May 2011 - Alaska Business Monthly

May 2011 $3.95

Special Section: Oil and Gas ■ Special Sec tion: Building Alaska

Tim AdamsCo-OwnerSharps Billiards/Kenai

Philip Brower(Seated)Co-OwnerSharps Billiards/Kenai

SBA Small Business Persons of the Year

Page 56

Page 50

ProfessionalLiability Insurance

A must for business

XTO Energy Inc.810 Houston StreetFort Worth, Texas 76102817.870.2800www.xtoenergy.com

leather seats, no

aluminum wheels, no

rear defroster, no

keyless entry, yes

There are plenty of options in Alaska – America’s Last Frontier.

Naturally, we’re proud to be a part of it.

www.akbizmag.com • Alaska Business Monthly • May 20114 www.akakbbizmag.com • Alasskaka Business Monthly • y May y 2020114

From the Editor . . . . . . . . . . . . . . 7Inside Alaska Business . . . . . . . . 8Events Calendar . . . . . . . . . . . . 41Right Moves . . . . . . . . . . . . . . . . 42Market Squares . . . . . . . . . . . . . 55Alaska Trends . . . . . . . . . . . . . . 119Ad Index . . . . . . . . . . . . . . . . . . 122

D E PA R T M E N T S

M AY 2 0 1 1TA B L E O F C O N T E N T S

R E G U L A R F E AT U R E S

ABOUT THE COVER:Philip Vern Brower and Tim D. Adams took the

Alaska Small Business Persons of the Year award by the Small Business Administration of Alaska. They own and operate Sharps Billiards, a family friendly billiards hall in Kenai. Story and this month’s Small

Business Special Section begins on page 56. Photo ©2011 M. Scott Moon.

A R T I C L E S

ASSOCIATIONSAlaska Oil and Gas Association . . . . . . . . . . . . . . . . . 18By Tracy Barbour

REGIONAL REVIEW Yukon-Kuskokwim Delta, a Vast Coastal Plain. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24Bethel hub of regionBy Tracy Barbour

BUSINESS BASICSPerformance Reviews . . . . . . . . . . . . . . . . . . . . . . . . . 28The most abused business processBy Eric Britten

HR MATTERSFive Essentials for Avoiding Legal Trouble with Employees . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30By Lynne Curry

LEGAL SPEAKProtecting Personal Assets . . . . . . . . . . . . . . . . . . . . . 32Tips for the small business ownerBy Jeff Waller

TOWNS IN TRANSITIONBarrow Blues . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38Housing shortage, growing population challenge far north communityBy Heidi Bohi

ALASKA THIS MONTHVolunteers Spruce Up Anchorage. . . . . . . . . . . . . . . . 40Citywide cleanup week brings spring cleaning outdoorsBy Nancy Pounds

VIEW FROM THE TOPKory Joyner, Owner . . . . . . . . . . . . . . . . . . . . . . . . . . 105Superstar Pastry DesignBy Peg Stomierowski

FINANCIAL SERVICES

Alaska Growth Capital Brings Funding to Alaska. . . 12Federal program trades tax credits for community investmentsBy Rob Stapleton

TRANSPORTATION

First-Class Business Travel . . . . . . . . . . . . . . . . . . . . . 20Trends in the industryBy Neal Webster Turnage

TRANSPORTATION

Crowley’s Habit: Ready and Waiting . . . . . . . . . . . . . . 34Company has long history of disaster responseBy Tracy Kalytiak

MINING OP-EDMineral Industry In 2011. . . . . . . . . . . . . . . . . . . . . . . . 44Another good year for AlaskaBy Steve Borell

MINING

Alaska Big Boys . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46Mines and projects in reviewBy Curtis J. Freeman

INSURANCE

Professional Liability Insurance Protects Businesses . . . . . . . . . . . . . . . . . . . . . . . . . . 50By Deborah Jeanne Sergeant

TECHNOLOGY

Corporate Communications . . . . . . . . . . . . . . . . . . . . 52In this do-it-yourself world, why do it yourself? By Kent L. Colby

(continued on page 6)

52PAGE

M AY 2 0 1 1TA B L E O F C O N T E N T S

Photo by Judy Patrick

66PAGE

110PAGE

Photo courtesy of MWH

www.akbizmag.com • Alaska Business Monthly • May 20116

OIL & GAS SPECIAL SECTION

Blessed Alaska? . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66Moving more oil through pipeline critical priorityBy Mike Bradner

Point Thomson . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72Will it keep Alaska oil flowing?By Jack E. Phelps

Moveable Energy – Liquefied Natural Gas . . . . . . . 76Market sector to watch By Jack E. Phelps

Value-Added Natural Gas . . . . . . . . . . . . . . . . . . . . . 80Gas-to-Liquids under discussion By Mike Bradner

Bringing LNG to the Bush. . . . . . . . . . . . . . . . . . . . . 84Projects must show profit to be fundedBy Rindi White

Support Oil and Gas Now! . . . . . . . . . . . . . . . . . . . . 87

ABM’s 2011 Oil & Gas Directory . . . . . . . . . . . . . . . . . 87

SMALL BUSINESS SPECIAL SECTION

Alaska Small Business Persons of the Year . . . . . . .56Phillip Brower and Tim Adams honored by SBA for Sharps BilliardsBy Tracy Kalytiak

SBA Financial Champ of Year . . . . . . . . . . . . . . . . . . .57Overcoming challenges, rising to the topBy Tracy Kalytiak

‘Black Gold’ for BEP Co. . . . . . . . . . . . . . . . . . . . . . . .58Toner cartridge remanufacturer serves Southeast By Richard Schmitz

Helping Anchorage Women Entrepreneurs. . . . . . . .60ATHENA Society is taking applicationsBy Gail West

Becoming an Entrepreneur OP-ED. . . . . . . . . . . . .62Mitigate risks to avoid needing rescuedBy Sam J. Dickey

BUILDING ALASKA SPECIAL SECTION

Construction Roundup . . . . . . . . . . . . . . . . . . . . . . 106Railbelt energy, hospitals and corrections top projects list

Alaska Construction Academies . . . . . . . . . . . . . . 109Training workers for the industryBy Nicole Bonham Colby

Susitna Dam Mega Project . . . . . . . . . . . . . . . . . . . 110Building new energy for AlaskaBy Gail West

Unalaska Upgrades for Dutch Harbor Fishing Fleet . . . . . . . . . . . . . . . . . . . . . . . . 114Carl E. Moses Boat Harbor adds needed infrastructureBy Gail West

Mat-Su Builders Recognized . . . . . . . . . . . . . . . . . 117Custom homes earn Pevan, Wirtanen awardsBy Rindi White

CORRECTIONSThe April issue of Alaska Business Monthly incorrectly identified Kurtis R. Morin, co-owner of Ward Cove-based Alaska Shellfish, as Kevin Morin on pages 34 and 35. Alaska Business Monthly sincerely regrets the error.

Volume 27, Number 5Published by

Alaska Business Publishing Co.Anchorage, Alaska

Vern C. McCorkle, Publisher1991~2009

EDITORIAL STAFF Managing Editor Debbie Cutler Associate Editor Susan Harrington Art Director Candy Johnson Art Production Linda Shogren Photo Consultant Chris Arend Contributing Photographers Judy Patrick Azimuth Adventure Photography

BUSINESS STAFF President Jim Martin National Sales Mgr. Charles Bell Account Mgr. Anne Campbell Account Mgr. Bill Morris Traffic Coordinator Ann Doss Accountant Mary Schreckenghost

501 W. Northern Lights Boulevard, Suite 100Anchorage, Alaska 99503

(907) 276-4373Outside Anchorage: 1-800-770-4373

Fax: (907) 279-2900www.akbizmag.com

Editorial e-mail: [email protected] e-mail: [email protected]

Pacific Northwest Advertising Sales1-800-770-4373

ALASKA BUSINESS PUBLISHING CO., INC.

ALASKA BUSINESS MONTHLY (ISSN 8756-4092) is published monthly by Alaska Business Publishing Co., Inc., P.O. Box 241288, Anchorage, Alaska 99524; Telephone: (907) 276-4373; Fax: (907) 279-2900, ©2011, Alaska Business Publishing Co. All rights reserved. Subscription Rates: $39.95 a year. Single issues $3.95 each; $4.95 for October. Back issues $5 each. Send subscription orders and address changes to the Circulation Department, Alaska Business Monthly, P.O. Box 241288, Anchorage, AK 99524. Please supply both old and new addresses and allow six weeks for change. Manuscripts: Send query letter or manuscripts to the Editor. Alaska Business Monthly is not responsible for unso-licited materials. Photocopies: Where necessary, permission is granted by the copyright owner for libraries and others registered with Copyright Clearance Center to photocopy any article herein for $1.35 per copy. Send payments to CCC, 27 Congress Street, Salem, MA 01970. Copying done for other than personal or internal reference use without the expressed permission of Alaska Business Monthly is prohibited. Address requests for specific permission to the Editor, Alaska Business Monthly. Online: Alaska Business Monthly is available online from Data Courier and online from Thomson Gale. Microfilm: Alaska Business Monthly is available on microfilm from University Microfilms International, 300 North Zeeb Rd., Ann Arbor, MI 48106.

F R O M T H E E D I T O R

www.akbizmag.com • Alaska Business Monthly • May 2011 7

Kudos to the University of Alaska Board of Regents who changed

its non-discrimination policy in mid-February to include sexual orientation, despite the fact they are not required to under Alaska Human Rights Law AS 18.80, which states protected classes are those based on religion, sex, race, color, age, national origin, disabilities, parenthood, pregnancy, marital status and change in marital status.

Many will disagree with me, but I say the UA system is ahead of the game and moving in the right direction.

Recently, I had the opportunity to read Martin Luther King’s speech “I have a dream.” Of course, I had read it before, heard it before, but this time it made more of an impact. I was in a classroom setting working on my MBA at a private religious-based uni-versity, when a gentleman in my class openly said he personally discrimi-nates against gays in the workplace – this, moments after we talked about the importance of the freedom King’s speech challenged us all to achieve.

I raised my hand and asked, “But what about what King taught us? Isn’t discrimination against gays today no different than discriminating against blacks when Martin Luther King preached tolerance for everyone, free-dom for everyone?”

Some will disagree. Some will say Biblically, gays are sinners and should not be given “special” freedoms. But in my opinion, freedom is freedom, for one and for all, and what our country

is based upon. And in my opinion, we all are sinners, and should judge not lest we be judged.

God didn’t make us clones of him, he didn’t take away our brains, he doesn’t want us to be puppets. He wants us to think for ourselves, make our own mistakes, find our own way to him, through good times and bad, through living, loving and learning. Love toward others being most im-portant of all.

I am lucky to work for an organiza-tion that does not discriminate. We have had gays work for us, people of many different ethnic groups, we currently have more women than men on staff and other times the opposite, and the majority of us are middle-aged. Some are raising children, some single, some married. We’ve had people with dis-abilities, and I’m sure sometime in the history of the organization, someone got pregnant.

What a pleasure it is to know man-agement has a tolerance policy toward everyone, and a no-tolerance policy against those who show hatred and act cruelly to anyone different.

I say the University of Alaska took one brave step forward in a world that hates. But so do we. And I’m not ashamed to stand up proudly and say so. Remember to love. Remember tol-erance. The world would be much bet-ter off indeed.

— Debbie Cutler Managing Editor

Freedom to One,Freedom to All

No place in workplacefor discrimination

New Barge Begins Rural Service

NorthStar Gas expects service to begin in May of its new shal-

low-draft fuel and deck-cargo barge. NorthStar Gas believes the new vessel will improve fuel and freight deliver-ies to Western Alaska communities. Delta Western will operate the 162-foot Cauneq, which in Yupik means “a place or thing to turn to.” The barge is ca-pable of carrying up to 200,000 gallons of fuel plus deck freight. NorthStar Gas and Delta Western aim to work together in an effort to help stabilize fuel trans-portation costs in Western Alaska.

NSG is an Alaska Native member-owned fuel distributor made up of 16 Alaska village corporations and two re-gional corporations. NSG serves more than 150 businesses in about 50 villages in the Yukon, Kuskokwim and Coastal region and has delivered more than 43 million gallons of fuel. Delta Western, a leading Alaska fuel distributor, has been serving Alaska communities for almost 30 years.

“This is great news for Western Alaska,” said Elaine Brown, NorthStar Gas president. “Many of our custom-ers are also owners of NorthStar Gas, so this important step of fuel barge-ownership is very meaningful.”

All Pro Alaska Joins National Dealer Network

All Pro Alaska has joined the na-tionwide network of Toyota In-

dustrial Equipment dealers. Toyota Material Handling U.S.A. Inc. added the Anchorage business as a new dealer

in its network. All Pro Alaska offers forklifts, warehouse equipment, parts, service and rentals. Jesse Thacker, who owns All Pro Alaska, has served as gen-eral manager since 2004. His parents, Bruce and Joann Thacker, founded B & J Forklift Services, later named All Pro Alaska.

GeoNorth Lands Software Reseller Designation

GeoNorth was chosen as an official government reseller in Alaska

and Oregon for Autodesk, a software company specializing in computer-aided design. AutoCAD software is Autodesk’s main product.

“With this authorization in place, GeoNorth is in a unique position to be a one-stop shop for geographic infor-mation systems, Web and now CAD development in Alaska, the Pacific Northwest, and on the East Coast,” said Bob Johnson, GeoNorth’s sales and marketing manager.

GeoNorth is based in Anchorage and has branch offices in Idaho, Or-egon and Virginia.

SBDC Marks 25 Years

The Alaska Small Business Devel-opment Center marks its 25th an-

niversary this year. The Alaska SBDC is a cooperative venture of the U.S. Small Business Administration and the University of Alaska Anchorage. The Alaska SBDC has centers in Anchor-age, Bethel, Fairbanks, Homer, Juneau, Ketchikan, Soldotna and Wasilla. The centers will offer anniversary open

houses throughout the year. For more information about the Alaska SBDC, visit www.aksbdc.org.

ABM Art Director Takes Two Awards from Alaska Press Club

Candy Johnson, art director for Alaska Business Monthly, took two

awards at the Alaska Press Club awards ceremony Saturday April 2. Johnson took second place for Best Magazine Overall Design. She also took third place for Best Magazine Cover: “Alaska Native Corporations Review: Eyes Toward the Future,” which was featured in Septem-ber 2010. Johnson has been with Alaska Business Monthly since summer 2001.

“We are very proud of Candy,” said Jim Martin, ABM president and general manager. “She brings a lot of talent to the company, is creative and deserves this recognition.”

To see other award winners, link to http://www.adn.com/static/includes/2011-APC/2010-apc-judge ments-with-comments.pdf.

INS IDE ALASKA BUS INESS COMPILED BY NANCY POUNDS


k

UAA Begins Lemonade Day for Schoolchildren

The UAA College of Business and Public Policy and UA Center for

Economic Development planned to debut Lemonade Day Alaska on May 1. Lemonade Day is a national program created by Prepared for Life, which teaches students business and leader-ship lessons using lemonade stands. Lemonade Day teaches young people how to start, own and operate their own businesses. The event is open to children in pre-kindergarten through high school. Children participate for free, working with a mentor and com-plete prepared lessons together. They apply new skills on Lemonade Day by operating their own lemonade stand. UAA has worked to attract community leaders and other volunteers for the first Lemonade Day. Event coordina-tors hoped to have 1,100 Alaska chil-dren participate.

USTravel Opens New Seattle Office

USTravel has opened its new re-gional headquarters office in

Seattle. The company closed smaller offices in Federal Way, Bellevue and Georgetown, and the new office takes over those operations. The company also aims to add mobile travel applica-tions, social media and latest industry advancements this year. USTravel has 15 locations in Alaska, Washington and Iowa, with five subsidiaries providing travel services for corporations, govern-ments, groups and leisure travelers.

UA Press Releases e-Books

Several University of Alaska Press new and best-selling titles are now

available as e-books via the Amazon Kindle Store. A partnership with the University of Chicago Press helped fund the e-book publications. Several months ago, the University of Chicago Press entered into an umbrella agree-ment with Amazon Digital Services Inc., allowing their partner presses to publish electronic books for sale in the Kindle Store. UA Press has collabo-rated with the University of Chicago Press since 2007 to expand its presence in the Lower 48 and internationally.

Among the books now available on the Kindle are Brian Garfield’s best-seller “The Thousand-Mile War: World War II in Alaska and the Aleu-tians,” Terrence Cole’s “Fighting for the Forty-Ninth Star: C. W. Snedden and the Crusade for Alaska Statehood” and Edna Wilder’s “Once Upon an Eskimo Time.” For more information about UA Press or to order books online, visit www.uapress.alaska.edu.

Denali Hotel, Employees Earn Industry Honors

The Alaska Hotel and Lodging As-sociation awarded the 188-room

McKinley Village Lodge with Outstand-ing Property of the Year Award. The honor is part of the group’s annual Stars of the Industry awards. The Doyon/ARAMARK joint venture at Denali National Park and Preserve received the Good Earthkeeping Award for their outstanding environmental efforts inside

the park. Also, three employees were honored for service. They are Samira Porter, front office manager of the year; Gretchen Weeks, housekeeping man-ager of the year and Kim White, guest services manager of the year. Doyon/ARAMARK is the Denali Park con-cessionaire, operating bus tours, park shuttles, food and beverages locations, and campground and retail sites.

Calista Adds Heritage Foundation

Calista Corp. recently created the Calista Heritage Foundation, which

will focus on scholarships and intern-ship opportunities for postsecondary students, plus programs and services for elders. The foundation combines two programs, the Calista Scholarship Fund and the Calista Elders Council. The scholarship program has provided more than $1.5 million to shareholders and descendants since its start in 1994. The elders council was created by the Calista board of directors to provide services and programs to elders age 65 years and older.

State Honors Copper River Highway

The Alaska Department of Trans-portation and Public Facilities

designated the Copper River Highway as an Alaska State Scenic Byway. The 52-mile road is located in the Copper River Delta. From 1911 to 1938 this cor-ridor contained the Copper River and Northwestern Railroad, which brought

INS IDE ALASKA BUS INESS


rich copper ore to the harbor town of Cordova. The now-abandoned railroad travels through the region, which sup-ports a stopover for more than 500,000 migratory birds. Scenic byways are eligible for grant funding to help create unique travel experiences and enhance local quality of life through efforts to preserve, protect, interpret and promote the qualities of the area.

Fairbanks Firm Earns State Safety Award

Bighorn Enterprises LLC of Fairbanks received the Sstate Department of

Labor and Workforce Development’s Construction Health and Safety Excel-lence Award. The honor recognizes the construction company’s efforts to reduce workplace injuries and incidents by pursuing the voluntary partnership. The company provides excavation and site prep, demolition, road construc-tion, transportation, new commercial, light industrial and multi-family hous-ing construction. Butch Whiting and Joshua Bennett own Bighorn Enter-prises. The award is given as part of the Alaska Construction Health and Safety Excellence Program.

Alaska USA Supports Armed Services YMCA

Alaska USA Federal Credit Union and the Alaska USA Foundation

donated $65,000 to the Armed Ser-vices YMCA of Alaska. The group provides educational, social and rec-reational programs to the military and

their families in Alaska. Alaska USA donated $25,000, and the Alaska USA Foundation donated $40,000 to support Armed Services YMCA programs and services on Joint Base Elmendorf Rich-ardson and Fort Wainwright.

Writing Workshops Set for McCarthy

The Wrangell Mountains Center in McCarthy is offering two creative

writing workshops this year, one in July and another in August. Essayist Kath-leen Dean Moore, Nancy Cook and Ma-ria Shell will lead the creative nonfiction workshop July 24-30. Jeremy Pataky and Elizabeth Bradfield will conduct the first Wrangell Mountains Poetry Workshop on Aug. 12-18. The events spring off the successful weeklong Wrangell Moun-tains Writing Workshop, which has run for 13 years.

This year’s workshops will be held in the historic Old Hardware Store facility. Activities will include craft talks, writing prompts and exercises, guided field ex-cursions to the Kennicott Root glaciers, a public reading featuring workshop faculty and a chance to share writing in a literary open mic night, group and one-on-one feedback, and a deadline to complete a new piece by week’s end. To register, contact Jeremy Pataky at [email protected] or 907-244-7717.

Apocalypse Design Wins State Honor

The State Made in Alaska program chose Apocalypse Design as the

2010 Manufacturer of the Year. Based in Fairbanks, the firm crafts cold-weather outdoor gear and products. The com-pany, begun in 1983, has been a Made in Alaska permit holder since 1995. Apocalypse Design has a year-round staff of five, with an additional 15 posi-tions added during the busy season.

“As a well-established local manu-facturer, Apocalypse Design has earned this award,” said Wanetta Ayers, director of the state Division of Economic Devel-opment. “The company has a notable history of good service to Alaskans and of productive contributions to Alaska’s manufacturing industry and economy.”

UAF Develops Food-Preservation DVDs

The University of Alaska Fairbanks Cooperative Extension Service has

produced three new DVDs detailing ways to help Alaskans preserve foods: “Cold Storage,” “Roses and Fireweed” and “Processing Game Meat.”

“Cold Storage” demonstrates how to preserve fruits and vegetables by freez-ing or by storing in different types of root cellars. “Roses and Fireweed” explains how and when to harvest and use fire-weed sprouts, fireweed and rosehip blos-soms and rosehips. “Processing Game Meat” offers information on the slaugh-ter and processing of reindeer, lessons that are applicable to moose, caribou and other large game. The DVDs sell for $5 and are available through extension offices or by calling toll-free, 877-520-5211. Interactive online lessons on the same topics are available at www.uaf.edu/ces/preservingalaskasbounty. ❑

INS IDE ALASKA BUS INESS


This month, CRW Engineering Group, LLC is celebrating its 30-year anniversary. It’s been

a fast, fun ride. CRW was established as a sole proprietorship by Willem Van Hemert, P.E., in 1981. Today, it is a lim-ited liability company with nine part-ners and a talented staff of 58 employ-ees, including 26 registered engineers and three registered land surveyors.

“When you reach these milestones, you can’t help but reflect on the journey we have taken to get to where we are to-day,” says Managing Partner Mike Rabe, P.E. “I am particularly proud of the posi-tive impact we have on our state – both to the communities we serve and the employees we provide jobs.”

Over the years, CRW has maintained a distinctive, fun-focused culture. Its mission is to provide outstanding engineering services through enthusiastic employees who work in an enjoyable environment and recognize the importance of each and every client. A pleasant work atmo-sphere fosters creativity, innovation and collaboration, all of which translate into superior technical solutions.

“Our employees really enjoy what they do; our clients see it, and it’s reflect-ed in the work product they provide,” Rabe says.

But the fun meter at CRW registers beyond its corporate walls. The com-pany supports employees in everything from hockey and snowshoe softball games to rafting trips and a shotgun club. “It’s a way for people to get togeth-er outside the office and have fun,” Rabe says. “We truly believe we’re a family, and it starts at the top.”

CRW’s unique culture also appeals to clients. “Our clients enjoy working with us because we’re fun to work with, and we develop real, personal relationships with them to make everyone’s work more pleasant,” says Marketing Direc-

tor Leah Boltz. “They know they can trust us because we are genuine, and we care about them.”

CRW takes a comprehensive approach to serving clients and the more than 90 Alaska communities in which it has worked. Boltz says: “We get to know our clients’ clients; our work doesn’t stop at just turning in our drawings or construct-ing a project. We are there for support, and our projects serve the Alaskans who will be using the facilities.”

Supporting Alaska’s communities is a priority for CRW. Its employees have given their time, resources and finan-cial donations to various organizations working toward community improve-ment, such as Adopt-A-Trail Cleanup, United Way and Food Bank of Alaska. “We have been very successful, and we feel it is part of our privilege to give back to the community,” Rabe says.

Much of CRW’s success is due to its ability to modify its corporate structure – while maintaining its culture – to better serve clients. These changes include in-creasing ownership opportunities, invest-ing in current technologies, supporting professional organizations, and initiating

employee training and professional devel-opment credits. Everything goes back to the company’s mission.

CRW’s work has primarily involved public and government projects in An-chorage and Western Alaska. For its efforts, CRW has garnered impressive awards, including recognition as one of the CE News Best Civil Engineering Firms to Work For (2007-2010), 2010 Best Recruiting and Retention Pro-gram and multiple Heart of Anchorage awards for its trail and road projects. “I feel like we’re meeting our mission statement,” Rabe says.

Wolk & Associates


Alaska Growth Capital Brings Funding to Alaska

A federal program that trades tax credits for community invest-ments in low-income and pov-

erty areas is soon to help Alaska Native elders live the last days of their lives with quality care.

Alaska Growth Capital BIDCO Inc. – a subsidiary of Arctic Slope Regional Corp. – seized the opportunity to use a new federal program to assist the Ma-niilaq Association to secure a much needed portion of the funding for the 18-bed Maniilaq Association Nursing Home in Kotzebue.

“The beauty of this project is that outside-of-Alaska funding will help Inupiat elders who in the past had to be moved to Anchorage or Fairbanks long-term advanced care facilities, can now live close to their

families in their region,” said Mani-ilaq President Ian Erlich.

Alaska Growth Capital combined the need by the Maniilaq Association, a nonprofit corporation, along with the State of Alaska, Dudley Ventures LLC and New York Community Bank to secure $18.9 million.

Maniilaq is a nonprofit with 550 em-ployees that serves all of the Northwest of Alaska, including the village of Point Hope. The association also represents a dozen federally recognized tribes in Northwest Alaska by providing health and social services, tribal services and human resources to rural residents there.

FINANCIAL SERVICES

Federal program trades tax credits for community investmentsBY ROB STAPLETON

Hugh Short, president and chief exec-utive officer of Alaska Growth Capital, directed his team to implement New Market Tax Credits so the Maniilaq Elder Home can open on time, uti-

lizing an argument that the facility will serve elders from villages qualifying as

Census poverty districts.

Phot

o by

Rob

Sta

plet

on


Hugh Short, president and chief ex-ecutive officer of Alaska Growth Capi-tal, says the new program is important for rural Alaska.

“This is a significant source of fund-ing that brings Lower 48 investment dollars into rural Alaska communities and gives tax and investment credits to the investor, it’s a win-win pro-gram,” Short said. “Basically, it takes money from Wall Street and brings it to Main Street … Kotzebue, Bethel or even Anchorage.”

Short is responsible for mastermind-ing obtaining the ability for Alaska Growth Capital to administer credits from the New Market Tax Credits and has been eager to use the program to aid Alaskans.

The $24 million 14,340-square-foot project, an addition to the Maniilaq Health Center, received partial funding from the State of Alaska, which helped with the construction of the facility. The use of the New Market Tax Credits fi-nancing will aid the organization’s start-up and first-year expenses.

“The financing facilitated by Alaska Growth Capital was easy, fast and will help us provide the first year of health care costs to extended care patients, Erlich said. “Due to the process of get-ting reimbursement from Medicaid, it would take as much as two years to get the operational funds. This will help us with start-up and immediate health care cost expenses for the care of the long-term advanced care elders.”

When complete, the facility will pro-vide advanced care for up to 18 elders, as well as provide 20 full-time jobs. Building of the addition in Kotzebue will be finalized this summer, and will be available for long-term occupancy by August.

In addition to the added long-term employment, the construction of the facility added 100 seasonal jobs to the Kotzebue economy. But the real value of the facility will be for the comfort and care the Inupiat elders will receive, according to Maniilaq’s leadership.

“This new facility will be able to house 18 elders who would be forced to leave the region, their families, culture and foods to live out the final years of their lives in Anchorage or Fairbanks,” Erlich said. “Kotzebue doesn’t have anything like this for the people of this region.”

NO MINOR BUSINESS Woody Angst &

Tom MartinTHE MEETING:

North American Youth Exchange Network Annual Conference300 delegates Feb. 28 – March 3, 2012Estimated Economic Impact: $328,590.30

Tom Martin and Woody Angst are both fathers. Not to just their own kids, but also to the North American Youth Exchange Network. They weren’t kidding around when they decided to bring their annual conference to Anchorage, fostering new business in our economy.

Congratulations Tom and Woody - ACVB Meeting Champions!Are you a member of a national or international association? Bring your group to Anchorage. Contact the Anchorage Convention & Visitors Bureau (ACVB):


While the NMTCs are being used for this long-term care facility, the program can also be used for edu-cational purposes, such as charter schools, or any other high-impact community projects.

ABOUT THE PROGRAMThe New Markets Tax Credit Program (NMTC) is the largest federal commu-nity development tax initiative created and used in the in the past 20 years, according to Alaska Growth Capital’s Hugh Short.

Alaska Growth Capital (AGC) was allocated $50 million in New Markets Tax Credits in 2009 for funding proj-ects in Alaska and Hawaii, Arizona, and Montana, and facilitated the Elder Care Addition as a Qualified Low-Income Community Investment project. AGC has received $90 million in allocation authority since 2002.

The Maniilaq elder project is only the second Alaska project to use the NMTC Program. The other project also was in rural Alaska. Three Community De-velopment Entities (CDEs) teamed to create a financing package of $41 million qualified low-income community invest-ments (QLICI) to develop a salmon-processing plant in Platinum Goodnews Bay Seafoods in 2009. Outside investors Travois New Markets, Waveland Com-munity Development and NCB Capital Impact used NMTC’s package to elimi-nate an 80-mile boat trip made by vil-lagers to sell their hand-caught salmon.

WHAT ARE NEW MARKET TAX CREDITS?

One of the biggest challenges for obtaining the tax credit status was to get the Kotzebue area qualified as a Census poverty area. According to Lahka Pea-cock, owner of Rural Credit Services in Nome. Peacock noticed the NMTC program, approached Alaska Growth Capital and found a way to qualify the Maniilaq elder care addition.

“We had to jump through a few hoops to qualify, but when we con-vinced the Community Development Financial Institutions (CDFI) fund that the people served and using the facility were from villages who did qualify as Census poverty areas there was no question that the facility could be funded,” Peacock said.

Good people make great lawyers.

To be a great lawyer in Alaska, you first need to understand Alaska.

We’re part of this state, and the business and public entities that

work for its people. Whether it’s mergers and acquisitions, real

estate, government, Native Corporations or finance, business is

our business. � We have the talent you’re looking for in an

attorney, and the experience you need to succeed. Simply put,

we know Alaska.

Anchorage 907.276.5152

Wasilla 907.376.5955

landye-bennett.com

A l a s k a � O r e g o n

Phil BlumsteinAlaska Native and Business Law

Simply Great Lawyers.


The NMTC program is designed to provide investors – such as banks, insurers, investment funds, corpora-tions and individuals – with credits against federal income tax in return for new investments. These invest-ments must be made with eligible businesses and commercial projects in low-income areas as defined by the U.S. Census Bureau. NMTC program funds are meant to be used as a flex-ible tool for a wide range of qualified business activities, from small-busi-ness lending to financial counseling to real estate development.

NMTCs are administered by the Community Development Finan-cial Institutions (CDFI) fund, an arm of the U.S. Treasury Depart-ment. The CDFI fund was initially authorized in 2007 to allocate $19.5 billion in NMTC investments. The fund uses a competitive process through which, in 2007 alone, al-located 294 awards totaling $16 bil-lion in tax credit authority.

CDFI officials announced it had al-located $3.5 billion late in 2010. As of spring 2011, the fund reported it final-ized 594 awards totaling $29.5 billion in allocation authority.

QUALIFYING FOR NMTC FUNDSCalled QALICBs, Qualified Ac-

tive Low-Income Community Busi-nesses satisfy tests regarding the proportion of their gross income, use of tangible property, and employee services relating to Low Income Communities (LICs).

Peacock’s vision for the Mani-ilaq’s elder care facility used the ten-ants of the program, low revenues and Inupiat elders in the Northwest Arctic, NANA and Arctic Slope re-gions who had little or no income or tangible property.

“While the location was in an area that did not qualify, the facility was pro-viding, and will continue to provide, services to the people from areas that do qualify,” Peacock said.

While commercial real estate is ac-ceptable, restrictions on the amount of collectibles or revenue-producing property held, the type of property, for example residential rental proper-ties, with the exception of mixed-use projects that derive less than 80 per-

cent of its income from housing units are acceptable.

Ineligible businesses include golf courses, race tracks, gambling, certain farming businesses and stores special-izing in alcohol sales.

WHAT CONSTITUTES A LOW-INCOME COMMUNITY?

A low-income community (LIC) is a census tract with at least 20 percent poverty or where the family income is below 80 percent of the area median fam-ily income. Eligibility can be determined

through the CDFI Fund Mapping System (CIMS). There also arwe certain targeted populations, for instance disaster area residents of floods or hurricanes in low income areas of the Lower 48. According to Short, most of rural Alaska and some urban areas can fall into this category.

INVESTOR LIABILITIESInvestors always ask themselves

what are the risks possible in this investment – in this case there are a few – but these are very techni-cal and not probable in nature.

There’s something for everyone at the Hotel Captain Cook.

reservations 907.276.6000 800.843.1950 939 w. 5th ave. captaincook.com

The B.L.T. Package

$155 per night*

Set your compass for a memorable experience, and book the B.L.T. package.

Whatever the reason—business or leisure travel—enjoy a deluxe room,

full access to our exclusive athletic club, a daily $20 breakfast credit in

the Pantry Restaurant, and complimentary in-room Wi-Fi.

*Does not include tax. From May 15 to September 15, 2011 package is $255.


According to the LISC/NEF Inc. explanation, the risks mainly relate to the economic performance of the QALICBs in which the Community Development Entity loses its certifi-cation from the CDFI fund, or the CDE redeems the equity investment within seven years, or the CDE pro-ceeds fail to meet certain tests over the percentage of community investment in the first six and seventh years, and NMTC are subject to federal tax on capital gains.

THE PROCESSManiilaq’s Erlich says that the pro-

gram’s processes facilitated by Alaska Growth Capital were relatively easy.

“We were so impressed with the ser-vices of AGC that we are considering using this method for a Behavior Health Center project once we have the Elder Nursing Home finished and running,” Erlich said.

The history of this financing was en-visioned by Nome’s Peacock who also has family in Kotzebue.

“I was looking at many different pro-grams when I ran across this new pro-gram,” he said. “I approached Alaska Growth Capital because I found they had $50 million in tax credits for the program. We then started approach-ing outside investors. It took about six proposals before we were able to attract New York Community Bank.”

Working with Short at Alaska Growth Capital is a team of experts using creative financing packages to support rural and Alaskan-owned businesses. One of the AGC team members involved in the transaction helped facilitate the technical requests for Maniilaq.

“Maniilaq was outstanding to work with,” said Jason Evans vice president of consulting for AGC. “This is a com-plex process with lots of complications. It is our goal to walk our clients through the process. We are happy we were able to make this happen for Maniilaq.”

Evans explained that the Census poverty areas are not confined only to rural areas.

“For example, there are Census poverty areas in urban areas, parts of downtown Anchorage could qualify, but it is based on the mean-income-average of the residents of a specific

geographical area. For the most part, federal, State and some health workers’ salaries skew the income average and make hubs like Kotzebue and Nome ineligible for NMTCs.

REGIONAL COOPERATION FOR MORE NMTCS

The point that an Arctic Slope Regional Corp. subsidiary – Alaska Growth Capital – was brought in by a Nome business to help Kotzebue-based Maniilaq shows how the regions can work closely to solve each other’s challenges.

“This is not unusual, just not many people outside the region see it,” Short said. “ASRC has a long history of helping people in the NANA region. Remember that Point Hope is one of ASRC’s villages and it is served by both Kotzebue and Barrow. We have family that spans all along the Bering, Chuck-chi and Beaufort seas coastlines.”

THE FUTURE USING NMTCS IN ALASKA

Alaska Growth Capital worked with Dudley Ventures in Phoenix, Ariz., to secure an investor for the funding, both are confident that the program will pos-itively impact rural and lower-income communities statewide.

“It seems Alaska will continue to garner interest because much of the state is rural and a large percentage of the state falls within qualified census tracts with high poverty and unem-ployment,” said James D. Howard Jr., principal of Dudley Ventures LLC. “Dudley Ventures’ investment focus has been innovative, high community impact transactions, utilizing tax eq-uity in conjunction with congressio-nally sanctioned programs to drive permanent subsidy to qualifying proj-ects which include community facili-ties, educational institutions, hospitals, health care clinics, charter schools, mixed-use projects and renewable en-ergy facilities.”

Dudley Ventures has closed more than 135 transactions totaling nearly $1 billion in NMTC financing nationwide. This includes the recently closed $18.9 million Maniilaq transaction and nearly $30 million in loan funds with Alaska Growth Capital, which have financed small businesses all over Alaska. ❑

The Alaska Oil and Gas Asso-ciation (AOGA) strives to foster the long-term viability of the oil

and gas industry in Alaska. As part of that mission, the nonprofit trade group represents the majority of oil and gas exploration, production, transporta-tion, refining and marketing activities in the state. AOGA has more than a dozen members that include entities such as Chevron Corp., Shell Exploration and Production Co., ExxonMobile, Alyeska Pipeline Service Co., Tesoro Alaska and Petro Star.

AOGA operates under the direc-tion of Marilyn Crockett, who assumed the role of executive director in 2007. She previously served as AOGA’s association administrator, exploration and production affairs representative, manager for environmental affairs and deputy director. Crockett, who was in-ducted into the Anchorage ATHENA Society, has lived in Alaska for more than 40 years.

Under Crockett’s leadership, AOGA engages in a variety of initiatives to pro-mote Alaska’s oil and gas industry. For instance, the group provides a forum for communication and cooperation with members, the public and local, State and federal governments. AOGA conducts legislative educational semi-nars on topics ranging from refining to oil spill responses. It also provides input on local, State and national leg-islative and administrative actions that affect the state’s petroleum industry. Oil and gas, incidentally, is Alaska’s largest nongovernmental industry. It generates 21 percent of the private-sector payroll in the state, according to AOGA.

AOGA AND HB 110 Recently, AOGA expressed its sup-port for HB 110, Gov. Parnell’s pro-posed amendments to the Alaska’s Clear and Equitable Share (ACES) oil production tax. HB 110 is designed to provide tax incentives and credits for the oil and gas industry to increase exploration for and the development of Alaska’s oil and gas resources at

any price range. On Jan. 18, the bill was referred to the Resources and Finance Committees.

On Feb. 16, Crockett testified before a House Resource Committee meeting.

“We sincerely believe these pro-visions, when enacted into law, will increase the competitiveness for in-vestment dollars in Alaska, resulting in increased job opportunities and the development necessary to stem the decline in oil production currently facing Alaska,” Crockett said.

In terms of specific portions of the legislation, AOGA supports provisions that would establish bracketing of the progressivity rates and cap progressiv-ity at 25 percent, for a maximum rate of 50 percent for progressivity and the base rate combined.

Currently under ACES, at $30, the taxpayer pays at the 25 percent base rate. But when the taxable production tax value (PTV) exceeds $30, the pro-gressivity feature takes effect. Instead of applying the higher tax rate to just the incremental dollar, the current tax system reaches back and taxes the en-tire original $30 at the higher rate. Each time the PTV per barrel increases fur-ther beyond $30, all prior dollars are taxed at the higher rate instead of just that further increase.

“This approach is what creates such high marginal tax rates and creates an imbalance in the risk-reward invest-ment environment in Alaska,” Crockett said in her testimony. “Removing the upside to the degree the progressiv-ity feature does makes it much more difficult to compete for investment dollars with other areas that are not as fiscally challenged as investments here in Alaska. Bracketing sets tax rates for the different levels of PTV so that each level is taxed only once and at a specific rate for that bracket, moderating the impact of ACES’ high rate of tax.”

The form of bracketing proposed by HB 110 adds much-needed stability and predictability to the tax, accord-ing to Crockett. “As companies real-ize higher prices and greater PTV, the

State, likewise, continues to share in those benefits,” she said.

AOGA also expressed support for the annual calculation of the progressiv-ity rate. Crockett testified: “We support moving from a monthly calculation of progressivity to an annual calculation to synchronize the revenues with the expenses, avoid the mismatching and more accurately reflect the philosophy behind what a progressivity feature should look like.”

OTHER IMPORTANT ISSUESAOGA has also spoken out on a number of other issues. On Feb. 25, Regulatory Affairs Representative Kate Williams addressed the Alaska Leg-islature regarding the scoping of the Programmatic Environmental Impact Statement (PEIS) and the EIS for the Chukchi and Beaufort Sea lease sales for the 2012-2017 Outer Continental Shelf (OCS) Leasing Program. She strongly urged the inclusion of analysis of the Beaufort Sea and Chukchi Sea planning areas as part of the 2012-2017 OCS Leasing Program.

“The scoping of the PEIS and EIS and the subsequent environmental

Alaska Oil and Gas Association

Alaska Oil and Gas Association operates under the direction of Executive

Director Marilyn Crockett.

Phot

o co

urte

sy o

f AO

GA

ASSOC IAT IONS BY TRACY BARBOURAA

O G

Phot

oco

urte

syof

AOG

A


analyses will provide critical informa-tion to the federal government to further inform and support decisions on areas to include in the 2012-2017 program and will be used extensively in support of holding lease sales in these areas,” Williams said. “We believe that lease sales in the Beaufort and Chukchi seas must be included as part of the 2012-2017 OCS Leasing Program. Given the reality that demand for energy is growing and that we will need more oil and natural gas to help meet growing demand for energy in the coming decades, we believe that providing environmental review of these areas now will help ensure sound policy and planning deci-sions for the future.”

AOGA also voiced its support for HJR 11, which opposes the federal gov-ernment designating the “1002 area” of the Arctic National Wildlife Refuge (ANWR) as wilderness. In a Feb. 3 letter to Rep. Charisse Millett, Deputy Director Kara Moriarty wrote: “Devel-opment is permanently restricted to more than 90 percent of ANWR, and for the last 24 years, four out of five Alaskans consistently have supported

ANWR to oil and gas exploration.”She added, “At a time when the

Trans-Alaska Pipeline is only operat-ing at one-third of its capacity, federal and State lands designated for oil and gas development should remain a vi-able option. Now is not the time to set aside more wilderness.”

LAWSUIT AGAINST THE FEDERAL GOVERNMENT

More recently, in March, AOGA sued the federal government over its desig-nation of 187,157 square miles as polar bear critical habitat, claiming it covers too much territory and could cost tens of millions or more in economic effects.

“This is an area larger that 48 of the 50 states, exceeding the size of the state of California by nearly 25,000 square miles,” association attorneys said in the lawsuit, which was described in a March 3 Associated Press article by Dan Joling.

The designation is unprecedented – the largest area set aside in the history of the Endangered Species Act – and was done for an animal that is abun-dant, with 20,000 to 25,000 animals in

19 subpopulations, according to AOGA.Designation of critical habitat does

not automatically block development, but requires federal officials to consider whether a proposed action would ad-versely affect the polar bear’s habitat and interfere with its recovery.

AOGA said the designation – which includes large areas where pe-troleum companies hope to drill in the Chukchi and Beaufort seas – was an abuse of discretion.

“The Service failed to balance the conservation benefits and the eco-nomic benefits to exclude areas where the benefits of exclusion outweigh the benefits of specifying such areas as part of the critical habitat,” AOGA stated in the lawsuit.

The association also said polar bear habitat already is adequately managed, and there is a long history showing interaction between bears and the oil and gas industry has had no more than a minor effect.

The lawsuit is the first filed in op-position to the critical habitat desig-nation, according to the Associated Press article. ❑



First-Class

TRANSPORTATION

Business Travel

BY NEAL WEBSTER TURNAGE

A few years ago, Karen Johnston, a high-ranking executive at a major health care consulting

firm, grew tired of the constant travel, the long flights between Anchorage and cities in the Lower 48. So she lobbied her team leader. The company opened wide the coffers and Johnston was off and running, one first-class flight after another. She could well be aloft at 38,000 feet as you read this, eyes at half-mast, a chilled flute of Tattingers in hand and a masseuse hard at work on her feet.

If it all sounds somewhat suspect, that’s because it is. Karen Johnston doesn’t exist. She’s an invention. But her prototype is the stuff dreams are

made of for airlines and others who hawk first-class travel within as well as to and from Alaska. The problem is those dreams have had a difficult time taking flight (no pun intended).

First, the U.S. economy tanked in 2008. Then came the layoffs in 2009. Then big businesses were outed for prof-ligacy in both 2009 and 2010, which led to the ultimate travel Grand Guignal. Executive and employee first-class air travel turned into economy fare or worse – car rentals to drive instead of fly, a train trip, or, in some cases it may well be imagined, at least in the Lower 48, a Greyhound bus ride. In short, airlines and luxury outfitters were left holding

the champagne and the in-flight mas-seuse was left to pass the time with a pile of trashy celebrity gossip magazines.

Not that much has changed, but the status isn’t exactly dismal. Some ground is being reclaimed. According to Jack Bonney, public relations manager of the Anchorage Convention and Visitors Bureau, while there are no first-class specific numbers, tourism was up in Southcentral in 2010 from 2009. “That says, we’re still not back to the type of growth we saw back in 2008,” he says.

The slight increase Bonney refers to indicates the economy is lurching forward in fits and starts. Perhaps some companies have quietly gone back to

Trends in the industry

Phot

o co

urte

sy o

f Del

ta A

irlin

es

Delta offers first-class travel aboard the 737s. The airline flies to and from Alaska and offers free upgrades to first-class for its elite Skymiles® members.


having a party with a big band and a few estate wines – and rewarding se-lect high producing employees a feted first-class trip to Alaska. But full-blown George Clooney Up In The Air-style year-round first-class travel within and to and from the state? It would appear the answer to that question is best found in the ersatz Hertz commercials whose catch phrase was “not exactly.”

BUSINESS AS USUAL“Our first-class business has remained basically flat, especially in regard to travel within Alaska,” says Scott Hab-berstad, manager regional sales, Alaska, for Alaska Airlines. So flat that as far as businesses and their employees utilizing first-class travel on the airline are con-cerned, the airline doesn’t even track it. Most of Alaska Airlines’ first-class travel customers, he adds, are those who belong to the loyalty program and have upgraded.

“We have a sales team that works with companies,” Habberstad says, “but that’s mostly to market the amenities and value of first-class travel on the longer haul flights, which is where we’re seeing a little bit of growth.”

Whether large Alaska employers such as Providence and Carr Gottstein are listening to the pitches is anyone’s guess. Company executives are more than shy when it comes to going on record about their status when it comes to talking about travel budgets and ex-ecutive preferences.

That doesn’t mean Habberstad and his team have given up. Quite the op-posite. The airline is on track to receive a new fleet of Boeing 737’s, series 800 and 900 planes. And the good news about that is that first-class seating con-figuration escalates from 12 seats in the current fleet to 16 in the new series. Not a whopping amount, but enough to make a difference in revenue over time.

The airline (and one would imagine the sales team) is doing everything it can to make those seats pay off. Hab-berstad provides a good example.

“Say a passenger walks up for a flight from L.A. to Anchorage,” he says. “What he or she will discover at the ticket counter is that it costs only $80 more to fly first-class.”

That $80 difference, Habberstad says, is a good value in respect to

Located in the heart of Downtown Anchorage, for more than two decades World Trade Center Alaska has opened doors overseas for companies participating in Alaska’s international trade economy.

– In 2010, Alaska’s overseas exports reached 4.2 billion dollars.

– Alaska ranks 6th in the nation by value of exports on a per capita basis.

To find out more, contact Greg Wolf, Executive Director, at (907) 278-7233.

Proudly Alaska Nativeowned and operated.

907.277.9501907.274.1000 907.222.5005

■ Free Breakfast■ Free Wireless Internet■ Free 24-hour Airport Shuttle

■ Free Business Center■ Downtown Locations■ All Locations Are Non-smoking


the array of amenities and service. “First-class passengers, in addition to

getting the extra room and larger seats, also receive complimentary meals and beverages, digital media players and access to our Board Rooms,” he says

The latter reference is akin to some-thing like American Airlines’ Admiral’s Club, a sort of private first-class travel lounge in the airport where various services are offered amidst a relaxed, well-appointed atmosphere. Alaska Airlines currently has Board Rooms in Anchorage, Los Angeles and Port-land. Those passengers also receive double the miles on their frequent flyer accounts by flying first class.

Businesses, whether they admit to it or not, have begun to yield to the temp-tation. Habberstad says the airline lately has seen an increase in first-class travel during drilling season, roughly mid-January to late March; most of the uptick is on the Dallas to Anchorage route.

PARTNERS COUNTAlaska Airlines also benefits through its partnership with Delta Airlines. Yet Delta, notes an Atlanta-based spokes-woman, is making its own strides to increase its individual identity in routes to and from Alaska.

The airline, like Alaska Airlines, does not track business passengers per se. However, the airline is making a bid to entice business travelers at a moment when economic indicators point to a looming rise in business travel. Delta streamlined its Salt Lake City hub to make it a central connecting point for flights from the Lower 48 to Alaska as well as international flights.

“We’ve done so with the express pur-pose of providing travelers, business or otherwise, a ‘one-stop’ shopping experi-ence when flying to and from Alaska either domestically or internationally,” she says.

Delta, like Alaska Airlines, has also added incentives to make that first-class ticket to Alaska more appealing.

“Our Elite level Skymiles® mem-bers (gold, silver and platinum levels) are offered free upgrades on first-class travel to Alaska,” she says. “And our in-flight first-class service on Alaska flights includes personalized TV screens for each seat with live Direct TV, free movies and complimentary

wine, beer and spirits as well as meals.”Also in partnership with Delta are

AirFrance and KLM Royal Dutch air-lines. Both airlines serve Anchorage with limited service via Seattle. For interna-tional passengers from France or other European countries, AirFrance flies di-rect from Paris to Seattle, thus making it possible to travel to Anchorage with only one layover and go first-class all the way. KLM offers a similar option with a Seattle stopover en route to Anchorage from their Amsterdam hub.

SERVICE WITHIN ALASKAThree smaller airlines offer service within Alaska on a commuter basis: Era Aviation, which flies from Barrow to Kodiak to Cordova and points in between; Grant Aviation, now in its 40th year of service, operates six- and nine-passenger commuter planes with service to select cities including Homer and Kenai (this month they will also be-gin “flightseeing” trips to Kenai Fjords National Park and Kachemak Bay Na-tional Park); and PenAir, with a fleet of 40 aircraft, serves 36 communities throughout Southwestern Alaska.

None of the aforementioned airlines offer first-class travel, however, each says, somewhat in jest, “Every seat is first class.”

FIRST-CLASS FLEXIBLEThe first-class travel experience on ma-jor carrier flights to and from Alaska, say industry executives, is not at the same standard as what the experience would be on a flight from New York to London or Paris. Depending on the airline, service on some of those long-haul flights can take on a Ritz Carl-ton or Four Seasons effect, extra-wide seats that fold down to become beds, made-to-order special meals and often separate lines for security.

Michelle Glass, a senior account man-ager at Entrée Alaska, an Anchorage-based travel company where 90 percent of company business is the elite leisure and business market, says four- and five-star ratings are not the same in Alaska’s metropolitan cities as in other markets.

“It’s Alaska, not Dubai or Rome,” Glass says. “We’re not on the same level. Yet, I can tell you that as far as hotels, travelers who do elect to stay at top-of-the-line places here will still

benefit from the service you’d expect – luxury SUV’s for personal transfers, for instance, and a one-to-one or two-to-one staff to guest ratio.”

Glass estimates approximately 15 per-cent of Entrée bookings are business related, however, “that number is prob-ably much higher as we can’t always confirm where a referral came from.”

The business traveler who works with Entrée is often a client who wants to extend a trip and enjoy the variety of experiences Alaska has to offer – all at the highest standard possible. Re-quests from those clients are on the rise, reports Glass.

Some of that may have to do with the fact that airlines aren’t the only ve-hicle for first-class travel to and from the state.

“This summer will see the arrival of two new luxury line cruise ships. Ocea-nia Cruises Regatta will travel a 12-day, one-way itinerary between Vancouver and Anchorage,” Bonney says. “Silver-sea Shadow will also call on Anchorage once during the summer.”

Silversea offers white-glove ser-vice, suites and of course, plenty of champagne.

That may play into why in the fall of 2010 Entrée found the number of advance bookings rebounded for lux-ury land packages that offer visitors exclusive tangential, sensory-rich expe-riences that compliment the suite and champagne treatment. One example she points to is a personal audience with a renowned Native Alaskan artist.

While those bookings appear to be increasing, Glass says a wildcard lurks forever in the background – the Internet.

“I think the Internet has changed the market in one significant way both for first-class and commercial travelers,” Glass says. “There’s the idea that plenty of options and good deals are always available. That breeds the mindset of ‘I don’t have to decide right this minute.’”

Glass believes since advance book-ings and requests are up beyond where they were a year ago that the Inter-net’s negative effect at least on first-class travel might be minimal compared to commercial and two- and three-star ground packages.

“We’re having availability issues in luxury travel now,” she says. “That’s a good thing.” ❑

Take advantage of customized solutions,

fewer fees, and local service.

Checking, loans, and depository services 24/7 online account management Business Visa® Check Card Insurance, bonds, and employee benefits Retirement services Investment management

563-4567 | (800) 525-9094 | www.alaskausa.orgFind out what Alaska USA can do for your business.

Your savings federally insured to at least $250,000 and backed by the full faith and credit of the United States Government. National Credit Union Administration, a U.S. Government Agency.

Discover real valuewith Alaska USA


REG IONAL REV IEWR

Al k B i M hl24

Yukon-Kuskokwim Delta, a Vast Coastal Plain

Yukon-Kuskokwim Delta at a GlancePopulation: Approximately 25,000

Location: Where the Kuskokwim and Yukon rivers empty in the Bering Sea

Key Contacts: Andrew Guy, president and CEO of Calista Corp.; Maver Carey, president and CEO of Kuskokwim Corp.; and Joseph Klejka, mayor of Bethel

Main Industries: Government (particularly local), health care, retail and transportation

Schools: University Alaska Kuskokwim Campus-Bethel

Hospital: Yukon-Kuskokwim Delta Regional Hospital in Bethel

Airport: Bethel Airport, one of the busiest in the state

Bethel hub of region

BY TRACY BARBOUR

Alaska’s Yukon-Kuskokwim Delta is one of the largest del-tas in the world. The area – an

expanse of land that occurs where the mighty Kuskokwim and Yukon rivers empty in the Bering Sea – is about the size of Oregon.

With 900 miles along the Bering Sea, the Y-K Delta is an intriguing contrast of landscapes. It is marked by marshy wet-lands, transitional grasslands, sporadic forests and small mountain groups. Some of the mountains, such as the Kilbuck Mountains, ascend thousands of feet in elevation.

The Y-K Delta is a remote place where roads are almost nonexistent, necessitating travel by airplane, boat and snowmachine. The isolated, rural nature of the region makes it an ex-pensive place for people to live and do business.

The largest city in the Y-K Delta is Bethel, which has about 6,000 residents. Other Y-K Delta communities of sig-nificant size include Kwethluk, Kipnuk, Quinhagak and Akiachak.

The delta has about 25,000 residents, 85 percent of whom are Alaska Natives: Yupik Eskimos and Athabaskan Indi-ans. Many of these residents rely on a traditional subsistence lifestyle of hunt-ing, fishing and gathering, due to the area’s prevailing scarcity of jobs and low wages. A considerable number of the area’s residents earn cash incomes well below the federal poverty threshold.

YUKON DELTA NATIONAL WILDLIFE REFUGE

The Y-K Delta is protected as part of the Yukon Delta National Wildlife Refuge, a vast area covering about 20 million acres within the northern boreal zone

Godwits in flight.

Photo ©JAN van de KAM, used under agreement with Yukon Delta NWR


of Southwestern Alaska. The refuge contains a wide range of habitat types, from rolling foothills to coastal mead-ows. It is home to two large islands: Nunivak and Nelson.

Nunivak Island, which has volca-nic origin, features sandy beaches that merge into active sand dunes. Nelson is covered with lakes and streams in the southern portion and accented by rugged peaks in the north. “The delta is definitely unique and brings something to the refuge system that you don’t see elsewhere,” said Refuge Manager/Pilot Gene Peltola Jr.

The Yukon Delta NWR is synony-mous with wide-open tundra. But per-haps nothing defines the refuge more than its wildlife – specifically, waterfowl. The refuge supports one of the largest gatherings of water birds in the world. In the spring, millions of ducks, geese and other water birds return there to nest. “It’s one of the premier waterfowl habitats in the world,” Peltola said. “We have a great population of raptors (birds of prey) in the eastern part of the refuge. There are hundreds of bird species in ad-dition to our large mammal population.”

An assortment of marine mam-mals can be seen along the coast of the refuge in the waters of the Bering Sea, including migrating whales. Riv-ers and streams traversing the area provide a habitat for dozens of species of fish. Upland, there are significant populations of brown and black bears, caribou, moose, wolves and muskox.

The abundant wildlife and vary-ing landscape are just two factors that make the delta a unique place. An-other distinctive element is its people, according to Peltola, who was born and raised in Bethel. “The uniqueness is the people; we have so many villages here on the refuge,” he said.

There are 56 villages located on and adjacent to the refuge. Forty-two of them are within the conservation unit boundaries.

BETHEL, AN IMPORTANT HUBWhen many people think of the Yukon Delta NWR, the city of Bethel comes to mind. It’s a natural association, since the refuge has headquarters there.

Bethel is a retail, services and trans-portation hub for the entire region,

providing vital transportation for the land-locked city and dozens of sur-rounding villages. The Bethel Airport, which facilitates air travel for about 300,000 people annually, is Alaska’s third-busiest airport in terms of pas-senger volume. It is the state’s second-busiest airport for cargo.

A central point for medical ser-vices, Bethel is home to the 50-bed Yukon-Kuskokwim Delta Regional Hospital that provides health care services to about 20,000 people liv-ing in the region. The hospital is operated by the Yukon Kuskokwim Health Corp. (YKHC), a private nonprofit Tribal Consortium. With more than 1,000 employees, YKHC is the largest private employer in the area.

The Y-K Delta’s largest employer overall is the Lower Kuskokwim School District, which has a teach-ing staff of nearly 400. Other large employers, based on the number of workers, are the Association of Vil-lage Council Presidents, AVCP Hous-ing Authority, the State of Alaska and Coastal Villages Seafoods.

Shipping to Alaska might seem complicated, but Span Alaska has spent over 30 years finding the right solutions for our customers. With decades of experience moving freight to and throughout Alaska, no one is better equipped to handle all your transportation needs. Across the country or across the state, we know how to get the job done. And get it done right. Because we don’t just move freight–we deliver satisfaction.

Mike Landry, President

1.800.257.7726www.spanalaska.com


BETHEL AND WADE HAMPTON CENSUS AREAS

The Y-K Delta region encompasses the Bethel and Wade Hampton Census Areas (CA). The Bethel Census Area, which occupies more than 41,000 square miles, rivals the size of Kentucky. The Wade Hampton Census Area is located to the north of Bethel on the central-western coast of AK.

The Bethel and Wade Hampton CA, like much of Southwest and West-ern Alaska, epitomize the idea of “the Bush,” stated Alaska Department of Labor Economist Mali Abrahamson. They’re largely remote, roadless areas that use rivers as transportation routes in the winter and airplanes to deliver supplies to many of the communities. The physical geography of the area presents a challenge. “Villages and towns are built near the water for ac-cessibility and traditional food sources, yet many are under significant threat from erosion issues,” Abrahamson said. “The high costs of building and transportation magnify the problems of building and/or relocating in these far-flung communities.”

With more than 81 percent Alaska Natives living in the Bethel CA and 89 percent in the Wade Hampton CA, traditional subsistence lifestyles and cultural values persist heavily in the region. Consequently, the region has a cash-subsistence economic system. Part of its income is derived from wage and salary employment, and part is from traditional hunting and fishing.

The government is the primary em-ployer. “Local government provides 45 percent of employment in the Bethel CA and a whopping 71 percent in Wade Hampton,” Abrahamson said. “The share of government employment in the whole state is only 25 percent.”

The retail and transportation in-dustries provide much of the private employment for the Bethel and Wade Hampton CA. Average monthly earn-ings for these areas in 2009 were $2,766 and $1,902, respectively. In compari-son, the state’s average monthly earn-ings in 2009 were $3,779. “The low wages in the Y-K areas can be attributed to the lack of high-paying jobs avail-able, but also to the part-time participa-tion in jobs,” Abrahamson said.

The unemployment rate for the Bethel and Wade Hampton CA con-tinues to trend upward. Abrahamson says the average unemployment rate, using preliminary unemployment for December 2010, was 15.1 percent in the Bethel CA. That’s considerably higher than the 2009 rate of 14.1 percent, and it continues a decade-long upward trend.

The Wade Hampton unemployment rate in 2010 was 20.6 percent, declin-ing slightly from 21.2 percent the year before. However, the unemployment rate has also grown significantly in the past 10 years. The rate in the late 1990s was as low as 11.2 percent and has since steadily risen. “The unemployment rates for both regions tend to peak in the sum-mer season and drop off in the fall,” Abraham says. “This may be attributable

to the employment availability in local educational services; teachers and other staff at local public schools don’t have summer work. It also may be the time when fewer people are looking for work due to subsistence occupations.”

Interestingly, the population of the Bethel and Wade Hampton CA is sig-nificantly younger than other regions of the state. In the Bethel CA, an estimated 34 percent of the population is under 14 years old; in Wade Hampton, 39 per-cent of residents is under 14 years old. In contrast, the zero-to-14 age group is only 24 percent of the statewide population.

The Bethel and Wade Hampton CA also have relatively high birth-rates: 26.3 per thousand and 28.1 per thousand respectively. The statewide average, by comparison, is 16.6 births per thousand people. However, net migration for these areas is negative. “More people are moving out than moving in, preventing the population from growing very quickly,” Abraha-mson explained.

CALISTA CORP. The Calista Corp. represents the vil-lages of the lower Yukon River, the central and lower Kuskokwim River, Nunivak Island, and the Bering Sea coast from the mouth of the Yukon River south to Cape Newenham. Cal-ista Corp. is the second-largest of the 13 regional corporations established under the Alaska Native Claims Settlement Act (ANCSA) of 1971.

A key issue for Calista is the proposed Donlin Creek mine. The corporation’s Shareholder Relations Committee, along with representatives of Donlin Creek LLC – the mine’s owner – visited nearly 20 villages in the first quarter of the year to provide updates and answer questions about the project.

Donlin Creek LLC has been doing exploration and baseline research for the past 15 years. The next phase of the project is to begin the permit process in fall 2011, which will take approximately three to five years for review and public comment, according to Calista. Min-ing operations would begin after the extensive permitting and construction phases have been completed.

During construction, an estimated 3,000 people could be employed at the mine and at related projects such as

After speaking to the audience, Calista Corp. President/CEO Andrew Guy watches a shareholder presentation in Bethel on Feb. 17.

Phot

o co

urte

sy o

f Cal

ista

Cor

p./T

hom

Leo

nard


ports, roads and other infrastructure de-velopment. Over the life of the mine – an estimated 25-plus years – there could be 600 to 1,000 year-round positions.

The mine would ultimately increase dividends for Calista shareholder and enable the corporation to increase its investment in economic and cultural projects in the region. In addition, lo-cal and State governments would see increased revenues in their tax base, and other Alaska Native corporations would receive increased revenue shar-ing under Section 7(i) of ANCSA.

“The income generated from mine-related jobs and associated dividends will provide a necessary infusion of funds to the region because hundreds of people will have more income to spend in their local village stores and in surrounding areas,” said Andrew Guy, Calista Corp.’s president and CEO. “Having full-time, year-round income will enable our shareholders and their families to more easily afford the gas and other supplies needed to maintain a subsistence lifestyle.”

Transportation and energy infra-structure are also important issues for

Calista Corp. Calista has been work-ing with and educating legislators at the State and national levels about the region’s challenges in these two areas. The Bethel Airport is a primary area of concern. “The Calista region needs extended service hours at the Bethel Airport to help ensure that weather delays do not affect access for medi-cal transport, food and other supplies,” Guy said. “There are only two inter-community roads serving just five of 46 communities in the region and no road link to the rest of the state, so the Bethel Airport is the only connection

to the rest of the state and the nation.”Calista is also advocating for the use

of hydroelectric power to help com-bat the high cost of energy in the re-gion. The hydroelectric option could help supply power to Bethel and 12 to 14 villages in the area, according to Guy. “The next step is for $17.6 mil-lion in governmental funding for final feasibility studies, initial design and permitting,” he said.

As an important development, Calista Corp. added two new wholly owned subsidiaries last year – Brice Companies, based in Fairbanks, and Yukon Equipment, based in Anchor-age. Calista also merged the Calista Elders Council and the Calista Schol-arship Fund to establish the new Cal-ista Heritage Foundation. Guy says the foundation will bridge and improve relations between elders and youth in the region, as well as provide financial help for students attending accredited collegiate or vocational schools. This academic year, the scholarship fund provided $293,250 in scholarships to more than 300 shareholders and descendants. ❑

Southern Nulato Hills in winter.

U.S. Fish & Wildlife Service file photo

BUS INESS BAS ICS BY ERIC BRITTEN

The most abused business process

The other day, I entered “why does everyone hate perfor-mance reviews” into my favor-

ite search engine. The site said there were about 6.9 million results from my query. Wow! A lot of people hate performance reviews.

I went to many of the sites that turned up in the search. Most of the comments didn’t talk about perfor-mance planning and reviews being a waste of time. What they did talk about was that few organizations and manag-ers know how to do them the right way. I felt vindicated because that is how I feel. Performance planning and reviews are a good management practice, and they can result in motivated employees, improved performance and stronger earnings. Unfortunately, many people and organizations set themselves up for failure right from the start.

I think the main reason performance planning and reviewing get such a bad rap in many organizations is because nobody takes them seriously. A good process that isn’t enabled with skilled and willing practitioners will fail. Tak-ing performance management seriously means those at the top of an organiza-tion ensure the requisite time, effort, re-sources and training necessary to yield a successful and meaningful result are all allocated.

GOOD SYSTEM PRACTICESHaving a good performance manage-ment system is important. Here are a few practices I have found that help enable a good system.

Each year, companies develop some sort of plan about what they will do during the coming year. It’s essential this plan is communicated to every-one in the organization. As part of this process, managers and subordinates identify what their roles are in moving these plans forward. Those elements should become some of the goals or

objectives in performance plans. That way, as operational and annual plans are reviewed periodically, the aligned elements in performance plans will also beg to be discussed.

The inevitability of accountability is a strong motivating dynamic. Whether it’s simple or complex, the planning and reviewing process, format and cycle should remain constant. Know-ing the process, format and timing of performance planning and reviewing will be constant; everyone in the or-ganization will know what is expected and when it’s expected. And they know that it will be done.

Talking not just about what needs to be done, but how it needs to be done adds a lot of quality to a performance-management process. Culture is an ever-increasing critical component of organizational success, so developing competencies that train and evaluate employees on expected behaviors and values delivers. Having discussions about values and behaviors can help connect employees to their job and their company.

ONGOING MANAGEMENTPerformance management isn’t some-thing that happens once or twice a year.

It happens daily and weekly. Managers and subordinates should continually be discussing items in their performance plans. It doesn’t have to be in depth. Sometimes a simple comment such as, “Good job. That’s one of the goals in your performance plan, isn’t it?” keeps awareness high. Awareness is important because it reminds everyone to check in with their plan frequently.

Everyone in an organization is a manager or a subordinate. Some are both. So, every person in an or-ganization needs to develop a per-formance plan and participate in performance reviews.

I have heard many mangers complain that their performance-management process is clunky, inflexible, hard to use and wastes their time. There are good performance-management processes and tools and there are some that aren’t so good. But, more often than not, it’s the inability of the indi-viduals within an organization to take the time to skillfully use their process and tools that makes them ineffective. That goes back to my earlier comment about performance management need-ing to be a priority in an organization.

Successful performance manage-ment lies within the ability of the or-ganization to unequivocally support it; and with people in the organization to commit to making the process mean-ingful, personal and a part of daily life. Vince Lombardi reminded us, “The achievements of an organization are the results of the combined effort of each individual.” ❑

About the AuthorEric Britten is president of Britten & Associates LLC, a management-con-sulting firm based in Anchorage. He can be contacted at 907-440-8181. Additional information is available at: www.brittenassociates.com.

Eric Britten


Performance Reviews

From powering snow machines to heating homes, Crowley Supervisor Mel Paukan knows that fuel keeps his community

running. The longtime employee also knows that good customer relationships keep our company strong. Quality products and customer service – they’ve gone hand-in-hand at Crowley for

over 50 years. And we plan to keep it that way.

For service in your area, call Crowley at 1.800.977.9771.


A botched employee situation can cost thousands or even hun-dreds of thousands of dollars

if it turns into a lawsuit. If you want to protect yourself and your company, consider these reminders.■ Don’t overlook warning signs. Em-ployee problems often lurk under the surface while managers focus on other more tangible tasks. Like the iceberg that sunk the Titanic, off-the-radar people problems can sink a company.

For example, while you know one of your more vocal employees feels unfairly paid or treated, you haven’t had time to sit down and either agree he merits an increase or let him know he’s mistaken. He grows more bitter every day and takes it upon himself to contact a local union, which initiates an organizing campaign. If you’d listened more to this employee, you could have fixed his perceived problems or pos-sibly realized you needed to suggest he find career happiness elsewhere. Instead, you face a union election.

Or, you consider a talented but high-maintenance employee simply grumpy. Since she worked hard her first two months and you and she had had a light-hearted teasing relationship, you attribute her gloom to mid-winter blues and handle the problem by avoid-ing contact with her and reducing her involvement with others. She feels slighted and attributes it to her per-ception that you showed interest in her and she didn’t reciprocate. Once she files a sex harassment lawsuit against you, you find yourself in substantial contact with her lawyers and the fact that you cut her out of several meet-ings she logically should have attended counts against you.

Whenever you notice an employ-ment problem, attend to it. The prompt action you take helps you avoid digging yourself out of trouble later. ■ Communicate, communicate and communicate. Regardless of what else

lands on your priority list, give your em-ployees time. Every hard-working em-ployee deserves thanks and deserved recognition pays off in continued mo-rale and productivity. After all, six em-ployees working at full speed give your company 240 hours of productivity. Even if you work 70 hours instead of 40, if each of your six employees decreases their work productivity slightly by five hours weekly due to lowered morale, their productivity dip wipes out your 30 extra hours. Further, motivated em-ployees rarely create problems.

Respect every employee in every interaction. Employees who feel disre-spected inevitably extract a payback, through lowered productivity, supply room theft or legal system revenge. Treat all your employees as if they merit thanks for the good work they do, because they DO.■ Do you have several employees you trust more than others? Although under-standable, remember that employees resent managers who play favorites. Consider what might occur if you treated all your employees, even the ones who get on your nerves, as valued.

Finally, no matter how often an employee pushes your buttons, watch your mouth and your actions – because co-workers and juries more often sym-pathize with fellow employees than the higher-paid manager. You never want to pay for that slip of the tongue with damaged morale.

■ Don’t punish messengers. Does one of your employees let you know when your actions upset him or other em-ployees? Although you may want to quash the loudmouth who comments: “Emperor, you forgot to put your clothes on,” those willing to speak up when we fall short help us out. Without them, we might not realize undercover problems exist.

Further, employers take a legal risk when disciplining whistleblowers or those who complain about discrimi-nation, harassment or unsafe working conditions. When you learn about problems, fix them and respect the employee who brought the problem forward. ■ Document before the last call. Hope springs eternal and most managers put off documenting performance prob-lems. As a result, they may arrive at a decision to terminate an employee yet lack the documentation needed. When you supervise an employee starting a downhill slide, begin documentation. If the employee improves, toss the documentation. If he doesn’t, you’ll have the proof necessary to back up your decision. ❑

About the AuthorLocal management/employee trainer and consultant and the author of “Managing Equally and Legally,” “Won By One,” and “Solutions,” Dr. Lynne Curry regu-larly provides managerial, leadership and board training seminars as well as public seminars. Curry’s company, The Growth Company Inc., offers a free monthly “breaking news” HR/management newsletter and two seminars (70 minute and three-hour) monthly. For more information on The Growth Company Inc.’s training and HR On-call services to companies needing help with recruiting, team-building, strategic plan-ning, management or employee training, mediation or HR troubleshooting, please visit www.thegrowthcompany.com.

Five Essentials for AvoidingLegal Trouble with Employees

HR MATTERS BY LYNNE CURRY

©20

11 C

hris

Are

nd


LEGAL SPEAKLLLLLLL

You incorporated your small busi-ness to protect your personal as-sets from lawsuits or debts of the

business and think you are safe – but are you? When a person incorporates their business, a “corporate veil” is created between the owner and the business. If someone sues your corporation for damages or debt that far exceed the cor-poration’s assets, then their lawyer is probably going to try to find a legal basis to push aside the protection and pierce the corporate veil. Incorporated small businesses and corporations owned by one person, or a small number of people, are most often the corporations that come under this attack.

A corporation is considered a separate entity from the shareholders (referred to as owners in this discussion), so it must be treated that way at all times or the protections of being incorporated can vanish. If the corporate veil is pierced, then the owner’s personal assets could be used to pay the business’ obligations. This article discusses some common mistakes that can accidentally destroy the corporate veil.

DON’T DO THIS!One of the most common mistakes is when the owner operates the corpora-tion in such a manner there is no differ-ence between the corporation and the owner. This usually starts with the owner using the company assets like they were the owner’s personal property. For ex-ample, the corporation must have its own bank accounts and credit cards, and the owner should not purchase items with a corporate check or corporate credit card for personal use. The typi-cal excuses are – the owner will refund to the corporation later (but often for-gets to), the funds spent were profit that had yet to be distributed to the owner,

the corporation gets a discount at this particular vendor, or the owner’s check-ing account is low on funds or his/her credit card is at its limit. This may occur infrequently at first, but over time, it can happen repeatedly until the owner is us-ing the corporate accounts like they were the owner’s personal property. Now the corporation has become the alter ego of the owner – like Superman and Clark Kent – they are really one in the same. In this type of situation, a court could allow the owner’s assets to be used to satisfy corporate obligations.

PROTECT YOURSELFAnother common mistake occurs when an owner fails to take all the actions re-quired each year to establish the corpo-ration is operating as a separate entity. Corporations can only act through peo-ple. Those people include not only the owners/shareholders, but directors and officers. Shareholders meet once a year to elect directors. The directors appoint officers. The directors and officers make

decisions regarding the business of the corporation. These decisions are recorded in corporate minutes. Many times, proof that these corporate actions happened every year is missing in smaller corpora-tions. If the owner of the corporation is not going to treat it as a separate entity, why should a court?

A further common mistake occurs when the owner has two or more corpo-rations in similar lines of business and al-lows finances, bank accounts and assets to be shared between the corporations. For example, the owner has two corpo-rations, Corporation A and Corporation B. Corporation A needs a new truck to help with deliveries and Corporation B has an extra vehicle. The owner decides to share equipment because he owns both corporations. Then later, Corpo-ration B needs some extra funds so the owner shifts money from Corporation A to B’s account. When Corporation B is sued, if the two different companies co-mingled their assets, there is a good chance the assets of both companies will be at risk.

While failure to keep a corpora-tion separate could result in the owner or owners losing their house, savings and other assets to satisfy the corpora-tion’s liabilities, the steps to maintain the corporate protection can easily be done. If you are in doubt, contact your attorney for specific guidance for your situation. ❑

Protecting Personal AssetsTips for the small business owner

© Chris Arend 2011

Jeff Waller

BY JEFF WALLER

About the AuthorJeff Waller is a senior associate

attorney at Holmes Weddle & Bar-cott P.C. in Anchorage. His practice includes litigation, construction law, employment law, insurance defense, and real estate matters. Prior to be-coming an attorney, Waller owned

and operated several businesses.


Ketra Anderson was preparing to board a plane at Narita airport in Tokyo when a magnitude

9.0 earthquake struck. Hanging signs swayed. Windows warped. Airplane wings on the tarmac moved. Most peo-ple froze in place. Some were knocked off their feet.

Anderson flattened herself against a column and helped two frightened preteen girls safely huddle in a corner.

“As a former resident of Alaska, I had experienced earthquakes before but this was like nothing I had ever felt,” said Anderson, director of Crowley’s safety, security, quality and environ-

mental team, who was returning from a business trip to Singapore on the day of the March 11 quake. “The way it built up was something I had not experi-enced before. It was ... not comfortable. The intensity of the movement of the building was massive.”

Thirty minutes later, everyone was

TRANSPORTATION

BY TRACY KALYTIAK

Crowley’s Habit: Ready and WaitingCompany has long history of disaster response

Crowley has been responding to disasters since the 1906 San Francisco earthquake. Crowley tugs Warrior and Avik and Barge 455 3 are pictured off Point Oliktok with the Eni module in August 2010 during last year’s sealift to the North Slope. The same Crowley assets also can be used to respond to disasters, manmade or natural.

Photo by Judy Patrick Photography


moved out to the tarmac. “It was quite cold. We were given blankets, and af-ter the building was assessed for dam-age, returned to the lower level of the airport,” Anderson said. “During the course of the next three hours, the air-port response crew distributed crackers and water, and emergency kits for ba-bies. The worst part was the aftershocks. They continued through the night and all through the next day.”

Communication was a challenge. Anderson’s phone wasn’t working. She borrowed someone’s iPhone to email her family, but the lines were so congested the email didn’t get through until the day she arrived home. Airport personnel said it would be days before planes would be able to depart. Anderson could see from the one television images of damaged roads, inoperable public transporta-tion and other devastation.

“We were stuck,” she said. “The next morning I was able to get wireless and I found a phone I could call out on. I called my husband and family and emailed my team at Crowley to let them know I was OK. They had al-ready organized the Crowley incident management team and were prepared for possible tsunamis on the U.S. West Coast. Our communication was limited to my well-being.”

THINK LOCALThe still-unfolding mega-catastrophe in Japan – earthquakes, tsunami and the threat of radiation exposure – demon-strates the need in Alaska for public and private entities to plan, prepare and train for natural and manmade di-sasters as well as possible combinations of disasters.

There is ample reason for concern here. The 9.2-magnitude Good Friday 1964 rocked the state, bringing with it a massive tsunami and fires that left peo-ple dead, injured, homeless or without utilities, and financially devastated busi-ness and industry throughout Alaska. Twenty-five years later, the Exxon Val-dez struck Bligh Reef and spilled its gar-gantuan cargo of oil into Prince William Sound. Alaskans have also endured floods, extreme cold, high winds and wildland fires. Ships founder and sink in storm-churned waters. Planes crash or simply disappear in remote areas.

Japan’s plight has prompted com-panies and government agencies to reassess, enhance or update their di-saster-response capabilities.

“We definitely watch it,” said Rob Fitch, emergency manager for the Of-fice of Emergency Management in Anchorage, which regularly trains a 150-person staff for its emergency op-erations center – including exercises coordinated with federal and State emergency managers.

“We don’t have the threat of tsunami in Anchorage because of the way Cook Inlet doglegs back and forth, but we do have earthquakes,” Fitch said. “We’re very interested in watching how they deal with mortuary services, debris management and recovery.”

How would Anchorage clear tons and tons of debris if a comparable quake hit? How would Anchorage receive supplies if a quake decimated the city’s port, gateway for food and goods destined not only for Anchorage but for communities throughout the state? How would emergency managers communicate, feed people and provide warm shelters for everyone who will need a place to stay?

“Roadways were totally demolished (in Japan),” Fitch said. “I worry about that happening to us, too. Anchorage is very single road in, single road out. What if we lose the railroad? Luckily we have a lot more air transportation. Again, we’re watching Japan. If any nation has been well-prepared, it’s been Japan.”

Fitch said the city has learned by ob-serving prior disasters. Katrina taught emergency managers here that it was important to consider people’s attach-ment to their pets and refusal to flee without them; about the importance of setting up decentralized, secure shelter facilities, to prevent another Superdome fiasco; to plan for the care of elderly people and others who are medically or otherwise vulnerable.

“Watching Japan and seeing the numbers, it’s overwhelming,” Fitch said. “I feel for them.”

LONG HISTORY OF QUICK RESPONSEAnderson’s employer, Crowley, is one example of a private company with a decades-long history of quickly responding to a range of manmade


and natural disasters in and outside Alaska. Its attention to Anderson’s plight as well as Crowley’s larger-scale plans to grapple with potential consequences of the disaster in Ja-pan highlight the company’s long-time practice of prioritizing employee safety while rapidly working to limit further devastation and help people in affected areas.

Crowley first delved into large-scale disaster response in 1906, in the wake of the San Francisco earthquake; the company whisked the city’s safes and money to a safe location out in the harbor.

“There was no way to police all the sites at the same time,” said Cole Cosgrove, Crowley’s vice president of safety, security, quality and environ-mental, about why the money had to be spirited away to a central location.

More recently, Crowley and sub-sidiary companies have tackled the Prince William Sound oil spill, helped commuters by stabilizing floating in-terstate highway bridges severed from their moorings during storms in Seattle, salvaged large debris washed inland by Hurricane Katrina, lent assistance during oil spills off the coast of Puerto Rico and in the Gulf of Mexico, among others, and rushed to the aid of quake victims in Haiti.

“Our assets are primarily multipur-pose and mobile,” said Bruce Harland, Crowley’s vice president, marine ser-vices, Alaska. “So while a ship might be constrained by the fact that a port facility is wiped out, as in Haiti, our barges are designed to be multiuse plat-forms that can be quickly mobilized and they’re shallow draft. They can be used for a variety of tasks, as opposed to specific purpose-built assets. We find that, for instance, with the Exxon Val-dez and the Haiti response, we can put a large variety of assets to work very quickly with very little reliance on in-frastructure from the shoreside, as in Port au Prince.”

A significant segment of Crowley’s mission is using its officials’ and em-ployees’ wealth of past experience to prevent potential future problems.

Crowley provides tanker escort and docking services at the south end of the trans-Alaska oil pipeline, in Valdez, using some of the most technologically

advanced and powerful tugboats in the world. During tanker escorts, Crow-ley tugs are tethered to – or shadow – tankers, in case braking or steering assistance is needed. Crowley initi-ated this operation after the Exxon Valdez grounding and spill on March 24, 1989.

In 1989 and 1990, Crowley was the principal contractor of equipment and personnel to provide marine support for the spill cleanup throughout the Sound. Sixty-six Crowley vessels were deployed at the operation’s peak, mo-bilized from Crowley operations as far away as Los Angeles.

Today, Crowley tugs help ensure such an accident will never happen again. In 2001, Crowley tugs in Valdez stopped a tanker from colliding with a fishing boat and its nets that had been set across the Valdez Narrows ship-ping channel. In 2002, Crowley tugs secured a tanker that was experiencing mechanical problems and had to shut off its engines. In both cases the system worked and the waters of Prince Wil-liam Sound were protected.

PUTTING TOGETHER A TEAMHarland said Crowley put together a team to respond to the incident. “We gathered capabilities that Crowley could bring to the table and started to reach out to entities directly involved in the Japan disaster to offer our services,” he said.

Crowley’s Jay Brickman, vice presi-dent of government services, says the company’s response to Japan’s situ-ation necessitated the consent of the Japanese government and coordination with what it wanted to do.

“It’s not like you just say, ‘OK, I’m going to do this, I’m going to set up a beach landing,’” Brickman said. “You’re looking at the third-largest economy in the world with a huge number of assets and obviously a lot of pride involved in what they do. You’re ready to be innovative but you have to integrate that into what the Japanese government wants to do.”

Cosgrove said Crowley responded to the Japanese quake with an incident management team since the company had a pipe-laying vessel in Singapore and a tanker in Pearl Harbor – places geographically close to Japan.

“And then of course all the assets that we have up and down the West Coast,” Cosgrove said. “Initially in the early morning hours of the alert, the first thing we did, the IMT was assembled. It usually takes maybe about an hour for some of us to get in here and start ... the command center.”

The first thing Crowley did was identify where all its vessels and other assets were, what the plan was for those employees.

“Obviously with a tsunami, with the speed that it moves, it’s a pretty quick-moving event,” he said. “We wanted to make sure that any of the assets we had that were close to the area had been notified, that they had themselves in a position that they were safe and ev-eryone was aware of what they were to do to coordinate with the different operations groups.”

Crowley then began talking with customers, because both vessels close to Japan were managed – not owned – by the company. “We had customers to deal with, we had their customers to deal with because one of them was a tanker delivering fuel for another customer,” Cosgrove said. “All those communications get established relatively quickly to let everybody know it’s something that’s being watched.”

A couple of Crowley vessels on the West Coast were actively discharging fuel at the time of the quake. Those cargo operations were stopped and the vessels were turned away from the dock so they could get away from the fuel terminals and head for deep wa-ter. Everybody else was put on alert, Cosgrove said.

“Crowley has a number of facilities up and down the West Coast that are close to the water and we wanted to make sure the employees weren’t in any danger, we didn’t incur any unneces-sary property damage,” he said. “Those employees were told to delay going in to make sure that in case whatever the event was that happened on the West Coast, we weren’t putting people in danger unnecessarily. So, everyone was set up to work from home until we could establish what the impact would be. That was pretty much the way the scenario went. It played out very well, I think.” ❑


TOWNS IN TRANS IT ION BY HEIDI BOHI

Barrow Blues

Robert Harcharek, mayor, City of Barrow.

Phot

o by

Jan

a H

arch

arek

Housing shortage, growing population challenge far north community

A steady stream of new residents moving to Barrow, added to those who were raised here as

children and now want to start their own families in the community, are two of the key reasons local nonprofits, the North Slope Borough and the City of Barrow are scrambling to come up with solutions for solving the housing short-age that continues to be a roadblock to both quality of life and economic development. Currently, it is estimated Barrow needs at least 200 housing units, comprising both single-family homes and rental units.

HOUSING SHORTAGEIn the case of at least one family, there are five kids and three generations liv-ing under one roof because of the hous-ing crunch, Mayor Robert Harcharek says. His own family is facing the same

challenge. Since returning from college to make Barrow home, his young son and his family have been living with Harcharek and his wife until housing becomes available. And that may not be anytime soon.

It is not a new concern, he says, but because of the nationwide eco-nomic crisis, it is next to impossible for those wanting to buy a home to get financing. Most locals don’t have incomes allowing them to make a 20 percent to 25 percent down pay-ment. In the meantime, it is not un-common for those in this market to build houses piece by piece, as the money becomes available, and there are currently about 30 homes at vari-ous stages of incomplete construction across the community.

Although there is new construction planned, to date most of it is allocated for the personnel of specific business and government entities. The local housing authority is looking for land to build an apartment complex and 12 housing units, which will likely be set aside for low-income tenants. The village corporation is building an apart-ment complex to house teachers so it will free up other units in the commu-nity. The weather bureau is building 28 units for its employees.

This spring, a housing summit was organized by the borough including representatives from the city, the Na-tive Village of Barrow and the Native Housing Authority to begin to find ways to help locals “creatively” finance homes. The group expects to have a plan for providing low-income starter loans, which may include issuing local bonds, and will meet again before whal-ing season. Communitywide, there is a waiting list of about 170 families who need housing.

GROWING POPULATIONWith Barrow’s population more than doubling in the past 20 years, Harcha-rek says the housing shortage is not the only symptom of this growth he spends his time working on recently. The younger population accounts for a large part of this increase, requir-ing the city to invest in recreational opportunities lacking for many years and critical for helping prevent crime among youth.

In the past year alone, the city has hired four additional recreation aides to run a hockey program that has grown from 60 to 150 students, and the popu-lar basketball teams that attract 600 boys and girls, a recent increase more than 60 students. At the same time, the city is working to raise $21 mil-lion to renovate and double the size of the multi-use Piuraagvik Recreation Center, a 27-year-old facility operating at full capacity seven days a week. Al-though the city received a $1.3 million grant for the design, Harcharek says, he is not sure where the remaining funds will come from. To make the renova-tion costs more manageable, he says the building will be designed so it can be completed in three phases.

“We can’t use the Band Aid approach anymore,” he says, adding that the first phase will focus on updating the build-ing’s mechanics and the facility’s floor, which he hopes begins this month.

In addition to catching up on pre-ventative maintenance of city facilities and assets ignored for too long, Harcha-rek says, building a 60-foot boat dock with a retractable ramp in North Salt Lagoon also is high on the community’s wish list. The project is ready to go out to bid and will be erected next summer after it has been built at pre-fab facilities in Anchorage or Seattle and barged to


Barrow. The dock will accommodate local boats used for subsistence fishing and will increase the number of vessels that can tie up at the same time.

FINDING FUNDINGNot unlike the never-ending funding challenge other communities deal with statewide, Barrow is always facing the funding battle, Harcharek says.

“The city needs to find ways to make its own money,” he says, adding that the longer projects are delayed, the more likely it is that the cost of materials and transportation will increase, making multi-million-dollar improvements even more cost-prohibitive.

One possible solution for raising a significant amount of money that could go toward community improve-ment projects is by the city operating a controlled-access-liquor store, modeled after a similar business owned and oper-ated by the City of Kotzebue and ap-proved by voters there. It would include a distribution center to track and tax all legal alcohol shipped into the damp community. In the case of Kotzebue, the new distribution center is taking in

more than a $250,000 a month before expenses. Barrow believes a similar business could gross about $4 million a year, which is enough to help fund the housing shortage, community improve-ments and various social programs.

The next step is to collect enough signatures requesting that the initia-tive be put on the ballot for a special citywide election. It remains a divisive issue, though, and in the past, efforts to advance the idea have been unsuccess-ful. Over the years, the community has gone from being wet to dry to damp and there are still many in Barrow who would like to see it going back to being

dry. Although a city-owned liquor store would have strict purchase limitations, many believe alcohol is the leading cause behind social ills such as murder, abuse and suicide.

Although Barrow is not without its challenges, as a 30-year resident, Harcha-rek says the community is simply facing growing pains and he and local resi-dents are optimistic for the city’s future.

“The traditional values are the strength of the community and they tie everyone together,” he says. “There are many opportunities here and there is a lot of respect and cooperation among residents. That’s how we get things done.” ❑

Barrow’s Ipalook Elementary School, and its reflection, on a beautiful, rare, windless evening in August 2009.

Phot

o by

Jan

a H

arch

arek

Volunteers Spruce Up Anchorage ALASKA TH IS MONTHAAAAAAA

MAY

1-7 BY NANCY POUNDS

Many Alaskans are taking their annual spring-cleaning frenzy outside this month. In Anchor-age, Eagle River and Girdwood, residents are

plucking winter’s rubbish from along sidewalks, medians, schoolyards and roadsides. The Anchorage Chamber of Commerce coordinates the longtime annual Citywide Cleanup, which runs April 30-May 7.

The Municipality of Anchorage also participates, slotting three free dump days for residential drop-offs at landfills in Anchorage, Eagle River and Girdwood. Businesses and organizations participate as cleanup crews and sponsors for Cleanup Week. The Chamber bills it as one of Anchorage’s largest annual community-service events.

Last year busy participants collected more than 3 million pounds of trash from around Anchorage.

‘GOOD CAUSE’“The Anchorage Chamber Citywide Cleanup program is a community service event hosted by our members that brings the whole community together for a good cause,” said Sami Glascott, Chamber president.

The results are evident and attractive to residents and summer visitors, she added. The lessons from Cleanup Week guide in litter prevention and participation in caring for the community.

“It also teaches our children, and reminds us all, that we are the stewards of our beautiful city,” Glascott said.

Local schools participate in the Super Sweeper program, which focuses cleanup efforts at schoolyards. Last year volunteers at Fairview Elementary hauled in the top tally of 278 bags of trash.

Thousands of people participate in Cleanup Week in Anchorage, Eagle River and Girdwood. Last year crews

from 100 businesses signed up to clean up, said J.J. Harrier, Chamber communications coordinator.

This year Chamber officials are launching a new interac-tive website to allow residents to sign up and claim an area to clean, Harrier said. Officials hope the new website will promote participation and generate ownership and apprecia-tion for neighborhoods.

HISTORY IN THE MAKINGThe event has a long history, starting in 1967 when residents continued to tidy up after the 1964 earthquake, Harrier said. Participation in Citywide Cleanup has grown over the years to include groups from businesses and thousands of individuals, he noted of the week-long event.

“Not everyone can leave work or take the weekend off to pick up trash,” Harrier said. “It takes a week to get the momentum going.”

Some peculiar items cleanup crews have found include a fur coat, sinks, unopened cans of food, hub caps, car parts and shoes. Debris isn’t always the result of litterbugs, though, he said.

“Most street-side trash is there because of uncovered loads to the landfills,” he said.

Cleanup Week also features a finale, the Clean Sweep Celebration. The free event at the Park Strip for volunteer cleanup crews includes live entertainment, games and ac-tivities. The teams of six compete in the Trash Triathlon, which includes the Trash Pass and Dash, Trash Tug and the Recycle Relay.

For more information, visit www.anchoragechamber.org. Free orange Citywide Cleanup bags are available at the Chamber office, 1016 W. Sixth Ave., Suite 303, or at Fred Meyer locations. ❑

Citywide cleanup week brings spring cleaning outdoorsPh

otos

cou

rtesy

of A

ncho

rage

Cha

mbe

r of C

omm

erce


More than 80 local schools participate in the annual Super Sweepers program during the Anchorage Chamber Citywide Cleanup. The program teaches kids the

importance of a clean city and social responsibility.

• • • • • • • A N C H O R P O I N T • • • • • • •

5/27-5/29 Memorial Weekend Family Fun Festival Events include free cookouts, pancake breakfast, games for kids of all ages, teen and adult softball and home-run derby, music and lots of fun! VFW and American Legion Memorial Day ser-vices at local cemeteries. Anchor Point Chamber of Commerce. Contact: 235-2600.

• • • • • • • A N C H O R A G E • • • • • • •

5/1-5/7 Sailing for SalmonSubtitled “125 Years of Commercial Fishing in Bristol Bay,” Anchorage Museum exhibit features historic photographs and more. Contact: 929-9200 or www.anchoragemuseum.org.

5/1-5/31 Mammoths and Mastodons: Titans of the Ice Age

This exhibition, developed by The Field Museum in Chicago, brings these animals to life by exploring their interactions with one another and with ancient humans. Encounter life-size, fleshed-out Ice Age creatures, as well as, skeletons, skulls and tusks. Rare and evocative objects on display include some of the oldest art in existence. Anchorage Museum. Contact: 929-9200.

5/6 First Fridays Art Walk Visual artists are in the spotlight the first Friday of each month when Anchorage art galleries stay open late to celebrate new works by local artists. A map for participating galleries is included in the Thursday edition of the Anchorage Press, one day prior. Time: 5:30 - 8:00 p.m.

5/7 Anchorage Youth Symphony Spring Concert Anchorage Youth Symphony builds musicianship and inspires youth. Come hear the talented young artists of Anchorage at the Discovery Theater, 7 p.m. Contact: 263-2787.

5/7 Catholic Social Services Charity Ball Annual benefit gala includes dinner, dancing and an auction. Time is 6 p.m. at the Hotel Captain Cook. Contact: 222-7355.

5/7 Walk & Roll for Hope This 42nd annual fundraiser starts at the west end of Delaney Park Strip. Bike, skate, rollerblade or run the 15K route or walk the 5K trail. All proceeds support Alaskans who experience disabilities. Contact: 561-5335 or www.hopealaska.org.

5/10 Blueman Group Avant-garde, unorthodox show is part comedy, part performance art and part wacky science experiment. Accompanied by a per-cussion driven soundtrack, these performers never utter a word, but instead use their eyes, facial expressions and subtle gestures to evoke responses from the audience. Separate charge for 6 p.m. wine tasting. Atwood Concert Hall. Contact: 272-1471.

5/14 Anchorage Ballet Spring Celebration Everything from classical ballet to cutting-edge modern dance. Show features the dancers of the Anchorage Ballet and special guest artists Pulse Dance Co., Peninsula Artists in Motion, and Underground Dance Co., 7:30 p.m. Contact: 263-2787.

5/17 May Flowers DanceAlaska Dance Promotions hosts community dance with floral theme. A $12 cover includes a dance class, drinks and snacks, prizes, games and dancing for everyone. Come and watch the dancers compete for the best showcase dance and have a blast. Time: 8 p.m. to 11 p.m. Contact: Info@AlaskaDancePromotions.

MAY EVENTS CALENDAR


• • • • • • • C O R D O V A • • • • • • •

5/5-5/8 Cordova Copper River Shorebird Festival The 21st annual event includes environmental education and shows the beauty and grandeur of Prince William Sound and the Copper River Delta. Keynote speaker Robert Bateman is a well-known artist, naturalist and environmentalist. Contact: 424-7260 or http://cordovachamber.com.

• • • • • • • F A I R B A N K S • • • • • • •

5/14 2011 Fairbanks Start! Heart WalkSignature fundraising event for the American Heart Association promotes physical activity and heart-healthy living in a family envi-ronment. Veteran’s Memorial Park, 700 Cushman Road. Registration is free. Starts at 8 a.m. to 12 p.m. Contact: Dane Landford: 479-7230 or Donna Hawkins: 455-9017.

• • • • • • • G I R D W O O D • • • • • • •

5/11 Women’s Midweek Ski ClinicWomen’s Midweek Ski Clinic, 10 a.m. to 5 p.m. Started more than 25 years ago and still going strong. Includes lunch, lots of fun and learning through Alyeska Resort Mountain Learning Center. Contact: 754-2280.

• • • • • • • H O M E R • • • • • • •

5/5-5/8 Kachemak Bay Shorebird Festival Annual festival celebrates spring and the return of hundreds and thousands of shorebirds, seabirds and woodland birds to Kachemak Bay. Keynote speaker is Carl Sanfina. For birders of all ages and skills, with workshops and presentations, field events and enter-tainment for the entire family. Contact Christina Whiting, festival coordinator: 235-7740 or fax 235-8766.

• • • • • • • J U N E A U • • • • • • •

5/6-5/21 Juneau Jazz & Classics Music FestivalNationally recognized for a diverse line-up of world-class artists, the festival is 16 days to celebrate the 25th anniversary this year with a mix of concerts, blues and classical music, workshops and family entertainment. Contact: 463-3378.

• • • • • • • K O D I A K • • • • • • •

5/26-5/30 Kodiak Crab Festival This island favorite has many events all over town besides the Grand Crab Festival Parade, (which is then followed by the Shrimp Parade!). Events include: survival suit races, a rubber ducky race fundraiser on Russian River, bike race, marathon up Pillar Mountain, arts/crafts and works by local artists, “Wild about Kodiak Seafood Cook-Off”, Kodiak Inn Bed Races, Kodiak Russian Balalaika Players performance at the Baranoff Museum and more.

• • • • • • • S I T K A • • • • • • •

5/28-5/30 Sitka Salmon DerbyCatch prize-winning fish in the sparkling waters of Sitka. Cash or prizes. Derby continues into June. Contact: Sitka Sportsman’s Association, P.O. Box 3030, Sitka, Alaska 99835, or phone 747-6790. ❑

RIGHT MOVES COMPILED BY NANCY POUNDS

DENALI ALASKAN FEDERAL CREDIT UNION

Lily Li was promoted to chief operating officer at Denali Alaskan Federal Credit Union. She previ-ously served as senior vice president of central operations and as vice president of internal audit and compliance. Tara Aubry was promoted to the new position of director of product management. Aubry previously worked in the investment services department, specializing in client relationship man-agement and new business development. Darcy Ellingboe joined Denali Alaskan Home Loans as a loan mortgage specialist. She has more than 14 years of banking and finance industry experience. She most recently worked at Bank of America Countrywide.

BUCCANEER ALASKAAndy Rike was pro-moted to executive vice president of operations for Buccaneer Resources and Buccaneer Alaska. He most recently worked as manager of operations. Buccaneer Alaska is a subsidiary of Buccaneer Energy of Houston, Texas. Rike has 31 years of oil

industry experience in Alaska, Texas, France, Dubai, Saudi Arabia and South America.

ANCHORAGE ATHENA SOCIETY

The Anchorage ATHENA Society inducted new members earlier this year. Members are honored

for professional excellence, community involvement and encouraging of women’s leadership potential. They are: Maver Carey, president, The Kuskokwim Corp.; Karen King, president, The Nerland Agency; Mary Jane Michael, board member, Alaska Mental Health Trust Authority; Sammye Pokryfki, program officer, Rasmuson Foundation; Debra Reinwand, president and chief executive, Bradley Reid + Associates; Michele Schuh, comptroller/vice pres-ident, First National Bank Alaska; Mary Shields, general manager, Northwest Technical Services; Thelma Snow-Jackson, case worker, immigra-tions/ visas, Office of U.S. Sen. Mark Begich; and Tamie Taylor, vice president, construction opera-tions, Bering Straits Native Corp.

ALASKA ASSOCIATION OF SECONDARY SCHOOL

PRINCIPALSThe Alaska Association of Secondary School Principals chose Karen Gaborik as 2011 Alaska High School Principal of the Year. She is principal of Lathrop High School in Fairbanks, a post she has held since 2006.

COFFMAN ENGINEERS

Dave Gardner was promoted to managing principal at Coffman Engineers’ Anchorage office. Gardner, who previously held the title of principal, has worked as Anchorage office civil engineering department manager for more than 10 years. Harold Hollis, previous managing principal, now moves to focus on business development projects, especially in the Pacific Rim. Hollis was instrumental in opening Coffman’s office in Honolulu in 2010.

POETRY OUT LOUDLakeidra Chavis of Lathrop High School in Fairbanks won the Alaska State Poetry Out Loud Finals. Kaylee Miltersen of Chugiak High took second place. The event was held in February at The Juneau Arts & Cultural Center. Chavis earned trip as the Alaska representative for the national finals in Washington, D.C., in late April. Poetry Out Loud is a national arts education program funded by The National Endowment for the Arts and the Poetry Foundation, with help from the Alaska State Council on the Arts and the Juneau Arts & Humanities Council.

MATANUSKA-SUSITNA BOROUGH

John Moosey was hired as borough manager for the Matanuska-Susitna Borough. He most recently worked as county administrator for Chisago County in Minnesota.

GEONORTH LLCMark Pearson earned three new levels of tech-nical certification from Environmental Research and Science Institute and CompTIA. Pearson is director of technology at GeoNorth LLC. His new designations include certified trainer with ESRI, ESRI-certified desktop associate and certified tech-nical trainer with CompTIA.

CREDIT UNION 1Leslie Ellis was elected chairwoman of the Anchorage Community Land Trust, a group aiming to revitalize the Mountain View community. Ellis is president and chief executive of Credit Union 1. Kodiak Chamber of Commerce chose Cheryl Blondin of Kodiak as volunteer of the year. Blondin is Credit Union 1’s Kodiak branch manager, a post she has held for 15 years. She has helped coordinate the Kodiak Crab Festival and last year’s Credit Union 1 Kodiak Member Appreciation Night.

UNIVERSITY OF ALASKA FAIRBANKS

Julie Matweyou was hired as University of Alaska Fairbanks Alaska Sea Grant Marine Advisory Program agent. The post had been vacant for

Rike

Aubry Ellingboe


Gardner Hollis

nearly 15 years, and last year the State Legislature approved funds to fill similar positions statewide. Matweyou earned a master’s degree in biological oceanography from the UAF School of Fisheries and Ocean Sciences. She previously worked for Bristol Environmental.

Brad Griffith was chosen as leader of the University of Alaska Fairbanks Institute of Arctic Biology’s Alaska Cooperative Fish and Wildlife Research Unit. Griffith is an associate professor of wildlife ecology. He has been a scientist with the unit since 1989 and an assistant leader for wildlife since 1996.

Michael Castellini was chosen dean of the University of Alaska Fairbanks School of Fisheries and Ocean Sciences. He has served as interim dean since June. He is a marine biologist who specializes in marine mammal physiology. Castellini has been a faculty member at the fisheries school for 22 years.

SOLSTICE ADVERTISING

Kathleen Bowman joined Solstice Advertising to specialize in client insights. Bowman has more than five years of experience in marketing, business strategy and client services. She earned a master’s degree in business administration from Alaska Pacific University. Laura Tauke was hired as production artist. She has worked as a freelance graphic designer and co-owned and designed Alaska Outlaw Cards.

ENTERPRISE ENGINEERING INC.LaQuita Chmielowski jo ined Enterpr ise Engineering Inc. as project manager. She is a licensed civil engineer with 10 years of experience in Alaska handling site development and utility dis-tribution system design.

CALISTA HERITAGE FOUNDATION

Debra Call was hired as president and chief exec-utive of the new Calista Heritage Foundation. The organization replaces the Calista Scholarship Fund and the Calista Elders Council. Call previously worked as vice president of operations and human resources for the Alaska Native Heritage Center.

ALASKA CHILDREN’S SERVICESDenis McCarville was chosen president and chief executive for Alaska Children’s Services. McCarville served as chief executive for Uta Halee/Cooper Village Residential Treatment Centers in Omaha, Neb., for the past 22 years.

CENTER FOR ALASKAN COASTAL STUDIES

Beth Trowbridge received the 2011 Ocean Literacy Award, given for the second year by the Alaska Center for Ocean Science Education Excellence. Trowbridge is the program director of the Center for Alaskan Coastal Studies in Homer. Since 2000, Trowbridge has developed more than 35 programs and curricula for the center that have been used by many people of all ages.

RESOURCE DATA INC. Kyle Davison was hired as a system administrator at Resource Data Inc. in Fairbanks. He has more than 14 years of system administration experience. Matt Lindberg joined the firm’s Anchorage office as a project manager and senior analyst. Lindberg, a software engineer, earned a master’s degree in project management from the University of Alaska Anchorage. Chris Peterson was hired to work as a programmer and analyst in the Anchorage office. He has three years of programming experience. Peterson expects to earn a bachelor’s degree from UAA this spring.

U.S. ARCTIC RESEARCH COMMISSION

President Barak Obama appointed Fran Ulmer to a four-year term as chairwoman of the U.S. Arctic Research Commission. Ulmer, chancellor of the University of Alaska Anchorage, plans to retire this year from the UAA post.

RIM ARCHITECTS

Jason Bowman and Monica Wotto Sullivan earned their registration as architects from the State of Alaska. Both employees of RIM Architects also were promoted to associates. Bowman has more than nine years of architectural experience. Sullivan earned a bachelor’s degree in archi-tecture from Instituto Tecnologico de Monterrey in Mexico.

INTERNATIONAL TOWER HILL MINES LTD.

Thomas Irwin was chosen construction manager for the International Tower Hill Mines Ltd.’s Livengood Gold Project near Fairbanks. Irwin has more than 35 years of natural resource industry experience. He most recently served as the commissioner of the State Department of Natural Resources.

STOEL RIVESJonathan Iversen joined the Anchorage law office of Stoel Rives as partner in the litigation group. He recently served as director of the State Department of Revenue tax division. ❑

RIGHT MOVES

l 15

.

Call

Iversen

S P O N S O R E D B Y N O R T H E R N A I R C A R G O


Bowman Tauke

Bowman Sullivan


MINING

Another good year for Alaska

BY STEVE BORELL

Mining and mineral exploration are expected to have a good year in 2011. This is not some

type of a “Gold Rush,” but rather a con-tinuation of the steady growth we have seen for the past several years. This is due to both strong metal prices and Alaska’s stable tax and regulatory policies.

Alaska’s six large mines will con-tinue producing in 2011. This follows a period of extreme uncertainty for the Red Dog zinc/lead mine north of Kot-zebue and the Kensington gold mine north of Juneau. Red Dog received its

final permits for the Aqqaluk deposit and mining of that deposit began last summer and will provide ore for the next 20 years. At Kensington, it took a U.S. Supreme Court decision to allow the mine to begin production and it began operating in July 2010.

The number of small family placer gold mines is expected to increase in 2011 due to the gold price. Many of these mines operated in 2010, while others have already been permitted but for various reasons did not operate. Still others have now completed the permitting process.

Coal production should continue its steady growth. Usibelli Coal produced a record 2 million tons last year. In-creased coal demand from the Pacific Rim and the prospect of two new coal mines within the next few years would significantly increase coal production and create hundreds of new jobs.

Mineral exploration has rebounded after the economic collapse of 2008-2009. In 2010, a total of 24 projects each spent more than $1 million exploring for minerals. That number should be even higher in 2011. Strong demand from China and India continues to be the primary driving factor for base met-als (copper, zinc, lead, nickel, iron). World political unrest and the weakness of the U.S. dollar are the primary fac-tors for gold and silver prices and there is every reason to believe these forces will continue, if not accelerate.

Production of industrial minerals, primarily sand and gravel, will remain steady and is closely associated with local construction projects.

The long-term outlook for metals and coal are very good. Alaska is ef-

fectively unexplored when compared to any other state and to most countries.

However, there are three major un-knowns. The first is whether the new Congress will be able to reign in the over-reaching power grabs, especially those of the Environmental Protection Agency. For the past several years, EPA has administratively expanded its au-thorities to control nearly every aspect of American business, not to reduce pollution, but to expand its control. The second unknown is whether anti-development use of the Endangered Species Act will be allowed to continue. Just like EPA, the ESA has expanded far beyond the original intent of Con-gress and this must be corrected. The third is whether the unfair and Dra-conian enforcement approach now being taken by the Mine Safety and Health Administration (MSHA) will be allowed to continue. All mines, includ-ing ones with excellent safety records, are being cited and fined for extremely trivial items. ❑

About the AuthorSteve Borell is executive director of the Alaska Miners Association, an industry support organization with more than 1,300 members. The AMA represents all aspects of the mineral industry before State and federal agencies, the State Legislature and U.S. Congress. He has more than 36 years experience involving exploration and operations in coal, placer and hardrock metal mining in various western and mid-western states, Canada and South America. He is a registered professional engineer in Alaska, Colorado and North Dakota.

Steve Borell

OP-EDPh

oto

©C

lark

Jam

es M

ishl

er

In Southwest Alaska, it’s easy to see the positive impact Pebble is having on the region. Jobs, business opportunities and economic stability – they’re vital to our future. For many people, Pebble may be the only income opportunity. Our communities rely on the opportunities Pebble provides. Opportunities that will help our communities survive.

www.pebblepartnership.com

Opportunities for our future


MINING

Mines and projects in reviewBY CURTIS J. FREEMAN

Alaska’s major mines turned in strong operating performances in 2010 and are well on the way

to similar performances in 2011. The operating mines produce zinc, gold, silver, lead and coal, commodities that have enjoyed stable prices the last year. Operating costs inevitably crept up in 2010 as a result of higher fuel and en-ergy costs, as well as a tightening labor market where skilled mine workers are hard to come by.

TECK & NANATeck Resources Ltd. and partner NANA Regional Corp. announced strong year-end 2010 results from its Red Dog mine. For the year, the mine produced 538,000 tonnes of zinc in concentrate at an ore grade of 18.2 percent while mill recoveries came in at 82.8 percent. The mine also pro-duced 109,900 tonnes of lead in con-centrate for the year at an ore grade of

5.4 percent, while mill recoveries de-creased significantly to 57 percent. Operating profit before depreciation, amortization and price adjustments was $548 million in 2010, compared with $402 million in 2009. Operating profit after depreciation, amortization and price adjustments was $505 million in 2010, compared with $399 million in 2009. Zinc and lead production in the fourth quarter of 2010 were 14 percent and 52 percent lower, respectively, than in the fourth quarter of 2009 due to a planned annual maintenance mill shutdown during the quarter and lower ore grades as the operation transitioned from Main pit to the new Aqqaluk pit-mill feed. The 2010 concentrate ship-ping season saw 1.04 million tonnes of zinc concentrate and 235,000 tonnes of lead concentrate shipped from the port. This compares with 1.03 million tonnes of zinc concentrate and 220,000 tonnes of lead concentrate for the 2009

shipping season. During 2010 the mine paid partner NANA Inc. and the State of Alaska royalties of $197 million ver-sus royalties of $144 million in the year-previous period.

KINROSS Kinross Gold announced year-end 2010 results from its Fort Knox mine. Total 2010 production was up 33 percent over 2009 totals due to the full year con-tribution of the heap-leach production. The mine produced 85,139 ounces of gold in the fourth quarter at a cash cost of $547 per ounce while year-end totals were 349,729 ounces of gold produced at a cost of $550 per ounce. During the fourth quarter the mill processed 6.350 million tonnes of ore grading 0.72 grams of gold per tonne. Mill recoveries were 77 percent for the fourth quarter. As planned, production for the full-year 2011 is expected to be less than 2010 due to lower grades, as most of the mining activity will be focused on capitalized stripping and as a result, the majority of ore processed will be sourced from

Curtis J. Freeman

Red Dog Mine.

NAN

A R

egio

nal C

orpo

ratio

n/C

hris

Are

nd


stockpiles. The company also tabled year-end 2010 resource updates that included proven and probable reserves of 253.43 million tonnes grading 0.44 grams gold per tonne, equivalent to 3.58 million ounces of gold. Early in 2011 the company announced that the Fort Knox mine operations had passed a major safety milestone in reaching an amazing 4 million man-hours without a lost-time accident.

SUMITOMOIn late March, Sumitomo Metal Mining Pogo LLC provided the Alaska Depart-ment of Natural Resources with a year-end 2010 summary of production from its 100 percent-owned Pogo gold mine near Delta Junction. During 2010, the mine treated an average 2,467 tonnes of ore per day and produced 383,434 ounces of gold at a cash cost of $449 per ounce. This equates to a recovered grade of 14.6 grams of gold per tonne (or 0.426 ounces of gold per ton). Total 2009 production was similar at 389,808 ounces of gold at a cash cost of $423 per ounce. The mine also conducted drilling, geophysical surveys, a LIDAR

survey and soil sampling on its holdings including 1,737 meters of underground drilling in 10 holes and an additional 22,632 meters of drilling in 76 holes from surface using roads and helicopter support. The current mine operating life now extends to 2017.

Usibelli Coal Mines reported that for 2010 their Healy coal mine pro-duced approximately 2 million short tons of coal. Approximately 1 million tons of that production was supplied to six Alaska power plants and the other 1 million tons was exported to Pacific Rim destinations as far away as Chile. The mine currently employs 130 full-time employees. Total permitted reserves at the mine are 30.6 million tons of sub-bituminous coal with total defined reserves of approximately 500 million tons. Total resources in the Ne-nana Basin coal field are pegged at an amazing 7 billion tons of coal.

HECLAHecla Mining announced year-end 2010 production results from the Greens Creek mine on Admiralty Island. The total cash cost per ounce of

silver produced at Greens Creek for the year was negative $3.90 per ounce ver-sus negative $1.93 per ounce in 2009. Total production costs for the year were $3.36 versus $7.65 for 2009. The aver-age grade of ore mined during the year was 13.30 ounces of silver per ton, down from the average grade of 13.01 ounces per ton in the year previous. For the year the mine produced 7.21 million ounces of silver, 68,838 ounces of gold, 25,336 tons of lead and 74,496 tons of zinc. The decrease in silver production year-over-year is due to lower silver ore grade. The lower silver grade, along with the higher zinc and lead ore grades were expected and are due to differences in the sequencing of production, according to the mine plan. The mine is work-ing to optimize mill capacity and has successfully increased throughput by approximately 10 percent since 2008 to 2,200 tons per day and will work toward increasing throughput to 2,250 tons per day in 2011. The total decrease in cash cost per ounce of silver produced year-over-year was primarily due to increased by-product production cred-its, partially offset by higher treatment


HYDRAULIC SOLUTIONSFOR THE MINING INDUSTRY

PUMPS · MOTORS · CYLINDERSCase · Caterpillar · Daewoo · Dusan · Hitachi · Hyundai · John Deere · Kato · Kobelco

Koehring · Komatsu · Liebherr · Mitsubishi · Prentice · Volvo/Samsung · Sumitomo · Terex Thunder Bird · Tigercat · Yutani · And many more!

REPAIR & RETURN

Repair and return of your unit. Send in your unit and we will give you a free quote for repair.

If time is of the essence, give HRD a call. We carry over 100 units on the shelf ready to go.

su Liebherr Mitsubishi Prentice VThunder Bird · Tigercat · Yutani · An

TURN

f your If t Repairing your component yourself? HRD can help. We have an extensive parts inventory, covering most major manufacturers.

REMAN & NEW UNITS PARTSPARTS

701 North Levee Road | Puyallup, Washington 98371 Toll Free: 1-877-224-4241 Fax: 253-604-0408

HYDRAULICREPAIR AND DESIGN

1-877-224-42411-800-422-4279

A N E W P A R T N E R S H I P

y

giveRD ll W 100

g

ime is of the essence, g Rep

EMANEEMAMAMANAN && NEW ITSUN

and freight costs, production costs and production taxes. The higher treatment and freight costs in 2010 are due to in-creased price participation charges by smelters. Greens Creek mined 800,000 tons containing 9.8 million ounces of silver in 2010 and added 728,800 tons containing 8.6 million ounces of silver to reserves. On the exploration front, underground drilling continues to de-fine high-grade reserves and resources with good widths in the NWW zone along two newly defined limbs below the current workings and along strike for at least 500 feet. Significant 2010 drilling results from the NNW zone include 8.4 feet grading 0.17 ounces of gold per tonne, 43.7 ounces of silver per tonne,16.4 percent zinc and 10.5 percent lead and 21.2 feet grading 0.15 ounces of gold per tonne, 28.7 ounces of silver per tonne, 15.8 percent zinc and 6.4 percent lead. Drilling in the 200 South zone has defined two separate mineralized zones that are typically barite-rich and contain higher values of precious met-als relative to other zones in the mine. Significant 2010 drilling results from the 200 South zone include 15.8 feet grad-ing 0.31 ounces of gold per tonne, 12.6 ounces of silver per tonne, 17.2 percent zinc and 3.45 percent lead and 30.3 feet grading 0.06 ounces of gold per tonne, 37.4 ounces of silver per tonne, 7.5 percent zinc and 3.2 percent lead. Surface and underground drilling con-tinues to define the North East (“NE”) contact, which represents a continua-tion of the Greens Creek mine contact. The contact has been folded underneath the existing mine workings; it extends near surface at Cub Creek less than a mile northeast of the mine infrastructure and dips below and is subparallel to the mine infrastructure.

Recent wide-spaced drilling has defined discontinuous mineralized in-tervals along the contact, which has a folded strike length of more than 5,000 feet and down dip extension of 3,000 feet. Exploration expenditures at Greens Creek in 2011 should exceed $8 million. Two drills are expected to work underground all year and the surface exploration program has three drills and a number of surface mapping and sampling crews in the spring and summer. The company also announced revised resource estimates for the mine


that include probable reserves of 8.24 million tons grading 12.1 ounces of sil-ver per ton, 0.092 ounces of gold per ton, 3.5 percent lead and 9.3 percent zinc, mineralized material of 789,800 tons grading 4.1 ounces of silver per ton, 0.063 ounces of gold per ton, 2.0 percent lead and 4.6 percent zinc and other resources of 2.34 million tons grading 11.8 ounces of silver per ton, 0.089 ounces of gold per ton, 2.9 per-cent lead and 4.4 percent zinc. Since 1987 Greens Creek has produced a total of about 170 million ounces of silver and approximately 1.17 mil-lion ounces of gold and currently has more than 154 million ounces of silver reserves and resources.

COEURCoeur d’Alene Mines Corp. reported progressively better operating perfor-mance from Alaska’s newest major mine, the Kensington gold mine near Juneau. This mine commenced com-mercial production on July 3, 2010, and produced 43,143 ounces of gold during 2010. Fourth-quarter 2010 production was 27,988 ounces, an 85

percent increase in quarterly gold pro-duction over the third-quarter’s 15,155 ounce production performance. Cash costs continue to decline as produc-tion increases, with fourth-quarter costs dropping 27 percent to $875 per ounce. There was also a 93 percent increase in average gold grade in the fourth quarter versus the third quarter. Quar-terly metal sales increased 77 percent to $15.1 million while production costs declined 11 percent compared to the prior quarter. Quarterly capital expen-ditures dropped to $9.5 million from $20.0 million in the prior quarter. For 2010, capital expenditures totaled $92.7 million including costs required to com-plete construction and commence pro-duction ahead of schedule. Year-end proven and probable reserves at the mine totaled 1.4 million ounces of gold, including 478,245 ounces pf gold in measured and indicated gold resources and an additional 121,182 ounces of gold in inferred resources. The com-pany also announced new exploration results from the Horrible vein system, located about 1,500 feet to the west of the main Kensington mine, where

mineralization remains open at depth and on-strike and is easily accessed from existing underground infrastructure. The 2010 program focused at the north end of a +14,000-foot long, northeast-trending mineralized belt that contains the recently discovered Kimberly vein as well as the Jualin and several other gold-bearing quartz veins located west of the operating mine. Significant re-sults include 6.5 feet of 2.39 ounces of gold per ton from core hole H10-016, 3.9 feet at 0.907 ounces of gold per ton from core hole H10-029 and 3.5 feet of 1.069 ounces of gold per ton from core hole H10-031. Many of the drill holes cut multiple quartz veins which are typical of the style of mineralization currently being mined. ❑

About the AuthorCurtis J. Freeman is president of Avalon Development Corp., a mineral explora-tion consulting firm based in Fairbanks (www.avalonalaska.com). He is a U.S. Certified Professional Geologist (CPG #6901) and a licensed geologist in the State of Alaska (Lic. #AA 159).


INSURANCE

BY DEBORAH JEANNE SERGEANT

Professional Liability Insurance Protects Businesses

Liability is inherent to businesses that provide a service to clients. Professional liability insurance

offers protection when things go wrong. You may not think your business needs liability insurance; however, when you’re faced with a claim is not the best time to find out.

Randy Pugh, president and CEO of Alaska USA Insurance Brokers in Anchorage, calls professional liability insurance “the only thing that can give business owners peace of mind regard-ing their professional exposures.

“You have to look at insurance as a book with a bunch of different chap-ters,” he added. “Some chapters cover certain types of risk. You’ve got to make sure that if your business has a pro-fessional exposure to risk where your assets are liable, you want to at least in-vestigate having professional liability.”

WHO NEEDS IT?Pugh has found among those who don’t have it and don’t know they need it include consultants and architects.

“Most of these types of claims aren’t covered in property and casualty insur-ance,” he said. “It’s almost impossible to transfer that liability to the builders. You’ve got to protect yourself. More and more, building contracts are be-ing done on a team basis where they get architect contractors and even sub-contractors involved. In the planning stages where you’re designing things, you have an exposure.”

Clients depend upon professionals to do the job they’re hired to do.

“A lawyer might not get a case filed in a timely manner and exceed the stat-ute of limitations,” said Paul Houston, president of CHI Alaska, as an exam-ple. “There could be financial damage to the client.”

Angela Pobieglo, vice president with Business Insurance Associates in An-chorage, said some business owners who need professional liability insur-ance “have no idea that this is a cover-age they should probably have.”

From her experience, the most common entities to forgo coverage are trade schools.

“The premise of professional liability is that it covers an error or omission you make if you work with your brain and not your hands,” Pobieglo said. “Since teachers mostly teach intellectually, the chances of a professional liability is so much greater that general liability.”

For example, a student of a dance school could allege the instructor taught a dance move improperly and the re-petitive use of the improper technique caused a student to hurt herself. If a stu-dent were to become injured because of a faulty balance bar at the studio, that would be a general liability claim.

Clients can choose to sue the company, the employees involved or both parties.

“Generally, the errors and omissions policy protects employees,” Pobieglo said. “Employees can get professional liability for themselves. Most often, people don’t realize the necessity of the coverage.

“A lot of people assume their em-ployers have the proper coverage in place, but that isn’t always the case. Thanks to our litigious society, you could be hung out to dry because there’s nothing legally that mandates this coverage for any industry. It’s more contractually required.”

Employees should ask if the pro-fessional liability policy defines “the insured” to include employees. Even if nothing does go wrong, not having professional liability insurance can cost business owners in lost business.

“If you don’t have it, (a potential client) doesn’t have the security that if anything went wrong, there would be financial backing,” said Jana Smith, vice president and partner at Parker Smith & Feek in Anchorage. “Typically, anytime you have a contract to provide a service, they won’t let you provide that service if you don’t have proof of that insurance.”

Providing a service based upon on

a handshake and no liability insur-ance can place your company’s assets at significant risk if your business is a corporation. A sole proprietor may risk personal assets.

“It depends upon the structure of the organization,” Smith said.

FIND A LICENSED BROKEROnce you decide to purchase profes-sional liability insurance, it’s time to talk with someone in the know. Talking with an insurance broker can help you evaluate your needs and options.

To find a good broker, ask for refer-rals from others in your field or mem-bers of your trade organization.

“Typically, trade associations can provide it,” Smith said. “They write special programs for this like for archi-tects and engineers, physical therapists, and lots of different things. Professional liability insurance is tailored around the types of services provided.”

Talk with a few different brokers to get a feel for which one is the right fit for you.

“You want to work with someone who is going to spend a little time with you to talk about your business and the different exposures,” Houston said. “If it’s one who doesn’t want to talk with you it’s not a good sign. Ideally, find a broker you trust and with whom you’re comfortable and who is professional. The cheapest price is not always the best. You want to have a good profes-sional relationship.”

Speak only with a licensed broker and ask about credentials.

“If they don’t have any, they’re not the one for you because they’re not invested in their education and under-standing your business and how best to protect you,” Pobieglo said.

Once you select one, be open with the broker as to your coverage needs, including what your business involves, how much risk your business is willing and able to accept, and how much you want to have the insurance company to handle.


CHOOSE THE AMOUNTHow much insurance will you need? There’s no hard-and-fast rule. Hous-ton recommends starting at $1 mil-lion in coverage, but “if you have a lot more exposure, you might want to purchase an umbrella,” he said. “Look at what could happen and the probability of that happening. Then make the call.”

An umbrella policy extends the lim-its beyond the primary coverage and only comes into play if the primary has been exhausted. Buying yet an-other policy may seem burdensome, but “umbrella liability policy pricing is generally better,” Houston said.

A broker can also explain the differ-ent types of coverage and how it relates to how you do business. One of those differences is how claims are made.

“Typically, professional liability policies are written on a claims-made form,” Houston said. “General lia-bility policies are written on an oc-currence form. With a claims-made form, the policy in place at the time the claim is made responds. With an occurrence form, the policy in place when the incident occurs responds to the claim.”

For example, an architect could provide a faulty construction plan to a builder. The latter builds based upon the plan but four years from now, a heavy snowfall reveals that the plans were not adequate to offer sufficient support to the roof and part of the building caves in. The expense for the cleanup and reconstruction could be a claim on the architect’s professional liability insurance.

The time during which a claim may be filed depends upon the profession.

“In the medical profession, they can be indefinite,” Smith said. “It could be something that happened at birth and it isn’t discovered until the child is 15. It’s one of the more complex types of insurance because of that reason.”

Professional liability insurance isn’t a bullet-proof vest, however.

“They think they can be covered for everything,” Pugh said. “The coverage still has exclusions in it. The premi-ums can change drastically. The most important thing is someone buying it must work with a professional insur-ance agent.” ❑

It’s too expensive. “The premiums have come down,” said Randy Pugh, pres-ident and CEO of Alaska USA Insurance Brokers in Anchorage. “There are more companies in the marketplace offering that type of coverage so that’s helped.”

I’m honest and work hard so I’ll never have a professional liability claim filed against me. “There’s no way to avoid liability other than not being in business,” said Angela Pobieglo, vice president with Business Insurance Associates in Anchorage. “What you’re liable for is what (the jury) decides. I’ve been on a jury and tried to talk sense into the others on the jury. I’ve told them you have to go from point A to point B. You can’t skip and go to C but there’s lots of money available and they want to give it to somebody.”

I don’t need it because I have no risk. “A lot of times, people don’t understand that they have a risk or an exposure,” Pugh said. “They give recommendations and they don’t know they can be held liable for those recommendations.”

Any claims filed will be covered by my general liability policy. “If a person is providing a service that is based upon their expertise, professional liability insurance is needed,” said Jana Smith, vice president and partner at Parker Smith & Feek in Anchorage.

If I ignore a possible claim, it will go away. “With professional liability policies, (claims-made form) you want to turn in any claim you have knowledge of or you reasonably suspect will be a claim so you can lock in your coverage,” said Paul Houston, president of CHI Alaska. “The reason for that is the renewal. You will be asked if you have knowledge of any claim or of anything that might reasonably become a claim. If you don’t disclose the potential claim and later a claim arises, the insurance company may have grounds to deny the claim on the basis of material misrepresentation. If you know something’s out there, don’t put your head in the sand.” ■

Clearing Up Misconceptions.Read what the experts said ...

S I D E B A R


TECHNOLOGY

Corporate Communications

Maintaining an IT staff and all the foundational hardware to support the business applica-

tion presence in the online marketplace supersedes the scope of most small- to medium-sizes businesses today. Include the infrastructure required to keep the office, plant and campus connected and the cost for communications plants be-gins to take on the aspects of a hole in cyberspace to pour money. Staffing that plant with qualified IT personnel daunts even the most IT-savvy manage-ment staff and board of directors. Infor-mation security, contingency plans for data backup and recovery, rising costs of hardware and software licenses all – individually and collectively – demand mitigating answers.

The IT component of any Alaska

business, from service to manufactur-ing, is mandatory and should not be compromised. Thus, it is just sage advice that a business should focus its time and resources on its specialty and, to use a long forgotten Greyhound Bus phrase: “Leave the driving to us.” In this case, leave the pervasive world of IT to those businesses that specialize in it (IT). There are Alaskans specializing in the ever-evolving world of communications and they perform world-class service.

IT RELIABILITYCIOs and business managers most all agree that a reliable, state-of-the-art IT infrastructure is paramount to the success of businesses in all categories. More importantly said, IT foundation is good for business and can be a profit

center. Additionally, inter- and intra-office telephony and long-distance services; data Internet and in-house data-management; remote monitor-ing and remote control; back-up and disaster recovery; local area networks; wide area networks; servers and work-stations; wireless; and WiFi hotspots all are in the mix of tools required for today’s leading businesses. No one will argue IT projects are resource consum-ing. Consequently, they should only be undertaken if they align with your business model, objectives and mis-sion. To build an IT department to rival television’s CSI may well be counter-productive. This is where the experts can help.

The network solution teams from Alaska’s big three service providers

In this do-it-yourself world, why do it yourself?BY KENT L. COLBY

2011© Alex Slobodkin


offer businesses design, configuration and maintenance support for data and voice networks. Most of all, they pro-vide planning and focus.

Big business needs big IT. But small and medium businesses are no less dependent on connectivity in the per-vasive world of the “infobahn.”

Utilizing the services of AT&T Alaska, GCI and/or Alaska Commu-nications frees a business to focus on capturing its investment capital into a competitive advantage while manag-ing an IT budget with flat-rate pricing. “Gain a virtual IT Department at a pre-dictable monthly cost,” pronounces the webpage of Alaska Communications. Businesses and their partners will enjoy managed IT solutions customized for their individual market niche.

Jobbing the IT department to these professionals makes available technical experts 24/7, including holidays. The network will be proactively managed and monitored. The website of GCI boasts: “This means that a real Alaskan networking expert is available to you around the clock to make certain your network stays up and running.”

It’s all about competition. Every size and type of business requires the basics of high-speed Internet access to com-pete in today’s marketplace.

Whether government, retail, finance, industry, health care, education, service industry, professional, mining, fish-ing, timber, oil and gas, or a dot com, these service providers add the value of experience to your business while their managers and engineers become a functioning part of your business by teaming with your staff to design and implement custom data and Internet solutions. Whether a single computer business or an enterprise, the depth of the knowledge base and experience provided is equal. The ability to adjust to your business’ size is crucial. The team approach solves a magnitude of logistic and cost issues.

WHAT’S HOT● Network design, implementation,

monitoring, maintenance and security● Always on Internet connectivity with

DHCP addressing (add computers to the local office on the fly – no special configuration required)

● Offering conferencing services, both

teleconference and videoconferenc-ing (connect distant offices, telework-ers, business partners and clients in a virtual conference room)

● Wireless phones, including all smart-phones

● LAN (local area networks)● WAN (wide area networks)● WiFi hotspots● Telephone systems● Hosted space, storage and server

solutions (off-site backups and total recovery contingency plans)

● System management● Fleet management● Web hosting, design and management● Conference calls and Web meetings

on demand● Constant network monitoring and

reporting● Standardized change-control pro-

cesses● State-of-the-art equipment for in the

office and the hosted backbone

TOP 10 IT SOLUTIONSIn a white paper, Alaska Communica-tions outlined the top 10 key points required to ensure the best decisions for IT solutions (paraphrased):

1. Adopt Standard Processes: Repeat-able, predictable processes are the basis of a strong IT team.

2. Grow Process Maturity: Build on top of the current, working foundation. Reach out to the leaders and users in your company for input. Use the Six Sigma process.

3. Unplug What You Don’t Use: Focus on a management plan and reduce where possible. Monitor what you need and what you don’t.

4. Focus on Fill Rate: It is vital to adopt providers who can maximize the use of space, power, equipment and labor.

5. Grow Scale: Scale builds purchas-ing efficiencies (purchasing, payroll, inventory and asset management are great places to work with others to maximize scale).

6. Outsource What Makes Sense: For every business, there are items that are not part of your critical business pro-cesses. In those cases, outsource every-thing you can.

7. Introduce Variability: Purchase ev-erything you can in a way that scales with your business.


8. Align to Business Strategy: Only undertake projects that do one of four things: protect your business from ob-solescence, guard against disaster, grow business capabilities or reduce unneces-sary capacity.

9. Repeat & Share: The best path to victory is in finding what works, reus-ing proven processes, repeating your successes and sharing infrastructure wherever possible.

10. Buy What You Need: It is easy to buy too much. Find a vendor who makes it easy to expand or contract your information technology, not one that pressures you into purchasing too much.

MAXIMIZE BUSINESS PRODUCTIVITYIn a recent webinar, James E. Gas-kin, author of the Broadband Bible and other books and Rias Muhamed of AT&T, advised ways to help your employees connect with company IT systems through their laptops or smart-phones; save important files online, to be prepared in case disaster strikes; multitask and access e-mail and docu-ments wherever you are; and research and prepare proposals faster.

MOST EVERY ALASKAN HAS COVERAGE

There is almost no place in Alaska that the service of one of the pri-mary providers is not available. GCI’s published goal is to build out the company’s wireless network to reach every community in the state by 2012. And they say they are way ahead of schedule, with voice and data services in more than 20 urban and 110 rural communities.

IMPROVE PRODUCTIVITYIt can be argued that most any busi-ness’ internal IT department, if it is keeping up on state-of-the-art technol-ogy, is growing exponentially and may even be out of control. That con-trol factor is not limited to cost. There has been more than one manager and CEO questioning who is in charge: them or the IT department. It may not be a matter of the objectives or goals that make the final do-ability decision; but rather, if IT can support it and can the cost be justified.

If yours is an established business manufacturing widgets and your IT

overhead rivals that of the production line, it may be time to look at reigning in costs and improving productivity by out-sourcing, keeping costs down and productivity up in your organi-zation. If you are a fledgling start-up, dependent on IT to keep your business connected, efficient, visible and productive then consult with an established IT service provider. They will most likely be able to minimize your IT startup costs and add that “professional” touch that is very vis-ible to staff and customers alike. Start off with state-of-the-art network con-nectivity, hosting and management. The good news is you will stay ahead of the accelerating IT curve and stay free to focus on your business and keep productivity up.

FOCUS ON YOUR BUSINESSThe benefits of a managed network out-weigh the ego of do-it-yourself that we all harbor. When it comes to IT, evalu-ate the value of your and your staff’s time. Maybe the best advice is to keep your do-it-yourself impulse focused on your weekend garage projects. ❑


Alaskan Owned & OperatedNo Job Too Big or Too SmallOne-time or Regular Service

Anchorage or Anywhere!

family member representatives will be happy to assist you with questions or to

arrange courier service.

(907) 345-4980 www.rosiesdelivery.com


Alaska Small BusinessPersons of the Year

Philip Brower and Tim Adams honored by SBA for Sharps BilliardsBY TRACY KALYTIAK


Billiards once was a game for royals and aristocrats, played in sumptuous surroundings. Its

appeal spread, but eventually billiards devolved into a pastime relegated to smoke-filled bars and pool halls. It was a way for idlers to while away their evenings.

For Philip Brower, however, bil-liards was something that transformed his world.

“By the time I was in ninth grade, I had gone to nine different schools. It was a pretty disruptive life,” said Brower, 37, a Michigan native whose single mother struggled with poverty. “There wasn’t any sports; I didn’t fit into anyone’s group or organization. Basically when I went to the pool hall it was an individual sport, something I could do and didn’t need a lot of money to do. I didn’t need a team behind me and there were always people willing to play. What else was there to do – vandalize things and get in trouble?”

Brower was 15 years old and sneak-ing into pool halls to play when the idea of his life first inspired him. He wanted to create a beautiful place where people and their families could come to shoot pool without being forced to breathe tobacco smoke or mingle with a boozy crowd.

Three years ago, Brower and his friend of more than 15 years, Tim Ad-ams, brought that dream to life. The Alaska Small Business Development Center helped Brower and Adams com-plete and polish a draft business plan and successfully leveraged a U.S. Small Business Administration guaranteed loan that helped pay approximately $80,000 in renovation costs and open 3,500-square-foot Sharps Billiards on May 24, 2008.

The Small Business Administration recently awarded Brower and Adams its top accolade, the Small Business

Persons of the Year award, for growing a business that offers “wholesome, non-smoking, nonalcoholic, family friendly entertainment” and contributes to local charities and causes.

“Sharps Billiards ... believes in be-ing good stewards of the community, helping to promote a positive envi-ronment through a deep respect and understanding of the responsibility we all share for one another,” said Bryan Zak, Southwest region director of the Alaska Small Business Devel-opment Center, of Sharps Billiards in his nomination of its owners for the award. “Sharps’ reputation is stellar and a shining example of small business caring for the community of which it is

integrated, on a very personal level.”Zak said Brower and Adams are

what is known as extended-engagement clients. “Throughout a business’s life cycle, we have many tools available to help them. They’re an example of business owners who took advantage of our many tools – initially with busi-ness planning and then with SBA loans, business counseling, marketing, finan-cial analysis and franchising.”

Sharps Billiards is recognized as a pioneer in its approach to setting a new standard of excellence in the billiard industry – not only with $325-a-rack billiard balls accurate to within a thou-sandth of an inch, 9-foot mahogany-and-nickel Brunswick tables, and an

Tim Adams and Philip Brower

Phot

o ©

2011

M. S

cott

Moo

n

emphasis on etiquette, but also in its approach to doing business and caring for its employees.

Brower owns 70 percent of the busi-ness but works on the North Slope, so Adams usually handles the day-to-day operation of the business.

“I know he is going to have the fortitude and motivation to intervene if it looks like customers are up to no good,” Brower said. “He cares if the front windows are washed or the bath-rooms are clean because he has a vested interest. He’s not going to tolerate bad behavior. If you cobbled together all different sizes and brands of tables, it would be chaotic and people would treat it as such. No one’s ever carved into my beautiful tables; there’s never even been a fight in our pool room. Because it is so nice when people walk in, they know how they’re supposed to behave and step up their behavior. There’s politeness, courtesy.”

Billiards Digest magazine, in its No-vember 2008 Architecture and Design awards, recognized Sharps as number eight in its Top Ten New (Billiard) Rooms in America. Zak is now helping Brower and Adams put together a franchise package that will offer the possibility of success to entrepreneurs interested in opening family friendly billiards halls in other parts of the country.

“I talked to someone from Great Falls, Mont.,” Brower said. “Got a phone call from a guy in Arkansas. Two weeks ago, I talked to a person in Milwaukee who wants to build a great big Sharps. All of a sudden things are coming out of the woodwork. We’re so different than every other pool hall in the country.”

Sharps is a haven for serious tour-nament billiards players. It’s also a place where church groups, hospital patients and even schoolchildren can shoot pool, at a reduced rate.

“They’re learning physics, geometry, sportsmanship, patience, how to focus,” Brower said. “Pool is not too easy. It’s comprehensive. There are so many variables – the condition of the felt, the bumpers, the lay of the table. You never see the same table twice. Everything is different. It requires focus, hand-eye coordination. Once you get good, it’s 50 percent mental, 50 percent skill. You have to dig down inside yourself to find


out what you are made of. To me, it’s an all-encompassing game – intellectu-ally, physically, emotionally. I’ve always been one who’s easily bored but I’ve never been bored with pool.”

One of the things Brower always loathed about billiard rooms was the stench of tobacco smoke and the yel-low stain it left on the walls. People warned him his new pool hall would fail if he made it into a nonsmoking establishment.

“I said, ‘Well, this is the future. I’m going to start it now,’” Brower said. “There are a lot more people out there not smoking than there are smokers. It was pretty entertaining. I thought I built that pool hall for me, but it belongs to the community. There’s a need in the community for that type of entertain-ment. I just think there needs to be some alternative to everything revolv-ing around bars and alcohol. I think we’re proving that.” ❑

Ten years ago, Neil Darish began realizing his long-held dream: restoring a historic ghost town situated inside Wrangell-St. Elias National Park. Now, the town of McCarthy is

flourishing, thanks to Darish, who operates its two restaurants, two hotels, a saloon, liquor store, grocery store, gift store and freight business. Darish, 51, is chief operating officer of McCarthy Ventures LLC, which employs 34 people and infused approximately $250,000 in payroll into the community last year.

“The logistics of operating a remote tourism business were a big challenge,” he said. “Fiscal stability with only a 100-day season and limited access created another critical obstacle.”

The Alaska Small Business Administration recently bestowed its 2010 Financial Champion of the Year award to Darish, recognizing his efforts through SBA to financially mentor other entrepreneurs with established businesses in remote areas of the state. Heather Heineken, director of the Alaska Small Business Development Center’s Fairbanks-based Great North Region, nominated Darish for the award.

Establishing a financially stable business in a place like McCarthy is almost as formidable a task as getting to the town, situated at the end of 60 miles of gravel road. Freight costs are huge and the costs of operation fluctuate even within the short four-month season, Darish said.

The most common problems remote-tourism entrepreneurs face are transportation of goods and people and maintaining and increasing perceived value.

“Ultimately, financial stability is the key,” Darish said. Alaska Division of Economic Development officials approached

the center last spring with a proposal that allowed the SBDC to offer business advising to rural tourism businesses, in partnership with industry mentoring to be offered by Darish via a webinar.

“The SBDC decided to participate ... and had no idea of the expert they were going to be working with,” Heineken wrote in her nomination of Darish. “Neil approached the project with amazing enthusiasm and energy.”

Darish offered ideas for immediate results with long-lasting positive effects on business ventures, including marketing expertise, operational suggestions and financial planning. He tailored his suggestions to the needs of each individual business.

Heineken says overall participant outcomes proved project success. “The results indi-cated an increase in sales and profitability and a decrease in operating costs.” ■

BY TRACY KALYTIAK

Neil Darish, chief operating officer of McCarthy Ventures

LLC, recently won the state

Small Business Administration’s

Financial Champion of the Year award

for his financial mentoring of other remote-business entrepreneurs in

Alaska.

Phot

o co

urte

sy o

f Nei

l Dar

ish

Overcoming challenges, rising to the topSBA Financial Champ of Year

SMALL BUSINESS SPECIAL SECTION: SIDEBAR


‘Black Gold’ for BEP Co.Toner cartridge remanufacturer serves Southeast

BY RICHARD SCHMITZ


In a community whose fortunes are rooted in tourism and govern-ment, Shelly Smith has nurtured

a manufacturing enterprise rooted in dependability, customer service and an environmentally conscious work ethic. With Smith as sole proprietor, Juneau-based BEP Co. remanufactures print toner cartridges for customers locally and throughout Southeast Alaska. In addition to saving money on toner car-tridges, local customers get the added benefit of time-saving pickup and de-livery service.

BEP customers range from govern-ment agencies and corporations to in-dividuals and their home-based offices. Customers typically save 30 percent or more on cartridges, which can be the larg-est line item in an office supplies budget.

As Smith expands her business, cus-tomers across Southeast are increasingly responsive to this locally offered ser-vice. “Toner cartridge remanufacturing is the norm in the Lower 48,” Smith said. “Interest continues to increase here in Alaska. Customers outside Juneau simply drop their cartridge(s) in the mail, though some have used air cargo or even hand-carry their depleted cartridges on the ferry when they come to town.”

CREATING WEALTHBuilding BEP’s customer base has re-quired determination. “The industry refers to toner as ‘black gold’ because of the high profit margins. The original equipment manufacturers vigorously defend this profit center, using state-ments like ‘This is not a genuine (brand name) product. Are you sure you want to install it?’ which deters many users from purchasing remanufactured cartridges.”

Smith identified another challenge. “The cheap ‘drill and fill’ method has given remanufactured cartridges a black eye. They are not true remanufacturers and offer a cheap and inferior product. It can be a challenge to overcome this reputation.” BEP Co. remanufactures cartridges in accordance with specific guidelines in factory-produced manuals.

Some customers express the concern that using remanufactured cartridges will void printer warranties. However customers can be assured that their printer warranties are protected by law. The Magnuson-Moss Warranty Act prohibits printer warranties from being voided by using remanufactured toner cartridges.

HISTORY LESSONSmith has a long history of creating success as an entrepreneur. While in college she and a fellow student started a business selling advertising on res-taurant placemats. In Connecticut, after leaving college, she designed a state-of-the-art facility in which she established a Kindergarten, childcare and early learning center. After settling in Juneau and starting a family, Smith and her daughter opened an organic health food restaurant serving home-

made soups, freshly tossed salads and signature wraps.

“My highest compliment was when a customer painted a watercolor land-scape and captioned it ‘for the best salad I’ve ever had in Juneau.’ It was fun and something I always wanted to do.”

She also founded a small natural foods purchasing co-op so she and friends could have access to organic whole foods and benefit from locally harvested foods whenever possible. Smith took over BEP in 2009 when its former owner and founder retired.

A HELPING HANDTom Buzzell provides the skilled hands and experience needed for the actual remanufacturing process, and keeps BEP Co. current with technological ad-vances. Along with replenishing the car-tridges with dedicated toners, BEP replaces computer chips, worn gears, wiper blades,

Phot

o by

Sum

mer

Sm

ith

BEP Co. proprietor Shelly Smith delivers remanufactured toner cartridges to a Juneau customer. Local pickup and delivery are a feature of the

customer-service oriented enterprise.


and thoroughly cleans each cartridge. “It can take between 30 and 90 min-

utes of skilled labor to remanufacture a single cartridge,” Smith said. “We do all our work to factory specifications because we take pride in our service.”

Longtime customer Ken Nestler has been bringing the same toner car-tridge to BEP Co. since 1988, although he presently recycles a cartridge for a newer printer. “I never would have believed you could re-use a cartridge for 23 years,” he said.

BEP Co. has earned certification from Green America as an environ-mentally sustainable supplier to busi-nesses and organizations. The Green America Seal of Approval was given for BEP Co.’s use of local labor, a locally made product, level of re-use and recy-cling, and importance of sustainability to overall business goals.

Toner cartridges are a significant contributor to e-waste that’s clogging landfills. The cartridge core, made of in-dustrial plastic, will last for years. Each year in North America alone, more than 350 million toner cartridges are sent to landfills after just one use. In one year, if all the world’s toner cartridges were laid end to end, it would circle the earth more than three times.

THE TWO ‘I’S OF BUSINESS“Our business practices have reflected two core values: integrity and innova-tion,” Smith said. “These values have guided us through massive changes in technology, many waves of competi-tion, and various changes in procure-ment regulations. All that time, we have kept our focus on local customers.”

BEP is building an informal network of customers and colleagues to support Southeast Alaska. Part of this effort is a new program where BEP customers will be able to go on the company’s website and vote for which charities receive a portion of BEP’s profits. “The economic well being of a community is about keeping money and resources local,” Smith said.

BEP has also joined Juneau’s Green Gazelle Network, where a group of en-trepreneurs have joined to share best sustainable business practices in rural Alaska. University of Alaska Southeast professor Rick Wolk runs the network as part of the Green Gazelle Research

Project. “BEP is a perfect participant because their customers save money, they support a local entrepreneur, and reducing waste is a first step for any office sustainability plan.”

BEP Co. recently qualified at the highest level of the Alaska Product Preference Program, which affords a 7 percent preference when bidding on State of Alaska contracts. Less than 1 percent of State agencies cur-rently use remanufactured cartridges. Smith is hopeful that this recent clas-sification and presence on the State of

Alaska vendor list will make it easier for government agencies to purchase toner cartridges remanufactured locally.

“Shelly exemplifies the modern-day entrepreneur,” said Eric Downey, client relations manager at the Alaska Manu-facturing Extension Partnership. “She expresses her creativity and sense of community through her business rela-tionships. She solves problems using lo-cal solutions and creates value for those around her. Entrepreneurs like Shelly create family wage jobs and maintain our unique Alaska character.” ❑

907.339.6760 | www.alaskagrowth.com

Alaska Growth Capital provides the expertise and resources to move your idea to reality.

Helping Alaska B wBusinesses Growes

BUSINESS LOANS

NEW MARKETS TAX CREDITS

CONSULTING SERVICES


Helping Anchorage Women EntrepreneursATHENA Society is taking applications

BY GAIL WEST


The PowerLink® program is a small business owner’s dream – and it’s available to women

entrepreneurs in the Anchorage area. Started locally in 2001, the Anchor-age Chamber of Commerce ATHENA Society accepts applications from eli-gible women business owners and, each year, selects one business to receive its support. Through PowerLink®, the successful applicant gains a volunteer panel of advisers with specific expertise to help meet the goals that business owner has established. Today, Pow-erLink® has graduated six woman-owned businesses and is working with a seventh (the program was inactive in 2004, 2007 and 2008).

“What PowerLink® did for me,” said Amie Sommer, who owns Tutka LLC with her sister Crystal Nygard, “was to give me the confidence to know when and how to ask for help and to know what resources are available. You can’t be an expert at everything.”

Sommer and Nygard were recipi-ents of PowerLink® help in 2003, and credit the program with the company’s increase in revenue.

“In 2003, we did about $1.5 million in business,” said Sommer, “and now we’re bringing in more than $3 million

a year. We’ve doubled our revenue and quadrupled our net income.”

When the sisters’ business was se-lected for the PowerLink® program, it was called PSI Environmental, and their primary focus was on sell-ing instrumentation. Their advisory panel included legal, marketing, government contracting and human resources expertise.

“As a matter of fact, our government contracting expert teamed up with us to submit a proposal. Although it was unsuccessful, that’s now evolved into our primary business,” Sommer said.

One of the issues the newly focused business tackled was changing their name from PSI Environmental to Tutka LLC and trademarking the new name and logo.

Eleanor Andrews, president and chief executive officer of The An-drews Group, initially found the Pow-erLink® program when she attended an ATHENA conference in the late 1990s, and she brought it home.

“Women own more businesses than men,” Andrews said, “but they don’t have that buddy, mentoring relation-ship with each other that men have. We don’t have a long history or tradition of talking with each other about how to get over hurdles. In the past, we didn’t network like men did.

“In the old days, we felt we had to put someone else down in order to get ahead,” Andrews added. “Not so now. We’re in a place in our professions to assist each other and help newer busi-nesses reach the next level.”

Phot

o co

urte

sy o

f Alis

on’s

Rel

ocat

ions

Alison McDaniel, owner of Alison’s Relocations, was PowerLink®’s first recipient. Today, McDaniel chairs the committee that helps other businesses.

2010 PowerLink® recipient Dog Tired Doggie Daycare is owned by Kari Campbell.

Phot

o co

urte

sy o

f Dog

Tire

d D

oggi

e D

ayca

re


The first recipient of the Anchor-age PowerLink® program, in 2001, was Alison’s Relocations, owned by Alison McDaniel.

“Alison was a sole proprietor in a man’s business, working in competition with well-known moving companies,” Andrews said. “Her niche was that she was flexible, she provided exceptional customer service, and she had great re-lationships with forwarders. She could give a competitive price to someone who didn’t have a corporate reloca-tion company, and she’d worked in the field for years before starting her own company.

Today, McDaniel chairs the Power-Link® committee, and takes a leader-ship role in putting together the advisory panel to help new recipients.

“With Alison,” Andrews said, “it was like paying it forward.”

According to McDaniel, one of the biggest things the program did was help her read and understand her financials.

“It took me a solid year to really un-derstand my balance sheet,” McDaniel said. “My panel very patiently walked me through it until I got it. They also gave me homework – mostly to learn more about my own business. Initially, I was so completely focused on mak-ing payroll. The panel helped me to see that worry is one all new business owners have, it wasn’t unique to me. With their help, I gained so much more self-confidence in my decisions and my choices.”

Businesses the PowerLink® pro-

gram has helped since its inception in Anchorage include an insurance agency, an engineering firm, a tanning salon and a winery. The 2010 recipient is Dog Tired Doggie Daycare, owned by Kari Campbell.

Campbell wants to expand her daycare to include boarding, as well. Campbell’s current panel gives her added expertise in real estate, human resources, general business, insurance and the law.

“One of the things I’ve asked from the panel is how do I leverage myself to grow the business,” Campbell said. “Do I need investors? Can I use my current space more efficiently or do I need to move? How can I make myself look the most marketable I can?”

McDaniel said Campbell’s business was already up and running profitably. The panel simply hopes to give her the boost she needs to expand and to retain a better net profit.

Although the current panel is still working with Campbell, the Anchor-age Chamber’s ATHENA Society is taking applications for new reci-pient businesses.

“The business has to be at least two years old and beyond the initial start-up difficulties,” McDaniel said. “The deadline for our next round of applications is May 30. Any eligible business that wants to apply can obtain an application from the Chamber or by going to the Chamber’s website at www.anchoragechamber.org and click on Programs.” ❑

Dogs get companionship at Kari Campbell’s Dog Tired Doggie Daycare.

Phot

o co

urte

sy o

f Dog

Tire

d D

oggi

e D

ayca

re


Somewhere shortly after meet-ing new people the question seems to arise: “What do you

do for a living?” It seems our identities are often inextricably linked to our professions. Often the conversation then turns to ones desire to start their own business. They want to turn their hobby into their work, follow their pas-sion, be their own bosses and any num-ber of other clichés about becoming an entrepreneur. But like a lot of people who start businesses, they sometimes are at a loss for the big picture.

Many believe that entrepreneurship is a risk and entrepreneurship is about taking risk. That is true – in the same way that a U.S. Coast Guard rescue swimmer is about taking risk. But, a successful rescue swimmer takes steps to mitigate risks so they don’t need to be rescued themselves. Successful entrepreneurship is also about miti-gating risks, which leads me to a few observations.

Your friends and family will be supportive. Don’t confuse being supportive with getting good advice.

The risk of entrepreneurship can be reduced if you understand how to take a calculated risk. Keep in mind though, “following your passion” (even though it can sometimes be good advice) is not about calculating any-thing. I have met plenty of passionate people who have experienced the hor-ror of failing in business.

Entrepreneurship is not about taking risk. It is about figuring things out: better products, better service, better hiring, better management, bet-ter marketing.

LEVERAGE ASSETSBeing successful in business is about leveraging your assets. Assets that may or may not include money. Your assets may be in your brand, your reputa-tion, your connections, your ability to connect with people, or your exper-tise. Combine your skills, background, experience and any other assets, tan-gible or intangible, to come up with a total package. It comes down to the all-important “how.” “How” solves your customers problems, “how” you solved their problem makes them come back, it’s “how” that pays the bills.

There are a number of resources available to help the new or expe-rienced entrepreneur figure out the

“How.” For those just starting a busi-ness Small Business Development Centers, SCORE, Women’s Business Solutions, the State of Alaska Business Assistance Center and ARDORS are all standing by to help with every-thing from business and marketing plans to setting up your bookkeeping software. The Procurement Techni-cal Assistance Center (PTAC) and State of Alaska Disadvantaged Busi-ness Enterprise (DBE) program can help your business grow as well. The SBA even has its own online training center with more than 25 free courses on issues ranging from starting a busi-ness to disaster recovery to entering government contracting. All of these resources have folks who can help you navigate the sometimes confusing world of business start-up.

For those in need of start-up or work-ing capital, equipment and inventory purchases, or a line of credit, the entre-preneur has many options as well. Fed-erally guaranteed, and in some cases, direct loans can be obtained from SBA, USDA or BIA. These are available in several forms, depending upon your project, your location, or specific cir-cumstances of individual borrowers. These federal loans and guarantees have no bottom threshold and top ends of up to $25 million.

The State of Alaska has several loan programs as well, many for specific projects or industries. A typical thresh-old within Department of Commerce programs is $300,000, but could be as high as $10 million. Under AIDEA the project can be even larger. Again, State programs have no mandated base loan amount.

Export capital, real estate purchase, energy and equipment upgrades on

Becoming an EntrepreneurMitigate risks to avoid needing rescued

BY SAM J. DICKEY


OP-ED

Sam J. Dickey, deputy district director, U.S. Small Business Administration

Alaska District Office.

Phot

o co

urte

sy o

f Sam

Dick

ey

Managing a healthcare enterprise as diverse as ours in bush Alaska can be quite a challenge. Thanks to our team at Parker, Smith & Feek who provide exceptional expertise supportive of our unique business model.

“

“DDDDDDDDDDDDDDDDDDDDDDDDDDiiiiiiiiiiifffffffffffffffffffffffffffffffffffeeeeeeeeeeeeeeeeeerrrrrrrrrrreeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeennnnnnnnnnnttttttttttttttttttttt bbbbbbbbbbbbbbbbbbbbbbbbyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy cccccccccccccccccchhhhhhhhhhhhhhhhhhhhhhooooooooooooooiiiiiiiiiiiiiiiiiiiiiiccccccccccccccccccccccccccccccccccccccccceeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee........ DDiiffffeerreenntt bbyy cchhooiiccee.UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUnnnnnnnnnnniiiiiiiiiiiiiiiiiiqqqqqqqqqqqqqqqqqqqqqqqqqqqqqquuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuueeeeeeeeeeeeeeeeeeeeeeee bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy ttttttttttttrrrrrrraaaaaaaaddddddddddddddddddddddddddiiiiiiiiitttttttttttiiiiiiiiiiiioooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooonnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn.....Unniiqquuee bbyy trraaddiittiioonn.

Coryee Hamons, Director of Risk Management Yukon-Kuskokwim Health CorporationBethel, Alaska

www.psfinc.com

2233 112th Ave. NE, Bellevue, WA 98004 425.709.3600 | 800.457.0220 4000 Old Seward Hwy., Suite 200, Anchorage, AK 99503907.562.2225

PPPPPaPaPaPaPPPaPaPaPaaPaPaPPPPaPaPPaaPaa kkrkrkrkrkrkrrkrkrrkrkrrkrkrrrkrrkr ererereerrererereeereerrreere ,,,, , SSSmSSmmmmmmmmmmmmmmmitititittiittitttttittititttttittthhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh h &&& &&&&&&&&& &&&&&&&&&&&&& FeFFFFFeFeeeFFFFFFeeFFFFeeeFeFFFeFFeFFeFFeeFFeeeekkkkkkkkkkkeekeekekeeekeekeeekkeeekekkkeekekeeekekkkkeeek ccccccccccc ccccccc ccccccccc ccoomooooooommmmmooommmomoommmomomoomooommommmmmooommommoommmoomommooommmooo bbbbbbiiibbbbbbbiibbbbbbibibbibbbibibbbinnnneeeeenenneeenneeeneennnnneeeeneeeesssssssssss sss aaa aa aaa aa ccocococococccococococooooocoocoooocolllllllllllllllllllllll bbbaaabbbabaabaabbaabaabbbaaaabbbbabaaba oorrorororoororororaatattttaataaatataaatatatattatata iiviiivivvivivvivvivivvvivvvivivivviviivveeeeeeeeeee eeeeParker, Smith & Feek combines a collaborativeteteeeeeteteeeteeteeteteeaaaammmammammmmamamammmmammmmammmammmm aaaaaaaaaaaa aa apppppppppppppppppppppppppppppppppppppppppprrrorooooooroororrrrororrror aaaaccccccccccaccacccaccaaccchhh hhhhhhhhhhhh tottototooooototootoootoooootottooto ccccccccccc ccccc c cccc c ccccliliiiiililililiillilliliieneneeenenennnnnneennenenenennennenennennennenennnnneeneneeennntttttttttttttttttttttt ttttttt sseeesseeseesesseeeeeeseseeeesseessseeeeeeeerrrrrvrvvrvrvrrvrvrrvrvrrvrrvrrrvvvvrrvrrrvvvvrrvviciciiciccicicicccccciiciccciciii eeeeeeeeee eee wiwwwiwiwiwiwiwiwwiwiwiwwiwwwiiwiwiwwiiiwiwwwwwwiiithtthtttthttthtthththththtthttththhttthttht 77777777777777777777777777777777777777777777777777777 7 4444444444444 444team approach to client service with 74yyyeyyyeyeeyyyeyeyeyyyyyeyeyyyeyeyeyyeyyyy aarrrrrrrarrarararrrarrraaaarraarararrsssssssssss sssssss sss ooofofoofffofoffofofofoofofffofofooffffffofoffffffofooof eeeeeee eee eeee ee ee eexxxpxxpxxxpxpxpxxxxpxpxxpxpxpxpxpxpxpxpxpxppppeerrrrerreerrrrrerreeerriiieeeeiiieiieieeeieiieeieeieeeeeeeieeeeieennccccncnnnccnnnn e e eeeeeeee tttttotoottotottottooootoottooootoooottotottttottotttooooootootootto ccccccccccccccccccccccccccc ccrrrrrererrrerererereereeerreeereeereeeattaatattttataatatatataattaatatattttaaaa eeee e e llalaaaaalaaalaaaalaaaaaaaaaaaaaaaaaasstttssttsssttttssststtstssssstssttsstsstssstiiniinnininininnnniiininnii ggggggggg gggg vvvvvvvvvavaaaaaaaaavvvavavvavvvvv llllluuuuullllulluuuuululluululuuuluuuuuuluuuuuueeeeeeeeeeeeeeeeeeeeeeeeeeee eeeee eeeeeeeeeeeeeeyears of experience to create lasting valuefffffofofofffofforrr r r r bbbbbbbbbuubuubbubbubbbbubbbububbbbubbuubuububbubbbusiisssssssisssiisisisisssinnnnnnenenenennenennnnenenenenneessssssssssssssssssssssssssssssssssssssssssssseseseseseeseesesseseeeseesesesessesesesseeesesesessses llll ll l l lliiikkkkkkkkkkikkkkkkkkkkkeeeeeeeeeeeeeeeeee e YuYuYuYuYYYYYYYYYYYuYuYuYYYuYYYYYYYYYYuuYuuuYuYuuYuuukkkokkkkkkokokkkokkkkokokkokokoookookokokkkkooonnnnnnn-nn-n-nnnnnn-n-nnnnn-nn-nnnnnnnnnnnnnn KuKKKuKuuuKKKuKuKuKuKuuKKKuuKuKK sssskkkkssssskkksskssskkkssskksssksssksss kokkkokkokokokokkokkkokwiwiiwiwiiiiwwwwiiiwiwiwiwwwiiiiwimmmmmmm mmm HHHHeeHHeHHeHHHHHeeHeeeeHHeeeeeHHeeeeealaaalalllaaalllllaalaaaallaaa thththtththhhhththhthththtthththhththththhthhhtthhh for businesses like Yukon-Kuskokwim HealthCCCCCCCCoCoCCoooooCCoCCCorrpprpppppprprpppppppppppppppppoooooorororororooooorooooooooooroo aataatttaatattattattaatattataaattaatttaatattatattttttaa iiiioioioiioiiiiioiiiiooooiioooiiiiiiooooiooiiiiiioiiiiooiiioiii nnnnnnnnnnn.nnnnnnn.nnnnnnnnnnnn...... TTTTTTTT TTTT TTTThhahhahhhahhhahahhahhh ttt’ttt’tt’tttt sssssssssssssssss s s wwwhwhhhwwhwhhwwwhwhwwwwhhwhwwhwwwwwwwwhww yyyyyyyyy yyyyyyy y yy yyyy oooovovoovovovovooovovoovooooooverererreerreererereerrrrr 9999999 6666%%%%%%%%%%%%%%%%%%%%%%66%%%%%%6%%6%6% oooooooo fffffff fff f f f ooooouuuuouoooouuuuuuouuuouuouuuuurrrrrrrrrrrrrrrrr rCorporation. That’s why over 96% of ourclclclcclcccccllliieeeeeeeieeieieiieieeeiieeeeeeieeeeeieeeeeennnntttntnnntnntnnntnntntnnn sss ss ss rrrrerereeeeeerrereeerrerrereeereeereeeeererreereeeerreeeetttatataaaatataatataaatatatataaatatatatttaaataatataataatttatattaaaattataaaatattt iiiinininnniiininniinniiiiniiininiiiniinini oooooo oooo oururururruruururuurruuuurrrruurrurr fififififififififififififififififififififififi firmrrrmmmmrmrmrrmmmrmrmrmrmmmrm yyyyyy yyyyeeeaaeaeaeaaeaearrrrrrrr fafffffffaffafafa tteeteteeetteeetttetettetteeeeeeeeeterrrrrr r rr yyyeyeyeyeeeeeyeeeeyeeyeeeeyeeeeeeeeeeyy aaaaaaaaarrrraarrrraaaarrraaarrraarraraaaaaaaaraara ...clients retain our firm year after year.


fishing boats, and many other types of capital needs can be accommodated through these programs. Under some circumstances you may be able to re-finance existing debt.

Current indicators show a large percentage of commercial real estate mortgages are set to mature within the next few years. In our current eco-nomic climate, businesses may find it difficult to renew maturing loans, even if they have performed well, due to declining real estate values.

REFINANCE For the first time in the history of the Small Business Administration, 504 program loans to be used for the re-financing of qualified existing debt without the need for the business to expand and create jobs. In other words, pure refinancing into a loan vehicle with no balloon or demand features and an attractive 20-year fixed interest rate on a significant portion of the debt.

Quali fying small - to middle-market business borrowers can re-finance their maturing fixed-asset loans with long-term, true amortiz-ing financing. The business owner secures long-term financing with a significant portion at an attractive fixed-interest rate, and the bank is able to mitigate its risk associated with declining real estate values. This structure is a clear win-win situ-ation for all parties involved.

This recent change is a rare op-portunity. Borrowers will be able to refinance up to 90 percent of the current appraised property value or 100 percent of the outstanding mortgage, whichever is lower, plus eligible refinancing costs. It is not possible to cash out of any equity position in the real estate through the 504 loan structure. This could help many Alaska businesses whose owner-occupied commercial real estate loans will be maturing in the near future. This is a temporary re-financing program and is expected to benefit about 20,000 businesses nationwide. If it sounds like this would be of benefit to your busi-ness then you should check into 504 refinancing soon.

Typically, a 504 project includes three elements:

1. A 1st mortgage loan from a bank covering up to 50 percent of the project cost

2. A second mortgage loan from an SBA Certified Development Com-pany covering up to 40 percent of the project cost

3. A 10 percent contribution from the business borrower

Many believe that entrepreneurship is a risk and entrepre-neurship is about taking risk. That is true – in the same

way that a U.S. Coast Guard rescue swim-mer is about taking risk. But, a success-

ful rescue swim-mer takes steps to mitigate risks so

they don’t need to be rescued them-

selves. Successful entrepreneurship is

also about mitigating risks, which leads me to a few observations.

– Sam Dickey,Deputy District Director

U.S. Small Business Administration,

Alaska District Office

EXPAND YOUR BASEYou have figured out the how of gather-ing assistance in business issues, and how to locate additional financing venues, now how can you expand your busi-ness base? The SBA has five programs designed to help small businesses get their foot in the door to federal contracts. The Section 8(a) program for socially and economically disadvantaged owned businesses, the Small Disadvantaged Business, Women’s Business Ownership, Service Disabled Veteran Business Own-ership and the HUBZone programs are all designed to help.

With the exception of the HUBZone program, business eligibility is based upon a qualifying individual. Under the HUBZone program the qualifiers are predominantly location based.

For all of the programs, the qualifying owner must own at least 51 percent of the business and have day-to-day manage-ment responsibility. All of these programs have a certification process before a busi-ness can claim status and the processes range from simple to fairly involved.

Another program to consider is the State of Alaska Disadvantaged Business Enterprise (DBE) program. Much like the SBA’s 8(a) program it can give you a leg up on the State contracting market and provide many kinds of assistance, including funding for some kinds of projects and reimbursement for some qualifying expenses.

The Procurement Technical As-sistance Center (PTAC) staff of expe-rienced contracting professionals can help you locate not just federal, State, and municipal contracting opportunities but help you with certifications as well.

Alaska is a resource-rich state and many of those resources are just a phone call away. ❑

About the AuthorSam J. Dickey is the deputy district director of the U.S. Small Business

Administration Alaska District Office. He has held this position since March

2006, and is responsible for the delivery of all SBA programs and services. He has been employed by the U.S. Small

Business Administration since 1988. A resident of Alaska since 1966, Dickey lives with his wife of 25 years and has

three children; all residing in Anchorage.

*SBA loans are subject to credit approval. Certain restrictions may apply. Key is an SBA Preferred Lender. Key.com is a federally registered service mark of KeyCorp. ©2010 KeyCorp. KeyBank is Member FDIC. ADL3027

your business is uniqueShouldn’t your SBA Loan be too?

Every business has different financing requirements. Whatever your

business needs, having an experienced SBA Preferred Lender on your

side is essential. Key has been a Top 30 SBA Lender for the last 13

years. Our dedicated SBA specialists have put the credit and financing

needs of our clients first. That has meant securing SBA loans* for

businesses that provide flexible payment options, competitive rates,

and lower monthly payments.

Find the right solutions for your business by contacting us today.

go to key.com/sbacall Win Gruening at 907-463-7201


Blessed Alaska?Moving more oil through pipeline

critical priorityBY MIKE BRADNER


Are the North Slope oil fields run-ning dry? Is the trans-Alaska oil pipeline about to shut down?

One hears a lot about these things re-cently. There are problems, indeed, but they are caused by humans. In other words, they are fixable.

To begin with, there is lots of oil

and gas on the North Slope and else-where in Alaska. The Slope is con-sidered by geologists to be one of the most prospective regions in the U.S. in terms of potential for new oil and gas discoveries.

But while major discoveries have been made in northern Alaska, and

large oilfields are now producing, high costs and inhibitions from ex-ploring the more prospective areas, such as the offshore, the Arctic Na-tional Wildlife Refuge coastal plain and the National Petroleum Reserve-Alaska, have kept exploration focused on areas of the central North Slope,

A Nabors Alaska drilling rig.

Photo by Judy Patrick


which have been explored and that have only modest prospects now.

The State’s high production tax rate is also now seen as a key obstacle to new development on lands available to the industry. Gov. Sean Parnell has a bill in the Legislature that would lower taxes, but its prospects are uncertain.

The fact that the trans-Alaska oil pipeline is now moving about 630,000 barrels per day, operating at one-third of its original capacity of 2 million bar-rels per day, is a concern. With North Slope production declining at rates of 6 percent per year, on average, the de-clining flow of oil has become a prob-lem for Alyeska Pipeline Service Co., the pipeline operator.

The “low flow” conditions will soon present operations and technical chal-lenges if the decline continues. Getting more oil moving through the pipeline is now a critical priority for the industry and the State.

It can be done. There is potential for new discoveries in the areas now open to development, particularly un-conventional oil. However, much of

this is technically challenged and will be costly to develop. But, the resource that is in place is large. Producing it is a matter of technology, cost and changes in the State’s tax system.

There are other parts of Alaska that have oil and gas potential besides the North Slope. There are the large sedi-mentary basins of Interior Alaska that are generally unexplored, and which are considered to have potential mostly for natural gas. There is also, in some places, potential for oil. Cook Inlet, Alaska’s oldest producing region, is now experiencing some new explora-tion for natural gas, but the there are concerns there is yet not enough drill-ing to deter shortfalls in gas supplies that are expected in a few years.

HISTORICAL PERSPECTIVEGeologists have known about the oil and gas potential of the North Slope since the early years of the 20th century. In 1923, the federal government de-clared a large area of the Arctic Slope, 23 million acres, as a petroleum reserve for the U.S. Navy (it is now NPR-A).

In the late 1950s, the federal gov-ernment held lease sales on lands in the central North Slope east of the pe-troleum reserve. The State of Alaska, formed in 1959, began selecting lands and holding lease sales in the northcen-tral part of the Slope, centering on the Prudhoe Bay area.

The industry’s early exploration wells were unsuccessful, but finally in 1969 a large discovery was made at Prudhoe Bay, the largest in North America. A pipeline was completed in 1977, and production began on the North Slope that year.

Since the start of production at the Prudhoe Bay field, several other large fields were discovered. According to the State Department of Revenue, since production began in 1977, the North Slope fields have produced more than 16 billion barrels. Remaining conven-tional oil reserves in the known fields exceed 5 billion barrels, according to the State’s estimates. The U.S. Geologi-cal Survey estimates there are 38.1 bil-lion barrels of technically recoverable oil on the North Slope and in offshore


stayPeak’s All Terrain Vehicles can carry loads of up to 50 tons without an impact on the environment, and they are recognized as “Summer Approved” for tundra travel by the State of Alaska’s Division of Natural Resources.

Our fleet of ATV’s are an investment toward protecting the environment and supporting the petroleum industry in its effort to explore and develop Alaska’s Arctic Regions.

We are mobile when you are ready to explore.

peakalaska.com

Vehicles can carry loads of up to 50 tons withohout aann

mobilewaters, but most of this is in areas where drilling is not yet allowed.

While these estimates appear im-pressive, it must be remembered that it will be a decade or more before oil can be produced from the offshore, as-suming that discoveries are made. As for ANWR, it is very unlikely Congress will approve exploration in the refuge because of environmental sensitivities, at least in the near-term future. NPR-A has seen exploration, but only small discoveries have been made.

Most of the approximate 5 billion barrels of oil yet to be produced in the central North Slope area, which can be reached by industry now, are reserves known to exist in the producing fields. Additions to field reserves can be made with more intensive development drill-ing and additional enhanced oil recov-ery techniques. A small percentage of additional recovery amounts to a lot of oil, because these are large fields.

UNCONVENTIONAL OILIn addition to the conventional oil, there are large resources of unconventional oil, which have not been included in the estimates. There are basically three types of unconventional oil resources – viscous oil, heavy oil and shale oil, in addition to deposits of conventional oil in thin layers of reservoir or reservoir rock of poor quality.

There are also large deposits of lower-quality “viscous” (thick) oil spread over wide parts of the central North Slope. Viscous oil is basically conventional oil that is thicker and more difficult to produce than conventional oil.

Companies have known about the viscous oil resource for decades and a great deal of research and development has been done in finding ways to com-mercially produce this oil. Producing conventional oil in thin layers or poor rock, or viscous oil, is a matter of tech-nology and costs.

A new development is that a com-pany relatively new to Alaska, Eni Oil and Gas, now has a separate field that is mostly viscous oil, at least in its first phase. The new Nikaitchuq field devel-oped the Eni began production in Janu-ary 2011, and is primarily viscous oil.

There also is heavy oil, or thick oil that exists at shallow levels to the point that it is partly frozen into


wwwwwwwww wwwwwwwwwwwww wwww . a ssssssss rrrr ccccc EEEEEE NNNNNN EEEEEEEEE R G YYYYYYYYYYY . ccccccccccc oooo mmw aaa sss r c EEEEEEEEE NNNNN EEE RRRR GGG YY ccccccccc

WE PERFORM JUST ABOUT EVERY TASK YOU CAN IMAGINE, BUT OUR MOST IMPORTANT JOB

IS SAFETY TH E P R O D U C E R S’ PA RTN E R F O R 25 YE A R S

the permafrost. This oil is not now economic to produce. An example of this is the Ugnu formation that is in a formation even shallower than the viscous oil. It is estimated that there are more than 20 billion barrels of oil “in place” in the Ugnu formation.

Companies are working on new technologies that could make heavy oil production possible. BP, for example, has a test production project due to begin in the spring 2011 using a tech-nology that has been adapted from a similar process used in Canada.

OIL PRODUCED FROM SHALE The newest idea being discussed for the North Slope is the possibil-ity of producing oil from the large formations of shale rock, the source of the oil that, over geologic time, accumulated in the conventional oil reservoirs that now support producing fields. It is estimated that 80 percent of the oil present in these shales is still in the rock. The other 20 percent of this escaped over time to migrate upward, and some of this wound up trapped in sandstone and limestone formations at shallower levels.

Geologists and petroleum engi-neers have long been intrigued with the possibility of producing this oil but it has not been technically possible until recently. Now the combinations of horizontal drilling of production wells combined with new methods of hydraulic fracturing of the tight shale rock to allow oil fluids to flow make this production economic.

In the Lower 48 states, oil is now being produced in large quantities from the Bakken shale in North Da-kota and other places, and there are companies who now want to import these techniques to the North Slope. Pioneer Natural Resources and Eni are using these techniques in tight reservoir rock and viscous oil formations of the Oooguruk and Nikaitchuq fields.

An independent company, Great Bear Petroleum, intends to test these concepts with the shale source rocks themselves. Great Bear has secured a large lease position south of the Prud-hoe Bay and Kuparuk River fields, ar-eas that have been explored extensively for conventional oil. Great Bear will drill two exploration wells in winter


2011-2012 to test where oil can be pro-duced from the shale rock.

If it can, the question of if it can be economically produced will de-pend on whether low-cost drilling, well completions and infrastructure can be done. These are critical questions because the North Slope is notorious for being a high-cost environment, and the shale rock production will require large numbers of wells and substantial surface infrastructure such as pads, roads and utilities.

Great Bear’s progress in testing its concept will be watched closely by many companies. For example Rep-sol, the major Spanish company, has recently acquired a large North Slope onshore lease position in partnership with Armstrong Oil and Gas, a Denver independent company. Many of Rep-sol’s new leases are west of the Great Bear leases and it is believed the com-pany is interested in the potential of a shale oil resource.

NATIONAL PETROLEUMRESERVE-ALASKA

The National Petroleum Reserve-Alaska has seen sporadic exploration since the post-World War II period. The U.S. Navy carried out early exploration, the result being discovery of a small oil field at Umiat, on the southwest-ern boundary of the reserve, and a gas field at Barrow. Numerous other oil shows were found in wells, but noth-ing substantial. The Umiat and Barrow discoveries were not large enough to commercially develop.

An independent company, Renais-sance Umiat LLC, is now engaged in possible development of the small Umiat field discovered more than 50 years ago.

The State is planning a road to this area from the existing Dalton Highway and the trans-Alaska oil pipeline cor-ridor. The road would also be used to support a small pipeline carrying oil from Umiat to the oil pipeline.

Meanwhile, gas wells at Barrow were drilled years ago to supply gas to gov-ernment installations and ultimately the local Inupiat village. The North Slope Borough, the regional municipality, now owns the Barrow gas fields and has sponsored exploration that located additional reserves.


• Pre-engineered steel buildings • Warehouses • Shops • Hangars • Bridge cranes • Riding arenas• Insulated foam panels

ConocoPhillips, Anadarko Pe-troleum Corp. and FEX LLC have meanwhile explored in areas of the northeast NPR-A in recent years and have made small discoveries. Cono-coPhillips and Anadarko would like to develop some of these but is in-hibited in building a road and infra-structure from the existing Alpine oil field because of a dispute with the U.S. Army Corps of Engineers over a permit to build a bridge across the Colville River. Development of these deposits is blocked until this disagree-ment is resolved.

The southern North Slope has seen little exploration, but is generally con-sidered to be more favorable to large gas discoveries than oil. Exploration for gas has been done in this area by Anadarko Petroleum, BG Energy and PetroCanada, working in a partner-ship. The results of drilling are being held confidential. Generally, this work is at a low level until there is some clarity on whether a natural gas pipe-line will be built. An exploration well drilled in the 1950s at Gubik found gas, but the discovery was not commercial at the time. Anadarko acquired this property and drilled a second well, but the results are not public.

There is also considerable poten-tial for new natural gas discoveries. The known, proven (confirmed) gas reserves are approximately 36 trillion cubic feet (tcf), mostly in the Prudhoe Bay and Point Thomson fields. The to-tal technically recoverable resource (unconfirmed) is estimated at 186.3 trillion cubic feet (tcf). Much of the remaining undiscovered gas resource is in the Chukchi Sea, at 60.1 tcf tech-nically recoverable.

Meanwhile, plans for a large natural gas pipeline face uncertainties because there is a large surplus of gas in North American markets and prices are low.

As an option in case the large pipe-line is delayed, the State is pursuing an in-state gas pipeline from the North Slope to Southcentral as an alternative to a large pipeline.

Gas production is seen as impor-tant to future oil production because it would share the costs of maintain-ing infrastructure. Plus, as companies begin to explore for gas they will also, inevitably, find more oil. ❑


Point ThomsonWill it keep Alaska oil flowing?

JACK E. PHELPS


The Point Thomson Unit of oil and gas leases on Alaska’s North Slope was created by

the State of Alaska in 1977, the same year the first North Slope oil moved down the trans-Alaska oil pipeline to Valdez.

According to a Department of Nat-ural Resources (DNR) briefing paper, “Units are formed when a group of lessees apply (sic) to the State to form a unit because their leases overlay a common geologic formation that holds recoverable oil or gas. Unitiza-

tion extends the term of lease so that the discovered resources can be pro-duced in an efficient and coordinated manner that will maximize recovery and minimize waste.” Unitization of petroleum leases is a common prac-tice in Alaska.

©Business Wire photo

The Nabors 27E rig drilled the surface section of the second well at the Point Thomson central pad in September 2009.


T M

U P T O 1 0 0 P O U N D S P E R G O L D S T R E A K PAC K AG E I

GoldStreak® Package Express is the best

option for all your time-sensitive shipments.

Reach more than 19 destinations in Alaska

and more than 80 cities across the U.S.

through same- or next-day delivery.

You focus on the contents, then count

on Alaska Air Cargo to take it

from there.

We’ll take it from here.

LONG-TERM PROJECTIn 1977, the Point Thomson Unit con-sisted of 18 leases on 41,000 acres in an area some 60 miles east of Prud-hoe Bay, along the Beaufort Sea coast near the western border of the Alaska National Wildlife Refuge (ANWR). Some of the original leases were pur-chased by ExxonMobil as early as 1965, before Arco (newly formed by the merger of Richfield Oil Co. and Atlantic) drilled the Discovery Well at Prudhoe Bay, revealing the existence of North America’s largest oil field. In 1969 and 1970, ExxonMobil and Chevron acquired additional leases in the Point Thomson area. According to DNR records, the Point Thomson Unit consisted of 46 leases, covering an area of 106,000 acres.

Over succeeding years, Point Thom-son leases were acquired by a variety of companies and are currently held by a group of Alaska’s most active oil companies, including ExxonMo-bil (52.6 percent), BP (29.2 percent), Chevron (14.3 percent), ConocoPhillips (2.8 percent) and others (1.1 percent). ExxonMobil is the operating company, responsible for exploring and develop-ing the unit’s resources.

Sufficient resource analysis has been done on the Point Thomson Unit to determine a significant amount of oil and natural gas exists in the lease area. It is estimated by the oil companies and verified by the State that the unit contains approximately 8 trillion cubic feet (Tcf) of natural gas and more than 200 million barrels of recoverable oil. The natural gas at Point Thomson rep-resents approximately one-fourth of all known gas reserves on the North Slope, according to knowledgeable sources.

During the early 1980s, the compa-nies began drilling in the Point Thom-son Unit to accomplish the initial steps of developing the resource. However, by the middle of the decade, work had virtually stopped in the area, and ExxonMobil drilled no new wells after 1983. In the mid-1990s, Chevron and BP drilled two wells in the unit, con-firming the presence of recoverable oil. Over the years, ExxonMobil filed nearly 20 Plans of Development for the Point Thomson Unit with the State, but by the turn of the century, little work had been done on the ground.


STATE TRIES TOTERMINATE LEASES

During Gov. Frank Murkowski’s administration (2002-2006), the State began to consider terminating the Point Thomson lease agreement, arguing that work associated with keeping the leases, as specified in the Unit Agreement, was not being done and the unit hold-ers were therefore in default. In 2005, DNR rejected ExxonMobil’s 22nd Plan of Development (POD) and proceeded toward terminating the unit.

On Nov. 27, 2006, just days before the Murkowski administration came to an end, DNR Commissioner Mike Menge signed an order terminating the Point Thomson Unit and cancel-ing the leases. ExxonMobil filed a request for reconsideration and, in keeping with applicable regulations, DNR took up the review. One month later on Dec. 27, 2006, DNR Acting Commission Marty Rutherford af-firmed the Menge decision and issued an order terminating the Point Thom-son Unit and its associated leases. This set the stage for litigation over Point Thomson, and the fate of a major fu-ture source of North Slope oil and gas was cast upon the courts.

Since litigation began over the State’s plan to de-unitize Point Thom-son, Anchorage Superior Court Judge Sharon Gleason has handed down two important decisions. The first came in December 2007, in which the court remanded DNR’s decision to then-Commissioner Tom Irwin, asserting the oil companies’ contractual rights had not been “fully resolved” and the decision was therefore faulty on proce-dural grounds.

After an administrative hearing held in February 2008, Irwin issued another decision that April, again ordering the termination of the Point Thomson Unit. The leaseholders again pursued a rem-edy in Superior Court and, in January 2010, Judge Gleason again found DNR had failed to adequately address the leaseholder’s due process rights.

BILLION-DOLLAR DEVELOPMENTAs of this writing, the Point Thom-son Unit is legally still intact, and DNR is involved in negotiations with ExxonMobil over the future of the unit and the remaining 38 leases

within it, according to Kevin Banks, director of the Division of Oil and Gas. The parties have agreed to postpone further court review pend-ing the outcome of settlement talks.

ExxonMobil Production Co. Presi-dent Rich Kruger expressed his com-pany’s commitment to bring Point Thomson on line, saying, “ExxonMobil wants to see Point Thomson developed. We have made substantial progress in the field, including safely drilling the first project well to total depth. This well reaches out horizontally from the shore-based rig to a subsurface target nearly two miles offshore.”

According to Kruger, ExxonMobil has spent more than $1 billion to de-velop the unit, with more than one-third of that money expended since 2008.

In addition, Kruger has publicly committed ExxonMobil to working with the State of Alaska to resolve the regulatory dispute. This commitment also has been affirmed by Gov. Sean Parnell. Speaking last year before a meeting of the Alaska Support Indus-try Alliance, Parnell said, “We need to resolve this litigation, and I intend to work diligently to bring this to a conclusion that is in the best interests of Alaska.”

In the meanwhile, under an interim decision issued by DNR, ExxonMobil was permitted to drill wells on two of its leases within the unit. Two produc-tion wells were completed last year under that program, and the stage has potentially been set for the Point Thomson Unit to begin contributing to North Slope production some time in the reasonably foreseeable future. Additionally, the interim agreement allows ExxonMobil to construct a gas-cycling and condensate-production facility within the unit.

Unfortunately, the difficulties are not limited to the regulatory impasse with DNR. Other hurdles must be overcome before any oil from Point Thomson can be added to the crude presently flowing from Pump Station One toward Valdez, or before natural gas from the unit can be shipped through any gas pipeline that may be built.

To begin with, the reservoir charac-teristics are very different from those at other North Slope oilfields, such as Prudhoe Bay and West Sak. The

Safe, Professional, Experienced

& Ready to Fly

For 63 years, Era Helicopters

LLC has been the leader in Alaskan

helicopter operations. The search for

minerals has taken Era into the most

rugged and remote areas of Alaska.

9 09 0999 0999 09 09 0 7 -7 -7 -7 -777 5 55 55 55 55 55 555 55 5555 55 55 55 0 -0 - 8 5 0 00 0 • m m i li l l i o n a i r . c o mmm

MILLION AIR A l a s k a ’s l a r g e s t 2 4 - h o u r f u l l

s e r v i c e F B O , f e a t u r i n g t h e h i g h e s t l e v e l o f p r o f e s s i o n a l

g r o u n d s u p p o r t , c u s t o m e r s e r v i c e , s e c u r i t y a n d s a f e t y.

9 0 7 5 5 0 8 6 0 0 • e r a h e l i c o p t e r s c o m9 0 7 5 5 0 8 6 0 0 • e r a h e l i c o p t e r s c o m9 0 7 5 5 0 8 6 0 0 • e r a h e l i c o p t e r s . c o m

H E L I C OP T E R S L L C a SEACOR company


reservoir is complex and questions remain about how to efficiently cycle the gas to produce its condensates so that its relatively “light” oil can be produced using a combination of gas injection and production wells.

“The condensates lie in an over-pressurized retrograde reservoir, and (the companies) must use dry gas injec-tion for cycling to maintain pressure or risk losing the liquid resource,” Banks says. “The pressures are very high – over 10,000 pounds per square inch – and will require lots of compression and stout vessels.”

ExxonMobil is currently working on an Environment Impact Statement under the supervision of the U.S. Army Corps of Engineers, that, when com-pleted, will allow the company to build new gravel pads, the production and compression facilities, and a pipeline to ship oil out of the area for transporta-tion down the trans-Alaska oil pipeline to Valdez. The plan is to construct a new pipeline from Point Thomson to BP’s Badami field west of the unit, where the oil will be fed into the existing pipe from Badami to Pump Station One, according to Banks. Badami is approxi-mately 30 miles away from the pipeline, about halfway between Point Thomson and Pump Station One.

The addition of condensates from Point Thomson to the currently pro-duced oil from fields such as Prudhoe Bay and West Sak will be a good thing, according to Banks.

“Crude from those fields is much heavier than the Point Thomson con-densates,” he says. “West Sak oil is very heavy and very cold.”

The lighter oil from Point Thomson will add to the efficiency of moving the combined crude down the pipeline, Banks adds.

At present, ExxonMobil seems de-termined to see Point Thomson con-tributing to the North Slope’s total production of oil sometime in the near future. Recent estimates indicate that could be a reality as soon as 2013. But for that to happen all the legal issues will have to be resolved soon and a successful, on schedule, completion of the environmental work is necessary for construction to begin in a timely manner. Alaskans should keep their fingers crossed. ❑


Moveable Energy – Liquefied Natural Gas

Market sector to watchJACK E. PHELPS


One of the great energy bounties contained within this globe we call Earth is natural gas.

It is abundant and provides a source of energy for mankind while emitting relatively few of the polluting elements so common to the use of other volatile substances. It is, therefore, a highly prized and coveted commodity around the world.

The challenge with natural gas has always been in the transportation equa-tion. The simplest and most efficient method is to push it to its destination market through pressurized pipelines. This has worked well in heavily settled areas of the world, such as the Lower 48, where there are thousands of miles of transmission and distribution pipes.

What happens, though, when some-

one wants to transport natural gas across an ocean or across the vast expanse of the Alaska tundra? Until the second half of the 20th century, this challenge was not answered. Today, however, we have the technology to liquefy natural gas by lowering its temperature to 259 degrees below zero, Fahrenheit. The process not only turns the gas into a liquid, but shrinks it to less than 0.06 of

Aerial view of Fairbanks Natural Gas LLC’s liquified natural gas (LNG) storage tanks.

Phot

o co

urte

sy o

f Fai

rban

ks N

atur

al G

as L

LC


its natural volume. The gas can then be stored in steel tanks and transported to wherever it is needed. At the destina-tion, it is warmed back up, reconverting it to gas, and distributed via the normal pipeline process.

LNG HISTORYLiquefied natural gas (LNG) has a long history in Alaska. Gas is commonly found in petroleum-producing basins, and Cook Inlet is no exception. Mara-thon Oil discovered gas on the Kenai Peninsula in 1959, two years after Rich-field Oil’s Swanson River oil discovery.

In the late 1960s, Phillips Petroleum developed a patented process called the Optimized Cascade® process for successfully liquefying and transport-ing natural gas. This development was prompted by a British process that al-lowed Great Britain to import gas from Algeria to the islands in the early 1960s. In 1967, Phillips Petroleum and Mara-thon Oil, holders of gas leases on the Kenai peninsula, signed agreements with Tokyo Gas and Tokyo Electric to supply LNG from Cook Inlet to Japan, according to company records.

The Kenai liquefaction plant was completed in June 1969, and the first shipment of LNG left Nikiski in Cook Inlet in October via the tanker ship Polar Alaska. Its destination was Yo-kohama, Japan, where it arrived in No-vember 1969. This was the first LNG ever exported from North America. The ConocoPhillips plant in Kenai was the only North American commercial exporter of LNG.

For the next 41 years, the gas lique-faction plant in Alaska continued to sup-ply Japan with natural gas. According to ConocoPhillips spokesperson, Natalie Lowman, the LNG plant in Kenai was acquired as a legacy property when Conoco Inc. and Phillips Petroleum Co. merged in 2002. Gas input to the plant came from leases held by Phillips (later ConocoPhillips) and Marathon Oil Co., on a 70/30 basis. This ratio has been maintained to the present day. Cono-coPhillips is the operator of the plant. Marathon has handled the responsibil-ity of transporting the LNG to Japan on ocean-going vessels.

Effective April 1, 2009, the Kenai liquefaction plant was authorized by the Federal Energy Regulatory Com-

mission (FERC) to export up to 98.1 billion cubic feet (Bcf) of natural gas to Asia through March 31, 2011. Recently, the companies applied for and received an order from FERC, extending the license until 2013. Contacts to support these exports proved illusive, however, and on Feb. 9, 2011, ConocoPhillips an-nounced it would be closing the facility.

Lowman says that operation of the facility and the export of LNG will con-tinue at least until the end of March. Beginning sometime in April or May, the plant will be put into mothballs to protect the assets until a decision can be reached about the future.

“The plant is in very good condi-tion and we are keeping our options open,” Lowman says. Possible future uses could include re-gasification of imported LNG, an operation exactly the opposite of the purpose for which the plant was built and for which it op-erated during more than four decades. In the meantime, we will continue to honor our contracts with local utilities.”

Production of natural gas from Con-ocoPhillips operations in north Cook Inlet and Beluga will not be affected. One-third of the ownership of the Be-luga field is held by ConocoPhillips. The remainder is owned by Municipal Light and Power and Chevron. Gas from that field is used to generate elec-tricity for the Anchorage bowl.

While the future of LNG opera-tions on the Kenai Peninsula remains uncertain, LNG is not a dead issue in Alaska. Discussions have been ongo-ing for years about piping natural gas from the North Slope to Valdez down the trans-Alaska oil pipeline corridor, liquefying it in Valdez, and selling it to overseas markets. This idea received a boost in 2002 when voters approved a measure establishing an agency to study and promote the project.

The Valdez LNG proposal had the strong backing of the late Gov. Walter Hickel and other politicians. But sup-port has been lacking from the industry, with the major owners of North Slope gas leases favoring a conventional pipe-line project. That proposal would take North Slope gas down a route roughly following the Alaska Highway and would connect to the North Ameri-can gas pipeline network in Alberta, Canada. From there, Alaska gas would


be sold on the open market along with gas from Canada and the Lower 48. With competing proposals for a con-ventional pipeline on the table, and a rapidly changing worldwide gas mar-ket, including new sources of LNG, the resolution of this debate is unknowable at the present time.

TAKING LNG TO MARKETFairbanks is not waiting for the matter to be settled. In 1998, a new company, Fairbanks Natural Gas LLC. (FNG), began delivery of natural gas to resi-dential customers. There are no known commercial sources of natural gas near Fairbanks. There is no pipeline from the North Slope, nor is there one from the fields in Southcentral. But such dif-ficulties do not deter determined en-trepreneurs. FNG President and Chief Executive Officer Dan Britton says his company buys approximately 1 Bcf of gas per year from Aurora Gas, an opera-tor of Cook Inlet gas near Point MacK-enzie. The method of delivery? LNG is trucked from a liquefaction plant in the Matanuska-Susitna Borough to Fairbanks. There it is gasified at one of two plants in Fairbanks and distributed by pipe to customers in the city. Ap-proximately 800 million cubic feet are delivered to consumers annually.

Demand for gas in Fairbanks is larger than the current supply, according to Britton. The company is in discussions with ExxonMobil with an eye toward securing supplies of North Slope gas to further exploit the Fairbanks mar-ket. Making this happen requires two key elements, Britton says. The first is securing an anchor client to purchase

There are no known commercial sources of natural gas near Fairbanks. There is

no pipeline from the North Slope, nor is there one from the

fi elds in Southcentral.


the gas. The second is for the Alaska Gas Line Port Authority to purchase Fairbanks Natural Gas LLC., and create a not-for-profit corporation to reduce costs to the local customers.

The goal is to purchase up to 4.7 Bcf annually from the North Slope. Of that amount, 3.4 Bcf would be delivered to Golden Valley Electric to power a gas turbine generator. This would replace a more costly, less efficient generator with one burning cleaner fuel. The re-mainder of the gas would be available for sale to residential customers.

“If we can secure gas from the North Slope, we could add an additional 70 miles to our current distribution pipe,” Britton says.

An influx of North Slope gas would also require construction of a larger gasification plant, which would be lo-cated in North Pole, replacing the two small facilities in south Fairbanks, now operating on Peger Road and Van Horn Road. Britton hopes progress in the negotiations will continue and agree-ments, including financing, will be in place sometime this summer.

“There is a two-year build time” an-ticipated for the project, he says.

If a gas pipeline gets built to carry North Slope gas to market, whether it goes to Valdez for liquefaction or to Alberta in a conventional delivery sys-tem, Fairbanks would be a beneficiary. A take-off point near Fairbanks would allow direct delivery to the North Star Borough market. If that happens, Brit-ton says, “we would redeploy LNG to other uses that don’t benefit from the pipe.” Therefore, currently planned investments in the use of LNG would not be nullified, according to Britton.

With the world economy in turmoil, a growing international environmental self-consciousness and political chal-lenges facing petroleum production in Alaska, the Gulf of Mexico, North Africa and the Middle East, liquefied natural gas is becoming an increas-ingly important commodity worldwide. Alaska is uniquely positioned to par-ticipate in this emerging sector of the energy market, both as a supplier and a consumer. Only time will tell how all the factors will play out, but this is one market sector that bears watching by politicians, businesses, investors and consumers alike. ❑


Value-Added Natural GasGas-to-Liquids under discussion

BY MIKE BRADNER


Alaskans have chased the notion of “value-added” manufactur-ing since the 1950s, sometimes

successfully, sometimes disastrously. Simply put, value-added in the Alaska context means the addition of value to a raw natural resource – oil and gas, fish, timber or minerals in some cases – through some form of local manufac-turing or processing.

The goal is for the work to be done in the state to add jobs, usually good-paying ones, in the development of a resource that would otherwise be exported in the raw.

There is actually a long history of value-added manufacturing in Alaska. Some of it was induced in one form or another by government action, while some happened at the initiative only of the private sector.

HISTORY OF ADDING VALUEIn the 1950s, federal government

inducements, in the form of extended long-term timber contracts, led to es-tablishment of the state’s first major value-added industry, the large pulp mills in Sitka and Ketchikan in South-east Alaska. These eventually closed due to changes in world pump mar-kets and changes in federal policy in the Tongass National Forest, the source of wood for the mills.

Similarly, State inducements in mak-ing State royalty oil available led to the establishment of refineries in Kenai, Fairbanks and Valdez that now supply fuel products in Alaska. A guarantee that crude oil supply was available made the refineries viable.

There are examples of value-added manufacturing that happened without government inducement or help, other than local tax holidays. Those include the large fertilizer plant and the lique-fied natural gas plant built near Kenai

in the late 1960s. These were based on gas produced in the Southcentral region that was, at the time, surplus to local demand for gas. The compa-nies involved, Phillips Petroleum (now ConocoPhillips), Marathon Oil and Union Oil of California were moti-vated to fine ways of selling their gas. They found they could do it by making something (fertilizer) or processing it into a form that could be transported by ocean (the LNG).

The surplus of local gas over time led to scarcity as the gas fields were depleted, and gas prices rose. These resulted eventually to the closure of the fertilizer plant a few years ago, and recently, the owners of the LNG plant announced they will mothball that plant, due to reduced gas supply as well as changes in the LNG market.

There are examples of unsuccess-ful government-induced value-added

Aerial view of the $19 billion Pearl GTL construction site in November 2008. The Qatar Petroleum and Shell project launched in 2006 and first gas flowed in March. When fully operational, 1.6 billion cubic feet of gas per day will be produced from the North Field. Pearl GTL, located in Ras Laffan Industrial City in the State of Qatar, is the largest gas-to-liquids plant ever built.

©20

11 R

oyal

Dut

ch S

hell

A i l i f th $19 billi P l GTL t ti it i N b 2008 Th Q t P t l d Sh ll j t l h d


manufacturing, a prime example the large seafood-processing plant in An-chorage that was built, operated briefly, and then closed. Alaska Industrial De-velopment and Export Authority, the State development corporation, built and owned the building for the plant, which is now a church.

However, there is also a success story of smaller-scale, value-added initiatives in seafood, mostly private-sector led, but much of it with government assis-tance. A State tax credit program that encourages value-added processing and quality improvement has contributed to an expansion of fillet production with salmon and other new product forms in lieu of the traditional canning or ex-porting raw frozen fish “in the round.”

These developments have allowed the state’s seafood industry to diversify its products, which strengthened the industry and the economies of coastal communities where the plants operate.

In recent years, plants have been developed, with various forms of assis-tance, to process fish waste into things that can be sold, including animal food and nutritional products.

Another example of seafood value-added development that occurred with-out government financial help are the large Japanese-owned surimi plants in Unalaska, in Southwest Alaska, where a food product – surimi – is made from pol-lock harvested in the nearby Bering Sea.

OIL & GAS FOCUSIn recent years, of lot of thinking has focused on oil and gas value-added products. An early attempt at a petro-chemical plant in Valdez, fostered by the State, was unsuccessful. Because of that State government left petroleum, also the State’s major revenue source, strictly to the private sector for many years. But the idea that making some form of product with gas, natural gas liquids or crude oil, and creating local jobs, has never been completely lost.

A small group of Alaskans, for ex-ample, have stuck with the idea of a large liquefied natural gas plant in Valdez as an alternative to an all-land gas pipeline to the Lower 48. While there has never been a suggestion that the State subsidize a Valdez LNG plant, the leading proponents have pushed successfully for various kinds


of political support from State govern-ment, which is important.

Most recently, former Gov. Sarah Palin included a requirement for a Val-dez LNG option in the Alaska Gasline Inducement Act contract issued to TransCanada Corp., a Canadian pipe-line company.

TransCanada is focused on a pipe-line from Alaska to Alberta, to bring Alaska gas into the company’s existing network of pipelines, but the State’s re-quirement was for the company to also offer potential gas shippers a pipeline to Valdez if there is interest in building a LNG plant. Whether any offers for a Valdez route were made is unknown, as TransCanada must keep any proposals for shipping confidential at this point.

Other ideas for value-added natu-ral gas include using the natural gas liquids, particularly ethane, that could be shipped in a gas pipeline along with the methane, the main component of natural gas used as fuel. Ethane is com-monly used as a petrochemical feed-stock. Fairbanks business leaders have considered whether gas liquids like ethane could be extracted from a gas

pipeline in Interior Alaska and used in some form in manufacturing products. One topic of discussion around the gas pipeline is whether the State should encourage some of the gas liquids to be used in Alaska instead of being shipped to Alberta for use in Canada’s petro-chemical industries.

GAS-TO-LIQUIDSA new idea for value-added manu-facturing with natural gas is now be-ing discussed – gas-to-liquids. This is a process makes high-value liquids – fuels or even petrochemical feedstocks – through a chemical conversion of the gas. Products like ultra-clean die-sel, gasoline or jet fuel can be made. These are made also from crude oil with conventional oil refineries, but the process that uses natural gas as a feedstock also produces products with superior environmental qualities, which allows them to command a premium price in the market. For example, ultra-clean diesel made in Shell’s gas-to-liquids plant in Malaysia commands a premium in West Coast diesel markets because it lacks the sulfur and other

pollutants found in conventional diesel. Fuel distributors blend the two diesels to make it easier to meet strict air-quality rules in California.

There has been interest in Alaska gas-to-liquids for several years but the notion is now attracting more interest because of the uncertainty over whether a large Alaska gas pipeline will be built. Many see gas-to-liquids as an option; at least until a gas pipeline is possible.

A gas-to-liquids plant on the North Slope could manufacture liq-uid products from gas and send the liquids through the trans-Alaska oil pipeline, which is now operating at one-third of its capacity. Alterna-tively, if a smaller gas pipeline is built from the North Slope to Interior and Southcentral Alaska (the State is now working on preliminary feasibility studies of this) a gas-to-liquids plant in Fairbanks or Southcentral could be the large industrial customer needed to make this pipeline feasible.

The process behind gas-to-liquids is not new. German scientists devel-oped the chemistry in the 1920s and Germany built plants using the pro-cess to make diesel and gasoline from coal during World War II. Since then, South Africa has developed a success-ful industry based on coal-to-liquids and more gas-to-liquids industry.

Today two major companies have gas-to-liquids plants that operate on a commercial scale. They include Shell, which operates a plant in Malaysia and Qatar, and Sasol, of South Africa, which operates plants in South Africa and Qatar. Other companies, including ExxonMobil, also a major North Slope producer, are quite advanced in their GTL work, but do not have commer-cially operating plants.

$475 MILLION TAX CREDITState legislators are now interested in encouraging this industry for Alaska. A bill introduced in the Alaska Legislature March 21 would grant $475 million in State investment tax credits toward de-velopment of plants converting natural gas to liquid products.

The $475 million credit would be against State corporate income tax liability and would be for each plant built in Alaska, although the credit could not exceed 60 percent of the

www.doyonemerald.com

OIL AND GAS CONSULTING SERVICES

Specializing in: Process, Permitting, Efficiency, Innovation, Risk Management, Compliance, and Operational Assurance

For more information please call 907-258-8137

ENERGYIDEAS

PEOPLE

Alaska’s Engineering Professionals


total cost of the facility.State senators Lesil McGuire and

Tom Wagoner are sponsors of Senate Bill 109. Wagoner is co-chair of the Sen-ate Resources Committee, where the bill was assigned. McGuire is a mem-ber of the Senate Finance Committee, which will also consider the bill.

The two senators and other Alaska legislators are primarily interested in encouraging gas-to-liquids or similar projects as a substitute for a large-di-ameter natural gas pipeline.

If a large pipeline is delayed, a gas-to-liquids plant on the North Slope could make 50,000 barrels per day of liquid products that could be shipped through the oil pipeline, McGuire said in a statement.

Although the focus of most of the current interest is on gas-to-liquids, Alaska also has large undeveloped coal resources that could be commercialized with a coal-to-liquids process similar to that used for gas.

Gas-to-liquids, coal-to-liquids and also biomass-to-liquids, which can make fuel from biomass waste, usually refer to processes involving the Fischer-Tropsch process, the chemical conver-sion process developed in Germany. Any carbon-bearing organic material can converted to liquids through a se-ries of chemical changes.

The process is different than LNG, which involves cooling gas to a tem-perature where it becomes a super-cold liquid, a form in which it can be trans-ported in tankers and then regasified at the destination. With LNG, the basic chemical formulation doesn’t change. It is still methane, but is chilled to a cold liquid, transported and regasified for use like any other natural gas. With gas-to-liquids, the final product, diesel or jet fuel for example, can be trans-ported and used like conventional die-sel or jet fuel. No special handling is required other than that employed to prevent contamintion and maintain its environmental qualities.

MAJOR INTEREST IN GTLThere are major companies interested in developing gas-to-liquids plants in Alaska. Sasol, the South Africa-based energy company with years of expe-rience operating coal-to-liquids and gas-to-liquids plants in its home coun-

try, as well as a gas-to-liquids plant in the Persian Gulf, is looking for op-portunities elsewhere, including North America. The company has looked at Alaska for some time, but actually got the cold shoulder from State officials, who preferred a gas pipeline, when Sasol officials visited several years ago. The company recently announced it will build its first North America GTL plant in British Columbia using gas produced from shale.

Lesil McGuire and other legislators are now trying to undo the rebuff and rekindle Sasol’s interest. They hope to invite the company to visit Alaska again later this year as well as Shell, which now also operates large gas-to-liquids plants in the Persian Gulf and Malaysia.

ExxonMobil also has been in-terested in a GTL plant over the years. Gas-to-liquids was actually the company’s preferred option for commercializing North Slope gas in the late 1990s until persuaded by BP and ConocoPhillips to take a new look at a gas pipeline. ExxonMobil owns the largest share of gas on the North Slope, and it is possible if the large pipeline is delayed the com-pany might turn once again to GTL as its favored option for Slope gas.

If GTL or coal-to-liquids plants are built, the projects would involve several billions of dollars of investment. They would be large construction projects, and although major plant components would have to be built elsewhere, once in operation they would employ hun-dreds of people in plant operations. However, developing the plants in Alaska offer challenges, too, because of high costs. But even here there are offsetting factors. Large module units transported by barge could be moved efficiently to a plant site in Southcentral Alaska or the North Slope, for example.

Although the legislation offered by senators McGuire and Wagoner are offering inducements for gas-to-liquids, companies like Sasol, Shell and Exx-onMobil will look at the underlying economics of such a project and make their decisions. What may be more important in the offering of State tax credit is its symbolic value, a message the State is receptive to other ideas of using gas than a gas pipeline, and that Alaska is open for business. ❑



High energy prices are a harsh reality for residents of rural Alaska. Despite State pro-

grams aimed at subsidizing the high cost of energy, some residents spend more than 30 percent of their income on electricity and home heating.

“A $200- to $300-a-month elec-trical bill is not uncommon,” said Bethel Mayor Eric Middlebrook. That doesn’t include other fuel ex-penses, such as the $100 or more residents spend to fill their vehicle fuel tanks or what they spend on fuel

for snowmachines or four-wheelers.PDC Harris Group LLC, a joint ven-

ture involving PDC Inc. Engineers, hopes to change that. Mike Moora, an engineer with PDC Harris, is working with the City of Bethel on a pilot proj-ect to bring a combination of liquefied

Bringing LNG to the BushProjects must show profit to be funded

BY RINDI WHITE

Phot

o co

urte

sy o

f U.S

. Arm

y C

orps

of E

ngin

eers

Aerial view of Bethel, Alaska.Aerial view of Bethel Alaska


natural gas and compressed natural gas, or LCNG, to the community as a cost-saving option to liquid fuels. Moora said if the project works in Bethel, it could serve as a model for other communities.

“They’re in the boat that most of the remote Alaska villages are in,” Moora said of Bethel.

PDC Harris Group has prepared a plan that would focus on space heating and power generation. To demonstrate whether the change is feasible, several furnaces or boilers in Bethel commu-nity buildings will be converted from fuel oil to natural gas. The city also hopes to demonstrate a project that would replace up to 90 percent of the fuel in the community’s diesel engine electric generators with LCNG. If those projects prove viable, a distribution system could be set up to carry natural gas to homes throughout Bethel.

If the project works in Bethel, the community could serve as a hub and distribute natural gas in its lique-fied and compressed form to sur-rounding villages.

But first they have to show the proj-ect makes fiscal sense. The city of Bethel

has applied for grant funding from the Alaska Energy Authority, through its Emerging Energy Technology Fund grant program, to clearly define the project, examine supply chain econom-ics and flesh out the project costs and potential returns.

“Does it generate a return for a busi-ness and is it saving a rural commu-nity’s energy costs? It’s got to do both,” Moora said.

It’s too early to know the costs of changing fuel sources; that’s something the study will determine. But if the numbers prove out, Moora estimated Bethel could be ready to receive LNG and use it to heat community-owned buildings in three to four years.

PRICE, AVAILABILITY, PROFITThe profit picture is where rural Alaska energy projects often hang up. Even if it makes economic sense to change a community’s fuel source, the return on investment is typically limited.

Jay Livey, a staffer in Sen. Lyman Hoffman’s office, said energy costs are one of the top concerns in District S, which includes Bethel and Dillingham,

along with several other villages in Southwestern Alaska.

“There’s no economy of scale,” Livey said. “To create an industry for 6,000 people is going to be expensive no matter how you look at it. That is an issue that defines rural Alaska.”

Currently, Bethel heats community buildings and powers generators with diesel barged in by Crowley Marine Services. Moora said using liquefied natural gas would mean developing a whole new supply chain – from ships to haul the fuel and pipes to offload it to tanks to store it and pipes to carry it to community buildings. But he believes the historically lower price of liquefied natural gas may make the investment worthwhile.

When oil prices spiked in 2008, ru-ral Alaska was hit hard. Diesel prices soared from $3 to $4 per gallon deliv-ered by barge to $7.50 to $8 per gallon. A 2009 analysis, Moora stated, showed a range of nearly $4 per gallon to more than $6 per gallon, with between $1 and $2 of that attributed to the cost of transporting the fuel to Bethel.

“This particularly grim situation for


Alaska’s rural communities is not sus-tainable, and is likely to increase in se-verity as crude oil prices rise with global economic recovery,” Moora stated in a 2009 presentation about the project.

Meanwhile, LNG prices have re-mained relatively stable and, thanks to a surge in drilling in the Lower 48, the U.S. has a surplus of natural gas and LNG prices are competitive, on par with natural gas prices in the U.S., Moora said.

But because LNG hasn’t been shipped to rural Alaska communities, it’s difficult to pinpoint the real cost of shipping, storing and converting LNG to usable gas. That’s why the study is needed, he said.

Middlebrook said his city supports the LNG proposal. The city council on March 8 unanimously approved the PDC grant application, reaffirming a resolution passed in 2009 that also supported the project.

LEADERS WANT CHANGELook at the city’s energy expenses and it’s easy to see why city leaders support a change. Last year the city spent nearly $900,000 to heat city-owned buildings and nearly $800,000 more for electric-ity. That’s a big chunk of the city’s $9.5 million budget.

“We’re starting with a cost of fuel that’s eight times higher than natural gas,” Middlebrook said.

The city’s support comes with a ca-veat, Middlebrook said. If the grant is successful, Alaska Energy Authority re-quires a 25 percent community match. Middlebrook said the city is looking at ways to meet that requirement by in-kind work because it can’t afford to shell out a monetary contribution.

“It’s frustrating to me because part of the reason the community is so cash-strapped is because of the high cost of energy,” he added.

Karsten Rodvik, external affairs manager for the Alaska Energy Au-thority, said the community match is aimed at making sure communities “have some skin in the game.”

Middlebrook said the LCNG option isn’t the only thing the city is looking at.

“There are a lot of options on the table right now. We’ve talked about propane and alternative energy – any of those would be good. We just want to look at all our options.”

SAFETY CONSIDERATIONSOne potential problem with import-ing LNG, Moora said, is that LNG is delicate and costly to store. It has to be kept at cold temperatures – minus 256 degrees, Fahrenheit and its storage is highly regulated to account for three primary risks – the cold temperature, its ability to form a combustible vapor cloud if the gas escapes, and the po-tential for explosion if the gas escapes.

Moora noted that despite those con-cerns, tens of thousands of large tanker deliveries have happened around the world with no explosions or loss of life. Use of other conventional fuels also pose risks, he said.

To address those concerns and al-low for easier transport to individual users or surrounding villages, Moora is proposing that Bethel store the natural gas in compressed form. Small CNG storage containers look like welding or scuba-diving tanks and can be stored in racks. Its chemical makeup is similar to the natural gas piped to homes in Southcentral Alaska.

Moora said he pitched the LCNG project because he recognized the project might make sense for rural Alaska communities, but lacks the economic incentive to make invest-ment worthwhile.

“I think there’s a lot of benefit to the citizens of Alaska,” he said.

Moora is involved with Engineers Without Borders, a group dedicated to addressing basic needs such as reliable power, sanitation and clean drinking water. He said this project merges his employer’s desire to iden-tify itself as a company interested in

solving energy problems and his own hope to offer clean new energy solu-tions in rural Alaska.

“This is sort of a way to do char-ity work but get reimbursed for it, and hopefully do a lot for people in rural communities and also cut down on emissions … (and) diesel fuel spills,” he said.

SHORT-TERM RELIEFThis is the first year the Alaska Energy Authority has offered the Emerging En-ergy Technology Fund grant program. It was created last year to fund projects that “test promising new energy tech-nology in Alaska,” Rodvik said.

Most importantly, the program re-quires the projects be commercially viable within five years, he said.

The Alaska Energy Authority also administers the popular Renewable Energy Fund. To date, the Legislature has appropriated $150 million to that fund, Rodvik said. He said the Energy Authority has received hundreds of ap-plications for that fund. So far, 133 have been selected for funding.

The Emerging Energy Technology Fund is much smaller at $5.5 million. The legislature appropriated $2.4 mil-lion of that, Rodvik said. The remaining amount came from the federal Denali Commission.

A week before the March 17 applica-tion deadline, Rodvik said his office had received two applications. He expected to receive several more. With guidance from the Emerging Energy Technology Fund advisory committee, Rodvik said AEA will decide by June 8 which pro-posals get funding.

Jay Livey, a staffer in Alaska Sen. Lyman Hoffman’s office, said the high cost of energy is one of the top concerns for residents in Hoffman’s wide-ranging Senate District S. While Hoffman is not involved in this particular project, he and his staff are pursuing several ways to reduce energy costs, including install-ing wind turbines, upgrading power plants and examining hydroelectric projects.

“There are a lot of ideas floating around, everybody recognizes that it’s a huge need,” he said.

Hoffman helped create the Alaska Energy Authority grant program Bethel is applying through, Livey said. ❑

Last year the city

(Bethel) spent nearly

$900,000 to heat city-

owned buildings and

nearly $800,000 more

for electricity.


Do you know Alaska Business Monthly’s purpose?We are here to build Alaska businesses up, strengthen them, give them a solid foundation of knowledge for

growth, teach them how to become better leaders and more effective and efficient in their operations.

We praise them when they do well. We encourage them in tough times. We promote them daily. We share success stories, new products and services, have interviews with leaders telling their stories and histories. We are the Good News Magazine, and uphold this policy even though our style may not attract those interested in knowing the dirt, the spoils, the dark secrets. We will not go tabloid. We’d rather dig a grave and bury ourselves than degrade our publication in this manner.

Above all we are pro-business. In everything we do, we sup-port business. We will never break away from this high standard we set for ourselves, even at the loss of revenue.

But that said, it does not mean we hide in a hole and ignore what is happening to industry and our economy. Oil and gas are perfect examples.

Alaska has so much promise, but oil production is on the

decline and the dream of a gas pipeline is quickly fading away. We need to do something.As I write this, Gov. Parnell is trying to reduce oil produc-

tion’s base tax from 25 percent to 15 percent to increase new oilfield development and change the production tax calcula-tion to an annual versus monthly basis. The House has passed HB 110. The Senate says “No,” for now.

But it is efforts like this, and the efforts of thousands of Alaskans, that is making our state residents aware the oil pipeline is in danger of shutting down, and efforts need increased for more gas exploration and development on the North Slope and Cook Inlet.

The companies that make up this list are key players in this effort. Let’s as a community rally around them, support them and all the jobs they create now, and ensure they are still here 10, 20 even 30 years from now.

Be pro gas and oil development. The state’s future depends on it.

— Debbie Cutler Managing Editor

Support Oil and Gas Now!

Alaska Business Monthly’s 2011 OIL & GAS DIRECTORY

EXPLORATION COMPANIES AKCompany Top Executive Estab. Empl. Business Description

Alaska Business Monthly’s 2011 OIL & GAS DIRECTORYEXPLORATION COMPANIES


AKCompany Top Executive Estab. Empl. Business Description

Anywhere you need it. Any season of the year.

Our crews have decades of experience, and the skilled manpower to take on any task.

With our tundra-approved vehicles, we can get your drill rig and project materials to any remote location, and build ice pads and ice roads. And our range of logistics support – hauling fuel and freight – has been broadened with the addition of our new marine services division.

From start to finish, we are a partner who can deliver what you need.

Where the road ends…

Our Work Begins

cruzconstruct.comMain Office (907) 746-3144

North Slope (907) 659-2866

Alaska Business Monthly’s 2011 OIL & GAS DIRECTORYEXPLORATION COMPANIES


PRODUCTION COMPANIES



Alaska Business Monthly’s 2011 OIL & GAS DIRECTORYPRODUCTION COMPANIES


SERVICES & SUPPORT



Alaska Business Monthly’s 2011 OIL & GAS DIRECTORYSERVICES & SUPPORT






40 Years...Thanks to our customers and employees, we’ve been privileged to serve Alaska’s oil industry for over 40 years. Our goal is to build a company that provides a service or builds a project to the complete satisfaction of its customers.

We shall strive to be number one in reputation with our customers and our employees.

We must perform safely.

We must provide quality performance.

We must make a profit.

We shall share our successes and profits with our employees.

Work can be taken away from us in many ways, but our reputation is ours to lose.

Our reputation is the key that will open doors to new business in the future.

urs to lose.

e.




Customer focused. Safety driven. Process oriented.

VISIT OUR WEBSITE: www.CCIindustrial.comPHONE: 907.258.5755 EMAIL: [email protected]

Asbestos and lead surveys and abatement ß

Specialty coatings and sandblasting ß

Corrosion under insulation refurbishment ß

Oil spill response ß

Biodegradable cleaning solutions ß

Tank and vessel cleaning ß

Hazardous waste removal ß

Operations, maintenance and construction ß

Effective. Efficient. Excellent.




Infrastructure Risk Assessment

Because what’s in the system should stay in the system.Nondestructive Testing ßExternal and Internal Corrosion Investigations ß

Integrity Program Management ßQuality Program Support ß

Learn more about how we help you ensure the safety of

your workforce and enhance the reliability and integrity

of your facilities by visiting our website www.kakivik.com

PHONE: 907.770.9400 EMAIL: [email protected] ALASKAN-OWNED AND ALASKAN-OPERATED




www.PSCNow.com

Redefining Service

1813 East 1st Ave., Suite 101Anchorage, Alaska 99501907.272.9007 or 800.478.9008

Providing Tomorrow’s Solutions Today.™

Alaska Business Monthly’s 2011 OIL & GAS DIRECTORYSUPPLIES & EQUIPMENT



Our clients helped make us who we are today. • Asset Based • Complete Lower 48 Coverage • Intra-State Alaska Service • Professional Drivers • Dedicated Customer Service • Comprehensive Web Services

www.pafak.com 800.426.9940 Anchorage 336.2567 Fairbanks 452.7971 Kenai 262.6137 Kodiak 486.8501

©The Valdez Museum and Historical Archive



Is your company missing from this year’s Oil & Gas Directory? Email a survey request to Annie Doss at [email protected] to be included in the annual Power List and the next Oil & Gas Directory. Include your company name, contact person’s fi rst and last

name, and the email address you want a survey link sent to. All surveys are online for quick and easy completion, and there’s never a charge for listings.


Owner

Superstar Pastry Design

©20

11 C

hris

Are

ndVIEW FROM THE TOP COMPILED BY PEG STOMIEROWSKI

Kory Joyner

Kory Joyner puts in 60 to 90 hours a week at the bakery she started in 2004. Besides the books, she does custom cakes for about three weddings and 12 parties a week, working with her assistant Yazmin. A cupcake “slinger”/barista, a dishwasher and couple of interns

provide part-time support. Joyner traces her passion to fifth grade. “We had a Mini Society, and the booth I opened was a bakery,” she says. She attended King

Career Center Culinary Arts program and later the California Culinary Academy. Joyner worked out of a commercial kitchen until 2008, when she opened her shop, tripling sales from 2007 to 2008.

CAKES ARE KING: We value fresh ingredients, scratch baking, knowledge base, and trained employees. We stock a small line of baked goods and do holiday pies or cakes for Christmas, Thanksgiving and Mardi Gras, but we decided 20 months ago to focus on cakes.

GREAT EXPECTATIONS: We have high standards for cake décor, and with a wedding, there’s no such thing as a do-over. We can do custom cakes, replicate designs, or do 3-D carvings. Our first year we did more basic party cakes, but we had to establish a minimum order for custom cakes. As more folks realized they could get a “TV cake” in town, it raised the cost and the challenge.

SOMETHING NEW: Our Cupcake Bar is like a Cold Stone. Customers choose their cakes, filling, icing, and toppings. Added in 2009, this is popular; we take it to the Women’s Show and the Spring Fling for Women. Before that, trying to guess what flavor combo would sell each day led to waste. By this March, cupcakes represented about 20 per-cent of our 2011 business – 13 percent in 2010 – up from just 1.5 percent in 2009. We are also seeing more weddings using cupcakes with or without a more traditional cake.

BLOOD, SWEAT & TEARS: Often we begin working with a bride four to 18 months ahead, before emotions start to run high. Still, when the rare customer is not satisfied, it’s important to be empathetic.

ONLINE LURE: Party orders are fairly split between walk-in, phone and e-mail. We do not have automated online ordering, as our cakes are too complicated. Our website (www.spdak.com) features almost 1,000 photos. Inquiries begin via phone and e-mail, but most come in to make sure of details – and taste the goods! Also, we use Facebook; often we post free cupcake codes, and we have a guess-that-cake contest on Fridays. It has really been a great, and free, way to get information and promotions out. We purchase Facebook ad space seasonally.

LIFETIME LOYALTY: Repeat business and word-of-mouth rule. Many couples who were wedding-cake customers come back for baby showers, anniversaries and birthdays. I don’t have to spend as much to bring in new clients, and we feel affirmed. Artistic skills matter, since I don’t have time to do much teaching.

WHAT’S IN A NAME? I wanted ours to be based on the pink-star tattoo I got after surviving a tough period. It reminds me that I am awesome and tough and can do whatever needs to be done.

(BUTTER) CREAM RISES: We’ve remained steady through the recession because quality cakes, served well, are an affordable luxury. While you may be inclined to cut cable costs and to turn down the thermostat, “darn it, Timmy is going to have a birthday cake!” ❑

Kory Joyner

CCCCCCAAAAAKKKKKEEEEESSSSSS AAAAARRRRREEEEE KKKKKIIIIINNNNNGGGGGG::::: WWeWeWe vvv lalalalueueue f fffrerere hshshsh i iiingngnggrereredidididienenenttststs,,, , scscscrararattctctchh hh bbababakikikikingngngg,,, , kknknknowowowlleleledgdgdgdge e ee

GGGGGGRRRREEEEEAAAAATTTTT EEEEEXXXXXPPPPPEEEEECCCCCTTTTTAAAAATTTTTIIIIIOOOOONNNNNSSSSS::::: WeWeWeWe hhhhavavavaveeee hihihihighghghgh sss statatatandndndndarararardsdsdsds fffforororor ccc cakakakakeeee dédédédécocococor,rr,r, aaa andndndnd www witititith hhh

SSSSSSOOOOMMMMMEEEEETTTTTHHHHHIIIIINNNNNGGGGG NNNNNEEEEEWWWWW::::: OuOuOuOurrrr CuCuCuCupcpcpcpcakakakakeeee BaBaBaBarrrr isisisis llllikikikikeeee aaaa CoCoCoColdldldld SSSStotototonenenene... CuCuCuCuststststomomomomererererssss chchchchoooooooosesesese

BBBBBBLLLLOOOOOOOOOODDDDD,,,,,, SSSSSWWWWWEEEEEAAAAATTTTT &&&&& TTTTTEEEEEAAAAARRRRRSSSSS::::: OOOOftftftftenenenen www weeee bebebebegigigiginnnn wowowoworkrkrkrkinininingggg wiwiwiwithththth aaa a bbbbriririridededede ffffouououourrrr totototo

OOOOOONNNNLLLLLIIIIINNNNNEEEEE LLLLLUUUUURRRRREEEEE::::: PPPParararartytytyty ooo ordrdrdrdererererssss arararareeee fafafafairiririrlylylyly sss splplplplitititit bbbbetetetetweweweweenenenen www walalalalk-k-k-k-inininin,,, phphphphononononeeee anananand ddd e-eee mamamamailililil..

LLLLLLIIIIFFFFEEEEETTTTTIIIIIMMMMMEEEEE LLLLLOOOOOYYYYYAAAAALLLLLTTTTTYYYYY::::: RRRRepepepepeaeaeaeat ttt bubububusisisisinenenenessssssss aaa andndndnd www worororord-d-d-d-ofofofof-mmmmououououthththth rrr rululululee.e.e. MMMMananananyyyy cocococoupupupuplelelelessss

WWWWWWHHHHAAAATTTTT’’’’’SSSSS IIIIINNNNN AAAAA NNNNNAAAAAMMMMMEEEEE????? IIII www wananananteteteted ddd ouououoursrsrsrs ttttoooo bebebebe bbbbasasasasedededed ooo onnnn ththththeeee pipipipinknknknk-sssstatatatarrrr tatatatattttttttoooooooo IIII ggg gotototot ?????

(((((BBBBBUUUUTTTTTTTTTTEEEEERRRRR))))))) CCCCCRRRRREEEEEAAAAAMMMMM RRRRRIIIIISSSSSEEEEESSSSS::::: WeWeWeWe’v’v’v’veeee rerereremamamamaininininedededed sss steteteteadadadadyyyy ththththrorororougugugugh hhh ththththeeee rerererececececessssssssioioioionnnn



Construction RoundupRailbelt energy, hospitals andcorrections top projects list


With the primary construction season kicking off to full swing, a handful of projects

around the state are indicative of con-tinued growth in the industry across all construction sectors. For many, the jump in construction activity during summer months – designed to take advantage of good weather and ease of logistics – makes for a round-the-clock summer soundtrack of indus-trial noise. It’s music to the ears of communities where construction jobs

constitute a much-anticipated annual infusion to the local economy.

Along those lines, such commu-nities will be glad to hear that pro-jections of construction spending in Alaska for 2011 are up overall by 4 percent from last year – and 5 percent if not counting oil and gas. Both private- and public-sector construction will see gains this year, experts forecast, with utilities and hospitals among areas of positive focus for construction growth.

UTILITY PROJECTS BREAK GROUND Chugach Electric Association and Municipal Light & Power (ML&P) broke ground this spring on the new Southcentral Power Project, located at Chugach’s headquarters complex in Anchorage, represents a joint project to construct an efficient, combined-cycle 183 megawatt power plant. The $369 million cost will be shared 70/30 between Chugach and ML&P. Speak-ers at the event noted how collaborat-ing on construction will save money

©20

11 C

hris

Are

nd/C

ourte

sy o

f Chu

gach

Ele

ctric

Ass

ocia

tion

Municipal Light and Power Board of Directors Chair Johnny Gibbons (left), and Chugach Electric Association Board of Directors Chair Jim Nordlund, broke ground March 28 on the $369 million, 183 megawatt Southcentral Power

Project going up in Anchorage over the next two years.

M i i l Li ht d P B d f Di t Ch i J h Gibb (l ft) d Ch h El t i A i ti B d


for the ratepayers of both utilities. Also, the plant’s advanced technology will use less natural gas than current generating units.

“I am pleased to see the city’s utilities working together on such an important project,” Anchorage Mayor Dan Sul-livan announced at the March ground-breaking ceremony. “This new plant is a step in the right direction as we look to provide reliable service at a reasonable cost for Anchorage’s electrical consum-ers. Citizens will reap the benefits of this new plant for many years to come, which is important as we continue plan-ning for the city’s energy future.”

The plant will have three natural gas-fired turbine-generators and one steam turbine generator. The units will operate in combined-cycle mode, meaning the hot exhaust from the gas turbines will be captured and used to make steam for the steam turbine.

SPP will use only about three-fourths of the natural gas needed to make a kilo-watt hour compared to the best units on the Chugach system today. That means Chugach and ML&P customers will save about $30 million in fuel costs annually once the plant is fully opera-tional in 2013. Those savings assume a fuel cost of $6.75 per thousand cubic feet of natural gas, and will grow if the price of fuel increases.

Another benefit of the project will be reduced emissions. The production of both nitrogen oxides and carbon mon-oxide will be significantly less from the combined-cycle Southcentral Power Project than from simple-cycle genera-tion now on the system.

Chugach is the largest electric util-ity in Alaska, providing power for Alaskans throughout the Railbelt through retail, wholesale and econ-omy energy sales.

ML&P provides electric service to more than 30,000 customers in a 20-square-mile area of the Municipality of Anchorage. The utility also provides power to Joint Base Elmendorf Rich-ardson and sells electricity for resale to other Railbelt utilities outside its service area. ML&P is owned by the Munici-pality of Anchorage.

This Chugach project is among sev-eral in Alaska that kick off this summer. Homer Electric Association announced plans to generate power via steam

generation and gas turbines, while Golden Valley Electric Association has plans to utilize wind energy at Eva Creek.

RAILBELT HYDROENGINEERING WORK

MWH, a global leader in the wet-infrastructure sector, recently an-nounced it won a two- to five-year contract for hydropower engineering services from the Alaska Energy Au-thority (AEA) to support the evalua-tion and development of hydropower projects along the Alaska Railbelt electrical grid.

Initial project efforts are funded by a $10 million appropriation from the Alaska Legislature. Potentially as much as $5 million of this funding will be allocated in FY2011 for engineering activities, which may include MWH assisting AEA in the evaluation of project selections, feasibility and cost estimates, data collection, conceptual design, permitting, and other required tasks to facilitate AEA submitting an application to the Federal Energy Reg-ulatory Commission for an operating license. The balance of funds may be used to support other contracts dedi-cated to environmental studies for the projects. The potential hydropower project(s) under consideration would be a key component to help achieve the State’s goal of producing 50 per-cent of electrical power from renew-able sources by 2025.

Among the projects being examined is an updated project concept for the Susitna River in a remote area in Alaska’s interior between Anchorage and Fairbanks. Last year, AEA focused on two large hydro-power projects for the Railbelt, including the Watana site on the Susitna River and Chakachamna, across Cook Inlet from Anchorage. In November 2010, AEA an-nounced its decision that the Watana site should be the primary hydroelectric proj-ect for the Railbelt, and Chakachamna should be considered as an alternative. The Susitna project could have an in-stalled capacity of up to 600 megawatts, sufficient to provide nearly half of the cur-rent electricity demands of Railbelt com-munities, including Fairbanks, Palmer, Wasilla, Anchorage and Kenai.

“MWH is proud and excited to work with the Alaska Energy Authority to bring this important development to


fruition for the people of Alaska,” says Alan Krause, president and chief operat-ing officer of MWH. “Our company’s roots and work run deep both in Alaska and with these projects; we look forward to bringing our expertise in permitting, licensing, design and construction of world-class hydropower projects to Alaska’s interior.”

A larger Susitna river project was studied by the State of Alaska in the mid-1980s with the assistance of a joint venture that included Harza Engineer-ing, which merged with Montgom-ery Watson in 2001 to form MWH. Chakachamna was also studied in the same period.

HOSPITAL PROJECTS With a strong increase in construction spending on heath care facilities in the state this year, Alaska will see such large-scale projects as the $150 million mod-ernization and expansion of Providence Hospital in Anchorage. Some $91 mil-lion is slated for the new Norton Sound Regional Hospital in Nome, with Indian Health Service awarding that contract last year to Inuit-NCI, JV, a venture join-

ing Inuit Services Inc. and Neeser Con-struction Inc. of Anchorage. That project will replace the aged existing hospital with a 150,000-square-foot building. An-ticipated to be finished in 2012, the con-struction project is estimated to employ some 100 construction workers. Another hospital project, this one in Barrow, will likewise expand the current health care footprint by four times, increasing the hospital space to over 100,000 square feet. Some 140 construction jobs are an-ticipated for that project, also funded by Indian Health Service.

CORRECTIONAL FACILITYPROGRESSES

The $240 million, 1,536-bed Goose Creek Correctional Center project is progressing on schedule and under budget, as of the last project status re-port. The medium-security correctional center for long-term male felony of-fenders is being constructed on a 330-acre tract located at the intersection of Point MacKenzie Road and Alsop Road, approximately nine miles from Port MacKenzie. A joint effort between the Matanuska-Susitna Borough and

the State of Alaska Department of Corrections, the project will deliver 430,000 square feet of building space on a 135-acre cleared compound. The compound features five separate build-ings; with the two largest serving as the general housing unit and a program supports building. The design-build contract went to Neeser Construction Inc. (NCI), which reported its work as 84 percent complete as of February. Some 193 NCI workers were on site in the spring. ❑


Alaska Construction AcademiesTraining workers for the industry

BY NICOLE A. BONHAM COLBY


As the overall construction in-dustry weathers the contin-ued ebb and flow inherent of

its environment, the industry itself is meanwhile planning ahead to ensure a ready supply of Alaskans trained and experienced to work in the trades for large and small projects that arise. The Alaska Construction Academies recruit, train and place students and adults in jobs across the construction sector.

STABLE STATEWIDE NUMBERS In its Employment Forecast for 2011, published in January’s Economic Trends, the Alaska Department of La-bor and Workforce Development’s Re-search and Analysis Section anticipates no change in statewide construction-sector wage-and-salary employment from 2010. The sector employed a monthly average of 16,200 workers in 2009, dropping by 0.6 percent (an es-timated 100 jobs) in 2010. That figure of 16,100 average monthly workers will remain constant through this year, State economists predict.

Regional areas, however, face local-ized ups and downs in construction employment. For example, the Anchor-age region saw overall construction em-ployment peak in 2005, decline each year subsequent, with additional drops forecast for this year.

In regions throughout the state, re-gardless of the current health of local construction activity, area contractors recognize and appreciate the availabil-ity of well-trained, experienced workers – the intent of the growing construction academy program.

EXPANDING A SUCCESSFUL MODELLegislation in 2007 directed funds to Alaska Home Building Association chapter communities beyond Anchor-age, given the prior success of that city’s

Anchorage Construction Academy, a construction work force pilot program. Started a year earlier by the Associ-ated General Contractors of Alaska (AGC), Anchorage Home Builders As-sociation, Anchorage School District, Alaska Works Partnership Inc., Alaska Department of Labor & Workforce Development and Cook Inlet Tribal Council, the academy yielded posi-tive inroads.

As a result, AGC expanded the con-cept statewide with Alaska Construction Academies (AkCA), and encouraged similar programs in Fairbanks, Juneau, Kenai, Ketchikan and Mat-Su. Armed with State monies, government grants and technical support from the Con-struction Education Foundation and local partners, the academy program sought to direct contracts to local opera-tions for construction training of both adults and students. Partners have since been sought in other Alaska communi-ties, specifically targeting remote rural areas. Last year, rural academies began in the Bethel, Nome and Kodiak regions funded by the Denali Commission.

REVERSING THE CURVEWhile the construction industry sees some of its most experienced workers retire, programs like the AkCA aim to overcome the loss with a stable of incoming workers who are well-trained and with hands-on experience directly related to the target work.

In 2009, an external review by the McDowell Group identified the pro-gram’s niche. “AkCA is a new approach developed … to help students and adults with little technical experience to obtain basic skills and entry-level employment,” analysts wrote. “The goal is to serve industry by providing knowledgeable, motivated, entry-level employees and to serve students and

job seekers by allowing them to explore their aptitudes and interests under the guidance of experienced, hands-on in-structors from the industry. An integral part of the strategy is to increase the likelihood that trainees will find jobs by tailoring instruction to the needs of local employers and providing refer-rals for actual job opportunities, often directly, but also through the Alaska Job Centers.”

LOCAL AND INDUSTRY EXPERTISEPart of the academy concept’s success comes in its close ties to local part-ners – for example, local job centers and educational institutions – and by drawing on the expertise of local con-tractors and construction experts to participate in the process. The method ensures that graduating students and adults have expertise directly appli-cable to the local construction scene, plus are armed with network contacts useful when job hunting. The local angle also results in considerable com-munity awareness and support of the programs, as local citizens can watch first-hand as the academy’s work on a project progresses.

At the Ketchikan academy, adults worked on a Head Start building proj-ect. The Kodiak Regional Construction Academy built two storage sheds and a fence at the Kodiak Women’s Re-source and Crisis Center. In Juneau, the academy worked on a House Build project where students gained direct experience through the entire housing process, from design to construction and eventual sale of the house. Acad-emy instructors say all efforts benefit its participants in competing in Alaska’s up-and-down construction environ-ment. Visit www.alaskaca.org to learn more, sign up for training, or become a partner. ❑


Susitna Dam Mega ProjectBuilding new energy for Alaska

BY GAIL WEST


Not often does the opportunity for a mega project present itself – one such as the trans-Alaska

oil Pipeline – and even less frequently does the State have control of its fate. The proposed Susitna Dam, however, is such a project. If Susitna becomes real-ity, and is followed by the proposed nat-ural gas pipeline, the two would bring new energy to the state and its residents and new life to Alaska’s builders.

Damming the Susitna River to pro-duce hydroelectric energy has been on the table since the 1950s. In the

1970s and early 1980s, the project was proposed as a four-dam system, then scaled back to two dams – one at Devil’s Canyon and one at Watana. In 1985, the Federal Energy Regula-tory Commission issued a license for the Bradley Lake Dam, and construc-tion began two years later. In 1991 Bradley Lake went online and began producing energy for Railbelt utilities. Its total capital cost was approxi-mately $357 million. Bradley Lake, however, was a much smaller project than the proposed Susitna dam.

As part of a joint venture, MWH was the lead designer for the kárahnjúkar Hydroelectric Project. Owned by the Icelandic National Power Company, Landsvirkjun, the project has many similarities to the project currently planned for the Watana site

on the Susitna river, including dam height, power generation, and remote arctic conditions.

Photo courtesy of MWH

Google map showing proposed site for the Susitna Dam at Watana.

©20

09 G

oogl

e/C

ourte

sy o

f Ala

ska

Ener

gy A

utho

rity


SUPER STRUCTUREAt a projected cost of $4.5 billion, Susitna (at the Watana site) dwarfs Bradley Lake. Compared to Bradley’s 125-foot-high structure, Susitna is ex-pected to be 700 feet high. Susitna is also anticipated to be 2,700 feet long at its crest, and would hold back a 39-mile-long reservoir that could be up to two miles wide at its widest point, according to Karsten Rodvik, external affairs man-ager for the Alaska Energy Authority.

“The Railbelt currently uses about 5,300 to 5,400 gigawatt (1 gigawatt is equal to 1 billion watts) hours of electrical energy annually,” Rodvik said. “This dam would have an in-stalled capacity of 600 megawatts, its annual energy production would be 2,600 gigawatt hours, which means it would supply about half the Railbelt’s electricity needs.”

Underlying the new momentum for the Susitna dam is the Railbelt Regional Integrated Resource Plan, which was released in 2010, Rodvik said. The plan looked at long-term power needs for the Railbelt as well as the uncertain gas supplies in Cook Inlet and calculated what that could mean for today’s and the future’s energy needs.

“Last year, too,” Rodvik added, “the Legislature established a new goal for the state to achieve 50 percent of its electrical production from renewable resources by 2025. The only way to reach that goal is with a large hydro project on Alaska’s Railbelt. With that in mind, AEA examined both the Chakachamna and the Watana sites.”

The State’s general timeline for the project covers 11 years, Rodvik said.

“In November 2010, we announced our decision that the Low Watana site on the Susitna River should be the primary hydroelectric project for the Railbelt,” Rodvik said. “The same day, Gov. Parnell announced his support. In January of this year, Gov. Parnell introduced legislation that would move this project forward – if passed, it will authorize AEA to build, own and oper-ate new power projects. It also sought funding to help the State prepare for its FERC license application.”

Rodvik added that AEA hopes to have FERC’s preliminary approval before the end of this year.

“Beyond that, it will be about

six-and-a-half years for the FERC process, licensing and permitting, then four-and-a-half years to build – 11 years in total,” Rodvik said.

WORKING WITH AEASeveral firms with local offices are working with AEA toward gaining the preliminary FERC approval, including Cardno Entrix, HDR Inc. and MWH.

Cardno ENTRIX provides environ-mental and natural resource manage-ment expertise, and both HDR and MWH bring worldwide experience

in renewable energy and hydropower generation. One of MWH’s most re-cent major hydroelectric projects, and on the same scale as Watana, is the Karahnjukar Dam in Iceland. Com-pleted in 2007, this is the largest project developed in Iceland, and consists of a 198-meter-high dam, 73 kilometers of hard-rock tunnels and a 690 megawatt underground power station.

“MWH has been involved in many of the big dams around the world,” said Chris Brown, vice president and Pacific Northwest regional manager for


MWH. “We’ve worked on the Three Gorges Dam in China, and major dams in Ethiopia and Venezuela – really, all over the world.”

Brown says his firm is contracted to AEA to do feasibility studies and to pro-vide FERC licensing support for large-scale hydropower projects in Alaska, not confined to Susitna. However, he said he anticipated that the bulk of the work will be directed toward Susitna.

“Part of our job is to develop final de-sign concepts for the new dam and hy-dropower project,” Brown said. “We’re going through the work that has been done before to determine what is still relevant, what needs to be updated and what gaps still need to be filled.”

There are challenges ahead, Brown said, and a lot of questions that need to be addressed.

“There are environmental, social, seismic, siltation and economic issues to work out,” he said. “The State’s going down that path now, and it’s impor-tant that it be done in a rigorous and transparent way to arrive at the best decisions. They’re using state-of-the-art approaches and some of the most quali-fied people in the world. If Susitna is found to be feasible, it’s important that we get serious about developing it.”

ECONOMIC IMPACTWith a project the size of the proposed Susitna Dam, the impact on the Alaska economy would be sizeable. Associ-ated General Contractors’ Executive Director John MacKinnon said there would be a tremendous amount of con-struction – 81 miles of new roads, new railroad track, a new highway bridge.

“Most of the jobs would be private-sector,” MacKinnon said. “There will be tunnels through the mountains to divert the river around where the dam will be built. There will also have to be tunnels where the water enters the powerhouse, and the powerhouse would be inside the mountain. That’s a tremendous amount of work for miners; and there’s a huge amount of land to clear, as well.

“Just about every trade you can imagine would be involved in a proj-ect like this. This is a project on which young people can cut their teeth and older folks could end their careers. It would be something people would talk about for years,” he added.


MacKinnon also said that whether we would have sufficient expertise to build a project of this size depends a good deal upon where it would fit in the queue with building the gas pipeline.

“We certainly can’t build both at the same time,” MacKinnon said, “but if we can build them in sequence, that’s a lifetime of work for Alaskans.”

Nationally, MacKinnon added, we’ve been talking about wind and so-lar power, but they just don’t work as well here. The problem with wind is that it’s intermittent, and the problem with solar almost goes without saying. Hydro, however, works “24-7-365” as long as it rains and snows.

“Looking way down the road, I can see power lines going out to Western Alaska. They’re talking of building a road to Nome and the Seward Penin-sula, well, take a power line with it,” MacKinnon said. “With energy and transportation, you’ve created an eco-nomic development corridor along the whole route.”

UP TO LEGISLATURERodvik reiterated that the whole Susitna Dam project will depend upon the Alaska Legislature to move it for-ward, and that it would be a sizeable commitment.

If Alaska chooses to make that com-mitment, Railbelt energy needs would no longer be dependent on the world commodities markets or the political stability of another source.

“It’s been about 40 years since there’s been a project of this size in the U.S.,” Rodvik said. “But someone once said that the best time to plant a tree is 30 years ago. The second best time is today.

“We have to look at the long-term needs of the Railbelt for subsequent gen-erations,” he said. “There is no reason, if this dam is built, that it cannot be pro-ducing clean, cost-effective and reliable power 400 years from now.” ❑

• General Contractor

• Civil Construction

• Environmental Cleanup and Consulting

• Operations and Maintenance of Wastewater

Pre-treatment Systems

With three locations and a staff of professional

environmental scientists, engineers, geologists,

chemists, biologists and technicians, we are

readily available to perform projects across the

State of Alaska.

All services are streamlined to ensure the

highest level of regulatory compliance and

cost controls.everything environmental

tutka—helping build Alaska.

Certified DBE (ADOT&PF, MOA) • SBA Certified HUBZone www.tutkallc.com

“This is a project on which young people can cut their teeth and older

folks could end their careers. It would be something people would

talk about for years.”— John MacKinnon, Executive Director,

Associated General Contractors


Unalaska Upgrades for Dutch Harbor Fishing Fleet

Carl E. Moses Boat Harbor addsneeded infrastructure

BY GAIL WEST


Alaska’s commercial fishing fleet faces some of the most rugged weather in the world,

often battling up to 60-knot winds and 30-foot waves in the waters of the Aleutian chain. Unalaska offers respite to many of the vessels at its har-bor – Dutch Harbor. Unalaska, itself, ranks second on the list of the top 101 cities with the highest average wind speeds, and boasts about 250 days of

rain each year. Construction, in this environment, is challenging enough. However, the city and its contractors have recently taken on an even more challenging project: the Carl E. Moses Boat Harbor.

Consisting of an inner harbor, uplands improvements, a new rub-ble-mound breakwater, f loating breakwaters and basin dredging, the new harbor will support the Bering

Sea and Aleutian Islands fishing fleets, according to John Fulton, Unalaska’s assistant city manager. A previous project under the U.S. Army Corps of Engineers, for approximately $26 million, has already completed the dredging and the rubble-mound breakwaters, and will be installing the floating breakwaters this summer. A design/build team of Pacific Pile & Marine and PND Engineers Inc. are

Fabricated float modules staged in Anacortes, Wash., awaiting transport to Dutch Harbor for Carl E. Moses Harbor project. Float construction consists of 48-inch-diameter steel-pipe pontoons supporting a tubular-steel frame with steel-grating deck.

Photo courtesy of John Fulton


preparing to build the inner harbor floats and the uplands facilities.

LONG-TIME COMING“This project has been in the works for about 15 years,” Fulton said. “We have more boats than we have dock space. Our harbor now is designed for about 75 boats. With the pollock, crab, cod and halibut fleets, we have at least double that number that use the port. In addition to the city’s funding, we’ve been able to pull together some federal funding and a State grant, along with a reimbursable bond through the State, to fund this project. The inner harbor is right at $30 million and the floating breakwaters are about $11.5 million. Then we have to build an access road and utilities for about $11.6 million, and we had to purchase some uplands for the project at $2 million.

“The State grant was the first money for this project, and it came through Rep. Carl Moses. That’s why it carries his name,” Fulton added.

“We currently have a linear dock and boats tie up in layers – rafting. In storms, that can sometimes cause

damage,” said Tyler Zimmerman, Un-alaska’s city engineer. “There’s also an increased chance for oil or fuel spills because of the rafting of these vessels. The new facilities also will save the fleet time and fuel – they won’t need to make the trip to Seattle for repairs or supplies. That’s about a seven- to 14-day trip for them and takes anywhere from 15,000 to 30,000 gallons of fuel each way. We’ll have all the services they need here.”

MAINTENANCE FACILITIES ADDEDAccording to Fulton, all commercial fish-ing vessels need regular maintenance.

“The Alaska locations, though,” Fulton said, “run out of slips, so the fishermen have to go farther south to Seattle. Soon, we’ll be able to keep those vessels here and keep more of the money and jobs in Alaska. The fleet is everything to the state and our whole economy in Un-alaska. Without the fishing fleet, we wouldn’t be here.”

Unalaska contributes approxi-mately 20 percent of the State Fish-eries Business Tax and approximately

40 percent of the Marine Fuel Tax collected for the State coffers each year. In addition, Unalaska is respon-sible for nearly 85 percent of the Fish-eries Landing Tax.

According to Pacific Pile’s Alaska Division Manager Jason Davis, on-site construction of the inner-harbor infrastructure and the uplands sup-port facilities was scheduled to begin in April and is slated for completion

“This project has been in the works for about 15 years.

We have more boats than we have dock space. Our harbor

now is designed for about 75 boats. With the pollock,

crab, cod and halibut fleets, we have at least double that number that use the port.”

— John Fulton, Unalaska Assistant City Manager


by November of this year. When com-pleted, there will be about 55 slips for the big commercial vessels, more than 50 slips for boats in the 100- to 150-foot range and 14 slips for boats in the 60- to 90-foot range, he said.

“We chose a heavy-duty steel float design for the dock rather than con-crete or timber because it provides the longest service life,” Davis said. “It’s the most durable design we have ever constructed.”

Installation of the floats requires piling to be drilled and seated into bed-rock, and, Davis says, socketing piles exceeding 140 feet in length is a very challenging operation in the Aleutian environment. “It makes a very com-petent foundation,” he said.

CHALLENGING PROJECTJohn DeMuth, senior engineer with PND, added that there are a number of challenges to this project, many pre-sented by the site and topography.

“It’s deep water that drops off quickly,” he said, “so the floats have to be anchored with relatively long piles. The contractor will have to drill into

rock and the rock is sloping; the pile will want to walk down the rock slope.”

Another challenge DeMuth added to the list was that everything is on a grand scale.

“We’re talking about some of the worst weather in the world – high winds and extremely large boats. Some of those vessels run 130 to 200 feet, and they’ll have to tie up to these floats,” DeMuth said. “When you get high winds bearing on the vessel’s sail area, it’s going to take well-anchored floats to withstand those forces.

“We’re also working in extra-deep water. Some of the piling will be go-ing into 90 to 100 feet of water; and when you get a pile that long, it deflects a great deal. All the piles going into this project will be framed together across the top so they don’t deflect as much when the vessels push on them. Because the float system will move so much, we had to design a connection for floats that’s not rigid so the bolts don’t shear, but that has the ability to flex and absorb energy. We are confi-dent our design will work well.”

DeMuth said the floats going into

the harbor are “of a strength and durability beyond what we’ve done before. The pontoons are four-foot-diameter pipes with a frame on top of 12-inch-square steel tube. This is very industrial-grade stuff,” he said. “We’re not talking recreational boats here. You need a float system to hold up to the big vessels.”

All of the floats will be equipped with fire suppressors, potable water and electrical service. To service the smaller fleet, a drive-down float for light vehicles, such as a pickup, and a dock crane to load or unload supplies will be incorporated into the dock.

CLIENT’S LONG-TERM VISION“One of the best things about this proj-ect,” Davis said, “is that the client has had the vision to create a long-term facility. They raised the standards and performance criteria higher than you typically see. These floats will have a 50-year life span with minimal main-tenance. This client recognized that by commissioning the best design and construction methods available, they will decrease the life-cycle cost and save money in the long run.”

Davis and DeMuth both said the city and the project team have worked well together.

“A lot of times, owners don’t rec-ognize the importance of quality,” Davis said. “They look at purchase cost rather than life-cycle cost. On this project, we’ve all made concessions and helped each other out. We’ll have a project that we’ll all be proud of.” ❑

“The new facilities also will save the fleet time and fuel – they won’t need to make

the trip to Seattle for repairs or supplies. That’s about a seven- to 14-day trip for them and takes anywhere

from 15,000 to 30,000 gallons of fuel each way.

We’ll have all theservices they need here.”

— Tyler Zimmerman, Unalaska City Engineer


Mat-Su Builders Recognized

Custom homes earn Pevan, Wirtanen awards

BY RINDI WHITE


Building homes in the Valley is a big industry. With the Mat-Su Borough reporting nearly

90,000 residents and 26,216 homes, it’s no wonder builders are keeping busy despite a national industry slow-down.

Among those builders are a few that stand out. Bob Pevan, owner of Tru Built Construction and current presi-dent of the Mat-Su Home Builders, a trade organization with more than 100 members, was recently selected as 2010 Builder of the Year in part for work he has done to build a much-needed home for a disabled Wasilla man.

Also catching notice is Steven Wirtanen, who runs Wirtanen Inc., a company building custom homes on a budget. Wirtanen won a Golden Spike award for a home his company built near Wasilla that was valued at just more than $500,000. That’s a high-end home but the company is making itself known for making custom homes avail-able on a budget.

GENERAL CONTRACTING WITH A HEART

Pevan was humble about receiving the Builder of the Year award.

“I don’t know how I got it,” he said. “I voted for Jess Hall.”

Hall is a prominent Valley builder and has received multiple Builder of the Year awards from Alaska State Home Builders and Mat-Su Home Builders.

But Pevan won the award, due in part to his efforts to make life better for another Valley family.

Last year the Mat-Su Home Build-ers board took on a project aimed at giving a Wasilla man a new home. Jim White, a former school bus driver, had developed peripheral degenerative

vascular disease and lost his legs in January 2008.

Israel Nelson, a former pastor and current board member of Habitat for Humanity, asked the Home Builders board to help build White a home. Pe-van, then vice president of the board, agreed to serve as general contractor.

Nelson said White had been saving money to build a home before his ill-ness. A “fascinating man,” Nelson said, White has retrofitted his vehicle and his current home so he can get around. But the home, a dilapidated pair of mobile home trailers more than 50 years old, is fast wearing out, Nelson said.

“They leak terribly, are filled with mold and are about to fall in,” he said. “We were worried they wouldn’t make it through the winter. Because of the mold, everybody in the family has been sick this winter … including Jim.”

Pevan said it’s been a pleasure and a challenge to work on the White project.

“It’s been a tough go of it to get money because times are tough,” he said. “If we’d had more money, the project would have been done.”

Nelson is seeking donations to get the project wrapped up. They’ve bud-geted $100,000 and, thanks to a recent anonymous $10,000 donation, they’re only $20,000 shy of their goal.

The exterior walls and roof are on, the electrical and plumbing are installed and the $10,000 donation will allow workers to finish insulation and put up the drywall, Nelson said. Cabinets in the kitchen and bathrooms, flooring, interior doors and trim are still needed.

He said Pevan’s experience has been invaluable. From finding people to do-nate work and materials to overseeing duties and having an employee take care of loose ends, Pevan has been “spectacular,” he said.

“He has done everything to get this thing to roll,” Nelson said. “I would have been at a loss to try to do this without him.”

A SECOND CAREERPevan started out building houses with his father but took a 17-year break to work in building maintenance for the Mat-Su Borough School District. He left the district in 1998 to get back into home building.

“I really found out how much I enjoy working for myself,” he said. “I can set my own challenges and goals.”

In the 13 years he’s run Tru Built Construction, Pevan has watched the Valley change. He has built custom homes ranging in price from $225,000 to $1 million. These days, he said, he

Steven Wirtanen, chief executive officer, Wirtanen Custom Homes Inc.

Photo by Rindi White


sees more homes being built in the $300,000 range. Being successful comes down to providing reliable work and good customer service.

“It’s a little bit slower now – it’s defi-nitely a buyer’s market,” he said. “You really have to provide quality service to keep customers.”

A NEW KIND OF CUSTOMER SERVICE

While Pevan is in his second career, builder Steven Wirtanen is in the midst of his first. Wirtanen, at 29, is one of the youngest builders working in the Valley.

Wirtanen has been helping build homes since he was 10 years old and has run Wirtanen Custom Homes Inc. for nearly four years. His company re-cently won a Golden Spike award for a home valued at more than $500,000 that was entered in the Mat-Su Home Builders’ Fall 2010 Parade of Homes. Wirtanen said the Wasilla home was built for a military family who had been planning their dream home and finally had a chance to settle down.

The company has won several Golden Spike awards in recent years.

Judged for qualities such as best curb appeal, best master suite, best layout, best kitchen and best value, the winning homes represent excellence in home construction.

Wirtanen said he tries to make it easier on homeowners by offering good communication upfront and eliminat-ing surprises throughout the process.

He uses a design/build program called SoftPlan that allows him to cus-tomize home plans to meet the client’s needs and tailor the design to the lot on which it is being built. A favorite feature, he said, is the ability to enlarge home plans on a five-foot screen in his conference room and make changes immediately to tailor the design to the customer’s wishes.

“Even if a client has a budget that’s like, $240,000 or $250,000, we can de-sign a house that puts the value where the client chooses it. Instead of, say, 12-foot coffered ceilings, maybe the client would prefer 9-foot ceilings and a deeper garage.”

That customization paid off for the Johnsons, the family whose home won a Golden Spike.

“We especially loved the way we were always encouraged to express our questions, thoughts and make changes right up to the end,” Mike and Darlene Johnson wrote of the process.

Wirtanen said his company aims to make custom homes available to ev-eryone.

“It doesn’t have to be expensive just because it’s custom,” Wirtanen said.

Wirtanen’s list of standard features includes spray-foam insulation, ultra-efficient heating systems, tankless hot water heaters and numerous other de-tails aimed at decreasing the cost of a home over its lifespan.

“Even though it’s a few hundred dollars here and there, basically we’re trying to offer our clients the least out-of-pocket cost over the life of the home,” he said.

Those details, along with website (www.wirtaneninc.com) and good placement in search engines, means Wirtanen Custom Homes had its busi-est year ever last year.

“It’s probably somewhat strange that we’re this busy, especially doing custom homes. Most people would correlate ‘custom’ with being expensive. But with modern technology, we’ve been able to build a customized package for a really moderate price,” Wirtanen said.

MORE GOLDEN SPIKESSeveral other builders also won Golden Spike awards for the Fall 2010 Parade of Homes. Winners were: in the $199,900 to $220,900 value range, Nick Fonov with Pacific North Construction Inc.; in the $245,000 to $248,900 range, Dwayne Jenson of Jenson & Sons Construction Inc.; for a home valued at $330,000, Drobenko Investments; for a home valued at $384,500, Wolfe Homes. And winning the Associate of the Year award was Raye Krueger with Alyeska Title Guarantee Agency. ❑

ALASKA TRENDS HAS BEEN BROUGHT TO YOU THIS MONTH COURTESY OF AMERICAN MARINE/PENCO

Alaska Trends, an outline of significant statewide statistics, is provided by the University of Alaska Center for Economic Development.

The State of Alaska is heavily dependent upon revenue gen-

erated from taxes on the oil com-panies, which provide more than 85 percent of total State revenues. Since taxes on the oil extraction industry represent such a large portion of the State’s tax revenue, Alaska’s economy is highly sensi-tive to changes in production levels and the spot price of crude oil. The chart illustrates the constant decline of crude oil production in Alaska, from 26.29 million barrels in 2005 to 18.23 million barrels in 2010 (a 30.63 percent decrease), while the West Coast spot price increased from a low of $53.48 in 2005 to $79.28 in 2010 (a 48.24 percent increase).

Although increased oil prices are passed on to con-sumers through increased shipping charges and the pric-ing of most products, Alaska benefits from higher oil prices. As a result of the increased spot price, the State of Alaska collects additional tax revenue. It is hotly debated whether the increased spot prices also result in increased profitability for the oil companies, due to the progres-sivity tax known as Alaska’s Clear and Equitable Share (ACES). Regardless of how the progressivity tax affects

production decisions, it is widely accepted that Alaska has begun experiencing increased competition for oil investment among other regions, most recently North Dakota, which has a lower tax rate on oil production. In addition, Alaska Gov. Sean Parnell has proposed lower-ing the ACES oil tax, with the belief that it will result in increased competitiveness for investment in the State. It is yet to be determined what the true result of adjusting the oil taxes would mean for the state’s economy, however, we can be sure that this topic will remain a high priority to residents and will continue to cause heated debate. ❑

ALASKA TRENDS

Crude Oil Production versus Price (2005-2010)

Sources: Crude Oil Production: http://doa.alaska.gov/ogc/Spot Price: http://www.tax.alaska.gov/programs/oil/prevailing/ans.aspx

BY WILLIAM COX


Year Over Year

Change

YearAgo

Period

Previous ReportPeriod(revised)

Latest Report PeriodPeriodUnitsIndicator

GENERALPersonal Income – Alaska US $ 3rd Q10 31,373 31,373 30,284 3.60%Personal Income – United States US $ 3rd Q10 12,590,671 12,590,671 12,156,914 3.57%Consumer Prices – Anchorage 1982-1984 = 100 2nd H10 195.46 195.46 193.456 1.03%Consumer Prices – United States 1982-1984 = 100 2nd H10 218.58 218.58 215.935 1.22%Bankruptcies Alaska Total Number Filed January 52 92 71 -26.76% Anchorage Total Number Filed January 8 52 54 -85.19% Fairbanks Total Number Filed January 64 14 13 392.31%

EMPLOYMENTAlaska Thousands January 328.78 330.59 324.00 1.48%Anchorage & Mat-Su Thousands January 185.45 188.15 182.77 1.46%Fairbanks Thousands January 42.45 43.46 41.69 1.82%Southeast Thousands January 34.06 30.27 34.49 -1.26%Gulf Coast Thousands January 33.55 32.89 31.65 6.02%Sectoral Distribution – AlaskaTotal Nonfarm Thousands January 311.3 313.4 302.9 2.77% Goods Producing Thousands January 38.5 35.8 37.2 3.49% Services Providing Thousands January 272.8 277.6 265.7 2.67% Mining and Logging Thousands January 14.8 15.7 14.0 5.71% Mining Thousands January 14.6 15.4 13.9 5.04% Oil & Gas Thousands January 12.5 13.1 12.0 4.17% Construction Thousands January 12.5 13.4 12.8 -2.34% Manufacturing Thousands January 11.2 6.7 10.4 7.69% Seafood Processing Thousands January 7.7 3.1 7.1 8.45% Trade/Transportation/Utilities Thousands January 60.5 61.8 58.9 2.72% Wholesale Trade Thousands January 5.8 6.0 5.9 -1.69% Retail Trade Thousands January 34.2 35.0 34.0 0.59% Food & Beverage Stores Thousands January 5.9 6.1 6.0 -1.67% General Merchandise Stores Thousands January 9.8 9.9 9.9 -1.01% Trans/Warehouse/Utilities Thousands January 20.5 20.8 19.0 7.89% Air Transportation Thousands January 5.7 5.6 5.3 7.55% Truck Transportation Thousands January 3.3 3.1 2.9 13.79% Information Thousands January 6.2 6.4 6.3 -1.59% Telecommunications Thousands January 4.2 4.3 4.1 2.44% Financial Activities Thousands January 15.2 15.4 14.6 4.11% Professional & Business Svcs Thousands January 24.9 25.5 24.7 0.81% Educational & Health Services Thousands January 42.7 42.4 40.8 4.66% Health Care Thousands January 30.8 30.4 29.4 4.76% Leisure & Hospitality Thousands January 28.6 29.0 26.4 8.33% Accommodation Thousands January 6.4 6.8 5.9 8.47% Food Svcs & Drinking Places Thousands January 18.2 17.1 16.9 7.69% Other Services Thousands January 11.4 11.2 10.9 4.59% Government Thousands January 83.3 85.9 83.1 0.24% Federal Government Thousands January 16.2 16.5 16.3 -0.61% State Government Thousands January 25.2 26.0 25.1 0.40% State Education Thousands January 7.5 8.4 7.5 0.00% Local Government Thousands January 41.9 43.4 41.7 0.48% Local Education Thousands January 24.7 25.1 24.7 0.00% Tribal Government1 Thousands January 3.5 3.8 3.5 0.00%Labor Force Alaska Thousands January 359.28 359.65 357.29 0.56% Anchorage & Mat-Su Thousands January 200.10 202.32 199.08 0.51% Fairbanks Thousands January 45.95 46.77 45.67 0.61% Southeast Thousands January 37.56 32.83 37.87 -0.80% Gulf Coast Thousands January 37.55 36.88 37.56 -0.02%

ALASKA TRENDS


Data compiled by University of Alaska Center for Economic Development.

S P O N S O R E D B Y A M E R I C A N M A R I N E / P E N C O

Year Over Year

Change

YearAgo

Period

Previous ReportPeriod(revised)

LatestReportPeriodPeriodUnitsIndicator

Unemployment Rate Alaska Percent January 8.5 8.1 9.3 -8.60% Anchorage & Mat-Su Percent January 7.3 7 8.2 -10.98% Fairbanks Percent January 7.6 7.1 8.7 -12.64% Southeast Percent January 9.3 7.8 9.2 1.09% Gulf Coast Percent January 10.6 10.8 11.7 -9.40%United States Percent January 9.8 9.1 10.6 -7.55%

PETROLEUM/MININGCrude Oil Production – Alaska Millions of Barrels January 14.38 18.97 16.95 -15.19%Natural Gas Field Production – Alaska Billions of Cubic Ft. January 12.95 12.79 12.87 0.65%ANS West Cost Average Spot Price $ per Barrel January 92.56 89.75 79.34 16.67%Hughes Rig Count Alaska Active Rigs January 5 7 7 -28.57% United States Active Rigs January 1711 1711 1267 35.04%Gold Prices $ Per Troy Oz. January 1,358.44 1,392.03 1,118.77 21.42%Silver Prices $ Per Troy Oz. January 2840.25 2934.90 1778.70 59.68%Zinc Prices Per Pound January 1.23 1.14 1.22 1.25%

REAL ESTATEAnchorage Building Permit Valuations Total Millions of $ January 27.39 15.80 5.83 369.53% Residential Millions of $ January 6.93 3.56 3.10 123.35% Commercial Millions of $ January 20.46 12.25 2.73 649.19%Deeds of Trust Recorded Anchorage – Recording District Total Deeds January 829 1149 562 47.51% Fairbanks – Recording District Total Deeds January No Data No Data 193

VISITOR INDUSTRYTotal Air Passenger Traffic – Anchorage Thousands January 329.74 368.74 No DataTotal Air Passenger Traffic – Fairbanks Thousands January 68.78 74.58 66.39 3.59%

ALASKA PERMANENT FUNDEquity Millions of $ January 38,896.10 38,425.10 33,978.50 14.47%Assets Millions of $ January 39,450.30 38,768.60 34,300.80 15.01%Net Income Millions of $ January 203.0 176.9 170.2 19.27%Net Income – Year to Date Millions of $ January $409.8 $1,347.1 ($705.1) 158.12%Marketable Debt Securities Millions of $ January -7.4 -61.3 65.3 -111.33%Real Estate Investments Millions of $ January 77.7 13.4 (80.7) 196.28%Preferred and Common Stock Millions of $ January 224.1 1,221.8 (757.9) 129.57%

BANKING (excludes interstate branches)

Total Bank Assets – Alaska Millions of $ 4th Q10 2,078.40 2,068.99 1,971.86 5.40% Cash & Balances Due Millions of $ 4th Q10 29.07 37.35 34.58 -15.92% Securities Millions of $ 4th Q10 156.42 131.40 123.37 26.79% Net Loans and Leases Millions of $ 4th Q10 1,150.21 1,110.96 1,138.51 1.03% Other Real Estate Owned Millions of $ 4th Q10 15.06 15.76 21.75 -30.76%Total Liabilities Millions of $ 4th Q10 1,832.10 1,823.80 1,740.69 5.25% Total Bank Deposits – Alaska Millions of $ 4th Q10 1,786.15 1,785.53 1,705.50 4.73% Noninterest-bearing deposits Millions of $ 4th Q10 470.20 479.89 445.65 5.51% Interest- bearing deposits Millions of $ 4th Q10 1,315.95 1,305.64 1,259.85 4.45%

FOREIGN TRADEValue of the Dollar In Japanese Yen Yen January 82.51 83.37 91.39 -9.71% In Canadian Dollars Canadian $ January 0.99 1.01 1.04 -4.77% In British Pounds Pounds January 0.63 0.64 0.62 2.52% In European Monetary Unit Euro January 0.75 0.76 0.70 6.97% In Chinese Yuan Yuan January 6.60 6.65 6.83 -3.38%



A D V E R T I S E R S I N D E XAlaska Air Cargo. . . . . . . . . . . . . . . . . . . . . . . . . . . . 73Alaska Dreams . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68Alaska Growth Capital . . . . . . . . . . . . . . . . . . . . . . . 59Alaska Media Directory. . . . . . . . . . . . . . . . . . . . . . . 55Alaska Rubber & Supply Inc. . . . . . . . . . . . . . . . . . . 89Alaska USA Federal Credit Union. . . . . . . . . . . . . . . 23Alutiiq Oilfield Solutions LLC. . . . . . . . . . . . . . . . 48, 83American Marine/PENCO. . . . . . . . . . . . . . . . . . . . 119Amerigas Propane . . . . . . . . . . . . . . . . . . . . . . . . . . 61Anchorage Convection & Visitors Bureau . . . . . . . . . 13Anchorage Sand & Gravel . . . . . . . . . . . . . . . . . . . 113Arctic Controls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69Arctic Fox Steel Buildings . . . . . . . . . . . . . . . . . . . . . 71Arctic Office Products (Machines) . . . . . . . . . . . . . . 54ASRC Energy Services. . . . . . . . . . . . . . . . . . . . . . . 69AT&T Alaska . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17AVTEC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67Azimuth Adventure Photography . . . . . . . . . . . . . . . 16B2 Networks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53Business Insurance Associates Inc. . . . . . . . . . . . . . 51Calista Corp. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96CareNet Inc. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61Carlile Transportation Systems . . . . . . . . . . . . . . . . . 31CCI Industrial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95Chris Arend Photography . . . . . . . . . . . . . . . . . . . . 122City Electric Inc. . . . . . . . . . . . . . . . . . . . . . . . . . . . 115Clarion Suites Hotel . . . . . . . . . . . . . . . . . . . . . . . . . 21CONAM Construction Co.. . . . . . . . . . . . . . . . . . . . . 79Construction Machinery Industrial LLC. . . . . . . . . . 123Crowley. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29Cruz Construction Inc. . . . . . . . . . . . . . . . . . . . . . . . 88CRW Engineering Group LLC. . . . . . . . . . . . . . . . . . 11

Design Alaska. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 108Dowland-Bach Corp.. . . . . . . . . . . . . . . . . . . . . . . . . 81Doyon Emerald . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82EDC Inc. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 118ERA Helicopters . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74First National Bank Alaska . . . . . . . . . . . . . . . . . . . . . 5GCI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33Golder Associates Inc. . . . . . . . . . . . . . . . . . . . . . . . 71Granite Construction. . . . . . . . . . . . . . . . . . . . . . . . 107Great Originals Inc.. . . . . . . . . . . . . . . . . . . . . . . . . 112Hotel Captain Cook. . . . . . . . . . . . . . . . . . . . . . . . . . 15Hydraulic Repair and Design . . . . . . . . . . . . . . . . . . 48Judy Patrick Photography . . . . . . . . . . . . . . . . . . . . . 78Kakivik Asset Management LLC. . . . . . . . . . . . . . . . 97Kendall Ford Wasilla . . . . . . . . . . . . . . . . . . . . . . . . . 19Key Bank. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65Kinross Fort Knox . . . . . . . . . . . . . . . . . . . . . . . . . . . 47Land’s End Resort . . . . . . . . . . . . . . . . . . . . . . . . . . 35Landye Bennett Blumstein LLP. . . . . . . . . . . . . . . . . 14Lounsbury and Associates . . . . . . . . . . . . . . . . . . . . 78Lynden Inc. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37MT Housing Inc. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91NANA Regional Corp.. . . . . . . . . . . . . . . . . . . . . . . . 49North Star Behavior Health. . . . . . . . . . . . . . . . . . . . 27Northern Air Cargo . . . . . . . . . . . . . . . . . . . . . . . 42, 43Northwest Ironworkers Employers

Association . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116Pacific Alaska Freightways . . . . . . . . . . . . . . . . . . . 101Pacific Pile & Marine. . . . . . . . . . . . . . . . . . . . . 8, 9, 10Paramount Supply . . . . . . . . . . . . . . . . . . . . . . . . . . 55Parker Smith & Feek. . . . . . . . . . . . . . . . . . . . . . . . . 63PDC Engineers Inc. . . . . . . . . . . . . . . . . . . . . . . . . . 77

Peak Oilfield Services. . . . . . . . . . . . . . . . . . . . . . . . 68Pebble Partnership . . . . . . . . . . . . . . . . . . . . . . . . . . 45Pen Air . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70PND Engineers Inc. . . . . . . . . . . . . . . . . . . . . . . . . 112PSC Environmental Services . . . . . . . . . . . . . . . . . . 99Right Systems Inc. . . . . . . . . . . . . . . . . . . . . . . . . . . 54Rosie’s Delivery . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55RSA Engineering . . . . . . . . . . . . . . . . . . . . . . . . . . 116SGS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92Shoreside Petroleum . . . . . . . . . . . . . . . . . . . . . . . . 70Shred Alaska . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13SLR. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79Span Alaska Consolidators. . . . . . . . . . . . . . . . . . . . 25Spenard Builders Supply . . . . . . . . . . . . . . . . . . . . 111Stellar Designs Inc.. . . . . . . . . . . . . . . . . . . . . . . . . . 55Sundog Media. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55Superstar Pastry Design. . . . . . . . . . . . . . . . . . . . . . 55The Growth Company. . . . . . . . . . . . . . . . . . . . . . . . 14Tobacco Prevention Control . . . . . . . . . . . . . . . . . . . . 2TTT Environmental . . . . . . . . . . . . . . . . . . . . . . . . . . 83Tutka LLC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113Udelhoven Oilfield Systems

Services . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93Ukpeagvik Inupiat Corp. . . . . . . . . . . . . . . . . . . . . . . 85UNIT Company . . . . . . . . . . . . . . . . . . . . . . . . . . . . 108URS Corp.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82Usibelli Coal Mine Inc. . . . . . . . . . . . . . . . . . . . . . . . 81Washington Crane & Hoist . . . . . . . . . . . . . . . . . . . . 39Waste Management . . . . . . . . . . . . . . . . . . . . . . . . . 75Wells Fargo Bank NA . . . . . . . . . . . . . . . . . . . . . . . 124World Trade Center Alaska . . . . . . . . . . . . . . . . . . . . 21XTO Energy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3

May 2011 - Alaska Business Monthly

Documents

Transcript of May 2011 - Alaska Business Monthly