Math 15Introduction to Scientific Data Analysis

Lecture 10Python Programming – Part 4

University of California, Merced

Today – We have A Quiz!

UC Merced 2

Schedule

Final ExaminationDecember ?Final

Project #2Python Programming - #6December 515

Python Programming – #5November 2814

Quiz #6Python Programming – #4November 2113

No LectureNovember 1412

Quiz #5Python Programming – #2November 711

Python Programming – #1October 3110

Quiz #4Programming – Introduction to Python Part - IIOctober 249

Project #1Programming – Introduction to Python Part - IOctober 178

Quiz #3Excel #6 – Interactive ProgrammingOctober 107

Excel #5 – Data AnalysisOctober 36

Quiz #2Excel #4 – Regression AnalysisSeptember 265

Excel #3 – Statistical AnalysisSeptember 194

Quiz #1Excel #2 – Plotting Graphs/ChartsSeptember 123

Excel #1 – General TechniquesSeptember 52

Introduction to the data analysisAugust 291

Project DueConceptsDateWeek

Final ExaminationDecember ?Final

Project #2Python Programming - #6December 515

Python Programming – #5November 2814

Quiz #6Python Programming – #4November 2113

No LectureNovember 1412

Quiz #5Python Programming – #2November 711

Python Programming – #1October 3110

Quiz #4Programming – Introduction to Python Part - IIOctober 249

Project #1Programming – Introduction to Python Part - IOctober 178

Quiz #3Excel #6 – Interactive ProgrammingOctober 107

Excel #5 – Data AnalysisOctober 36

Quiz #2Excel #4 – Regression AnalysisSeptember 265

Excel #3 – Statistical AnalysisSeptember 194

Quiz #1Excel #2 – Plotting Graphs/ChartsSeptember 123

Excel #1 – General TechniquesSeptember 52

Introduction to the data analysisAugust 291

Project DueConceptsDateWeek

December 176-9pm

Quiz #6

But, there will be a lab!

Masa will be in Reno next week!

UC Merced 3

Math 15 Now till the end of Fall semester

Four more Labs

One more Assignment ( HW #6 due November 18)

Total of 6 assignments

Two more Quizzes (Today-20pts and Nov. 28-30pts) Total of 6 quizzes

Project #2 (due December 7) – Available @ November 19th

Final Exam – December 17th

UC Merced 4

Grading for Math 15

Activity Points % Final Grade

Assignments 100 20%

In-Class Quizzes 100 20%

Computer Labs 60 12%

Project #1 70 14%

Project #2 70 14%

Final Exam 100 20%

Total 500 100%

Activity Points

Assignments 110

In-Class Quizzes 130

Computer Labs 60

Project #1 70

Project #2 70

Final project 100

Total 540

Projected points

Grade Total points achieved

A Over 425

B Over 375

C Over 325

D Over 275

UC Merced 5

Bonus or Extra Points

So far Lab/homework/project – 15 points Seminar Report – 50 points (Done) Halloween Bonus – 10 points (Done)

Near future Maybe …

UC Merced 6

Any Questions?

UC Merced 7

After Three weeks of Python Programming experience, what did you think?

python

UC Merced 8

Don’t make Python bother you.Don’t be scared!Python is just a Tool!

UC Merced 9

This Week

More Programming

Review New materials for Next Week’s Lab

Dictionaries Input from a file / Output to a file Defining function

Homework #6 is due November 18th!

Next Week’s Lab (#9) is available at the UCMCROPS.

UC Merced 10

Quick Reminder – Part 1

List

UC = [“UCLA”, “UC Davis”, “UC Merced”, “UC Berkeley”, “UCSF”, “UCI”]

# of elements in UC = 6

>>> print UC[1]UC Davis>>> print UC[6]Error!

Python – Index of List starts at 0

UC Merced 11

Quick Reminder – Part 2

range() function range(n) : a list of integers from 0 to up to n, but not

including n.

Concept of “Counter”

>>> range(10)[0,1,2,3,4,5,6,7,8,9]

N = 15icount = 0 # Initializing a variablefor var in range(1,N,2): icount = icount + 1 print var, icount

>>> 1 13 25 37 49 511 613 7

UC Merced 12

Dictionary Mutable (or changeable) table of object

references, accessed by keys.

Is like an address-book where you can find the address or contact details of a person by knowing only his/her name i.e. we associate keys (name) with corresponding

values (details).

Note that the key must be unique to have associated values. just like you cannot find the correct information if

you have two persons with the exact same name.

UC Merced 13

Dictionary – cont.

In python, dictionary entries are enclosed in braces {}. Here is the general syntax:

Name_of_dictionary = { key1 : value1, key2 : value2 }

UC = { 'Bruins'  : ‘UCLA', ‘Bobcats'  : ‘UC Merced',

'Highlanders'  : ‘UC Riverside', ‘Anteaters'  : ‘UCI' ‘Banana Slugs’: ‘UC Santa Cruz’}

>>> UC[‘Highlanders’]UC Riverside

UC Merced 14

Example: DNA Sequence Analysis

Objectives: Convert a DNA sequence to a protein sequence by using the

translation table.

Then, use the resulting sequence to identify your protein and its function.

ATGAGGAAAATGCTGACCGCTGTGCTGTCTCACGTATTTTCGGGAATGGTCCAAAAGCCAGCTCTCAGAGGACTGCTGTCATCTCTGAAGTTCTCCAACGACGCCACCTGTGACATTAAGAAATGTGACCTGTACCGGCTGGAGGAGGGCCCACCGACCTCCACCGTGCTCACCCGAGCCGAGGCCCTCAAGTACTACCGGACCATGCAGGTAATTCGGCGCATGGAGTTGAAGGCCGACCAGCTGTATAAGCAGAAATTCATCCGTGGTTTCTGTCACCTGTGTGATGGGCAGGAAGCCTGCTGCGTGGGGCTGGAGGCAGGGATAAATCCCACGGATCACGTCATCACGTCCTACCGGGCTCATGGCTTCTGCTACACGCGAGGACTGTCCGTGAAGTCCATTCTCGCCGAGCTGACTGGACGCAAAGGAGGCTGTGCTAAAGGCAAGGGAGGCTCCATGCACATGTACGGCAAGAACTTCTACGGTGGCAATGGCATTGTTGGGGCCCAGGTACCCCTGGGAGCTGGTGTGGCTTTTGCCTGTAAATACCTGAAGAATGGTCAGGTCTGCTTGGCTTTGTACGGCGATGGTGCGGCTAACCAAGGGCAGGTATTCGAAGCATACAATATGTCAGCCTTGTGGAAATTACCCTGTGTTTTCATCTGTGAGAATAACCTCTATGGAATGGGAACCTCCAACGAGAGATCAGCAGCCAGTACTGATTACCACAAGAAAGGTTTTATTATCCCCGGACTGAGGGTGAATGGGATGGATATTCTCTGTGTTCGGGAGGCAACCAAGTTTGCAGCTGATCACTGCAGATCTGGAAAGGGGCCCATTGTGATGGAGCTGCAGACCTACCGTTATCATGGACACAGTATGAGCGACCCAGGGATCAGTTATCGTTCACGAGAAGAAGTTCATAACGTGAGAAGTAAGAGTGATCCTATAATGCTGCTCCGAGAGAGAATTATCAGCAACAACCTCAGCAATATTGAAGAATTGAAAGAAATTGATGCAGATGTGAAGAAAGAGGTGGAGGACGCAGCTCAGTTTGCTACGACTGATCCAGAACCAGCTGTGGAAGATATAGCCAATTACCTCTACCACCAAGATCCACCTTTTGAAGTCCGTGGTGCACATAAGTGGCTCAAGTATAAGTCCCACAGTTAG

UC Merced 15

How to convert? The modern genetic code uses triplets

of letters to form the words or codons of the genetic language.

Table 1. Amino Acid Codon Table Second Base

First Base T C A G Third Base

T Phe (F) Phe (F) Leu (L) Leu (L)

Ser (S) Ser (S) Ser (S) Ser (S)

Tyr (Y) Tyr (Y)

Stop Stop

Cys (C) Cys (C)

Stop Trp (T)

T C A G

C Leu (L) Leu (L) Leu (L) Leu (L)

Pro (P) Pro (P) Pro (P) Pro (P)

His (H) His (H) Gln (Q) Gln (Q)

Arg (R) Arg (R) Arg (R) Arg (R)

T C A G

A Ile (I) Ile (I) Ile (I)

Met (M)

Thr (T) Thr (T) Thr (T) Thr (T)

Asn (N) Asn (N) Lys (K) Lys (K)

Ser (S) Ser (S) Arg (R) Arg (R)

T C A G

G Val (V) Val (V) Val (V) Val (V)

Ala (A) Ala (A) Ala (A) Ala (A)

Asp (D) Asp (D) Glu (E) Glu (E)

Gly (G) Gly (G) Gly (G) Gly (G)

T C A G

UC Merced 16

Create the simple Python program to do the job!

First: Convert a codon table into Python’s dictionary

Code = {'TTT': 'F', 'TCT': 'S', 'TAT': 'Y', 'TGT': 'C', 'TTC': 'F', 'TCC': 'S', 'TAC': 'Y', 'TGC': 'C', 'TTA': 'L', 'TCA': 'S', 'TAA': '*', 'TGA': 'W', 'TTG': 'L', 'TCG': 'S', 'TAG': '*', 'TGG': 'W', 'CTT': 'L', 'CCT': 'P', 'CAT': 'H', 'CGT': 'R', 'CTC': 'L', 'CCC': 'P', 'CAC': 'H', 'CGC': 'R', 'CTA': 'L', 'CCA': 'P', 'CAA': 'Q', 'CGA': 'R', 'CTG': 'L', 'CCG': 'P', 'CAG': 'Q', 'CGG': 'R', 'ATT': 'I', 'ACT': 'T', 'AAT': 'N', 'AGT': 'S', 'ATC': 'I', 'ACC': 'T', 'AAC': 'N', 'AGC': 'S', 'ATA': 'M', 'ACA': 'T', 'AAA': 'K', 'AGA': 'R', 'ATG': 'M', 'ACG': 'T', 'AAG': 'K', 'AGG': 'R', 'GTT': 'V', 'GCT': 'A', 'GAT': 'D', 'GGT': 'G', 'GTC': 'V', 'GCC': 'A', 'GAC': 'D', 'GGC': 'G', 'GTA': 'V', 'GCA': 'A', 'GAA': 'E', 'GGA': 'G', 'GTG': 'V', 'GCG': 'A', 'GAG': 'E', 'GGG': 'G'}

UC Merced 17

Functions

Functions are reusable pieces of programs. i.e. range(5), math.sqrt(9), pow(5,2) etc.

Using that function any number of times and anywhere in your program.

This is known as calling the function.

UC Merced 18

Defining Functions

Functions are defined using the def keyword. This is followed by an identifier name for the

function followed by a pair of parentheses which may enclose some names of variables and the line ends with a colon.

This is followed by a block of statements that form the body of the function.

Syntax

def function_name(arguments):“function_documentaion_string”function_body_suite

UC Merced 19

Defining Functions - cont

Example# python Program#def say_hello():

print 'Hello World!' # body of the function

say_hello() # calling the functionsay_hello()say_hello()

Hello World! Hello World!Hello World!

UC Merced 20

Defining Functions – cont. Another Example

# Python Program# Min & Max #def print_max(x, y):

if x > y: print x, 'is maximum'

else: print y, 'is maximum'

print_max(3, 4) # directly give literal constants as arguments

a = 5 b = 7 print_max(a, b) # pass in variables as arguments

4 is maximum 7 is maximum

UC Merced 21

Defining Functions Yet Another Example

The return statement is used to return from a function (i.e. break out from a function).

We can optionally return a value from the function as well.

# python No. 3

def maximum(x, y): if x > y:

return x else:

return y

print maximum(2, 3) 3

UC Merced 22

Calculation of n! and (n!/r!)

One way:n = input ("What is n? ")icount = 1for i in range(1,n+1): icount = icount * infact = icountpnint n,"! =", nfact

r = input("What is r? ")icount = 1for i in range(1,r+1): icount = icount * irfact = icountprint r,"! = ", rfact

print float(nfact)/(rfact)

n!

r!

Another way:#==================================def fact(x): icount = 1 for i in range(1,x+1): icount = icount * i fact = icount print n,"! = ", fact return fact#==================================

n = input("What is n? ")r = input("What is r? ")

a = fact(n)b = fact(r)

print float(a)/(b)

Reusing the function

UC Merced 23

Files and Input/Output

Working with files is a lot like working with notebooks. To use a notebook, you have to open it. When you're done, you have to close it.

With Python, it’s easy to read strings from plain text files and write to plain text files.

UC Merced 24

Open a file for reading data!

This time for reading, and read the contents into a string. This time, the mode argument is "r" for reading:

>>> shrimp = open("test.dat","r") If we try to open a file that doesn't exist, we get an error.

The readline method reads all the characters up to and including the next newline character:

>>> shrimp = open("test.dat","r") >>> print shrimp.readline() Now is the time to close the file

The read method reads data from the file. With no arguments, it reads the entire contents of the file:

>>> text = shrimp.read() >>> print text Now is the time to close the file

UC Merced 25

Open a file for writing!

Opening a file creates a file object. In this example, the variable bobcat refers to the new file object.

>>> bobcat = open("test.dat","w") The open function takes two arguments.

The first is the name of the file, and the second is the mode. Mode "w" means that we are opening

the file for writing. If there is no file named test.dat, it will be created. If

there already is one, it will be replaced by the file we are writing.

To put data in the file we invoke the write method on the file object:

>>> bobcat.write("Now is the time") >>> bobcat.write("to close the file")

Closing the file tells the system that we are done writing and makes the file available for reading:

>>> bobcat.close()

UC Merced 26

Example – No.1:

#

# Program to read and print a file

#

file = open(“I_hate_Python.txt","r")

text = file.readlines()

file.close()

for line in text:

print line,

file_out = open(“I_Love_Python.txt","w")

file_out.writelines(text)

file_out.close()

UC Merced 27

Example- No. 2:

Raw_data.txt - 3.0,4.0,5.0,6.0

Incorrect way to do this:infile = open("raw_data.txt","r")icount = 0for line in infile: # Loop through each line of the file icount = icount + line print line, icount

Correct way to do thisinfile = open("raw_data.txt","r")icount = 0for line in infile: icount = icount + float(line) print line, icount

UC Merced 28

Type Conversion

Type conversion functions are useful. Especially, a time when you need to read data sets from the file.

Python reads data sets as strings. You need to convert to numerical types in order to conduct some mathematical operations.

FunctionDescription

int(x ) converts x to an integer

float(x)converts x to a floating-point number (or real number)

str(x) converts x to a string representation

list(s) converts a sequence to a list

chr(x) converts an integer to a character

UC Merced 29

Let’s start programming

Again!The best way to learn a programming is

To Practice!python