varia-tions in transfection efficiency.Very low CAT activity was observed with the pCAT-Basic

plasmid vector, which lacks eukaryotic promoter and en-hancer sequences upstream of the CAT reporter gene. How-ever, pCAT-5'PKR, which contains the 5' flanking region ofthe PKR gene corresponding to nt -935 to -28 insertedupstream of the CAT reporter in pCAT-Basic, had signifi-cantly increased CAT activity. Treatment for 24 hr witheither IFN-aA/D (15.6% substrate conversion) or IFN-y(14.0% conversion) increased CAT activity about 3-fold overthat observed in untreated cells (5.6% conversion). In con-trast, pCAT-Xc1,g with the 5' flanking region of the PKRgene inserted in reverse orientation displayed very low CATactivity (0.5% conversion) for both untreated and IFN-aA/Dtreated cells. For comparative purposes, the positive controlvector pCAT-C containing the simian virus 40 promoter andenhancer gave 57.5% conversion. These results demonstratethat the 5' flanking region of the PKR gene corresponding tont -935 to -28 is a functional promoter in IFN-treated mouseL cells.

Mapping of the PKR Transcriptional Start Site. We iden-tified the precise location of the transcriptional start site byprimer extension analysis (Fig. 3A) and S1 nuclease mapping(Fig. 3B). The major product maps to a guanosine residue 159nt upstream ofthe translation initiation site. Additional minortranscription initiation sites, all purines, were observed in thevicinity of the major site. No products were detected incontrol experiments in which yeast tRNA was substituted forthe analyzed mouse cell RNA (data not shown). The yield ofprotected fragments obtained in the S1 mapping analysis forRNA isolated from IFN-treated L cells was enhanced overthat obtained with RNA from untreated cells (Fig. 3B),consistent with the conclusion based on previously reportedNorthern gel-blot and nuclear run-on analyses (8, 9) that thetranscription of the PKR gene is IFN inducible.

Analysisofthe 3' TerminusofPKRmRNA. The 3' UTR, 627nt, is completely within exon 16, which contains the polya-denylylation signal ATTAAA positioned at nt 2153-2158.Based on the cDNA sequence obtained for the oligo(dT)-primed PKR cDNA clone (10) and our PKR genomic se-quence data (Table 1), it is likely that 3' cleavage andpolyadenylylation of the PKR nascent transcript occurs afterthe T(A) at nt 2175(76) rather than a C(A). The T(A), 17 bpdownstream of the ATTAAA polyadenylylation signal, wasthe 3' terminal nucleotide of the cDNA clone (10). Located33 bp downstream of the ATTAAA motif is a G/T cluster

Genetics: Tanaka and Samuel

7998 Genetics: Tanaka and Samuel

DR1i DR1

(-423) GATCATTGAT CCAGGAdCAG GAtGCTTGGG_1TCTCCTTC -384NF-kB like

DR2 DR2v

-383 TTCTTCCTGC AGAGCTTCCCAG AGGAGT GTCCGAAACC -334Ets GAS Ets

NF-IL6 APRFDR3 DR3

-333 TGGAGAAGCT GGCAGrEACT GCAGTfGCAC AGGAGAGGGG AGGCGGGCCC -284Myb MYb SPi

E2A-283 GGACCTTGGC TCCCGCGCTG GGGTACAGAG GCGACACGCC TACCTGACTT -234

RCE CK2DR4 ' DR4 IR1

-233 CTCGCGGGTG C(§AGCCGETG CdGGAGGGGC CCAGAGCAGT GTGGGAAGGC -184NF-kB like NF-IL6<IR1 r+ r_+ ro e +r+

-183 GGACCGCC GI GA MCAIGMGAG AACCGGCCAG GCCCGGACiT -134ISRE

+ E2F-133 CCATGGGCAG CAGCAGCGGC AGGGAACGGA GGGCGAATAG ATTICAGAGC -84

-83 CTGCACCTGA AGTACAA1TC GAATCCTGCT CCAGGGAGCG AGCCACTGTC -34MyoD intron 1 ( 4.1 kb )

7 +1-33 CGGATCCAGA AAC1GCC ACTGGGAGGA AMATG

FIG. 2. Nucleotide sequence of the 5' flanking region of themouse PKR gene. The sequence of the promoter region as well as thecomplete exon 1 untranslated sequence (bases -159 to -17) areshown, where the A of the ATG translation start codon in exon 2 isdenoted at nt + 1. The transcriptional start sites are indicated by filledarrows, with the major site at the -159 G residue indicated with alarger arrow. Several potential transcription factor binding sites asdescribed in the text are shown, sites that have a perfect sequenceidentity with those previously reported or, in the case of NF-KB, asingle base mismatch. The location of the 4.1-kb intron 1 is shown byan open triangle between positions -16 and -17. Arrows above thenucleotide sequence indicate direct repeats (DR) or inverted repeats(IR).

followed by the trinucleotide TGT, structures frequentlyobserved in the region about 30 bp downstream of thepolyadenylylation signal (39). No additional candidate poly-adenylylation signals were found in the genomic sequencewithin 130 nt downstream of the proposed ATTAAA. Thus,including the 159 bp 5' UTR, the complete cDNA of themouse PKR would be 2334 bp in length excluding the 3'poly(A)+ tail.

Nucleotide Sequence of the PKR Exons Determined fromGenomic Clones. During the course of PKR genomic cloneDNA sequencing, several differences were found from thecDNA sequences reported for mouse PKR (10, 12). Nucle-otides 154 and 155 are CC instead of GG; nt 178 and 179 areCA instead of AC; nt 260 is a C instead of G; and, there aretwo additional A residues after nt 1527 (AAAAA instead ofAAA), which causes a shift in reading frame. The newpredicted C-terminal amino acid sequence is KKRNTC (ami-no acid residues 510-515). In the 3' UTR there is a deletionof the T following the T at nt 1571; there is a 16-nt (CAGA)4insertion after nt 1945; nt 2045 and 2046 are CC rather thanGG; and nt 2171 is a C instead of a G.

DISCUSSIONIFNs induce multiple biological responses, some overlappingand others not, ranging from the inhibition of virus growth tothe modulation of the immune response to the inhibition ofcell proliferation and differentiation (40). PKR, the IFN-inducible RNA-dependent protein kinase, is implicated bothin the antiviral actions ofIFN and in the effects ofIFN on cellgrowth (1, 41). In this paper, we provide information regard-ing the structure of the gene encoding mouse PKR. Twoimportant findings emerge from the results reported herein.The first is that structural organization of the 28-kb murinePKR gene is complex, involving 16 exons that constitute the2.4-kb mature mRNA transcript (9, 10) that encodes the PKRkinase. The second is that the 5' flanking region of the PKR

A 1

uCD uF U-I<00 IH-

J-

...:)

li

;ZZ

<: C) C W +

..-

FIG. 3. Determination of the transcription initiation site of themouse PKR gene. (A) Primer extension mapping. An end-labeledantisense primer, 5'-TACTTCAGGTGCAGGCTCTGAAATC-3'was annealed to total RNA (30 pg) isolated from mouse L cellstreated with IFN-aA/D. After extension with reverse transcriptase,the products were analyzed on a 6% polyacrylamide/7 M urea DNAsequencing gel (lane 5). A pBluescript plasmid construction contain-ing the 5' flanking region of the mouse PKR gene, pBluescript-5'PKR, was sequenced with the same antisense primer to generatea sequencing ladder (lanes 1-4). The larger arrow indicates the singlemajor extended product that terminated at base -159 (Fig. 2); thesmaller arrows indicate the minor extended products. (B) SI nucleasemapping. A 355-base antisense single-stranded DNA fragment wassynthesized using the end-labeled primer and the template as de-scribed in A. This probe was annealed to total RNA (30 pg) isolatedfrom mouse L cells that had been either treated with IFN-aA/D (+,lane S) or left untreated (-, lane 6). After digestion of the RNA*DNAheteroduplex with Si nuclease (200 units/ml), the products (lanes 5and 6) were analyzed on a DNA sequencing gel with sequencingladders derived from pBluescript-5'PKR (lanes 1-4 and 7-10) asdescribed in A.

gene includes multiple potential recognition sites for tran-scription factors implicated in the control of cell proliferationand differentiation as well as responsiveness to IFNs andother cytokines.A single major as well as multiple minor transcription

initiation sites were identified within the 5' flanking sequenceby primer extension and S1 nuclease mapping. The major sitewas similar forRNA isolated from untreated and IFN-treatedcells. The PKR promoter region lacked classical consensussequences such as a TATA box (42), a CAAT box (43), orCTCANTCT initiator positioning sequence (44) in the vicin-ity of the transcription start site. In this context, the mousePKR promoter shares common features with several otherprotein kinase genes from mammalian cells (45); these in-clude the lack of a TATA box, multiple transcriptionalinitiation sites, lack of a CAAT box at the standard position,and a high GC content of the promoter region.

Proc. Natl. Acad. Sci. USA 91 (1994)

.-

) S..:7 .-.

I I

,,- ( r, -,

Proc. Natl. Acad. Sci. USA 91 (1994) 7999

Sequencing the 5' flanking region of the PKR gene allowedus to recognize several potential binding sites for transcrip-tion factors. Adjacent to the major PKR transcription startsite is an ISRE sequence involved in the transcriptionalinduction of genes by type I (a and /3) IFNs (29, 46). Thesequence of the PKR ISRE (GGAAAACGAAACA) matchesthe consensus ISRE sequence (GGAAANNGAAACY) withthe exception of the terminal A.A GAS element involved in the transcriptional induction of

type II (y) IFN-stimulated genes is also present in the PKR5' flanking region (46). The GAS element core sequence ofPKR (TTCCCAGAA) exactly matches the GAS core of thehigh-affinity Fc receptor gene (30). Overlapping the PKRGAS core sequence is the recognition site for APRF, a factorthat interacts with promoters of genes encoding acute-phaseproteins (32). Promoters of genes involved in the inflamma-tory, immune, and acute-phase responses also often containbinding sites for both NF-IL6 and NF-KB, factors known tointeract in a structural and functional manner (32). The PKRregulatory region contains tandem NF-IL6 and NF-KB sites.

Overlapping the 5' portion of the PKR ISRE is an E2Fbinding site that exactly matches the consensus E2F se-quence (31). This may be important, as both IFNs andinterleukin 6 suppress the DNA binding activity of E2F ingrowth-sensitive hematopoietic cells (47). E2F is believed toregulate genes involved in cell cycle control; furthermore,E2F appears to be the target of the retinoblastoma geneproduct, which plays a major role in controlling mammaliancell growth (48). Potential elements for both Ets and Mybfactors are also present in the PKR promoter in closeproximity with each other. For optimal activity, Ets proteinsseem to require the adjacent binding of another transcriptionfactor, often Myb. Ets-family proteins and Myb are involvedin regulation of proliferation and differentiation during he-matopoiesis (35, 49).The existence within the PK.R promoter of multiple factor

recognition elements coincides with and may explain howmultiple stimuli can both limit and augment biologic responsesbelieved to involve PKR-for example, host response to virusmultiplication (1, 4) and control of cell proliferation (41). Afragment of the 5' flanking region of the PKR gene wassufficient to drive, in an orientation-dependent manner, theexpression of a CAT reporter gene in transfected L cells. It isnow offundamental importance to demonstrate, by systematicmutational analysis, which of the transcription factor motifspotentially relevant to the regulation ofPKR actually interactwith protein factors and under what conditions of cytokinetreatment and cell growth those interactions occur.We are grateful to Dr. D. C. Thomis of this laboratory for his

assistance with the isolation of parts of the murine PKR cDNA clone.This work was supported in part by Research Grant AI-20611 fromthe National Institute ofAllergy and Infectious Diseases, U.S. PublicHealth Service.1. Samuel, C. E. (1993) J. Biol. Chem. 268, 7603-7606.2. Hershey, J. W. B. (1989) J. Biol. Chem. 264, 20823-20826.3. Mathews, M. B. (1993) Semin. Virol. 4, 247-257.4. Samuel, C. E. (1991) Virology 183, 1-11.5. Chong, K. L., Feng, L., Schappert, K., Meurs, E., Donahue, T. F.,

Friesen, J. D., Hovanessian, A. G. & Williams, B. R. G. (1992)EMBO J. 11, 1553-1562.

6. Koromilas, A. E., Roy, S., Barber, G. N., Katze, M. G. & Sonen-berg, N. (1992) Science 257, 1685-1689.

7. Meurs, E. F., Galabru, J., Barber, G. N., Katze, M. G. & Hova-nessian, A. G. (1993) Proc. Nati. Acad. Sci. USA 90, 232-236.

8. Meurs, E., Chong, K., Galabru, J., Thomas, N. S. B., Kerr, I. M.,Williams, B. R. G. & Hovanessian, A. G. (1990) Cell 62, 379-390.

9. Thomis, D. C., Doohan, J. P. & Samuel, C. E. (1992) Virology 188,33-46.

10. Icely, P. L., Gros, P., Bergeron, J. J. M., Devault, A., Afar,D. E. H. & Bell, J. C. (1991) J. Biol. Chem. 266, 16073-16077.

11. Baier, L. J., Shors, T., Shors, S. T. & Jacobs, B. L. (1993) NucleicAcids Res. 21, 4830-4835.

12. Feng, G.-S., Chong, K., Kumar, A. & Williams, B. R. G. (1992)Proc. Natl. Acad. Sci. USA 89, 5447-5451.

13. Bischoff, J. R. & Samuel, C. E. (1985) J. Biol. Chem. 260, 8237-8239.

14. Samuel, C. E. (1979) Proc. Natl. Acad. Sci. USA 76, 600-604.15. McCormack, S. J., Thomis, D. C. & Samuel, C. E. (1992) Virology

188, 47-56.16. Barber, G. N., Edelhoff, S., Katze, M. G. & Disteche, C. M. (1993)

Genomics 16, 765-767.17. Squire, J., Meurs, E. F., Chong, K. L., McMillan, N. A. J., Hov-

anessian, A. G. & Williams, B. R. G. (1993) Genomics 16,768-770.18. Barber, G. N., Wambach, M., Wong, M.-L., Dever, T. E., Hinne-

busch, A. G. & Katze, M. G. (1993) Proc. Natl. Acad. S6. USA 90,4621-4625.

19. Aebi, M., FMh, J., Hurt, N., Samuel, C. E., Thomis, D., Bazzigher,L., Pavlovic, J., Haller, 0. & Staeheli, P. (1989) Mol. Cell. Biol. 9,5062-5072.

20. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J. & Rutter,W. J. (1979) Biochemistry 18, 5294-5299.

21. Gubler, U. & Hoffman, B. J. (1983) Gene 25, 263-269.22. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T.,

Erlich, H. A. & Arnheim, N. (1985) Science 230, 1350-1354.23. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular

Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press,Plainview, NY), 2nd Ed.

24. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad.Sci. USA 74, 5463-5467.

25. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517.26. Felgner, P. L., Gadek, T. R., Holm, M., Roman, R., Chan, H. W.,

Wenz, M., Northrop, J. P., Ringold, G. M. & Danielsen, M. (1987)Proc. Natl. Acad. Sci. USA 84, 7413-7417.

27. Padgett, R. A., Grabowski, P. J., Konarska, M. M., Seiler, S. &Sharp, P. A. (1986) Annu. Rev. Biochem. 55, 1119-1150.

28. Thomis, D. C. & Samuel, C. E. (1992) Proc. Natl. Acad. Sci. USA89, 10837-10841.

29. Williams, B. R. G. (1991) Eur. J. Biochem. 200, 1-11.30. Pearse, R. N., Feinman, R., Shuai, K., Darnell, J. E. & Ravetch,

J. V. (1993) Proc. Natl. Acad. Sci. USA 90, 4314-4318.31. Faisst, S. & Meyer, S. (1992) Nucleic Acids Res. 20, 3-26.32. Wegenka, U. M., Buschmann, J., Lutticken, C., Heinrich, P. C. &

Horn, F. (1993) Mol. Cell. Biol. 13, 276-288.33. Baeuerle, P. A. (1991) Biochim. Biophys. Acta 1072, 63-80.34. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio,

Y., Nakajima, T., Hirano, T. & Kishimoto, T. (1990) EMBO J. 9,1897-1906.

35. Wasylyk, B., Hahn, S. L. & Giovane, A. (1993) Eur. J. Biochem.211, 7-18.

36. Shannon, M. F., Gamble, J. R. & Vadas, M. A. (1988) Proc. Natl.Acad. Sci. USA 85, 674-678.

37. Mudryj, M., Hiebert, S. W. & Nevins, J. R. (1990) EMBO J. 9,2179-2184.

38. Kim, S.-J., Onwuta, U. S., Lee, Y. I., Li, R., Botchan, M. R. &Robbins, P. D. (1992) Mol. Cell. Biol. 12, 2455-2463.

39. Birnstiel, M. L., Busslinger, M. & Strub, K. (1985) Cell41, 349-359.40. Pestka, S., Langer, J. A., Zoon, K. C. & Samuel, C. E. (1987)

Annu. Rev. Biochem. 56, 727-777.41. Lengyel, P. (1993) Proc. Natl. Acad. Sci. USA 90, 5893-5895.42. Breathnach, R. & Chambon, P. (1981) Annu. Rev. Biochem. 50,

349-383.43. McKnight, S. L. & Kingsbury, R. (1982) Science 217, 316-324.44. Smale, S. T., Schmidt, M. C., Berk, A. J. & Baltimore, D. (1990)

Proc. Natl. Acad. Sci. USA 87, 4509-4513.45. Voss, H., Wirkner, U., Jakobi, R., Hewitt, N. A., Schwager, C.,

Zimmermann, J., Ansorge, W. & Pyerin, W. (1991) J. Biol. Chem.266, 13706-13711.

46. Pellegrini, S. & Schindler, C. (1993) Trends Biochem. Sci. 18,338-342.

47. Melamed, D., Tiefenbrun, N., Yarden, A. & Kimchi, A. (1993) Mol.Cell. Biol. 13, 5255-5265.

48. Nevins, J. R. (1992) Science 258, 424-429.49. Shen-Ong, G. L. C. (1990) Biochim. Biophys. Acta 1032, 39-52.

Genetics: Tanaka and Samuel