Materials Science and Engineering C 33 (2013) 2113–2121

Contents lists available at SciVerse ScienceDirect

Materials Science and Engineering C

j ourna l homepage: www.e lsev ie r .com/ locate /msec

Zr61Ti2Cu25Al12 metallic glass for potential use in dental implants: Biocompatibilityassessment by in vitro cellular responses

Jing Li a, Ling-ling Shi b, Zhen-dong Zhu b, Qiang He b, Hong-jun Ai a,⁎, Jian Xu b,⁎⁎a School of Stomatology, China Medical University, 117 Nanjing North Sreet, Shenyang, 110002, Chinab Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang, 110016, China

⁎ Corresponding author. Tel.: +86 24 22891420.⁎⁎ Corresponding author. Tel.: +86 24 23971950; fax:

E-mail addresses: aih0620@yahoo.com.cn (H. Ai), jia

0928-4931/$ – see front matter © 2013 Elsevier B.V. Allhttp://dx.doi.org/10.1016/j.msec.2013.01.033

a b s t r a c t

a r t i c l e i n f o

Article history:Received 23 November 2012Accepted 15 January 2013Available online 20 January 2013

Keywords:CytotoxicityBiocompatibilityOsteoblastMetallic glassZirconium

In comparison with titanium and its alloys, Zr61Ti2Cu25Al12 (ZT1) bulk metallic glass (BMG) manifests a goodcombination of high strength, high fracture toughness and lower Young's modulus. To examine its biocom-patibility required for potential use in dental implants, this BMG was used as a cell growth subtract forthree types of cell lines, L929 fibroblasts, human umbilical vein endothelial cells (HUVEC), andosteoblast-like MG63 cells. For a comparison, these cell lines were in parallel cultured and grown also oncommercially pure titanium (CP-Ti) and Ti6–Al4–V alloy (Ti64). Cellular responses on the three metals, in-cluding adhesion, morphology and viability, were characterized using the SEM visualization and CCK-8assay. Furthermore, real-time RT-PCR was used to measure the activity of integrin β, alkaline phosphatase(ALP) and type I collagen (COL I) in adherent MG63 cells. As indicated, in all cases of three cell lines, no sig-nificant differences in the initial attachment and viability/proliferation were found between ZT1, CP-Ti, andTi64 until 5 d of incubation period. It means that the biocompatibility in cellular response for ZT1 BMG iscomparable to Ti and its alloys. For gene expression of integrin β, ALP and COL I, mRNA level from osteoblastcells grown on ZT1 substrates is significantly higher than that on the CP-Ti and Ti64. It suggests that the ad-hesion and differentiation of osteoblasts grown on ZT1 are even superior to those on the CP-Ti and Ti64 alloy,then promoting bone formation. The good biocompatibility of ZT1 BMG is associated with the formation ofzirconium oxide layer on the surface and good corrosion-resistance in physiological environment.

© 2013 Elsevier B.V. All rights reserved.

1. Introduction

Chemically similar to titanium, zirconium as an endosseous im-plant exhibits good biocompatibility, as indicated by both in vitro[1,2] and in vivo assessments [3]. Even if considering the inevitabilityof metal ions release during biocorrosion, toxicity of Zr ions is ac-knowledged to be minimal due to the lack of combination with bio-molecules [4]. However, in the absence of prominent advantages inmechanical properties and corrosion resistance, whether the Zr andits alloys are adequate as biomedical implants remains inconclusive[5]. In contrast to the conventional crystalline metals, metallic glasses(or amorphous alloys) manifest substantially uniformmicrostructure,without defects such as dislocation and grain boundary. Periodicatomic ordering arrangement in metallic glass only occurs in short-range rather than in long-range like crystalline solids. Consequently,glassy/amorphous alloys exhibit many unique properties, such ashigh yield strength, large elastic strain (~2%) and excellent corrosionresistance. In the light of these attractive features, a considerable at-tention is paid to the potential of Zr-based bulk metallic glasses

+86 24 23971215.nxu@imr.ac.cn (J. Xu).

rights reserved.

(BMGs) as biomedical implants [6–9]. Recently, a new Zr-based BMG,Zr61Ti2Cu25Al12 (designated as ZT1 hereafter), was developed [10,11].In comparison with the previously-developed BMGs, this alloy is notonly chemically free from the toxic elements such as nickel, cobaltand beryllium, but also has unique mechanical properties such aslow Young's modulus (E=83 GPa) and high fracture toughness(KJIC=130 MPa√m). In this sense, it is of interest if such an “amorphousZr” can be a candidate material for the endosseous implants orhard-tissue prostheses.

Currently, titanium and its alloys, commercially pure Ti (CP-Ti)and Ti–6Al–4V (Ti64) as the representative, have been widely usedin clinic, including usage of bone plates, screws, and pins for oraland maxillofacial reconstruction as well as dental root implants[12–14]. However, significant mismatch in Young's modulus of Ti(E=110 GPa) with that of the bone (10–30 GPa) yields a “stressshielding effect” [15,16]. This has been identified as a major reasonfor implant failure [17]. From the materials perspective, for most crys-talline metals, reduction of the modulus is usually accompanied by asacrifice in strength. As noticed, Young's modulus of the ZT1 BMG isabout 20% lower than that of Ti and its alloys, more proximal to thatof the bone, together with a large elastic strain limit. It is expectedto reduce the stress shielding effect, then to prevent osteolysis underloading service.

2114 J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121

As well documented [18], the biocompatibility of a material isstraightforward related to cell response on contact with the implantsurface. Cell adhesion, spreading and proliferation on the implant sur-face are essential events for differentiation of bone cells before bone tis-sue formation.

In the present work, biocompatibility of the ZT1 BMG wasassessed by in vitro cytotoxicity testing. To this end, three represen-tative cell lines are selected, including the mouse fibroblasts L929[19,20], human umbilical vein endothelial cells (HUVEC) [21,22],and osteoblast-like MG63 cells [23–27]. These differentiated celllines are widely used for in vitro biocompatibility evaluation of mate-rials. In addition, gene expressions of three differentiation proteins/markers from MG63, integrin β, alkaline phosphate (ALP) andtype I collagen (COL I) were investigated to evaluate cell differentia-tion. For purpose of comparison, CP-Ti and Ti64 are investigated inparallel as their cytocompatibility has been well understood anddue to their maturated clinical application as typical dental implantmaterials.

2. Materials and methods

2.1. Materials fabrication

To fabricate the Zr61Ti2Cu25Al12 BMG samples, master alloy ingotswith the nominal composition of Zr61Ti2Cu25Al12 (in atomic percent-age, or Zr–25Cu–12Al–2Ti in weight percentage) were prepared byarc melting. Elemental pieces with purity higher than 99.9% wereused as starting materials. The ingot was re-melted, and then castinto a copper mold to form cylindrical rods of 6 mm in diameterand about 60 mm in length. Amorphous feature of as-cast rod sam-ples was characterized by using X-ray diffraction (XRD). The thermal,elastic and mechanical properties of this BMG were presented else-where [10,11].

As-cast BMG rods were cut into disk of about 2-mm thickness. Forthe CP-Ti and Ti64 alloy (medical grade), disk samples of 6 mm in di-ameter and about 2 mm in thickness were taken from the as-receivedplates by electro-erosion cutting. The disk samples were wet-groundusing silicon carbide abrasive paper until 1200 grit, then finallypolished to a mirror finish with diamond paste. The samples werecleaned in an ultrasonic bath sequentially using acetone, ethanol,and double distilled water for 10 min in each solution.

2.2. Surface roughness characterization and XPS analysis

The surface arithmetic average roughness parameter Sa (μm) withan area of 65 μm×65 μm for the ZT1 disks was measured using a 3DMeasuring Laser Microscope LEXT OLS4000 (Olympus, USA). Sa is thearithmetic average of 3D roughness. It was determined by taking themean value of three individual measures for each disk.

Chemical composition of the ZT1 disk surfaces was analyzed usingan ESCALAB250 X-ray photoelectron spectrometer (XPS, Thermo VG,USA). The disks were examined under two conditions, as-polishedand cell-cultured for 14 days. Measurements were performed with amonochromated X-ray source of Al Kα. Binding energies were calibrat-ed using carbon contamination with a C 1s peak value of 284.6 eV.Depth profiles of sample surface were established by in situ XPS ionbeam sputtering with argon. The XPS spectra were analyzed usingXPSPEAK surface chemical analyses software.

2.3. Cell cultures

The HUVEC (American Type Culture Collection, Manassas, VA,USA:CRL-1730) and MG63 cells (ATCC, CRL-1427) were cultured inhigh-glucose Dulbecco's modified Eagle's medium (DMEM) (GibcoBRL Life Technologies, Grand Island, NY, USA) supplemented with 10%fetal bovine serum(TBD, Tianjin, China) and 1% penicillin/streptomycin.

For the L929 fibroblast, a RPMI 1640(Gibco BRL) supplemented with10% FBS (TBD, Tianjin, China) was used as culture medium. All cultureswere performed under a humidified 5% CO2 air atmosphere at 37 °C.The medium was changed every 2–3 days. Primary cultures weresubcultured with trypsin-EDTA solution (0.05% trypsin, 0.25% EDTA)after reaching 70%–80% confluence. For subculture, metallic diskswere sterilized with exposure to UV radiation for 1 h on both sides be-fore using them as cellular growth support.

2.4. Cell morphology observation

After incubation for 2, 4, and 6 h, non-adherent cells were removedby rinsing in phosphate buffer solution (PBS). The cells attached on thesurface of disks were then fixed with 4% formaldehyde. The sampleswith fixed cell were washed with distilled water, and dehydratedusing a gradation series of ethanol/distilled water mixtures. With criti-cal point drying and gold coating, morphology of cells on the disks wasobserved using a scanning electron microscopy (SEM; LEO Supra 35,Heidenheim, Germany).

2.5. Cell viability

Cell viability was measured by Cell Counting Kit-8 (CCK-8,Dojindo, Kumamoto, Japan) assay, resulting in the cellular conversionof the tetrazolium salt into a soluble formazan dye. The cells were cul-tured on three investigated materials in 96-well plates (Costar, USA)at a density of 20,000 cells cm−2. The plastic is used as control. Afterculturing for 4 h, 1 d, 2 d, 3 d, and 5 d, specimens with seeded cellswere rinsed three times with sterile PBS, and transferred to fresh96-well plates. Subsequently, culture medium with 10% CCK-8 wasintroduced to the samples in a separate volume of 0.7 ml. Then,cells were incubated for 1 h according to the instructions. Finally, col-orimetric measurement of the formazan dye was performed on aspectrophotometer (NANO 2000, Thermo, USA) with an optical den-sity reading at 450 nm. Five parallel replicates were performed.

2.6. Real time RT-PCR

Gene expression of integrin β (cultured for 4 h and 1 d) and ALP(cultured for 4, 7 and 14 d), and COL I (cultured for 4, 7 and 14 d)was determined through a real-time TaqMan RT-PCR (ExicyclerTM 96,BIONEER, South Korean) assay. GADPH (Glyceraldehyde-3-phosphatedehydrogenase) was used as a housekeeping gene.

TheMG63 cells were cultured on threematerials in 96-well plates ata density of 20,000 cells cm−2, with the cells directly cultured on plas-tic (polystyrene) as control. After incubation for 4 h, 1 d, 4 d, 7 d and14 d, themediumwas aspirated, and the specimenswere gently rinsedwith PBS three times. The viable cells were harvested using 0.25%trypsin-EDTA. The following protocol was applied: (1) mRNA extrac-tion, a total RNA extraction kit (TianGen Biotech, Beijing, China) wasused; (2) spectrophotometric quantification of RNA was achieved bymeasuring the absorbance with a spectrophotometer (NANO 2000,Thermo, USA); (3) reverse transcription (RT), with a TIANScript RT Kit(TIANScript cDNA first strand synthesis kit, TianGen Biotech, Beijing,China); (4) polymerase chain reaction (PCR), the resulting cDNA isthen amplified using the SYBR greenmethod (TianGen Biotech, Beijing,China). The above steps were operated strictly in accordance with themanufacturer's instructions. Primer (Sangon, Shanghai, China) se-quences are listed in Table 1.

2.7. Statistical analysis

All testing were repeated at least three times. Data are expressed asmeans±standard deviation (SDs). Statistical analysis was performedusing a software named as Statistical Package for the Social Sciences(SPSS) version 14.0 (SPSS Inc. Chicago, IL, USA). Statistical comparisons

2115J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121

were made by one-way ANOVA analysis for independent samples. Inall statistical evaluations, pb0.05 is considered to be statisticallysignificant.

Fig. 1. Surface topographies observed with laser-scanning confocal microscope forZr61Ti2Cu25Al12 BMG disks. (a) as-polished and (b) after culture for 14 d withMG63 cells.

3. Results

3.1. Surface characterization of ZT1 BMG

Fig. 1 (a) and (b) shows surface topographies observed under op-tical microscope for the ZT1 BMG disks of the as-polished and cul-tured with MG63 for 14 d, respectively. For the as-polished ZT1disk, its surface roughness characterized by the Sa is determined tobe 0.014±0.005 μm, while the Sa for the disk cultured with MG63for 14 d increases to 0.026±0.004 μm. Subjected to cell cultivation,subtle increase in the surface roughness of the sample is probablycaused by corrosion exposed in the cell culture medium.

Fig. 2 shows XPS surveys of sample surfaces of the ZT1 BMG disks,in the cases of the as-polished and cultured with MG63 for 14 d. Forthe as-polished sample, primary peaks for the outermost surface areidentified as the Zr 3d, Al 2s, Cu 2p, Ti 2p, O 1s and C 1s, as seen inFig. 2. The detected C 1s peak in the spectrum results from the carbonas contaminant. Fig. 3 (a)–(d) display the XPS spectra in the two casesfor the Zr 3d, Al 2s, Cu 2p and Ti 2p. As indicated, in contrast to thesample without cell culture, composition in the surface for the cul-tured sample is depleted in Al, Cu and Ti, besides the remaining Zr3d XPS peaks, as seen in Fig. 3 (a).

To determine the thickness of the passive film on the surface, thesamples were cleaned by Ar-sputtering at several depths for XPSanalysis. As the representative, Fig. 4 (a)–(d) displays the XPS spectraof the as-polished and cultured ZT1 disk after cleaning at a depth ofabout 2 nm. As indicated, the peaks of Zr 3d, Al 2s, Cu 2p, and Ti 2pare detected in the XPS spectra [28], when removing the “native”oxide layer away. By deconvoluting the spectra for each element atdifferent sputtering depths, the states and distribution of alloyingcomponents at the surface layer are revealed. Depth profiles of the el-ements in the alloys for ZT1 before and after cell culturing arepresented in Fig. 5 (a) and (b), respectively. The area under thecurve in the figure represents the concentration for each species. Asan approximation, the thickness of oxide films is estimated with adepth at the half of the oxygen concentration. Then, the thickness offilm increases from 4 nm to 9 nm after cell culturing, as indicatedby the dash lines in Fig. 5 (a) and (b). With increasing the sputteringdepth, concentrations of components at metallic state gradually in-creases until the nominal concentrations are reached. For theas-polished samples, the outermost surface is composed of metallicZr0, Zr4+, metallic Cu0, Al3+ and Ti4+, as seen in Fig. 5 (a). Subjectedto cell culture, the ZrO2 phase becomes predominant on the surface,indicating that the Zr is preferentially oxidized, to form the surfacefilm, as shown in Fig. 5 (b). In addition, Cu dissolved in the oxidelayer is detectable as well.

Table 1Primer sequences used in gene expression analysis with real-time PCR.

Name Sequence(5′¬3′) Length Tm Size

Integrinβ F TGAAGGGCGTGTTGGTAGAC 20 54.17 121Integrinβ R GCCGCACTCTCCATTGTTACT 21 54.86 121Collagen type I F AAACATCGGATTTGGGGAACG 21 61.5 120Collagen type I R CACATCAAGACAAGAACGAGGTAG 24 58.6 120ALP F CCGTGGAACATTCTGGATCTG 21 60.1 193ALP R CTGGTGGTCTTGGAGTGAGT 20 54.1 193GAPDH F GAAGGTCGGAGTCAACGGAT 20 58.7 224GAPDH R CCTGGAAGATGGTGATGGGAT 21 60.8 224 Fig. 2. Typical XPS surveys of the outermost surface for Zr61Ti2Cu25Al12 BMG disk be-

fore and after culture for 14 d with MG63 cell.

Fig. 3. XPS spectra of the outermost surface for Zr61Ti2Cu25Al12 BMG disk before and after culture for 14 d with MG63 cells. (a) Zr 3d, (b) Al 2s, (c) Cu 2p, and (d) Ti 2p.

Fig. 4. XPS spectra at Ar-sputtering cleaned depth of about 2 nm for Zr61Ti2Cu25Al12 BMG disk before and after culture for 14 d with MG63 cells. (a) Zr 3d, (b) Al 2s, (c) Cu 2p, and(d) Ti 2p.

2116 J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121

Fig. 5. Schematic illustration of states and distribution of component elements at sur-face layer of Zr61Ti2Cu25Al12 BMG disk as a function of sputtering depth. (a) as-polishedand (b) after culture for 14 d with MG63 cells.

Fig. 6. SEMmicrographs of MG63 cell morphology after culture for 6 h on (a) Zr61Ti2Cu25Al(c), respectively.

2117J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121

3.2. Cell morphology in SEM observation

Fig. 6 (a)–(c) illustrates SEM images of the MG63 cells attached onthree investigated metal substrates after seeding for 6 h. Correspond-ing high-magnification images in each case are presented in Fig. 6(d)–(f). As seen in Fig. 6 (a), the cells adhere to the ZT1 metallicglass exhibit typical polygonal morphology covered about 60%–80%of the growth area. In a high-magnification observation as shown inFig. 6 (d), the cell spreading is quite extensive, displaying numerouspseudopodia with distinct terminal protein spots. It is indicative ofgood adhesion on the substrate. Moreover, overlapping of adjacentcells is visible as well, indicating the healthy growth. In contrast, themorphology of the cells grown on the CP-Ti and Ti64 substrates issimilar to the case of ZT1 BMG, as well as to the findings in previouswork for the identical materials [24,29]. It implies that, at least atthe adhesion stage, no significant difference between amorphous Zrand crystalline Ti-based metals was found for the cellular response.

Furthermore, Fig. 7 (a)–(c) and (d)–(f) shows the high-magnificationSEMmicrographs of morphologies of the L929 and HUVEC cell culturedfor 2 h on the ZT1 BMG and the CP-Ti and Ti64, respectively. L929 cellscultured on three different materials present spindle-shaped morphol-ogy, whereas HUVEC cells show cobble-stone shape. Both of them dis-play well-spreading and good adhesion on the three sorts ofsubstrates, with their characteristic shapes and numerous filopodiasand lamellipodias. Thus, in terms of morphologies of three cell lines, itis suggested that the ZT1 BMGmanifests good adhesion ability compa-rable to the Ti metals.

3.3. Cell viability and proliferation

Fig. 8 displays dependency of cell viability characterized by opticaldensity (OD) value on incubation periods for three cell lines. In allcases, the counted number of viable cells gradually increases withextending the incubation time. As seen in Fig. 8 (a), for the L929 cellafter 4 h of incubation, OD value of ZT1 BMG is significantly higherthan that of the CP-Ti and Ti64. At 1 d, OD value for the differentgrowth surfaces is nearly identical. However, OD value at 2, 3, and5 d for ZT1 BMG is slightly higher than that of the CP-Ti and Ti64,but no difference exists between CP-Ti and Ti64. In the case of

12, (b) CP-Ti and (c) Ti64. (d), (e) and (f) are high-magnification images of (a), (b) and

Fig. 7. SEM micrographs of L929 and HUVEC cell morphology after culture for 2 h of on (a) and (d) Zr61Ti2Cu25Al12 BMG, (b) and (e) CP-Ti, (c) and (f) Ti64, respectively.

2118 J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121

HUVEC cells, there is no difference between the OD values of threemetals, incubated from 4 h to 2 d, as shown in Fig. 8 (b). At 3 d, theOD value of cell growth on the Ti64 is significantly higher thanthose on the CP-Ti and ZT1, but no difference between the lattertwo groups. Nevertheless, the OD values of all materials go back tosimilar level at 5 d. For the MG63 cell, OD values of cell growth onZT1 BMG incubated up to 2 d are significantly higher than those onthe CP-Ti and Ti64. The OD values of all materials are similar at 3 d,whereas the OD value at 5 d for the ZT1 is significantly higher thanthat for two Ti metals, but no difference between the latter twogroups, as shown in Fig. 8 (c). Consequently, we can conclude that, in-dependent of the cell lines, the viability and proliferation of cell cul-tured on the ZT1 are completely comparable to those on the CP-Tiand Ti64.

In addition, it is noteworthy that, after seeding, proliferationtrends for three cell lines are substantially the same, with a unidirec-tional feature. They rapidly attach to the surfaces, and then the num-ber of viable cells increases gradually, as seen at 2 d. Doubling the cellnumber happens at 5 d, when the disk surfaces are fully covered byproliferous cells, accompanied by cell confluence and a maximum ofOD values. As indicated, no detectable difference between threemetals and polystyrene as a control is present. It means that thesemetals have no deleterious effects on cell proliferation. Moreover, itis interesting to note that the cell proliferation rate exhibits the de-pendency of cell lines. Among the three cell lines, HUVEC is thefastest, while the MG63 is slowest, and the L929 is between them.In fact, it is noticed by Trentani et al. that, when grown either onTiMoZrFe alloy or on plastic control, proliferation capacity of osteo-blasts is slower than that of human dermal fibroblasts [30].

3.4. Gene expression for osteoblastic differentiation of MG63

Fig. 9 (a)–(c) illustrates gene expression of three differentiationproteins of MG63, integrin β, ALP and COL I, which are relative changeevaluated by real-time RT-PCR with respect to the plastic. The mRNAlevels of target genes are expressed as a normalized value with con-trol material (polystyrene). Comparative mRNA levels were analyzedstatistically by using one-way ANOVA (SPSS version 14.0). Differ-ences were admitted when statistical significance appears at pb0.05.

As shown in Fig. 9 (a), mRNA level of integrin β at 4 h, as an earlyadhesive protein, is more active with respect to the level at 1 d. In ad-dition, mRNA level of integrin β for the cells adherent on the ZT1 at

4 h is significantly higher than those on the CP-Ti and Ti64, even onthe plastic. It is noteworthy that higher level of integrin β mRNA isconsistent with the morphology of well-spreading phenotype ofMG63 on ZT1, as seen in Fig. 6 (a) and (d), since the formation ofintegrin receptor plays an essential role in cell spreading and adhe-sion. Nevertheless, at 1 d, mRNA level of integrin β from the ZT1BMG is comparable to that from CP-Ti, but superior to that fromTi64 alloy, as seen in Fig. 9 (a).

For the ALP level, no significant difference between cells adherentof three investigated metals is present at 4 d, as shown in Fig. 9 (b).However, at the 7 d and 14 d, mRNA level of ALP from the ZT1 BMGis much higher than those from the CP-Ti and Ti64. Furthermore,mRNA level of COL I for the cells grown on ZT1 is significantly higherthan those on the CP-Ti and Ti64 as well, which happens at all of threetime points, as seen in Fig. 9 (c).

4. Discussion

As the in vitro assessment, cellular response has been a powerfultool as preliminary assays to evaluate biocompatibility of a materialthat is potentially used as implant. In the current work, three cell phe-notypes were selected to examine their interactionwith our ZT1 BMG.It is desirable to provide more understandings for the response fromrelevant tissues as dental implants, and to address possible differencein cellular responses to materials [31]. Among them, fibroblasts allowus to examine the basal cytocompatibility of a biomaterial, which re-lates to the common cellular functions. Moreover, this phenotype issensitive to the metal ions, as well as with high metabolic activity[31]. MG63 cells, originally isolated from a human sarcoma [32],have beenwidely used for immuno- and biochemical studies of cell re-sponse to metallic implant surfaces, as initially recommended byKrikpatrick and Mittermayer [33]. They share several similaritieswith isolated human bone-derived cells [34]. Endothelial cells, herewe used HUVEC, are important in inflammation response by secretingcytokines, expressing surface adhesion molecules for attraction andattachment of leucocytes [21]. As shown in Figs. 6 and 7, in terms ofmorphology at the cell adhesion stage, no significant differences be-tween the grown-onmetal subtractswere found, which is irrespectiveof whatever cell lines were used. For the cell proliferation rates, asshown in Fig. 8, at the incubation time of 5 d, the rate for MG63 cellsgrown on ZT1 is higher than on CP-Ti and Ti64, whereas no differenceis presented in L929 and HUVEC between ZT1 and two Ti materials.

Fig. 8. Cell viability/proliferation measured with CCK-8 assay of cells cultured onZr61Ti2Cu25Al12 BMG, CP-Ti and Ti64 after 4 h, 1 d, 2 d, 3 d, and 5 d, with a controlcultured on plastic. (a) L929, (b) HUVEC and (c) MG63.

Fig. 9. Quantitative analysis of Real-time PCR for MG63 cells cultured on Zr61Ti2Cu25Al12BMG, CP-Ti, and Ti64 as well as plastic as a control at several incubation periods. Relativeamounts of (a) integrin β, (b) ALP, and (c) COL I (*pb0.05).

2119J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121

Furthermore, as well documented, integrin is the most importanttransmembrane receptor in cell binding process [35–37], which con-tains two different subunits: α and β. Osteoblast interacts with thesubstrate through integrin receptor. The integrin forms the linkagebetween the extracellular matrix and the interior of the cell. In thepresent work, as shown in Fig. 8 (a), higher activity of integrin β is ob-served for the culture on ZT1 with respect to the CP-Ti and Ti64. It re-flects that the ZT1 BMG is muchmore amenable for cell attachment incontrast to the Ti metals.

ALP activity is an indicator of early osteogenic differentiation, boneformation andmatrixmineralization [38,39]. COL I is themost abundantprotein present in different connective tissues especially in skin andbone [40]. It not only plays a pivotal role of collagen in modulatingcell growth and differentiation [41], but also serves as a basis for themineral scaffold [42]. As indicated in Section 3.4, activity of the ALPand COL I mRNA for MG63 cells grown on ZT1 BMG is significantly

higher than those on both CP-Ti and Ti64. It suggests that in the senseof osseointegration, ZT1 BMG is quite promising. Further investigationusing animal models to examine the bone-growth scenarios aroundthe ZT1 prototype implant is on-going work.

As well-known, good bioactivity of titanium and its alloys is ingreat part attributed to the formation of a passive oxide film on themetallic surface [43–45]. For the Ti64 alloy, the oxide layer that spon-taneously forms upon air exposure was predominantly TiO2, and itsthickness varied from 2 nm to 4 nm [45]. The CP-Ti has an oxidethickness of 2–6 nm before implantation, whereas films on implantsretrieved from human tissues are two- to three-times thicker [46].Though the cytotoxicity investigation of an alloy with high contentof toxic element vanadium (Ti1.5Al25V), Eisenbarth et al. [47] foundthat the cell reaction is influenced only by thin titanium oxide surface

2120 J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121

layer and not by the composition of the bulk material. The thick(~100 nm) and stable oxide layer on the Ti alloy is able to shieldthe cell from toxic elements.

In the alloy we investigated, amorphous Zr61Ti2Cu25Al12, elementsCu and Al are necessary to maintain robust glass-forming ability forfabricating the bulk material [10]. However, it is well recognizedthat the Cu ions are toxic [48–50]. Using MG-63 osteoblast, Hallabet al. [49] indicate that the concentrations required to decrease viabil-ity by 50% (LC50) for Cu ions are approximately in a range of 0.05–0.3 mM, while the Al ions are moderately toxic, with a concentrationrange of 0.3–4.0 mM for LC50. Sun et al. [51] found little cytotoxicityof Al in ROS 17/2.8 osteoblast-like cells. The Al significantlysuppressed ALP gene expression, but did not alter ALP activity inROS cells. In addition, as indicated by Hallab et al. [52], the responseof peri-implant cells such as osteoblasts, fibroblasts andlymophocytes to metal challenge is primarily determined by compo-sition and concentration, not by cell type. On the other hand, it hasbeen well recognized that corrosion-resistance of metallic materialsin a physiological environment is a key issue for its biocompatibility,which determine the amount of undesired metal ions/corrosion prod-ucts released.

In the current work, we found that the oxide layer predominantlycomposed of zirconium oxide spontaneously forms on the surface ofZr61Ti2Cu25Al12 BMG, when it is exposed to air, together with Al0,Al2O3 and Ti0, TiO2 as trace components, as indicated in Section 3.1. Dur-ing the cell culture, only subtle corrosion happened in the BMG surface,without visible surface pitting, but accompanied by an increased thick-ness of oxide layer up to ~9 nm. Thismeans that the amount of cytotox-ic species, such as Cu and Al ions, released from the alloy surfaceremains quite tolerable for cell healthy survival. As a matter of fact, Zroxide (zirconia) possesses good biocompatibility and osseoconductivityand has been used in total hip replacement and dental implantology[53–55]. Consequently, although “toxic” elements such as Cu and Alare present in our ZT1 BMG, stable oxide layer on its surface and goodcorrosion resistance in physiological environment plays a role to shieldthe release of toxicmetal ions,whichprovides its good biocompatibility,like TiO2 layer in the case of Ti and its alloys. Moreover, as indicated byelectrochemical evaluation [56–58], Zr-based BMGs manifest good cor-rosion resistance under simulated physiological condition, besideslower pitting corrosion resistance in contrast to the Ti and Ti64.

Furthermore, cytotoxicity through in vitro assessments for Zr-basedBMGs with different chemical compositions was examined in severalstudies [6,9,58–61]. For a purpose of comparison, cell lines, speciesand phenotypes used in these studies as well as the investigated alloys

Table 2Cell lines, species, and phenotypes currently used for cytotoxicity study of variousZr-based bulk metallic glasses.

Subtract alloy Cell line Species Phenotype Res.

Zr58Cu22Fe8Al12 (Bio 1)Zr58.5Cu15.6Ni12.8Al10.3Nb2.8(Vit106a)

3T3 Mouse Fibroblast [6]

Zr55Cu30Ni5Al10(Zr0.55Cu0.30Ni0.05Al0.10)99Y1

MC-3T3-E1 Mouse Pre-osteoblast [9]

Zr60Nb5Cu22.5Pd5Al7.5Zr60Nb5Cu20Fe5Al10

NIH3T3 Mouse Fibroblast [58]

Zr62Cu15.5Ni12.5Al10 MC-3T3-E1 Mouse Pre-osteoblast [59]Zr57Cu15.4Ni12.6Al10Nb5(LM106)Zr41Ti14Cu12Ni10Be23 (LM1)Zr44Ti11Cu10Ni10Be25(LM1b)

L929NIH3T3

MouseMouse

FibroblastFibroblast

[60]

Zr50Cu43Al7 hMSC Human Mesenchymalstem

[61]

Zr61Ti2Cu25Al12 (ZT1) L929HUVEC

MouseHuman

FibroblastUmbilical veinendothelial

Thiswork

MG63 Human Osteoblast-like

are summarized in Table 2. For the Zr58Cu22Fe8Al12 BMG, Buzzi et al. [6]found that a natural layer of zirconium oxide layer forms on the surface,with a thickness of 7–8 nm, and small amount of Cu is included in theoxide layer, or lies on the surface. Good cell growth for MC3T3 cells isobserved. No difference in the cytotoxic properties is present betweenFe-containing Bio 1 and Ni-containing Vit BMGs. He et al. [59] indicatedthat in comparisonwith Ti alloy, the favorable attachment of osteoblastson the Zr-base BMG surface, which is attributed to that the BMG surfaceis relatively more hydrophobic than the surface of Ti alloy. They foundthat the Zr-based BMG provides a favorable substrate for osteoblastdifferentiation and matrix production, which is reflected by a higherALP level of the cells on the Zr BMG surfaces with respect to that onthe Ti alloy surface. It is in agreement with the findings in the presentwork, as seen in Fig. 9 (b). Using cell lines of L929 and NIH 3T3, Wanget al. [60] presented that the extracts from the LM106, LM1 and LM1bZr-based BMGs had no cytotoxicity. Nevertheless, Cu ion release associ-ated with pitting corrosion gives rise to a decrease proliferation rate ofLM106 and LM1 in comparison with the LM1b. Recently, Huang et al.[61] showed that ternary Zr50Cu43Al7 BMGwas nontoxic in terms of cy-totoxicity assessment with human mesenchymal stem cells (hMSC).Compared with Ti metal, Zr50Cu43Al7 BMG had a high level of proteinadsorption and better cell adhesion and cell migration. In addition, itwas observed that the total ion release from the BMG sample after1 day of immersion in cell culture medium was below 100 ppb, whichis comparable to that from the Ti sample.

In general, in the light of cytotoxicity assessment, it is suggested thatbiocompatibility of Zr-based BMGs, nomatterwhat alloy composition isselected, is tolerable, even comparable to the Ti metals, due to the for-mation of Zr oxide layer on the surface. To minimize the amount ofmetal ion release, enhancing the pitting-corrosion resistance in physio-logical environment by the alloy design or surfacemodification remainsa vital issue. Further investigations on the hemocompatibility andgenotoxicity, and osseointegration by in vivo animal testing are neces-sary to understand the biocompatibility of Zr-based BMGs from multi-ple perspectives.

5. Conclusions

In terms of cellular responses for three cell phenotypes, L929,HUVEC and MG63, the phenomenological behavior of cells such as at-tachment, adhesion, spreading and proliferation for the Zr61Ti2Cu25Al12(ZT1) metallic glass is substantially comparable to the CP-Ti and Ti64alloy. As indicated by osteoblast gene expression of integrin β, alkalinephosphate and type I collagen, mRNA level for the cells grown on ZT1substrates is much higher than those on the CP-Ti and Ti64 alloy. It sug-gests that the adhesion and differentiation of osteoblasts grown on ZT1are even superior to those on the CP-Ti and Ti64 alloy, therefore pro-moting bone formation. The good biocompatibility of ZT1 BMG is attrib-uted to the formation of zirconium oxide layer on the surface and goodcorrosion-resistance in physiological environment. Further investiga-tions on the hemocompatibility and genotoxicity, and osseointegrationby in vivo animal testing are currently in progress.

Acknowledgment

The authors gratefully acknowledge the stimulating discussionswith Prof. H.H. Huang. Thisworkwas supported at SYNL by theNationalNatural Science Foundation of China under Grant Nos. 51171180 andNo. 51001099.

References

[1] E. Eisenbarth, D. Velten, M. Muller, et al., Biomaterials 25 (2004) 5705–5713.[2] L. Saldaña, A. Méndez-Vilas, L. Jiang, et al., Biomaterials 28 (2007) 4343–4354.[3] P. Thomsen, C. Larsson, L.E. Ericson, et al., J. Mater. Sci. Mater. Med. 8 (1997)

653–665.[4] T. Hanawa, Mater. Sci. Eng. C 24 (2004) 745–752.

2121J. Li et al. / Materials Science and Engineering C 33 (2013) 2113–2121

[5] J.A. Helsen, Y. Missirlis, Biological and Medical Physics, Biomedical Engineering,Biomaterials, 2010, p. 99.

[6] S. Buzzi, K.F. Jin, P.J. Uggowitzer, et al., Intermetallics 14 (2006) 729–734.[7] J. Schroers, G. Kumar, T.M. Hodges, et al., JOM 61 (2009) 21–29.[8] M.D. Demetriou, A. Wiest, D.C. Hofmann, et al., JOM 62 (2010) 83–91.[9] L. Huang, Z. Cao, H.M. Meyer, et al., Acta Biomater. 7 (2011) 395–405.

[10] Q. He, Y.Q. Cheng, E. Ma, J. Xu, Acta Mater. 59 (2011) 202–215.[11] Q. He, J.K. Shang, E. Ma, J. Xu, Acta Mater. 60 (2012) 4940–4949.[12] K. Yokoyama, T. Ichikawa, H. Murakami, et al., Biomaterials 23 (2002) 2459–2465.[13] L.S. Morais, G.G. Serra, C.A. Muller, et al., Acta Biomater. 3 (2007) 331–339.[14] M.G.Manda, P.P. Psyllaki, D.N. Tsipas, P.T. Koidis, J. Biomed.Mater. Res. B 89B (2009)

264–273.[15] D.R. Sumner, T.M. Turner, R. Igloria, R.M. Urban, J.O. Galante, J. Biomech. 31

(1998) 909–917.[16] B.V. Krishna, S. Bose, A. Bandyopadhyay, Acta Biomater. 3 (2007) 997–1006.[17] D.R. Sumner, J.O. Galante, Clin. Orthop. Relat. Res. 274 (1992) 202–212.[18] K. Anselme, Biomaterials 21 (2000) 667–681.[19] S. Rao, Y. Okazaki, T. Tateishi, T. Ushida, Y. Ito, Mater. Sci. Eng. C 4 (1997) 311–314.[20] M.C. Serrano, R. Pagani, M. Vallet-Regi, et al., Biomaterials 25 (2004) 5603–5611.[21] R. Tsarky, M. Kalbacova, U. Hempel, et al., Biomaterials 28 (2007) 806–813.[22] C. Treves, M. Martinesi, M. Stio, et al., J. Biomed. Mater. Res. A 92A (2010)

1623–1634.[23] O. Zinger, K. Anselme, A. Denzer, et al., Biomaterials 25 (2004) 2695–2711.[24] H.J. Kim, S.H. Kim, M.S. Kim, et al., J. Biomed. Mater. Res. A 74A (2005) 366–373.[25] L. Montanaro, C.R. Arciola, D. Campoccia, et al., Biomaterials 23 (2002) 3651–3659.[26] C. Fleury, A. Petit, F. Mwale, et al., Biomaterials 27 (2006) 3351–3360.[27] M. Amaral, A.G. Dias, P.S. Gomes, et al., J. Biomed. Mater. Res. A 87A (2008) 91–99.[28] I. Milosev, M.Metikos-Hukovic, H.H. Strehblow, Biomaterials 21 (2000) 2103–2113.[29] Barbara Nebe, L. Müller, F. Lüthen, et al., Acta Biomater. 4 (2008) 1985–1995.[30] L. Trentani, F. Pelillo, F.C. Paversi, et al., Biomaterials 23 (2002) 2863–2869.[31] J.C. Wataha, C.T. Hanks, Z. Sun, Dent. Mater. 10 (1994) 156–161.[32] A. Billiau, J.J. Cassiman, D. Willems, M. Verhelst, H. Heremans, Oncology 3 (1975)

257–272.[33] C.J. Krikpatrick, C. Mittermayer, J. Mater. Sci. Mater. Med. 1 (1990) 9–13.[34] J.M. Clover, M. Cowen, Bone 15 (1994) 585–591.

[35] R.K. Sinha, R.S. Tuan, Bone 18 (1996) 451–457.[36] M.C. Siebers, P.J. ter Brugge, X.F. Walboomers, J.A. Jansen, Biomaterials 26 (2005)

137–146.[37] E. Ruoslahti, M.D. Pierschbacher, Science 238 (1987) 491–497.[38] M. Laitinen, T. Halttunen, L. Jortikka, et al., Life Sci. 64 (1999) 847–858.[39] A. Piattelli, A. Scarano, M. Corigliano, M. Piattelli, Biomaterials 17 (1996)

1443–1449.[40] A.M. Ferreira, P. Gentile, V. Chiono, G. Ciarleli, Acta Biomater. 8 (2012) 3191–3200.[41] C. Roehlecke, M. Witt, M. Kasper, et al., Cells Tissues Organs 168 (2001) 178–187.[42] U. Geissler, U. Hempel, C. Wolf, et al., J. Biomed. Mater. Res. 51 (2000) 752–760.[43] M. Ask, Lausmaa, J.B. Kasemo, Appl. Surf. Sci. 35 (1988–89) 283–301.[44] S.J. Kerber, J. Vac. Sci. Technol. 13 (1995) 2619–2623.[45] I. Milošv, M. Metikoš-Huković, Strehblow, Biomaterials 21 (2000) 2103–2113.[46] D.A. Puleo, A. Nanci, Biomaterials 20 (1999) 2311–2321.[47] E. Eisenbarth, D. Velten, L. Schenk-Meuser, et al., Biomol. Eng. 19 (2002) 243–249.[48] J.C. Wataha, P.E. Lockwood, A. Schdle, J. Biomed. Mater. Res. 52 (2000) 360–364.[49] N.J. Hallab, C. Vermes, C. Messina, et al., J. Biomed. Mater. Res. 60 (2002) 420–433.[50] J.C. Hornz, A. Lefèvre, D. Joly, H.F. Hildebrand, Biomol. Eng. 19 (2002) 103–117.[51] Z.L. Sun, J.C. Wataha, C.T. Hanks, J. Biomed. Mater. Res. 34 (1997) 29–37.[52] N.J. Hallab, S. Anderson, M. Caicedo, et al., J. Biomed. Mater. Res. A 74A (2005)

124–140.[53] M. Hisbergues, S. Vendeville, P. Vendeville, J. Biomed. Mater. Res. B 88B (2009)

519–529.[54] Y. Josset, Z. Oum'Hamed, A. Zarrinpour, et al., J. Biomed. Mater. Res. 47 (1999)

481–493.[55] R. Depprich, H. Zipprich, M. Ommerborn, et al., Head Face Med. 4 (2008) 30.[56] S. Hiromoto, A.P. Tsai, M. Sumita, T. Hanawa, Mater. Trans. 42 (2001) 656–659.[57] M.L. Morrison, Buchanan, R.V. Leon, C.T. Liu, B.A. Green, P.K. Liaw, J.A. Horton, J.

Biomed. Mater. Res. 74A (2005) 430–438.[58] L. Liu, C.L. Qiu, Q. Chen, K.C. Chan, S.M. Zhang, J. Biomed. Mater. Res. A 86A (2008)

160–169.[59] W. He, A. Chuang, Z. Cao, P.K. Liaw, Metall. Mater. Trans. 41A (2010) 1726–1734.[60] Y.B. Wang, Y.F. Zheng, S.C. Wei, M. Li, J. Biomed. Mater. Res. B 96B (2010) 34–46.[61] H.H. Huang, Y.S. Sun, Y.S. Wu, C.P. Liu, P.K. Liaw, K. Wu, Intermetallics 30 (2012)

139–143.