Marine Methyl Halide Utilising Bacteria

i

Marine Methyl Halide-Utilising Bacteria

A thesis submitted by

Michael J Cox BSc (Hons)

to

The Department of Biological Sciences in

fulfilment of the requirements for the degree of

Doctor of Philosophy

July, 2005

University of Warwick

Coventry, UK

ii

Dedicated to the girl who sang the blues.

iii

Table of contents Title Page i Table of contents iii List of Figures iv List of Tables vi Abbreviations viii Acknowledgements xi Declaration xii Publications xiii Abstract xiv Chapter 1: Introduction 1 Chapter 2: Materials and Methods 35 Chapter 3: Measurement of Methyl Bromide 58 Chapter 4: Enrichment and Isolation of Methyl Bromide-Utilising Bacteria 83 Chapter 5: Methanol Dehydrogenase as a Functional Genetic Marker 100 Chapter 6: Diversity of cmuA in Marine Environments: Clone library and TRFLP analysis 119 Chapter 7: Leisingera methylohalidivorans strain MB2 and attempts to identify cmuA 144 Chapter 8: Synopsis, Discussion and Future Work 153 Bibliography 164 Appendices 181

iv

List of Figures Chapter 1 Figure 1.1 Global methyl bromide budget 5 Figure 1.2 Metabolism of C1 compounds by aerobic methylotrophic

bacteria 10

Figure 1.3 Pathway of CH3Cl degradation in Methylobacterium chloromethanicum CM4

14

Figure 1.4 Comparison of cmu gene clusters sequenced to date 22 Figure 1.5 Maximum likelihood tree of 16S rRNA sequences isolated

strains of CH3X utilisers 24

Figure 1.6 Location of sampling station L4 in the English Channel 31 Figure 1.7 Arabian Sea AMBITION cruise track 33 Chapter 3 Figure 3.1 Diagrammatic representation of the Electron Capture

Detector (ECD) 62

Figure 3.2 Purge apparatus for GC ECD ‘system two’ 64 Figure 3.3 Gas purifier system for the carrier, make-up, sparge and

Nafion counter flow gases of GC ‘system two’ 66

Figure 3.4 Diagram of GC ECD System two 68 Figure 3.5 L4 CH3Br measurements 73 Figure 3.6 Phytoplankton abundance and CH3Br concentration at L4 74 Figure 3.7 Pigment concentrations during the AMBITION cruise 78 Chapter 4 Figure 4.1 Chemical equation for complete oxidation of CH3Br 85 Figure 4.2 Oxidation of CH3Br by four enrichments 91 Chapter 5 Figure 5.1 a α subunit of methanol dehydrogenase with coordinated

PQQ and Ca2+ 102

Figure 5.1b β subunit of methanol dehydrogenase. 102 Figure 5.1c α2β2 structure of methanol dehydrogenase. 102 Figure 5.2 Alignments mxaF sequences used for PCR primer design 108 Figure 5.3 mxaF PCR of a range of environmental samples 112 Figure 5.4 Phylogenetic analysis of mxaF sequences of strains used in

PCR primer design 115

Chapter 6 Figure 6.1 Pathway of CH3Cl degradation in Methylobacterium

chloromethanicum CM4 (as figure 1.3) 120

Figure 6.2 Comparison of cmu gene clusters sequenced to date (as Figure 1.4)

122

Figure 6.3 Example EcoRI/DdeI RFLP digest of cmuA clones from enrichment L4.1

125

Figure 6.4 cmuAF802/cmuAR1609 PCR products from CH3Br enrichments

126

Figure 6.5 Phylogenetic analysis of all cmuA sequences; parsimony analysis and clade assignment

131

Figure 6.6 Phylogenetic analysis of selected cmuA sequences; maximum-likelihood analysis

132

Figure 6.7 BsiYI TRFLP pattern of clone PMLSW6 (AJ810829) 139 Chapter 7 Figure 7.1 Alignment of cmuA sequences with primer cmuAF802 146

v

Figure 7.2 Alignment of cmuA sequences with primer cmuAR1609 147 Figure 7.3 Alignment of cmuA sequences with primer cmuAR1244 147 Figure 7.4 3D-views of a four helix bundle corrinoid-binding domain

with bound cobalamine 148

Figure 7.5 Alignment of cmuA sequences with primer cmuAR1352 149 Figure 7.6 Autoradiograph of L. methylohalidivorans Southern

analysis 151

Figure 7.7 L. methylohalidivorans MB2 restriction digested DNA samples prior to Southern hybridisation analysis

151

Appendices Figure A.2 Physicochemical data from the Arabian Sea AMBITION

cruise 182

Figure A.3 Productivity data from the Arabian Sea AMBITION cruise 184 Figure A.4 Microorganism abundance data from the Arabian Sea

AMBITION cruise 186

Figure C.1 Excel spreadsheet for Henry’s Law calculations 199

vi

List of Tables Chapter 2 Table 2.1 Bacterial and algal strains used in this study 37 Table 2.2 Genomic DNA extracts used in this study 38 Table 2.3 Cruise enrichment carbon sources 45 Table 2.4 Selected media concentrations of CH3X in various culture

formats 46

Table 2.5 PCR Primers used in this study 52 Chapter 3 Table 3.1 Detection limits of a selection of common detectors used in

gas chromatography 61

Table 3.2 Marine phytoplankton demonstrated to produce CH3Br in laboratory cultures

76

Table 3.3 Linking pigment presence with classes of phytoplankton 77 Chapter 4 Table 4.1 Cruise enrichment carbon sources 86 Table 4.2 Turbidity estimation of Arabian Sea cruise enrichments 87 Table 4.3 Arabian Sea enrichments positive for CH3X utilisation 88 Table 4.4 Total CH3X consumed by enrichments 90 Table 4.5 Emiliania huxleyi culture axenicity 92 Table 4.6 Strains isolated from CH3Br enrichments of Arabian Sea

samples 95

Table 4.7 Amounts of substrate used in O2 electrode studies 96 Table 4.8 Substrate affinity and maximum oxidation rate of H.

chloromethanicum CM2 with CH3X 97

Chapter 5 Table 5.1 mxaF sequences used for PCR primer development 106 Table 5.2 mxaF PCR primers used in this study 107 Table 5.3 Expected product sizes for each of the combinations of

primer and results of the first trials 110

Table 5.4 Genomic DNA samples used for testing efficacy of primer pairs

113

Chapter 6 Table 6.1 OTUs from library 25, the cmuA clone library from

enrichment 249 126

Table 6.2 OTUs from library 27, the cmuA clone library from enrichment PE2

127

Table 6.3 OTUs from library 9, the cmuA clone library from enrichment PE2, amplified with primers cmuAF229/cmuAR1609

128

Table 6.4 Effective sample volumes for 1 µl volumes of SAP sample DNA extracts

129

Table 6.5 OTU assignment of cmuA sequences from SAP sample clone libraries

130

Table 6.6 TRF sizes of known cmuA sequences 137 Table 6.7 Absorption and emission maxima of fluorophores for

TRFLP analysis 139

Table 6.8 AMBITION samples analysed by cmuA PCR 140 Table 6.9 Celtic Sea samples 141

vii

Appendices Table A.1 Location of casts used for data analyses of the Arabian Sea

AMBITION cruise 181

Table B.1 List of Arabian Sea AMBTION cruise DNA samples 187 Table B.2 List of Arabian Sea AMBTION enrichments 191 Table D.1 Clade affiliation of cmuA TRFs based on in silico analysis

of database cmuA sequences 120

viii

Abbreviations

A adenine

AMO ammonia monooxygenase

ANMS ammonium nitrate mineral salts

ATP adenosine-5’-triphosphate

BAC bacterial artificial chromosome

bp base pair

BLAST basic local alignment search tool

BSA bovine serum albumin

C cytosine

CFC chlorofluorocarbon

CH3Br methyl bromide (bromomethane)

CH3Cl methyl chloride (chloromethane)

CH3I methyl iodide (iodomethane)

CH3X methyl halide (halomethane)

CODEHOP consensus-degenerate hybrid oligonucleotide primers

CoM coenzyme M

CTD conductivity, temperature and depth

Da Dalton

DMA dimethylamine

DMSO dimethyl sulfoxide

DMSP dimethyl sulfoniopropionate

DNA 3’-deoxyribonucleic acid

DGGE denaturing gradient gel electrophoresis

ECD electron capture detection

ix

EDTA ethylenediaminetetraacetic acid

FID flame ionisation detection

FISH fluorescence in situ hybridisation

G guanine

GC gas chromatography

H4F tetrahydrofolate

H4MPT tetrahyhdromethanopterin

ID identity

kb kilobase

kDa kiloDalton

LB Luria Bertani

MAMS marine ammonium mineral salts

MAMSTY marine ammonium mineral salts with tryptone and yeast

extract

MDH methanol dehydrogenase

MMA monomethylamine

mRNA messenger ribonucleic acid

NMS nitrate mineral salts

OD optical density

ORF open reading frame

OTU operational taxonomic unit

PAGE polyacrylamide gel electrophoresis

PCR polymerase chain reaction

pMMO particulate methane monooxygenase

ppmv parts per million by volume

x

pptv parts per trillion by volume

PQQ pyrrolo-quinoline quinone

RFLP restriction fragment length polymorphism

RNA ribonucleic acid

rRNA ribosomal ribonucleic acid

RuMP ribulose monophosphate

SDS sodium dodecyl sulfate

SIP stable isotope probing

sMMO soluble methane monooxygenase

T thymine

TBE Tris-borate EDTA

TE Tris-EDTA

TMA trimethylamine

Tris Tris-(hydroxymethyl)-aminoethane

TRFLP terminal restriction fragment length polymorphism

analysis

U uracil

uv ultraviolet

v/v volume to volume

w/v weight to volume

xi

Acknowledgements

My first thanks must go to my three supervisors, Prof. Colin Murrell, Dr. Ian McDonald and Dr. Phil Nightingale who were fantastic supervisors and an excellent team despite being geographically as far-flung as you can be. Thank you very much for your help, advice and patience. I have worked with a large number of people in Warwick, Plymouth and the middle of the Arabian Sea and I would like to thank everyone I have ever asked for advice, equipment or support, there was not a single occasion when any of these were refused without good reason. At Warwick special thanks must go to the methyl halide team, now sadly disbanded; Hendrik Schäfer, a fantastic friend and unofficially supervisor number four, Elena Borodina, my coordinated dancing partner, and Karen Warner, whose selectively embarrassing taste in music matched my own. Stefan Radajewski and Johannes Scholten were endless sources of knowledge on molecular biology and thermodynamics respectively that I hope I have learnt from. I would also like to thank Gez Chapman for all his help and Julie, Moh, Ju-Ling, Marc, Simon, Matt, Jo, Hanif, Andi, and everyone else in Micro I for making it a fantastic place to work . Thank you to Helen Bird, and the ladies of the Molecular Biology Service for help and advice, particularly with TRFLP. At PML the Biogas and Tracer Group were extremely welcoming and patient, if I can tell one end of a spanner from the other it’s down to you . Particular thanks to Malcolm Liddicoat for his help and advice, John Wood for egg custard tarts, and to Dr. Laura Goldson for laughing at my jokes. I would also like to thank Norman Reville and the crews of RVS Squilla, RVS Sepia and RVS Plymouth Quest for getting me to L4 and back in one piece, and for making the experience enjoyable. The AMBITION cruise was a baptism of fire at the very beginning of my PhD; I would like to thank the Captain and crew of RRS Charles Darwin and all the participants. I would especially like to thank Dr. Malcolm Woodward, Dr. Andy Rees, Dr. Glen Tarran and Denise Cummings who took me under their wing from the start, and Dr. Nick Fuller, Dr. Clare Bird and Dr. Karen Orcutt who made it all the more fun. I have never consumed so much gin and hope never to again. I would also like to thank my Mum, Dad and brother for many things, but in particular for taking me Wembury beach, letting me poke about in rock pools for hours, and for being interested in every unremarkable shell, stone or bit of seaweed I ever showed you. Who’d have thought someone would pay you to do it? Finally thank you to Karen who suffered at least as much as me whenever an experiment went wrong and had to endure every whinge. You are so much more patient than me and I love you very much.

xii

Declaration

The work present in this thesis is original work conducted by myself unless stated otherwise, under the supervision of Prof. Colin Murrell and Dr. Ian McDonald at the University of Warwick and Dr. Phil Nightingale at Plymouth Marine Laboratory. The measurements of methyl bromide at L4 in Chapter 3 were carried out by Malcolm Liddicoat, Plymouth Marine Laboratory. All sources of information have been acknowledged by reference. None of this work has been used in any previous application for a degree.

xiii

Publications Borodina, E., Cox, M. J., McDonald, I. R., and Murrell, J. C. (2005) Use of DNA-

stable isotope probing and functional gene probes to investigate the diversity of

methyl chloride-utilizing bacteria in soil. Environmental Microbiology. 7(9) 1318-

1328.

McDonald, I. R., Kampfer, P., Topp, E., Warner, K. L., Cox, M. J., Connell

Hancock, T. L., Miller, L. G., Larkin, M. J., Ducrocq, V., Coulter, C., Harper, D.

B., Murrell, J. C. & Oremland, R. S. (2005) Aminobacter ciceronei sp. nov. and

Aminobacter lissarensis sp. nov., isolated from various terrestrial environments.

International Journal of Systematic and Evolutionary Microbiology. 55(5) 1827-

1832.

xiv

Abstract

Methyl bromide is a potent ozone-depleting atmospheric trace gas with both natural and anthropogenic sources, and a complex natural cycle. The sources and sinks of methyl bromide are numerous and are currently unbalanced. The oceans are both a source and a sink of methyl bromide, but believed to be a net sink. Chemical degradation rates of methyl bromide in the oceans are too slow to account for the observed loss of this methyl halide and degradation is thought to be due to oxidation by marine bacteria. A number of bacteria have been isolated that are able to use methyl halides, including methyl bromide, as sole source of carbon and energy. The gene cmuA encodes a methyltransferase/corrinoid-binding protein that has been shown to catalyse the first step in a methyl chloride and methyl bromide utilisation pathway. Components of this pathway have been shown to be present in the majority of methyl halide-utilising bacteria that have been isolated and cmuA has been used as functional genetic marker of methyl halide utilisation by bacteria. In this study, the presence and diversity of marine methyl bromide-utilising bacteria was investigated by enrichment, isolation and molecular biological methods, alongside the measurement of methyl bromide in seawater samples by a sensitive gas chromatography with electron capture (GC ECD) technique. Methyl bromide enrichments of seawater samples from the Arabian Sea and from L4, a sampling station in the English Channel off the coast of Plymouth demonstrated oxidation of methyl bromide. Measurements of methyl bromide by GC ECD at L4 suggested rapid biological removal of methyl bromide dissolved in the water column. Isolation of methyl bromide-utilising bacteria was attempted and amplification of marine bacterial cmuA sequences achieved from a number of enrichments. These were cloned and sequenced and their diversity analysed, resulting in the identification of three clades of marine cmuA sequences. DNA extracted from large volumes of Arabian Sea seawater from a cruise track that covered 11 sampling stations mainly along the 67 oE meridian was also PCR amplified using cmuA specific PCR primers. PCR products were cloned, dereplicated and sequenced and phylogenetic analysis assigned the sequences to the same three clades of cmuA identified from the enrichments. A shift from one clade to another could be seen between the oligotrophic station one and the more eutrophic stations four and nine of the Arabian Sea cruise track. A rapid microbial assemblage fingerprinting technique was developed for use with cmuA. A further functional genetic marker, mxaF, encoding the large subunit of the methanol dehydrogenase of methylotrophs and methanotrophs was redesigned in order to take into account new full-length sequences of this gene, and the PCR primers were validated using DNA templates from a range of methylotrophs and methanotrophs. The marine methyl bromide-utilising bacterium Leisingera methylohalidivorans MB2 had not yet been shown to possess the cmu pathway of methyl halide-utilisation and this was attempted using Southern hybridisation analysis. This study has demonstrated the diversity of cmuA sequences and the potential for organisms possessing these genes to form an important part of the oceanic sink of atmospheric methyl bromide. It has also laid firm foundations for further investigation of these bacteria through the development of GC ECD and molecular microbiological techniques.

1

Chapter 1

Introduction

2

1 Ozone depletion and the methyl halides

1.1 Atmospheric methyl halides

Methyl halides (CH3X, X= Br or Cl) are reactive volatile organic compounds

composed of a halogen atom covalently bonded to the methyl group CH3. Methyl

bromide (CH3Br) and methyl chloride (CH3Cl) are gases under standard conditions,

and methyl iodide is a volatile liquid. All three compounds exhibit varying degrees of

toxicity, but CH3Br in particular has been used to good effect as a fumigant in

agriculture in order to control insect, nematode and other pests in a wide range of

economically important crops. It has found use for pre-plant soil fumigation, post-

harvest protection and in quarantine procedures (Ragsdale & Vick, 2001; Yagi et al.,

1995) and its efficacy for these purposes was confirmed as long ago as 1949 (Goodey,

1949).

CH3Br and CH3Cl are present in the atmosphere as trace gases at levels of ~10 and

600 pptv (parts per trillion by volume), respectively (Khalil & Rasmussen, 1999;

Khalil et al., 1993). Although only present in trace amounts, these CH3Xs have a

large effect on atmospheric chemistry, CH3Cl contributes 15 % to the overall

atmospheric burden of chlorine and CH3Br is the largest carrier of bromine to the

stratosphere (Butler, 2000). Once in the stratosphere, reactions with hydroxyl radicals

and photolysis release the reactive halogen species Br and Cl allowing them to

catalyse in cyclic reactions with ozone (O3), which ultimately result in the destruction

of this compound (Yung et al., 1980). It has also been demonstrated that they

contribute to destruction of tropospheric ozone (Platt & Honninger, 2003). Bromine

is 50-60 times more effective at ozone destruction than chlorine on a per atom basis

3

(Butler, 2000) and as such has been assigned a high Ozone-Depleting Potential of

0.65 (Mellouki et al., 1992). As such, in 1992 under the Copenhagen amendment,

CH3Br has come under the auspices of the ‘Montreal Protocol on Substances that

Deplete the Ozone Layer’, which aims to freeze emissions of ozone-depleting gases at

their 1995 levels for developed countries

(http://www.undp.org/seed/eap/montreal/montreal.htm).

1.2 Sources and sinks

Quantification of sources and sinks of ozone-depleting gases allows the assessment of

how effective bans on usage of these compounds are. With entirely anthropogenically

produced chlorofluorocarbons such as CFC-11 it is possible to monitor their

atmospheric decline in response to the protocol (Walker et al., 2000). With CH3Br

the case is complicated by the fact that there are natural sources and sinks of the

compound as well as anthropogenic production from biomass burning (Andreae &

Merlet, 2001; Mano & Andreae, 1994), car exhausts (Baker et al., 1998), as well as

soil fumigants (Yates et al., 1998). Natural sources of CH3Br include the oceans,

where it is produced by macro-algae (Laturnus, 1995; Laturnus et al., 1998) and

phytoplankton (Saemundsdottir & Matrai, 1998; Scarratt & Moore, 1998); and

terrestrial sources include higher plants (Saini et al., 1995, Rhew et al., 2003;

Yokouchi et al., 2002), fungi (Field et al., 1995; Manley, 2002), coastal salt marshes,

rice paddies and wetlands (Rhew et al., 2000), (Redeker et al., 2002), and (Varner et

al., 1999), degradation of organic matter (Keppler et al., 2000) and even

photochemically induced production within surface snow (Swanson et al., 2002).

Sinks of CH3Br include tropospheric hydroxylation, chemical and biological

degradation in soils (Yates et al., 2003) and also the oceans, which are both a source

4

and sink of CH3Br (Butler, 1994; Tokarczyk et al., 2003), but overall seem to be a net

sink (Groszko & Moore, 1998; Lobert et al., 1995). Atmospheric chemistry requires

that the total amount of CH3Br produced equals the total amount degraded, minus the

standing stocks of CH3Br. Currently atmospheric budgets for CH3Br are unbalanced,

in (Ennis, 1998) sources for only 60 % of the sinks could be accounted for, the

missing sinks totalling 83 Gg/yr of CH3Br. Fig 1.1 displays current estimates of

CH3Br fluxes (Rob Rhew, pers. comm.).

5

Fig 1.1. Global CH3Br budget. Values are the amount of CH3Br in Gg/yr. Yellow arrows indicate sources of CH3Br and blue arrows indicate sinks. There are missing sources which contribute 83 Gg/yr . These are known to be terrestrial and believed to be plant based (based on a figure by Rob Rhew, pers. comm.)

Oceanic production

56 41

83

Biomass burning

CH3Br fumigation

Leaded petrol

Missing source

2 Gg/yr 5 Gg/yr

77

42

86 •OH hv

Soils

Oceans

Atmosphere

6

The global oceans are an interesting case as they are both a source and a sink of

CH3Br (Anbar et al., 1996). CH3Br can be broken down chemically in seawater by

hydrolysis and nucleophilic substitution with Cl- (Elliott & Rowland, 1995; Gentile et

al., 1989). There have been conflicting reports concerning the oceans as a sink for

CH3Br since they were previously thought to be supersaturated with respect to

atmosphere and therefore a strong source of CH3Br (Khalil et al., 1993; Singh &

Kanakidou, 1993). However, more recent work has shown that most oceans are

undersaturated in CH3Br with respect to the atmosphere (Lobert et al., 1997; Lobert et

al., 1995; Tokarczyk & Saltzman, 2001; Tokarczyk et al., 2003). An exception is the

North Atlantic during algal blooms (Baker et al., 1999). Coastal waters are also often

supersaturated (Baker et al., 1999), with one study demonstrating that the sea was

saturated with CH3Br for over three months of the year and that greatest saturation

occurred in conjunction with a bloom of the phytoplankton Phaeocystis (Baker et al.,

1999). Upwelling regions are near equilibrium with respect to atmosphere (Lobert et

al., 1997). The ocean is now thought to be a global net sink of atmospheric CH3Br of

–21 Gg/yr (Lobert et al., 1997).

(King & Saltzman, 1997) determined chemical and biological loss rates for CH3Br

surface ocean waters and demonstrated that biological loss rates were significant in

comparison to chemical loss rates and that biological pathways existed for the

removal of CH3Br from these waters. Both autoclaved and 0.2 µm filtered seawater

samples failed to demonstrate the high rates of CH3Br degradation seen in unamended

samples. Examination of the CH3Br loss rates associated with individual size

fractions of the marine biomass resulted in the discovery that loss of CH3Br was

associated with that fraction that encompassed the bacterial size range. #

7

The oceanic lifetime and fate of CH3Br is an important parameter in global models

seeking to predict the atmospheric response to proposed changes in emissions of

CH3Br. A clearer understanding of the biological mechanisms for the removal of

CH3Br in the marine environment by microorganisms is therefore essential.

1.3 Methylotrophic bacteria

Methylotrophic bacteria are capable of gaining all their carbon and energy needs from

one-carbon compounds more reduced than CO2. Substrates utilised by these

organisms include methane, methanol, methylated amines (e.g. mono-, di-, and

trimethylamine), methylated sulphur species and methyl halides (Murrell &

McDonald, 2000). Both aerobic and anaerobic prokaryotes can make use of

methylotrophic substrates for growth, and aerobic methylotrophs include both Gram

positive and Gram-negative bacteria (Anthony, 1982).

1.3.1 Aerobic methylotrophy

Within the aerobic methylotrophs, a functional distinction is made between obligate

methylotrophs and facultative methylotrophs, which can also use non-methylotrophic

compounds as growth substrates. Obligate methylotrophs can be subdivided into

those that can use methane as sole source of carbon and energy (methanotrophs) and

those that cannot. The CH3X-utilising bacteria that have been isolated so far are all

capable of growth on non-methylotrophic substrates and are hence classified as

facultative methylotrophs. Aerobic methylotrophs play an important part in global

carbon cycling as methane is the most abundant organic gas in the atmosphere

(DeLong, 2000; Murrell & McDonald, 2000).

8

1.3.2 Methanotrophy

Methanotrophs make use of methane monooxygenase enzymes in order to oxidise

methane to methanol, which is further oxidised by methanol dehydrogenase. There

are two forms of this enzyme, a particulate form and a soluble form. Methanotrophs

have been isolated with either one or both of these enzymes, but possession of the

soluble form is a less common trait (Colby et al., 1977; Dedysh et al., 2000). The

methanotrophs are divided into two groups by arrangement of intracellular

membranes, Type I methanotrophs possess bundles of vesicular discs and Type II

methanotrophs have membranes running around the periphery of the cell. The two

types differ from one another in their biochemistry as Type I methanotrophs and other

α-Proteobacterial methylotrophs assimilate carbon at the level of formaldehyde

through the serine pathway, whereas Type II methanotrophs (γ-Proteobacteria)

together with obligate methanol-utilizers of the β-Proteobacteria use the ribulose

monophosphate cycle (RuMP) (Chistoserdova & Lidstrom, 2002).

1.3.3 Biochemistry: carbon assimilation and energy generation

Methylotrophs face a number of metabolic challenges, including building all their

cellular carbon from one carbon compounds and channelling all their assimilatory and

dissimilatory carbon through the toxic intermediate formaldehyde. Certain key

enzymes are involved in this process, including the methane monooxygenases and

methanol dehydrogenase (MDH), both of which have been used as functional

molecular markers of methylotrophy in the environment (Inagaki et al., 2004;

McDonald & Murrell, 1997). Methyl groups of methylotrophic substrates are

oxidised to formaldehyde by various substrate specific oxidases or dehydrogenases.

Formaldehyde can then either be completely oxidised to CO2, or be assimilated into

cellular biomass by the serine or RuMP cycles. If present, the ribulose bisphosphate

9

cycle (Calvin-Benson-Bassham cycle) can also be used to assimilate cellular carbon

from CO2. A summary of aerobic methylotrophy pathways can be seen for a variety

of substrates in Fig 1.2 below.

10

Fig. 1.2. Metabolism of C1 compounds by aerobic methylotrophic bacteria adapted from (Lidstrom, 2001). Numbering refers to the enzymes for each step: 1, methane monooxygenase; 2, methanol dehydrogenase; 3, formaldehyde dehydrogenase; 4, formate dehydrogenase; 5, dichloromethane dehalogenases; 6, methyl halide methyltransferase/corrinoid binding protein; 7, methanesulfonic acid monooxygenase; 8, methylated sulphur dehydrogenases or oxidases; 9, methylated amine dehydrogenases; 10, methylamine oxidase.

11

At least four pathways have been identified for the oxidation of formaldehyde, one

being cyclic and three linear. The cyclic pathway involves a dissimilatory RuMP

cycle and 6-phosphogluconate dehydrogenase (Anthony, 1982), and the first of the

linear pathways is a common mechanism involving a NAD+ linked formaldehyde

dehydrogenase (Duine, 1993). The further two pathways were identified in

Methylobacterium extorquens AM1 where formaldehyde reacts with either

tetrahydromethanopterin, a co-factor previously thought to be specific to

methanogens, or tetrahydrofolate forming the methylene form of the co-factors. The

methylene group is progressively oxidised to CO2 by a series of different enzymes

specific for the particular carrier (Chistoserdova & Lidstrom, 2002).

1.3.4 Anaerobic methylotrophy

Two bacterial processes are involved in anaerobic methylotrophy: methanogenesis

and anaerobic methane oxidation. Methanogens are Archaea that either

disproportionate acetate, formate and selected other C1 compounds to CO2 and CH4,

or reduce them to CH4 using H2. Methanogens reduce the methyl group carrier

methyl coenzyme M (McoM) to methane and oxidised coenzyme M using the enzyme

methyl coenzyme M reductase. Reduction of the coenzyme M is coupled to the

phosphorylation of ADP to ATP, and thus energy production. Methyl groups can be

transferred to McoM via a variety of systems, including tetrahydromethanopterin.

The employment of tetrahydromethanopterin could indicate a link between

methanogenesis and aerobic methylotrophy (Ferry, 1999; Sauer et al., 1997). When

using methanol or methylamine as an energy source specialised methyltransferases

and corrinoid-binding proteins transfer the methyl group directly from these

compounds to coenzyme M (Deppenmeier, 2002). These two enzymes share some

homology with the CmuA methyltransferase/corrinoid binding protein of aerobic

12

methyl halide utilisation (see below), which is similarly reminiscent of the strictly

anaerobic process of methanogenesis and aerobic methylotrophy.

1.4 Bacterial degradation of halogenated compounds

A wide range of different halogenated compounds, including aliphatic and aromatic

halogenated hydrocarbons, exist in the environment and can be degraded aerobically

and anerobically by bacteria using a variety of means. Many of these have significant

anthropogenic sources and investigation into their bacterial degradation is often from

a bioremediation standpoint (Fetzner, 1998). Five strategies for dehalogenation were

defined by (Fetzner, 1998) and include:

• Oxidative dehalogenation as a result of mono- or di- oxygenase-catalysed co-

metabolic reactions (such as co-metabolic degradation of CH3Br by methane

monooxygenase (Dalton & Stirling, 1982).

• Dehydrohydrohalogenase-catalysed dehalogenation involves the removal of

the halogen atom and formation of a double bond. This has been

demonstrated to occur in the degradation of the insecticide lindane by

Sphingomonas paucimobilis UT26 (Fetzner, 1998).

• Substitutive dehalogenation involves either hydrolysis catalysed by

halidohydrolases, or a thiolytic mechanism with glutathione as co-substrate.

Substitutive dehalogenation mechanisms are the most common mechanisms of

dehalogenation and have been found in a wide range of bacteria and acting

upon aliphatic, heterocyclic and aromatic halogenated compounds (Fetzner,

1998).

• Reductive dehalogenation and dehalorespiration. Certain anaerobic bacteria

can use halogenated compounds such as chlorophenols and chloroethenes as

13

electron acceptors. This process is important in the biodegradation of

halogenated pollutants such as trichloroethene in anaerobic environments

(Gerritse et al., 1999).

• Halogen methyltransferases can operate in both anaerobic and aerobic

organisms. The anaerobic homoacetogen Acetobacterium dehalogens uses

CH3Cl as sole energy source, producing acetate (Fetzner, 1998). The aerobic

methyltransferase system is best exemplified by the CH3X-utilisers that are the

subject of this thesis.

1.5 Aerobic utilisation of methyl halides and characteristics of isolates

The first CH3X-utiliser was Hyphomicrobium sp. MC1, isolated by Leisinger and

colleagues in 1986, which was shown to degrade CH3Cl aerobically (Hartmans et al.,

1986). At the time this reaction was suggested to occur via a monooxygenase

reaction rather than a dehalogenation. The strain has subsequently been lost and so

this cannot be confirmed.

1.5.1 Methylobacterium chloromethanicum CM4

Doronina et al., (1996) isolated eight strains of CH3Cl-degrading bacteria from

industrially-contaminated Russian soils. After 16S rRNA phylogenetic analysis it

was revealed that in fact two distinct strains had been isolated, which were designated

as Methylobacterium chloromethanicum CM4 and Hyphomicrobium

chloromethanicum CM2 (McDonald et al., 2001).

The mechanism of CH3Cl metabolism in M. chloromethanicum CM4 was investigated

and two major polypeptides, of 67 kDa and 35 kDa were discovered to be induced

during growth on CH3Cl. Cells grown on CH3Cl were also shown to be capable of

14

oxidising CH3Br and CH3I (Vannelli et al., 1998). Transposon mutagenesis was used

in order to identify the genes responsible for CH3Cl degradation and mutants that

would still grow on other methylotrophic compounds. This information was coupled

with physiological, biochemical and genetic evidence, and a pathway was suggested

for the process (Vannelli et al., 1999) see Fig 1.3).

Fig 1.3. Pathway of CH3Cl degradation in Methylobacterium chloromethanicum CM4 as (Vannelli et al., 1999). Numbering refers to enzyme for that particular step in the pathway: 1. CmuA, methyltransferase/corrinoid protein; 2. CmuB, methyltransferase; 3. MetF, 5,10-methylene-tetrahydrofolate reductase; 4. and 5. FolD, 5,10-methylene-tetrahydrofolate dehydrogenase/cyclohydrolase (4./5.); 6. PurU, 10-formyl-tetrahydrofolate hydrolase; 7. FDH, Formate dehydrogenase.

Carbon assimilation via serine cycle

CH3Cl

H4folate

CH H4folate

CHO H4folate

CH2 H4folate

CH3 H4folate

HCOOH

CO2

H2O

H2O

H4folate

2 H+

2 H+

2 H+

HCl

CoI

CH3 CoIII

1

4

5

6

3

7

2

15

The first step in this pathway is the transferral of the methyl group of CH3Cl to the

Cobalt atom of a corrinoid group. A single 67 kDa enzyme, CmuA carries out this

task, being a methyltransferase coupled to a corrinoid-binding protein. The second

step involves the methyltransferase CmuB (35 kDa), which transfers the methyl group

from the corrinoid group to tetrahydrofolate forming methyl tetrahydrofolate. Both

these methyltransferases were demonstrated to be essential for growth on CH3Cl by

transposon mutagenesis (Studer et al., 2002). Methyl tetrahydrofolate is then

progressively oxidised to formate and CO2, with carbon assimilation via the serine

cycle at the level of methylene tetrahydrofolate. CmuA and CmuB were purified and

were able to catalyse the transfer of the methyl group of CH3Cl to tetrahydrofolate in

vitro (Studer et al., 2002).

Sequence analysis of the genes involved indicated that they were present on two

clusters on the M. chloromethanicum CM4 genome (see Fig 1.4, later). CmuC and

FolD were also shown to be essential for growth on CH3Cl, but the function of the

methyltransferase CmuC is not yet known.

Vitamin B12 was shown to be required for the growth of M. chloromethanicum on

CH3Cl and that it was not required as an addition to the growth medium as it was

synthesised by the cells. Presence of cobalt in the growth medium was an obligate

requirement (Studer et al., 2002).

1.5.2 Hyphomicrobium sp.

Hyphomicrobium chloromethanicum CM2 was isolated alongside M.

chloromethanicum CM4 (Doronina et al., 1996) and along with this strain it is one of

the most studied CH3X-utilising bacteria. A CH3Cl-inducible enzyme system was

16

shown to be present in H. chloromethanicum CM2 with a 67 kDa CmuA and 35 kDa

CmuB being expressed during growth on CH3Br and CH3Cl (McAnulla et al., 2001b).

A single gene cluster containing the cmuA, cmuB, cmuC and folD genes known to be

essential for growth on CH3Cl was cloned and sequenced. CmuA from H.

chloromethanicum CM4 displayed the same methyltransferase/corrinoid binding

protein structure as with M. chloromethanicum CM4 and shared 80 % identity at the

amino acid level (McDonald et al., 2002). A number of other ORFs were present on

this cluster, including paaE encoding a putative reductase and hutI encoding an

imidazolonepropionase (see Fig 1.4).

Transposon and site-directed mutagenesis studies were carried out in H.

chloromethanicum CM2 (Borodina et al., 2004) and mutational inactivation of cmuB,

cmuC or hutI was shown to negate the ability to use CH3Cl as sole carbon and energy

source. Furthermore it was demonstrated by reverse transcription PCR analysis that

the cmuB, cmuC, cmuA, fmdB, paaE, hutI and metF genes were co-expressed and co-

regulated as parts of a single mRNA transcript. Expression of the transcript was

CH3Cl inducible and not repressed by the presence of the alternative growth substrate

methanol. CH3Cl- transposon mutants were also unable to use CH3Br as sole carbon

energy source, indicating that the same pathway was being used to utilise both

CH3Xs. These analyses indicated that a similar pathway for CH3Cl-degradation

existed in both these Methylobacterium and Hyphomicrobium isolates.

A number of other Hyphomicrobium spp. have been isolated that are capable of

growth on CH3Cl and CH3Br. (McAnulla et al., 2001a) enriched for and isolated six

Hyphomicrobium strains: S-3 was isolated from the Severn estuary, S-4 from

17

Warwick soil, MAR-1 from the North Sea, SAC-1 and SAN-1 and PMC from the

same woodland site. Strains S-3, S-4 and MAR-1 were phylogenetically very similar

to H. chloromethanicum CM2, SAC-1 and SAN-1 in comparative 16S rRNA

sequences analysis grouped together close to, but separate from strain CM2. PMC

was more distantly related. (Borodina et al., 2005) isolated seven further

hyphomicrobia from a range of soils enriched with CH3Cl.

The number of Hyphomicrobium spp. that have been isolated on CH3Xs may indicate

that these bacteria form a significant sink for CH3Cl and CH3Br in soils, although this

may also be due to enrichment conditions favouring these organisms to the detriment

of environmentally more significant organisms. It is not known how active they are

in the environmental degradation of CH3Xs. Borodina et al., (2005) also applied

CH3Cl DNA Stable Isotope Probing (Radajewski et al., 2000) to the same soil

samples and revealed a greater diversity of CH3Cl-utilising bacteria to be present as

demonstrated by analyses of 16S rRNA and functional gene (cmuA) amplification and

sequencing than that from the enrichment cultures.

1.5.3 Aminobacter sp.

Two Aminobacter sp. that are capable of growth on both CH3Cl and CH3Br have been

isolated and have had their cmu (chloromethane-utilising) gene clusters characterised.

They have recently been designated Aminobacter ciceronei IMB1 and Aminobacter

lissarensis CC495 (McDonald et al., In Press). A. ciceronei IMB1 was isolated from

soil that had previously been fumigated with CH3Br (Connell-Hancock et al., 1998;

Miller et al., 1997) and A. lissarensis CC495 was isolated from pristine woodland soil

(Coulter et al., 1999). A. ciceronei IMB1 was able to utilise CH3Cl, CH3Br, and CH3I

as sole carbon and energy sources and CH3Cl and CH3I demonstrated competitive

18

inhibition with CH3Br, suggesting that a common enzyme system was responsible for

utilisation of all three CH3Xs (Schaefer & Oremland, 1999). Growth on all three

CH3Xs was also demonstrated to be inducible and cells grown on CH3Br were

capable of oxidising CH3Cl and vice versa. In addition, this organism was

demonstrated to be able to oxidise tropospheric concentrations (pptv) of CH3Br,

indicating the potential of these bacteria to be important degraders of CH3Br in the

environment (Goodwin et al., 2001). A cmu cluster has been cloned and sequenced

from this organism (Woodall et al., 2001) and contained cmuC, cmuA, paaE, hutI and

metF genes, cmuB was not identified in this strain (see Fig. 1.4). Again, these results

combine to suggest that a similar pathway is in operation in A. ciceronei IMB1.

A. lissarensis CC495 was only able to grow on CH3Cl or CH3Br as sole carbon and

energy source when vitamin B12 was supplied in the medium (Coulter et al., 1999),

in contrast to M. chloromethanicum CM4, H. chloromethanicum CM2, and A.

ciceronei IMB1 (Studer et al., 1999). Growth on CH3Cl and CH3Br was

demonstrated to be inducible and 68 kDa and 28 kDa proteins were shown to be

expressed when cells were grown on CH3Cl , but not when grown with methylamine.

The 68 kDa protein was purified and identified as a halomethane:bisulfide/halide ion

methyltransferase (Coulter et al., 1999).

N-terminal sequences of this protein displayed identity to the derived N-terminus of

CmuA from M. chloromethanicum CM4 (81.3 %), H. chloromethanicum CM2 (68.8

%), and A. ciceronei IMB1 (81.3 %) (McDonald et al., 2002). Southern hybridisation

analysis using a radiolabelled probe based on the cmuA sequence of A. ciceronei

IMB1 allowed the cloning and sequencing of a cmu cluster from A. lissarensis CC495

19

(Warner, 2003; Warner et al., In Press). Similar to H. chloromethanicum CM2 and A.

ciceronei IMB1 genes were arranged in single cluster: cmuB, cmuC, cmuA, paaE and

hutI and shared high identities with the corresponding genes from A. ciceronei IMB1.

It is likely that a pathway similar to that elucidated by (Vannelli et al., 1999) is also in

operation in this case, rather than the halomethane:bisulfide/halide ion methyl

transferase mechanism suggested by Coulter et al., (1999).

1.5.4 Marine CH3Br utilising bacteria

Prior to the start of this investigation, despite the fact marine systems have been

shown to possess significant capacity for biological CH3Br degradation, only two

marine bacteria capable of utilising CH3Br as sole source of carbon and energy had

been isolated: Leisingera methylohalidivorans MB2 (Goodwin et al., 2001; Schaefer

et al., 2002) and strain LIS 3 (Hoeft et al., 2000). L. methylohalidivorans MB2 was

isolated from a CH3Br-degrading seawater enrichment that had been sourced from a

tide-pool of the coast of California (Goodwin et al., 1998). It was able to utilise

CH3Br, CH3Cl, and CH3I as sole sources of carbon and energy and this trait was

demonstrated to be inducible (Schaefer et al., 2002). Alongside A. ciceronei IMB1,

L. methylohalidivorans MB2 was also able to oxidise tropospheric levels of CH3Br.

Attempts have been made to identify a cmuA gene in L. methylohalidivorans MB2,

but have yet to meet with success (Warner, 2003). Southern hybridisation analyses

with probes generated from M. chloromethanicum CM4, H. chloromethanicum CM2,

A. ciceronei IMB1 and A. lissarensis CC495 failed to hybridise with

L. methylohalidivorans MB2 DNA. SDS PAGE analysis of cells grown on complex

marine broth with and without CH3Br failed to reveal any differences in expressed

proteins. The pathway of CH3Br-utilisation remains unknown in this organism.

20

Strain LIS 3 was isolated from a CH3Br and dimethyl sulfide enrichment of Long

Island Sound seawater and inhibition experiments using trichloroethene as an

inhibitor of methyltransferase reactions indicated that it was capable of utilising

CH3Br via a methyltransferase mechanism (Hoeft et al., 2000). This isolate has yet to

be characterised further and so the details of this mechanism also remain unknown.

During the course of this investigation (Schaefer et al., 2005) enriched Plymouth and

Scottish coastal seawater with CH3Br and isolated 13 strains of marine CH3Br-

utilising bacteria belonging to three distinct clades of the α-Proteobacteria. Of these

clades, two were found to make use of the cmu pathway and representatives of each of

these (strains 179 and 198) had their cmu clusters successfully cloned and sequenced.

Sequence analysis indicated the presence of cmuA, fmdB, paaE, hutI and metF in the

fragment of strain 179 cmu cluster, and of cmuC, cmuA, fmdB, paaE, and hutI in

strain 198. A metF sequence could not be identified in strain 198. SDS PAGE

analysis of CH3Br grown cells of strains 179 and 198 compared with glycine betaine

grown cells demonstrated inducible expression of 67 kDa proteins and their identity

was confirmed by mass spectrometry analysis. This indicated that the cmu pathway

of CH3X degradation was present, not only in terrestrial environments, but also in

marine environments. The conservation of structure of all the cmu clusters sequenced

to date can be seen in Fig 1.4.

Strains of the third clade of marine CH3Br-utilising isolates, represented by

Rhodobacteraceae strain 217 (sharing most phylogenetic identity with Roseovarius

strains) did not demonstrate the presence of a 67 kDa protein that was inducibly

expressed when grown on CH3Br. Those proteins that did demonstrate differential

21

expression between CH3Br grown and glycine betaine grown cells could not be

conclusively identified by mass spectrometry. As with L. methylohalidivorans MB2,

it is not known by what mechanism CH3Br is utilised in these strains.

22

Fig 1.4. Comparison of cmu gene clusters sequenced to date. Genes involved in the metabolism of CH3X are in blue with cmuA in red. Genes not directly involved are in green. Organisms are referred to by their strain names.

str. IMB-1

2 kb

I

I

I

str. CC495

str. CM4

str. 198

cmuB cmuC cmuA fmdB paaE hutI

cobU cobD metF cmuB cmuC cobC

cobU folC folD purU cmuA

cmuC cmuA fmdB paaE hutI metF

cmuA fmdB paaE hutI cmuC nrdF nrdA

str. CM2 cmuB cmuC cmuA fmdB paaE hutI metF

//

str. 179 cmuA fmdB paaE hutI metF

23

1.5.5 Phylogeny of CH3X-utilising bacteria

All CH3X-utilising bacteria isolated and characterised so far have been members of

the α-Proteobacteria. A single Gram positive bacterium, which was determined to be

most similar to the Nocardiodes was isolated, but unfortunately the strain was lost

(McAnulla, 2000). Despite the fact they are all within the α-Proteobacteria, the

CH3X-utilising strains are distributed throughout this clade (see Fig 1.5). CH3X-

utilisation is a monophyletic trait in that it has thus far only been found within the α-

Proteobacteria, although within this clade it is sporadically distributed a fact that is

best demonstrated by A. ciceronei strains IMB1, ER2 and C147 (McDonald et al., In

Press). These three strains are all members of the same species, but only A. ciceronei

IMB1 is capable of utilising CH3X as sole carbon and energy sources, strains ER2 and

C147 cannot grow on these compounds and have not been discovered to possess a

cmuA gene.

24

Fig 1.5. Maximum likelihood tree of near full-length 16S rRNA sequences of a selection of the isolated strains of CH3X utilisers, indicating their distribution throughout the α-Proteobacteria. Terrestrial isolates are indicated in red, with marine isolates highlighted in blue. The 16S rRNA sequence of Erythrobacter longus was used to root the tree

25

1.6 Molecular ecology

Traditional microbiological techniques such as the enrichment and isolation of novel

organisms are exceedingly useful tools for determining the ecology of particular

bacterial species. However, the limitation of these approaches is that many organisms

are recalcitrant to culture by traditional means. New culturing approaches, such as

dilution to extinction culturing methods and use of extremely dilute media

demonstrate some promise for accessing microbial biodiversity missed by classical

culturing techniques (Rappe et al., 2002), but molecular ecology techniques can

access much more of this diversity.

Molecular ecology makes use of analyses of individual bacteria and, more commonly,

populations of bacteria at the molecular level in order to gain information about the

function and/or phylogenetic affiliation of that organism or population in the

environment. A wide range of techniques are available and some of the most

common, and powerful techniques are discussed below.

1.6.1 Functional and phylogenetic genetic markers

DNA or RNA samples can be extracted from entire communities of environmental

bacteria. Amplification of genes of functional or phylogenetic interest using the

polymerase chain reaction and specific primers can allow determination of whether a

particular functional gene is present in a given sample, and the diversity of the

organisms bearing those genes can be assessed. The 16S rRNA gene is often targeted

in this way in order to determine the diversity of microbial assemblages, as it is

conserved between all bacteria. Universal bacterial primers have been designed for

the 16S rRNA gene, which amplify various regions. Ligation of these amplimers into

26

plasmid vectors and transformation into bacterial hosts creates a library of sequences

representative of those in the environment. These can be dereplicated by techniques

such as restriction fragment length polymorphism analysis (RFLP) (Borodina et al.,

2005) for example) and divided into operational taxonomic units (OTUs).

Representative clones of OTU can be sequenced and phylogenetic analyses applied in

order to establish the identity and relatedness of the cloned genes to one another.

With the CH3X-utilising bacteria phylogenetic analyses are hampered by the fact that

CH3X degradation is not a monophyletic trait. In this and similar cases functional

genetic markers can be used in order to assess the diversity of bacteria that are

capable of carrying out a particular process associated with the targeted gene in the

environment. Examples of genes that have been used as functional genetic markers

include the pmoA and mmoX genes, which encode the catalytic subunits methane

monooxygenases and have been used as markers of methanotrophy, and mxaF, which

encodes the large subunit of methanol dehydrogenase and has been used as a

functional marker of methylotrophy (Inagaki et al, 2004; McDonald and Murrell

1997).

With CH3X-utilising bacteria cmuA, the gene encoding the first step in the

methyltransferase pathway, has been developed and applied as a functional genetic

marker in a variety of terrestrial environments (Borodina et al., 2005; McAnulla,

2000; Miller et al., 2004; Warner, 2003).

27

1.6.2 Microbial assemblage finger-printing techniques

Clone library analysis can be time-consuming and the cost of sequencing large

numbers of clones in order to be statistically rigorous in representation of the

microbial assemblage can be prohibitive. These factors limit the number of clones

that can be analysed and may result in libraries that severely underestimate the

diversity present in the environmental sample. Techniques, such as denaturing

gradient gel electrophoresis (DGGE, Diez et al., 2001; Freitag & Prosser, 2003) and

terminal restriction fragment length polymorphism (TRFLP, Engebretson & Moyer,

2003; Moeseneder et al., 1999; Osborn et al., 2000) have been developed that allow

the more rapid assessment of the diversity of organisms present in microbial

assemblages. Both techniques are again based on PCR amplification of DNA using

primers specific for particular phylogenetic or functional genetic markers; however,

the primers have been modified, in the case of DGGE by addition of a GC-rich

sequence, and in the case of TRFLP by addition of a 5’ fluorophore.

DGGE PCR products are run on acrylamide gels that contain an increasing

concentration of denaturant from the top to the bottom of the gel. PCR products

denature at positions in the gel that correspond to their sequence, but are held together

by the more strongly bonded GC-clamp. Different sequences halt their

electrophoretic movement at different positions in the gel, thus, after staining and

visualisation of the gels, producing a characteristic banding pattern representative of

the sequence diversity amplified from the particular DNA sample. The intensity of

individual bands can be used as an indicator of the relative dominance of each

sequence type in the sample and excision and sequencing of bands can allow their

identification.

28

TRFLP PCR products are digested with carefully selected restriction enzymes which

are chosen for their ability to discriminate between different sequence variations of

the same gene. These digested products are resolved by DNA sequencing. Only the

terminal restriction fragment corresponding to the 5’ end of the product can be

visualised as it is the only fragment that remains attached to the fluorophore. The size

of these terminal restriction fragments (TRFs) produces the microbial assemblage

fingerprint. The relative fluorescence of each TRF can be used as an indicator of the

relative abundance of particular sequences in a similar manner to intensity of bands in

DGGE analysis, although identification of a particular TRF relies on comparison of

their sizes with known sequences, as TRFs cannot be sequenced.

1.6.3 Localisation of specific microorganisms within environments and

microbial assemblages

The molecular ecological techniques discussed so far allow the identity and diversity

of genes to be assessed in a bulk sample, but do not allow visualisation or

identification of individual organisms within an environment. Fluorescence in situ

hybridisation causes individual cells that possess a specific DNA sequence to

fluoresce and they can then be visualised using fluorescent microscopy (Davenport et

al., 2000). DNA probes are designed for specific sequences of 16S rRNA and

labelled with fluorophores. These are then hybridised with microbial assemblages

fixed to slides and permeablised in order to allow entry of the fluorescent probe to the

cell, where it hybridises to the cognate sequence of 16S rRNA. By using a variety of

probes that hybridise with various taxonomic groups together with a variety of

fluorophores the diversity within a microbial assemblage can be resolved at the level

of individual organisms.

29

One of the drawbacks of FISH has been that it has only been possible to design probes

for ribosomal RNA as these are expressed at high copy numbers in bacteria. Recently

a mRNA FISH technique has been developed that allows simultaneous hybridisation

of probes to mRNA and rRNA and therefore the detection of functional gene

expression alongside determination of phylogenetic identity at the level of individual

cells (Pernthaler & Amann, 2004).

1.6.4 Linking microbial assemblage identity with function

Determining the identity of organisms within an assemblage may give clues to

environmental function they perform, but cannot elucidate this further. Similarly

examination of functional diversity is useful, but can only give clues to the identity of

the organisms performing the function in the environment if the functional trait is

monophyletic. Recently there have been a number of significant developments of

techniques that can link the functional diversity of a microbial assemblage with the

phylogenetic identity of the organisms involved. mRNA FISH is an example of one

of these techniques. Other techniques include the use of micro-autoradiography of

organisms that have been fed with radiolabelled substrates and subsequent FISH

analysis, identifying the organisms in the sample that have been utilising the substrate

(MAR-FISH, Lee et al., 1999). DNA Stable Isotope Probing (SIP, Radajewski et al.,

2000) and the complementary RNA SIP (Manefield et al., 2002) again make use of

labelled substrates, in this case, heavy isotopes such as 13C, which are pulse fed to the

subject assemblage. The heavy isotope is incorporated into the biomass of that

portion of the microbial assemblage that is actively utilising the substrate in question.

DNA or RNA from the total population can be extracted and separated by density

30

gradient centrifugation, as nucleic acids from the active portion of the assemblage are

heavier than that of the non-active portion. These nucleic acids can then be subjected

to the other molecular techniques mentioned in order to identify the active population,

thus linking population identity with environmental function.

1.7 Sampling sites

Two main sampling sites were used during this investigation, L4, a sampling station

off the coast of Plymouth which could be visited up to weekly, and the Arabian Sea as

part of the AMBITION (Analysing Microbial Biodiversity In The Indian OceaN)

NERC thematic cruise for the Marine and Freshwater Microbial Biodiversity thematic

programme.

1.7.1 Station L4

Station L4 has been visited weekly by scientists based at Plymouth Marine Laboratory

and the Marine Biological Association of the UK since 1988 (see Fig 1.6). Research

vessels RVS Squilla, RVS Sepia and RVS Plymouth Quest bring back weekly water

samples from this station for laboratory analysis and conduct in situ depth profiles of

CTD (conductivity, temperature and depth) and chlorophyll a abundance. Datasets

for zooplankton identification and abundance from this sampling site extend back to

1988 and from 1992 physical, chemical and biological measurements have been taken

including phytoplankton identity and abundance. The datasets are freely available

from the L4 website www.pml.ac.uk/L4/.

31

Fig 1.6. Location of sampling station L4 in the English Channel. L4 is located 10 nautical miles South of Plymouth and is subject to weak seasonal stratification. Phytoplankton composition is characterised by spring diatom and summer dinoflagellate blooms (information from www.pml.ac.uk/L4/Location.htm).

1.7.2 Arabian Sea

The Arabian Sea has been used as a sampling site by a large number of investigators,

including the global programs JGOFS (Joint Global Ocean Flux Study) and WOCE

(World Ocean Circulation Experiment). The Arabian Sea and Indian Ocean are often

selected for analysis because, despite being one of the smallest ocean basins, they

contain a diversity of biogeochemical provinces including eutrophic, oligotrophic,

upwelling and oxygen deplete environments (Burkhill et al., 1993). In 2001 from the

30th August to 29th September, RRS Charles Darwin research cruise CD132

completed a transect (see Fig. 1.7.) of the Arabian Sea in order to characterise the

32

microbial diversity present. 11 stations were sampled along the 5 500 km transect,

mainly following the 67o E meridian. The cruise was collaborative with participants

studying a range of different bacteria and making a wide range of complimentary

measurements including nutrients, photosynthetic pigments, phytoplankton abundance

and production. Microorganisms studied included the Bacteroidetes, pico-eukaryotes,

and nitrogen-fixing bacteria. Data are available from the BODC (Biological

Oceanography Data Centre) and the cruise report contains full details of

measurements taken. Some data are included in Appendix A, and a list of samples

taken is included in Appendix B.

33

Fig 1.7. AMBITION cruise track. The track is marked in red, with sampling stations indicated in yellow.

34

1.8 Aims

Given the importance of marine systems in CH3Br cycling, and the potentially

significant role of bacteria as a sink of CH3X in the marine environment the aims of

this project were four-fold:

• Measurement of environmental (pptv) concentrations of CH3Br in seawater

• Enrichment, isolation, and characterisation of CH3Br-utilising bacteria

• Use of molecular ecological analyses to determine the presence, distribution

and diversity of CH3Br-utilising bacteria in seawater

• Correlation of the presence and concentration of CH3Br with the presence and

abundance of CH3Br-utilising bacteria in seawater

The studentship was funded by NERC and tied to a larger thematic program, Marine

and Freshwater Microbial Biodiversity. Funding was also provided on the project for

a PDRA, Dr. Hendrik Schäfer. The principal and co-investigators were Prof. Colin

Murrell and Dr. Ian McDonald at the University of Warwick and Dr. Phil Nightingale

at Plymouth Marine Laboratory.

35

Chapter 2

Materials and Methods

36

2 Chapter 2: Materials and Methods

2.1 Bacterial and Algal Strains

The bacterial and algal strains used in this study are given in Table 2.1.

Strain Characteristics Source Reference Methylobacterium chloromethanicum strain CM4

MeX utiliser Prof. Yuri Trotsenko

(Doronina et al., 1996)

Hyphomicrobium chloromethanicum strain CM2

MeX utiliser Prof. Yuri Trotsenko

(Doronina et al., 1996)

Aminobacter strain IMB-1 MeX utiliser Dr. Larry Miller

(Connell-Hancock et al., 1998)

Aminobacter strain CC495 MeX utiliser Prof. David Harper

(Coulter et al., 1999)

Leisingera methylohalidivorans strain MB2

MeX utiliser Dr. Kelly Goodwin

(Goodwin et al., 1998)

Ruegeria strain 198 MeX utiliser Dr. Hendrik Schäfer

(Schaefer et al, 2004)

Strain 179 MeX utiliser Dr. Hendrik Schäfer


Roseovarius strain 217 MeX utiliser Dr. Hendrik Schäfer


Silicibacter pomeroyi strain DSS3

Related to marine MeX utilisers

Dr. J Gonzalez

(Gonzalez et al., 2003)

Strain DSS8 Related to marine MeX utilisers

Dr. J Gonzalez


Roseobacter agricola Related to marine MeX utilisers

Dr. J Gonzalez


Methylobacterium extorquens AM1

Possesses a Methanol dehydrogenase

Warwick

Methylococcus capsulatus (Bath)


Warwick (Whittenbury et al., 1970)

Methylophilus methylotrophus W3A1


Prof. Nigel Scrutton

Flavobacterium strain RD4.3

Methylotroph without Methanol dehydrogenase

Dr. Paolo de Marco

(De Marco et al., 2004)

Mycobacterium ratisbonense strain EM3


Dr. Paolo de Marco


Pseudomonas strain PM2 Methanol utiliser Dr. Paolo de Marco

(Pacheco et al., 2003)

37

Strain Characteristics Source Reference Escherichia coli strain TOP10

Cloning host strain Invitrogen Corporation

TOPO TA cloning Kit

Emiliania huxleyi 92A MeX Producer Dr. Declan Schroeder

Emiliania huxleyi 373 MeX Producer Dr. Declan Schroeder

Emiliania huxleyi 373 UEA

MeX Producer Dr. Declan Schroeder



Emiliania huxleyi 1516 CCMP

MeX Producer Dr. Declan Schroeder

Table 2.1. Bacterial and algal strains used; available references are indicated.

2.2 Genomic DNA Samples and Plasmids

Genomic DNA samples used in this study are recorded in Table 2.2.

Strain Characteristics Source Reference Afipia felis strain 25Ei Possesses a methanol

dehydrogenase Dr. Azra al-Moosvi

(Moosvi et al., 2005)

Marinosulfonomonas strain TR3


Warwick

Methylosinus trichosporium OB3b


Warwick

Methylosinus sporium 5 Possesses a Methanol dehydrogenase

Warwick

Methylocystis parvus Possesses a Methanol dehydrogenase

Warwick

Methylomonas methanica S1


Warwick

Methylomonas rubra Possesses a Methanol dehydrogenase

Warwick

Methylomicrobium album BG8


Warwick

Methylomonas agile A20 Possesses a Methanol dehydrogenase

Warwick

Hyphomicrobium strain P2 Possesses a Methanol dehydrogenase

Dr. Paolo de Marco


Methylobacterium strain P3


Dr. Paolo de Marco


Ancylobacter strain SC5.10


Dr. Paolo de Marco


38

Strain Characteristics Source Reference Methylobacterium strain PM1


Dr. Paolo de Marco


Methylophilus strain ECd4 Possesses a Methanol dehydrogenase

Dr. Paolo de Marco


Ralstonia strain EHg5 Methylotroph with no Methanol dehydrogenase

Dr. Paolo de Marco


Rhodococcus strain RD6.2 Methylotroph without Methanol dehydrogenase

Dr. Paolo de Marco


Arthrobacter strain SK1.18


Dr. Paolo de Marco


TOPO Vector Cloning Plasmid Invitrogen Corporation

TOPO TA cloning Kit

Table 2.2. Genomic DNA extracts used; available references are included.

2.3 Media

Liquid media were prepared as described below. The corresponding agars were

prepared by the addition of 1.5 % (w/v) Bacto agar (Difco) to the respective liquid

media prior to autoclaving. All media were autoclaved at 121 oC for 15 min.

39

2.3.1 MAMS (Marine Ammonium Mineral Salts)

MAMS medium was used for growth of Leisingera methylohalidivorans strain MB2

and also for enrichments and was adapted from Thompson et al., 1995; the SL-10

trace elements solution as described by Widdel et al., 1983.

Amount (per L)

deionised water 970.0 mL

NaCl 20.0 g

(NH4)2SO4 (200 g/L stock soln.) 5.0 mL

100 x CaCl2 stock soln. (2.0 g/100 mL) 10.0 mL

100 x MS soln. 10.0 mL

SL-10 Trace Elements soln. 1.0 mL

Methyl Halide Vitamin soln. 5.0 mL

100 x Phosphate Stock soln. 10.0 mL

Adjust pH to 7.0-7.3 if required, and add phosphates and vitamins solutions

aseptically after autoclaving for 15 min at 121 oC.

100 x MS Solution

Amount (per 100 mL)

MgSO4.7H2O 10 g

FeSO4.7H2O 0.02 g

Na2WO4 (0.1 mM in 20 mM NaOH) 1.0 mL

Na2MO4.2H2O (0.2 g/mL solution) 1.0 mL

Made using deionised water and autoclaved

40

100 x Phosphates Stock Solution

Amount (g/100 mL)

KH2PO4 3.6

K2HPO4 23.4

Made using Milli Q water and autoclaved

Methyl Halide Vitamin Solution

Amount (mg/L)

Thiamine HCl 10

Nicotinic acid 20

Pyridoxine HCl 20

p-Aminobenzoic acid 200

Riboflavin 20

Biotin 1

Cyanocobalamine (Vit. B12) 200

Folic acid 4

Filter sterilized and stored refrigerated.

MAMSTY (Marine Ammonium Mineral Salts with Tryptone and Yeast Extract)

This is a complex medium based on MAMS with the addition of 1.0 g/L yeast extract

and 5.0 g/L tryptone prior to autoclaving.

2.3.2 10 x ANMS (Ammonium Nitrate Mineral Salts) Medium

This was made as described by Whittenbury et al., 1970 as a base for the marine

methylotroph growth medium described below. The other stock components, except

the vitamin solution described below can also be found in (Whittenbury et al., 1970).

41

2.3.3 Marine Methylotroph Growth Medium

Amount (per L)

10 x ANMS 10.0 mL

ANMS Trace Elements 1.0 mL

ANMS Molybdate Stock 0.5 mL

ANMS Fe-EDTA Stock 0.1 mL

ANMS Phosphate Stock 10.0 mL

Methyl Halide Vitamin Solution 5.0 mL

NaCl 35.0 g

After autoclaving, add phosphates and vitamins aseptically. ANMS is used at 0.1 x

above strength.

2.3.4 Choi Medium

This was used for the growth of Methylobacterium extorquens strain AM1 as

described by Bourque et al., 1995 except that 5.37 g/L of Na2HPO4.12H2O was used

in place of 4.02 g/L of Na2HPO4.7H2O. Filter sterilized methanol (Aristar , BDH

Laboratory Supplies) at 0.5 % (v/v) was used as the carbon source.

2.3.5 NMS (Nitrate Mineral Salts)

Medium for growth of Methylococcus capsulatus (Bath) was made as described by

Whittenbury et al., 1970 with 10 % (vol/vol) methane in the headspace as carbon

source.

2.3.6 C2 Medium

This was used for growth of Methylophilus methylotrophus W3A1 as described by

Colby & Zatman, 1973. A stock solution of 10 % (w/v) TMA (trimethylamine) was

filter sterilized and added to a final concentration of 0.3 % (w/v).

42

2.3.7 Luria-Bertani Medium

This was routinely used for the growth of Escherichia coli and prepared as described

by Sambrook & Russell, 2001.

2.3.8 f/2-Si Medium

This medium was used for the culture of all Emiliania huxleyi strains. The recipe

used was that of the Provasoli-Guillard National Centre for Culture of Marine

Phytoplankton (CCMP) and can be found on their website at the URL

http://ccmp.bigelow.org/CI/f2_family.html (Guillard & Ryther, 1962; Guillard, 1975).

It was made using aged and filter-sterilised and aged seawater from the English

Channel.

2.4 Growth and maintenance of bacterial cultures

All strains except E.coli were routinely grown in 25 mL of media in 125-mL serum

vials. Those that were grown on a MeX substrate were closed with blue Teflon

coated butyl rubber stoppers and crimp sealed. All cultures were grown with orbital

shaking at 200 rpm.

2.5 Microscopy

A Zeiss Axioskop (Germany) microscope with phase contrast and oil immersion was

routinely used to examine bacterial cultures and enrichments.

2.6 Sample collection and storage

Seawater samples were collected using a variety of different techniques depending on

the source of the sample and the availability of equipment at the time of sampling.

43

2.6.1 Arabian Sea samples

Water samples were taken using a SeaBird rosette sampler equipped within 24 x 30-L

Niskin bottles and CTD (conductivity, temperature and depth) devices. The exact

configuration of the system can be found in the AMBITION Cruise report available

from the Biological Oceanographic Data Centre website at the following URL:

www.bodc.ac.uk/projects/m&fmb.html. The Niskin bottles were sub-sampled using

their integral taps and a short length of Tygon tubing into 2 L polycarbonate bottles

rinsed three times with seawater sample. Water was treated in one of two ways. It

was filtered through 47 mm Polyethersulfone Supor-200 0.2 µm filters (Pall-Gellman)

using Nalgene filter housings and transferred to cryovials. These were subsequently

flash frozen in liquid nitrogen and stored at –80 oC. Alternatively water was filtered

through 0.2 µm Sterivex filter cartridges, which were sealed at either end with

Nescofilm, flash frozen and stored in 15 mL Falcon tubes at –80 oC.

At the end of the Cruise, the samples were packed in copious quantities of dry ice in

polystyrene boxes for the transfer from Oman to the UK. After no more than four

days in dry ice, they were transferred back to –80 oC where they remained until DNA

was extracted. Dry ice remained in the boxes when they were opened, indicating the

temperature had been maintained. A list of samples can be found in Appendix B.

2.6.2 Station L4 Samples

L4 Samples were collected using individual 5 L Niskin bottles and transferred to 2 L

polycarbonate screw-cap bottles. Surface water samples were collected in the same

type of bottles using the non-toxic seawater supply pump of the vessels RVS Squilla

and RVS Sepia. When larger volumes of surface water samples were required, 20 L

44

carboys (Nalgene) were filled from the non-toxic supply and sub-sampled back at the

laboratory.

2.6.3 Celtic Sea Samples

These samples were provided by Dr. Gary Smerdon of Plymouth Marine Laboratory

and were taken during a cruise aboard RRS Discovery (D261) in the Celtic Sea from

the 1st to 14th of April 2002.

2.7 Enrichment and isolation of CH3X-utilising marine bacteria

During the AMBITION Cruise alongside the filtering of water for DNA extraction

2 L of water were filtered through 47 mm, 0.2 µm Supor filters and the filtrate was

then resuspended in ~3 mL of sample water. This was repeated for both the 5 m

depth sample and the chlorophyll maximum sample, the depth of which was

determined by the CTD profile at each station. At station 6 an extra set of samples

were taken from the deep cast of 2501 m. An extra set at was also taken at 250 m at

station 8, together with a final extra set at station 11 at the salinity maximum. See

Appendix B for a complete list of samples.

100 µL of the filtrate suspension was added to each of twelve pre-prepared 25 ml

enrichment vials containing 5 ml of 0.1 x ANMS with 3.5 % (w/v) NaCl, ANMS trace

elements and the following 200 x vitamin solution, used at 1 x final concentration.

Amount (mg/L)

Folic Acid 4

p-aminobenzoic acid 200

Cyanocobalamine 200

45

Seven different carbon sources were used, either individually, or in combination with

one another, and at various concentrations, resulting in a set of twelve enrichments

being prepared for each sample.

2.7.1 Enrichment Conditions

Twelve different enrichment conditions were used on the cruise with the carbon

sources as shown in table 2.3.

Vial Carbon Source Gas Concentrations 1 0.1 % (vol/vol) CH3Br 85.9 µM CH3Br 2 0.5 % (vol/vol) CH3Br 429.3 µM CH3Br 3 1.0 % (vol/vol) CH3Br 859.7 µM CH3Br 4 50 mM Methanol 5 50 mM Methanol and

0.5 % (vol/vol) CH3Br 429.3 µM CH3Br

6 10 mM Methylamine 7 10 mM Methylamine and


8 10 mM Formate 9 10 mM Formate and


10 10 % (vol/vol) Methane 145.0 µM Methane 11 2 % (vol/vol) CH3Cl l 1536.5 µM CH3Cl 12 10 mM L-Methionine and


Table 2.3. Cruise enrichment conditions. Gas concentrations are calculated as described in Appendix C using the Henry’s law constants of De Bruyn & Saltzman, 1997.

2.7.2 A Note on gas concentrations in media

For the sake of practicality, gaseous carbon sources were added to the pre-sealed

crimp-top vials as a percentage of the headspace volume of the vial. Henry’s Law

was then used in order to calculate the concentration of the substrate in the aqueous

phase. The concentrations found with the most commonly used enrichment volume

formats for CH3Br and CH3Cl can be found in Table 2.4, below.

46

Gas Temp. (oC)

[Headspace] (%)

Headspace Volume (mL)

Medium Volume (mL)

[Medium] (µM)

CH3Br 20 0.2 100 25 176.9 CH3Br 30 0.2 100 25 148.6 CH3Br 20 0.2 300 700 128.0 CH3Br 20 0.1 19 5 85.9 CH3Cl 20 2 100 25 1574.8 CH3Cl 30 2 100 25 1173.8 CH3Cl 20 2 300 700 1176.8 CH3Cl 20 2 19 5 1536.5 Table 2.4. Selected concentrations of CH3X depending on the culture format employed. Headspace concentrations of 0.2 % (v/v) and 2 % (v/v) for CH3Br and CH3Cl

respectively were found to be the highest that did not exhibit toxicity as determined

by restriction of growth in enrichment culture. Enrichments could not be maintained

on higher concentrations of these CH3X.

2.8 O2 Electrode

A Rank Brothers (Cambridge, UK) digital Clark-type Model 10 oxygen electrode

connected to a Churchill thermocirculator was used for potentiometric studies. A

2 mL electrode chamber was used and the change in potential (oxygen consumption)

recorded on a Philips PM8251A one-line chart recorder. Sodium dithionate crystals

and air saturated de-ionised water were used to calibrate the electrode. The method

followed was that of Thompson et al., 1995. Gaseous substrates and substrates or

inhibitors with only limited water solubility were added as µl volumes of saturated

solutions prepared in stoppered and crimp-sealed 125 ml glass vials.

2.9 Gas Chromatography

Three gas chromatographic (GC) systems were used during the project, a GC with

flame ionisation detection (GC FID) and two GCs with electron capture detection

(GC ECD). The GC FID system was based at the University of Warwick in the

47

Department of Biological Sciences, and the GC ECD in the Biogas and Tracer Group

of Plymouth Marine Laboratory.

2.9.1 GC FID

This GC system (‘system one’) was used to determine the presence or absence of

CH3X in the headspace of cultures and enrichments. 100 µl of headspace gas was

injected manually into a GCD Gas chromatograph (PYE Unicam Ltd., Cambridge,

UK) fitted with a 1 m x 4 mm glass column containing Poropak Q (Phase Separations

Ltd., Deeside, UK). Oxygen-free N2 was used as the carrier gas at a flow rate of 30

mL min-1 and the oven temperature was 200 oC. The flame ionisation detector

generated peaks in potential and these were integrated by a 3390A Integrator (Hewlett

Packard, Berkshire, UK). The gas chromatograph was calibrated with known

amounts of standards using a range of dilutions of CH3Br and CH3Cl. Typical

retention times were 1.10 min and 1.65 min for CH3Cl and CH3Br respectively.

2.9.2 GC-Electron Capture Detection

The GC-ECD system (‘system two’) based at PML was initially designed around a

Shimadzu 8A gas chromatograph with custom built air purifiers and purge and trap

apparatus. The carrier gas was ECD grade He, with N2 as make-up and sparge gases.

After identification of an electronic problem with this system, the GC was changed to

a system previously used for the detection of fluorocarbons “system three” (Haine et

al., 1995). Both systems were partially automated. For further details of the design

and specifics of these systems see Chapter 3.

48

2.10 General Purpose Buffers and Solutions

TE buffer, 10 x TBE buffer, Southern hybridisation buffers and 6 x agarose gel-

loading buffer (with Ficoll and Bromophenol Blue) were prepared and used as

described in Sambrook & Russell, 2001.

2.11 DNA extraction methods

2.11.1 Hot phenol extraction

This method was used for the preparation of nucleic acids from environmental

samples concentrated on 0.2 µm Supor filters. The polyethersulfone from which these

filters are made is phenol-soluble, thus all the cells from the filter are released during

this procedure. The method used was that of Schaefer & Muyzer, 2001; briefly filters

are rinsed with ice-cold buffer and then cells are lysed by the addition of SDS and hot

(65 oC) phenol followed by incubation at 65 oC and frequent vortex mixing.

Subsequent phenol:chloroform:isoamyl alocohol (25:24:1) extractions result in DNA

purification and DNA is precipitated using sodium acetate. DNA was resuspended in

50 µl or 100 µl of sterile deionised water, by mixing overnight at 0-5 oC and then split

into two equal aliquots. A working stock was kept at –20 oC and a reserve stock was

stored at -80 oC.

2.11.2 DNA extraction from Sterivex filters

As the Sterivex filters are completely enclosed inside a cartridge casing, DNA

extraction was carried out using the method of Somerville et al., 1989. SDS,

lysozyme and proteinase K incubations accomplish cell lysis before subsequent

phenol:chloroform extractions and DNA precipitation. This method generally yielded

lower amounts of DNA in comparison to the hot phenol method as determined by

49

agarose gel electrophoresis, presumably due to adherence of the filtered biomass to

the surface of the filter.

2.12 Gel Electrophoresis

Depending upon the separation required 1-2 % agarose gels were prepared and run in

1 x TBE buffer. Small gels were run using a Flowgen minigel systems (Flowgen

Instruments Ltd., Sittingbourne, UK). Larger gels for Southern hybridisation were

run on BRL model H4 horizontal gel systems (Bethesda Research Laboratories,

Cambridge, UK). RFLP analysis was performed on 2 % agarose gels on the same

systems. For minigels, 0.5 µg/ml ethidium bromide was included during the casting

of the gels; for the larger gels, staining was carried out after electrophoresis by

soaking in 1 x TBE with 0.5 µg/mL ethidium bromide with gentle orbital shaking for

60 min. Destaining was carried out for 30 min in 1 x TBE. DNA was visualised by

placing the stained gels on a UV transilluminator and photographed using an instant

camera (CU5 Land Camera) loaded with Polaroid 665 black and white film.

Exposure times varied according to the intensity of the products. Alternatively,

particularly for the larger gels, a Gel Documentation system was used.

2.13 Quantification of DNA

This was carried out by two methods, depending upon the accuracy of measurement

required. For approximate determination of DNA concentrations, dilutions of DNA

solution were electrophoresed alongside with the Invitrogen 1 kb ladder at a

concentration of 0.5 µg/lane. At this concentration the 1 636 bp band is present at 50

ng. After ethidium bromide staining, the intensity of this band was compared to the

intensity of the DNA to be quantified and an estimate of DNA concentration was then

calculated.

50

For applications when more accuracy was required, or to compare the amount of

DNA produced from different DNA extractions a Nanodrop Spectrophotomer

(Nanodrop) was used to give concentrations of DNA. This system had the advantage

of being able to indicate the purity of the DNA sample, since protein concentration

would also be determined. This service was provided by the University of Warwick

Central Molecular Biology Services Laboratory.

2.14 Gel extraction of DNA

After electrophoresis, gel fragments were excised using an ethanol cleaned scalpel

blade and the DNA extracted using the QIAquick gel extraction kit (Qiagen)

according to the manufacturer’s instructions.

2.15 Restriction digests

Restriction digests of DNA were generally performed in 20 µL volumes in 0.5 mL

Eppendorf tubes with 10 U of enzyme, according to the manufacturer’s instructions.

A range of enzymes from different suppliers was used and these are indicated in the

text. Restriction digests for RFLP analyses were performed in 10 µL reaction

volumes and those for TRFLP analyses were carried out in 100 µL reaction volumes.

See below for details.

2.16 PCR

2.16.1 PCR reaction mixtures and conditions

PCR reaction mixtures were 2.5 mM MgCl2, 200 µM each dNTP, 10-25 pmol of each

primer (dependent on reaction), 1.3 M betaine, 1.3 % (vol/vol) DMSO, in 1 x

Invitrogen Taq DNA Polymerase buffer and 2.5 U of Taq DNA Polymerase

51

(Invitrogen, Paisley, UK) in a total volume of 50 µL, made up with sterile deionised

water. Thermal cycling was carried out on a Hybaid Touchdown thermal cycler with

initial denaturation at 95 oC for 5 min, whereupon the Taq DNA Polymerase was

added as a hot start. This was followed by 35 cycles of 1 min at 95 oC, 1 min at the

primers’ annealing temperature (see table 2.5), and 1 min at 72 oC, followed by final

extension step of 72 oC for 10 min.

2.16.2 PCR Primers

Table 2.5 lists the primers used for both the PCR and in sequencing reactions together

with details of the annealing temperatures used.

52

Primer Sequence (5’-3’)

Annealing temperature

Reference

CmuAF802 TTCAACGGCGAYATGTATCCYGG 55 oC* (Miller et al., 2004)

CmuAR1609 TCTCGATGAACTGCTCRGGCT 55 oC* (Miller et al., 2004)

CmuAF229 CTTTTYACKCCRGTGGAATGCGT 55 oC (Warner, 2003)

CmuAR824 CCRGGATACATRTCGCCGTTGAA N/A* This thesis cmuAR1244 TABTCCATKATBGCYTCGAC 55 oC Dr. Hendrik

Schäfer cmuAF1225 GTCGARGCVATMATGGAVTA 55 oC This thesis cmuAR1352 TCRCCVACGAYYTTCATSCC 55 oC This thesis 27F AGAGTTTGATCMTGGCTCAG 60 oC* (Lane,

1991) 1492R TACGGYTACCTTGTTACGACTT 60 oC* (Lane,

1991) 341F CCTACGGGAGGCAGCAG N/A* (Muyzer et

al., 1993) M13F GTAAAACGACGGCCA N/A* Invitrogen

Corporation M13R CAGGAAACAGCTATGA N/A* Invitrogen

Corporation mxaF1003 GCGGCACCAACTGGGGCTGGT 55 oC (McDonald

& Murrell, 1997)

mxaR1561 GGGCAGCATGAAGGGCTCCC 55 oC (McDonald & Murrell, 1997)

mxaR1555 CATGAABGGCTCCCARTCCAT 55 oC This thesis Table 2.5. PCR Primers used. An * indicates that the primer has been used successfully in sequencing reactions. Primer pairs used in the PCR are as follows: cmuAF802/cmuAR1609, cmuAF229/cmuAR1609, cmuAF1225/cmuAR1352 for cmuA amplification; 27F/1492R for 16S rRNA amplification; MxaF1003/MxaR1561 and MxaF1003/MxaR1555 for mxaF amplification.

2.17 Southern Hybridisation Analysis

Southern blotting (Sambrook & Russell, 2001) was used to transfer DNA onto Nylon

Hybond-N membranes (Amersham, Little Chalfont, UK). DNA was fixed to the

membrane using a UV Stratalinker (Stratagene, Cambridge, UK). Probes were

produced by PCR amplification of the desired segment of the target gene. The DNA

53

fragments were subsequently radiolabelled by the random priming method of

Feinburg & Vogelstein, 1983, with 50 ng of PCR product being labelled with 50 µCi

of 32P dGTP. Probes were denatured by addition of NaOH to a final concentration of

0.4 M prior to use in hybridisation reactions.

Hybridisations were performed according to the method of Feinburg & Vogelstein,

1983 using the buffers of Sambrook & Russell, 2001in a Hybaid oven (Hybaid Ltd.,

Middlesex, UK) with washing stringencies as described by Oakley & Murrell, 1988.

Removal of bound probe from membranes before reuse with other hybridisation

probes was achieved by boiling in 0.1 % (w/v) SDS for at least 10 min.

Fuji nif RX medical X-ray film was used for all microautoradiographs. Radioactive

membranes were exposed to this film in light-tight autoradiography cassettes with two

intensifying screens. Cassettes were stored at –80 oC for between 2 and 96 hr

depending on the signal intensity. Autoradiographs were developed using a Curix 60

automatic X-ray film developer (AGFA).

2.18 Cloning and Clone Library Dereplication

Cloning of PCR products was performed using the TOPO TA cloning kit (Invitrogen)

according to the manufacturer’s instructions. E.coli TOP10 cells were transformed

using the manufacturer’s chemical transformation method and plated according to the

manufacturer’s instructions for blue/white colony screening. Positive (white) clones

were picked onto LB agar containing 50 µg/mL Ampicillin. Master plates of 50

clones each were produced and kept at 0-5 oC for short-term storage. For long-term

storage, clones were grown in 10 mL of LB broth with 50 µg/mL Ampicillin added

from a stock of 100 mg/mL (filter sterilized and stored at –20 oC) and incubated at

54

37oC and 200 rpm shaking in an orbital shaker overnight. The cells were centrifuged

in order to obtain cell pellets, resuspended in 30 % (vol/vol) glycerol and stored at –

80oC.

For dereplication of the clone libraries, all clones were inoculated into 10 mL LB

broth using sterile wooden toothpicks as for the construction of glycerol stocks. After

growth of the overnight culture, 2 mL was taken for use in the alkaline lysis mini-prep

procedure of Sambrook & Russell, 2001. Plasmid DNA then was resuspended in

50 µl of sterile deionised water and was then subjected to restriction fragment length

polymorphism analysis as outlined below.

2.19 Restriction Fragment Length Polymorphism (RFLP) analysis

Restriction digests were performed on plasmid DNAin order to dereplicate the clone

libraries. Digests were carried out in a total volume of 10 µl in 0.5 ml

microcentrifuge tubes, with 2 µl of plasmid DNA and 0.5 U of restriction enzyme.

Double digests of plasmid DNA were with EcoRI, in order to liberate the cloned

insert from the vector, and another enzyme (in the case of cmuA either RsaI or DdeI).

0.25 U of each enzyme was used. Buffers were used according to the manufacturer’s

guidelines and the volume was made up to 10 µl with sterile Milli Q water. 2 µl of

100 µg/mL RNase (Promega) was added to reaction mixes in order to prevent RNA

smears obscuring restriction patterns. Restriction digests were incubated at the

manufacturer’s recommended temperature in a water bath for 16 hours. Loading

buffer was then added to each of the reaction mixtures and the entire volume was

loaded onto agarose mini-gels for electrophoresis. Gels were then stained with

ethidium bromide (EtBr) in order to enable visualisation of the DNA fragments. For

large clone libraries, 500 mL gels cast with 72 wells were used and these gave better

55

resolution of RFLP patterns than the mini-gels. Operational Taxonomic Units

(OTUs) contained within the clone libraries were defined as groups of clones

containing plasmid with unique restriction enzyme patterns. The identity of OTUs

was confirmed by sequencing.

2.20 DNA Sequencing

DNA sequencing was performed in the University of Warwick Central Molecular

Biology Services Laboratory using the BigDye dyedeoxyterminator ready reaction kit

(Applied Biosystems, Warrington, UK) and ABI3100 capillary DNA sequencers.

2.21 Sequence Analysis, Alignment and Phylogenetics

Analysis of 16S rRNA gene sequences was carried out by using the BLAST program

(Altschul et al., 1997) at http://ncbi.nlm.nih.gov/BLAST. The sequences were

aligned with the highest scoring hits using the fast-aligner included with the ARB

software (Ludwig et al., 2004) and the same software was used to produce

phylogenetic trees using the 16S rRNA database provided with the software.

Functional gene sequences were analysed using BLAST to check their identity and

then imported directly into “in-house” ARB databases set up for the relevant gene of

interest.

Phylogenetic trees were calculated using the neighbour-joining, DNAPars (maximum

parsiomony) and AxML (maximum likelihood) programs available in ARB.

Bootstrapping was carried out with at least 100 replicates in neighbour-joining and

DNAPars analyses and the trees produced by each algorithm compared to ensure the

stability of nodes. Bootstrapping for neighbour-joining analysis was carried out in

56

PHYLIP independently of ARB due to a known issue with ARBs implementation of

this algorithm. Trees were rooted with an appropriate relative in each case.

2.22 Terminal Restriction Fragment Length Polymorphism (TRFLP)

analysis

The method used was that of Moeseneder et al., 1999 with certain modifications. The

primers used were cmuAF802 with 5’ 6-carboxyfluoroscein (FAM) labelling and

cmuAR1609 with 5’ 6-carboxy-2’,4,4’,5’7,7’-hexachlorofluoroscein (HEX) labelling

(TAGN, Newcastle). The primers were provided high performance liquid

chromatography (HPLC) purified in order to preclude fluorescent label unbound to

primer and prevent it from interfering with peak detection. Primers were used as for

PCR reactions at 25 pmol per reaction. The PCR reactions were not precipitated prior

to gel extraction as described in the Moeseneder et al., 1999 method, but gels were

cast with wells large enough to take the entire volume of the reaction. This avoided

any potential loss of PCR product during the precipitation. Restriction enzymes

BsiYI (Roche), HaeIII (Helena biosciences) and HpaII (Helena biosciences) were

found to give the best discrimination between OTUs in either the forward, reverse or

both terminal restriction fragment lengths (TRFs); this was determined by analysis of

previously obtained cmuA sequences from cmuA clone libraries of marine

enrichments, using ARB sequence alignments (see also Chapter 6 and Appendix D).

Definition of an OTU was dependent upon the level of analysis. It was defined either

as a single TRF produced by a single restriction enzyme, or as the collation of each of

the three TRFs for each gene sequence. Amounts of product were determined on a

per sample basis by the University of Warwick Central Molecular Biology Services

Laboratory and samples were run with ROX 500 ladder in de-ionised HiDi formamide

on an ABI3100 capillary sequencer running in Genescan mode. Data were analysed

57

using Genemapper v.3.0 (Applied Biosystems, Warrington, UK). Genemapper

analysis parameters are discussed in Chapter 6.

58

Chapter 3

Measurement of Methyl Bromide

59

3 Chapter 3: Measurement of Methyl Bromide

3.1 Introduction

One of the aims of this project was to couple the molecular analysis of CH3X

degrading bacteria with measurements of CH3Br in the same seawater samples.

Gas/liquid chromatography was the natural choice for measurement of CH3Br as

many other investigators have demonstrated (e.g. Nightingale et al., 1995; Cicerone et

al., 1988; Grimsrud & Miller, 1978).

Gas/liquid chromatography (referred to henceforth as gas chromatography) involves

the separation of the component gases of a sample by means of a gaseous mobile

phase along a narrow tube, known as the column, which is coated with a liquid

stationary phase. The components of the sample are retarded at different rates

depending upon their partition into the liquid phase and can be identified by their

retention times on the column. Different compounds require different detectors to

maximise the sensitivity of the system and different column types and compositions to

maximise separation of the compound of interest from the others in the sample.

3.1.1 GC columns

There are many different types of column used in gas chromatography, depending on

the compounds you wish to differentiate, the composition of the sample and the

solvent used. Factors important in the separation of the sample include the length of

the column, the internal diameter of the column, the nature of the liquid phase, the

carrier gas used, and the composition of any support included for the liquid phase.

Two common types of column are discussed here.

60

Packed columns are commonly glass or stainless steel tubes which are packed with a

porous support material such as diatomaceous earth. The packing can be coated with

the liquid phase for the separation. The nature of the column means that they tend to

be shorter and have a wider internal diameter, which can limit the separation.

Capillary columns, with internal diameters of 0.18 to 0.53 mm are made from fused

silica and are coated with a polyamide polymer. This means they can be much longer

as they are more flexible and can be coiled, with lengths of 100 m being possible.

The liquid phase can coat or be chemically bonded to the inside of the column.

Some columns, such as PLOT columns (Porous Layer Open Tubular) do not have a

liquid phase at all and rely on separation between the carrier gas and a solid phase

bonded to the glass of the column.

3.1.2 GC detectors

Once the sample components have been separated from one another they must be

detected. There is a large range of different types of detector and they vary in their

selectivity and sensitivity, which in turn affects their potential applications. A

selection of common detectors and an approximate lower detection limit is shown in

table 3.1.

There were two detector types used in this study, a flame-ionisation detector (FID)

and two electron capture detectors (ECD). The FID is much less sensitive to CH3Br,

but it is simpler to run. It was used to demonstrate the presence or absence of the

relatively high concentrations with respect to atmosphere of CH3Br used in

enrichments and culture of CH3Br utilisers. With the improved sensitivity of the ECD

61

to halogenated compounds it is possible to measure the parts per trillion by volume

(pptv) levels of CH3Br in the atmosphere.

Detector Selectivity Lower Detection Limit ECD (Electron Capture Detector)

Halides, nitrates, nitriles, peroxides, anhydrides, organometallics

50 fg

FID (Flame Ionisation Detector)

Most organic compounds 100 pg

FPD (Flame Photometric Detector)

Sulphur, phosphorous, tin, boron, arsenic, germanium, selenium, and chromium containing compounds

100 pg

PID (Photo-ionisation Detector)

Aliphatics, aromatics, ketones, esters, aldehydes, amines, heterocyclics, organosulphurs, some organometallics

2 pg

TCD (Thermal Conductivity Detector)

Universal 1 ng

Table 3.1. A selection of common detectors used in gas chromatography. Adapted from technical information available from www.agilent.com.

3.1.3 Theory of electron capture detection

The ECD was invented by James Lovelock in 1959 (Lovelock, 2000; Lovelock,

1963). He used it to make measurements of compounds such as methyl iodide and the

chlorofluorocarbons (CFCs) in the marine boundary layer (Lovelock, 1973). It

enabled measurements of pesticides to pptv levels with such data informing Rachel

Carson’s book The Silent Spring in 1962 and empowering the environmental

movement.

The detector consists of a source of β-particles, normally 63Ni and two electrodes in a

sealed chamber. Make-up gas molecules, such as N2, are supplied constantly and

collide with the β-particles, ionising them and providing a stable electron cloud within

62

the detector (Fig 3.1). A constant current is maintained across this cloud by the

electrodes. As electronegative compounds from the column enter the detector, they

absorb electrons from this cloud and disturb the current. The detector’s electronics

compensate for this, maintaining the current, and the level of the perturbation is

equivalent to the concentration of the compound entering the detector. The fact that

the compound in order for it to be measured must disturb the electron cloud, lends the

detector its selectivity. Halogenated compounds disturb it significantly, whilst

hydrocarbons do not and cannot be detected at all. Oxygen strongly affects the signal

due to its high electronegativity and as such the make-up gas and carrier gas (which is

chemically inert and carries the sample to the detector) must be free of oxygen. It

also reduces the lifetime of the 63Ni β-emitter by oxidising it. Oxygen and water can

also deactivate the column coatings resulting in poor separation of compounds.

Fig 3.1. Diagrammatic representation of the Electron Capture Detector. The cathode is the casing of the detector.

3.1.4 Sample collection

Sample collection is a critical step in the analysis of seawater samples. Turbulence or

mixing with ambient air can alter the amounts of CH3Br present in the sample

especially if the sample is under- or over- saturated with respect to the ambient air.

Samples should be collected in gas tight vessels preferably of brown glass to prevent

63

photolysis. Vessels should also be completely filled, avoiding the presence of both

headspace and bubbles in order to prevent exchange of the dissolved gases with the

gaseous phase.

For the study at L4 sub-samples were taken from Niskin bottles, which can be

winched to the desired depth and fired and sealed remotely, in 300 mL darkened BOD

(Biological Oxygen Demand) bottles without headspace, avoiding bubbles, and

allowing the sample to over-flow before capping and avoiding contamination sources

such as ship’s exhaust.

3.1.5 Analysis of seawater

Samples for gas chromatographic analysis are normally gaseous, or easily volatilised.

Measurements of trace gases in seawater have their own inherent difficulties. Firstly

the levels of CH3Br present can be very low. At L4 the lowest concentration was

0.23 pmol dm-3 (8 % saturation with respect to atmosphere), and thus samples require

concentration prior to analysis. Secondly, the CH3Br needs to be completely stripped

from the seawater sample, as water adversely affects the ECD and seawater is also

corrosive to the mechanical components of the GC system.

Purge and trap methods offer the perfect solution to this (e.g. Krysell & Nightingale,

1994). The apparatus in Fig. 3.2 displays the major components of a purge and trap

system. The seawater sample is passed into the sparge tower from a gas-tight glass

syringe (1, syringe not shown). A purified gas, inert with respect to the compound

you are analysing, is bubbled through the seawater sample for enough time to strip the

dissolved gasses from it (A). Water is removed from this gas stream by a rage of

means that can include chemical driers, such as magnesium perchlorate (4), or by

64

physical means, such as condensation (3) or counter-current exchangers (5). Finally

the gas is passed through a collecting loop that is held above liquid nitrogen (not

shown). The gas of interest freezes and concentrates in the loop. Once the sample

has finished sparging a valve is thrown which enables carrier gas to pass through the

Fig. 3.2. Purge apparatus for GC ECD system two. Numbering refers to items in the text: 1. Sample inlet, 2. Sparge tower, 3. Condensation tube, 4. Magnesium perchlorate drying tube, 5. Nafion counter current exchange drier, 6. Bubble flow meter. Gas flow direction is indicated: A. Sparge gas inlet, B. Sparge gas containing sample outlet, C. Counter-current gas inlet.

loop, which is rapidly heated, driving the concentrated sample onto the column in a

single pulse. Both ECD systems (systems two and three) employed this methodology

for analysis of CH3Br from seawater samples.

3.1.6 Advantages of automation

It was decided that the GC systems used for CH3Br measurement should be

automated as far as possible. This has several advantages, including the fact that it

facilitates operation of the system during ship-based fieldwork. Under any

circumstances it can be difficult to throw the valves in time in the correct sequence

and in a reproducible way, this is rendered more difficult when the system is at sea.

Automation of the system using computer- or integrator-driven programming allows

the reduction or removal of much of the variability between samples

1

2 3

4

5

4

A

B

Fig 3.4. Diagram of GC ECD System two. Solid black lines indicate 1/8 “ Swag

Fig 3.4. Diagram of GC ECD System two. Solid black lines indicate 1/8 “ Swagelok stainless steel tubing, except in the case of the cryofocussing loop which is 1/16 “ Swagelok stainless steel tubing. The area in the dashed box is the water sample purging tower and drying apparatus. C

65

3.2 System one

This system had flame ionisation detection of CH3Br and was also able to detect

CH3Cl. It was fitted with a Porapak Q packed column. It was used to monitor the

disappearance of CH3Br from enrichment cultures and was calibrated by using a range

of standard concentrations of CH3Br. Samples were injected manually through a

septum. See methods section for further details. Owing to the nucleophilic attack by

chloride ions in the media and seawater of enrichments, CH3Br became gradually

substituted to CH3Cl and degradation of the two methyl halides could only be

separated when consumption rates by the enrichment exceeded the substitution rate.

Enrichments were considered to have consumed all the CH3Br when both CH3Br and

CH3Cl peaks were undetectable (Schaefer et al., 2005).

66

3.3 System two

The core of this system was a Shimadzu GC 14A ECD gas chromatograph with an HP

PLOT Q 30 m 0.53 i.d. megabore column and integration by a Chromjet

Spectraphysics integrator. A gas purifier system was built using swagelok connectors

and water and O2 strippers (Supelco, UK) in order to purify the carrier (He), make-up,

sparge and Nafion counter-flow (all N2) gases (see Fig. 3.3)

Fig 3.3. Gas purifier system for removing water, oxygen and other contaminating molecules (such as hydrocarbons) from the carrier, make-up, sparge and Nafion counter flow gases prior to entering the GC system two.

The system was initially designed to be fully automated, with a system of solenoid

and 6-port valco valves for taking in, sparging and removing the seawater sample,

cryotrapping and release of the sample to the GC column and the switching of sample

stream between the main column and a pre-column (see Fig 3.4). All tubing was 1/8”

or 1/16” stainless steel and the valves that came into direct contact with seawater were

Hastalloy C rather than stainless steel as this has greater long-term resistance to the

67

corrosive effects of seawater. The presence of a pre-column in the system allowed the

sample to be diverted once the CH3Br peak had been detected, preventing other

compounds present in the sample from entering the main column and speeding up the

analysis time as there was no need to wait for these other compounds to leave the

main column before starting another sample. Flow rates for the carrier and make-up

gases ranged between 1-5 and 30-40 ml min-1 respectively as the system was being

tested for measurement of CH3Br and the GC oven was run isothermally at 60oC (the

coolest stable temperature setting) with the detector at 320oC.

CH3Br was detectable using the system, but seemed to be extremely variable in the

seawater samples from L4 used to test it. It was unknown at the time whether this

was an artefact of the sample or analysis methodology or a true representation of

natural variability. It was also discovered by using pure CH3Br diluted in laboratory

air as a standard that there seemed to be a fault with the electronics of the GC, which

resulted in the signal output remaining off-scale despite the actual signal being

transient, a fault known as ‘latch-up’. Owing to this problem and attention being

required on other aspects of the project this system was abandoned.

68 Fig 3.4. Diagram of GC ECD System two. Solid black lines indicate 1/8 “ Swagelok stainless steel tubing, except in the case of the cryofocussing loop which is 1/16 “ Swagelok stainless steel tubing. The area in the dashed box is the water sample purging tower and drying apparatus.

69

3.4 System three

Rather than starting from scratch system three was based on a system previously used

for the detection of chlorofluorocarbons (Haine et al., 1995) and the testing and

validation of the system for measurement of CH3Br was started by Malcolm Liddicoat

at PML, continued by myself; the system was finally used to measure natural

concentrations of CH3Br in seawater at L4 by Malcolm. The system was partially

automated with programmable control from a Chromjet Spectraphysics integrator and

actual integration of the signal performed by a personal computer running

ChromPerfect version 3.52 (Justice Innovations Inc., California, US), which

facilitated data handling. The column was a DB-624, 60 m, 0.32 mm widebore

capillary column with 8 µm film from J&W Scientific, which had been found to give

better separation than the HP PLOT Q column used on system two (Malcolm

Liddicoat pers. comm.). The gas purifier set-up was not required for this GC as the

gases were supplied in BIP cylinders (Built-in purifier) by Air Products (UK). The

flow rate of the N2 make-up gas was 30 ml min–1 and the He carrier gas was

5 ml min-1. The sensitivity of the ECD changed whilst the system was in use as the

detector was ageing and the 63Ni source becoming attenuated, by both natural

radioactive decay and the oxidation of the 63Ni. This resulted in the make-up gas

flow-rate having to be increased to 55 ml min-1 in order to ensure the same level of

sensitivity. A gravimetric standard of 500 ppm CH3Br (BOC, UK) was measured

with each batch of runs allowing standardisation despite this.

200 mL seawater samples were sparged for 20 min with BIP N2 at 110-120 ml min-1,

which had been demonstrated to remove CH3Br from the sample to a level below the

detection limits of the system (Malcolm Liddicoat pers. comm.). The gas stream was

70

dried using two magnesium perchlorate drying tubes and cryotrapped on a 1/16”

stainless steel loop held above liquid N2 and maintained at –150oC for the 20 min

sparge time. After 20 min valves were thrown automatically and simultaneously the

liquid nitrogen removed and replaced with boiling water to drive the gas sample onto

the column.

3.5 L4 results

Samples were taken from station L4 for CH3Br measurement from 10th July 2003 to

23rd November 2004, with a hiatus from March to August 2004, as the GC was

required for a cruise. Data were corrected for cryofocussing loop volume (50 µl to

1000 µl), and calibrated against a 500 ppb standard, which corrected for natural drift

of the detector. The detector was changed on the 6th October 2003 and the standard

runs, which were carried out at least once with each batch of samples and usually two

or three times, allowed continuation of the data set. Contaminated samples and those

with no calibration were discarded to produce the graphs in Fig 3.5.

Saturations of CH3Br in the water column seem to vary quite strongly and rapidly and

are reported relative to atmospheric CH3Br concentration (100 % being at

atmospheric concentration, < 100 % undersaturated and > 100 % supersaturated. On

the 13th October 2003 saturations of 164.0 % were measured at 50 m, and became

progressively less saturated until 47.3 % was measured at 10 m depth. The following

week (21st October 2003) levels in the water column were fairly uniform with large

undersaturations of 16.9, 16.3 and 12.9 % measured at 50 m, 10 m and 0 m

respectively.

71

This suggests that CH3Br was being actively produced and rapidly degraded. The

peaks in CH3Br supersaturations occurred in August and September of both 2003 and

2004 and it is a shame that there is gap in the data between March and August 2004 as

this would presumably have demonstrated the transition from undersaturated to

supersaturated levels of CH3Br in the water column.

Comparison of the CH3Br data with the available data from L4 on phytoplankton

abundance (2003 only) indicated that the peak in CH3Br correlated with peaks in the

abundance of both phytoplankton in general and species known to be CH3Br

producers such as Emiliania huxleyi (Fig 3.6). Pearson correlation analysis indicated

that CH3Br abundance was significantly positively correlated with both E. huxleyi and

colourless dinoflagellate abundance. It is interesting to note that the peak in CH3Br

lags behind the peaks in phytoplankton abundance, this agrees with observations that

it is produced by phytoplankton entering stationary phase and senescence/death.

My hypothesis would be that CH3X degrading bacteria bloom in response to the

elevated levels of CH3Br at L4 as the phytoplankton reach their stationary phase and

that the bacteria are responsible for the rapid switch from supersaturated to

undersaturated that can be seen. It is also possible that the CH3Br utilising bacteria

bloom in response to elevated levels of other nutrients released by the lysis of

phytoplankton, and degrade CH3Br alongside these other carbon and energy sources.

The data gives a tantalising glimpse of this possibility, but as there is no molecular or

bacterial evidence that correlates with this data set it is impossible to test this

hypothesis.

72

Enrichments from L4 were inoculated from samples collected on the 18th April 2002,

20th June 2002 and 30th July 2002, and cmuA PCR products detected from all three

enrichments, indicating the presence of bacteria capable of utilising CH3X at all these

times. If patterns of previous years are followed it is likely that the July, and possibly

June samples were taken during a period of supersaturation of CH3Br with respect to

the atmosphere and the April sample during a period of undersaturation.

73

Fig 3.5. L4 CH3Br measurements. Data is expressed as % saturation with respect to atmosphere and the solubility of CH3Br was calculated using the method of (De Bruyn & Saltzman, 1997). The first sample data point was 02/07/2003. The data shown in red are CH3Br measurements irrespective of the depth of sampling. Those in pink are water column means. The gap prior to day 200 of sampling is present as although sampling had begun, data was discarded due to poor calibrations.

74

Fig 3.6. Phytoplankton abundance and CH3Br concentration at L4. ‘Picos’ refers to picoeukaryotes, CH3Br data are the water column means and also averaged when there was more than one reading per week. L4 data from the L4 plankton monitoring programme, Plymouth Marine Laboratory, available from http://www.pml.ac.uk/L4/.

75

3.6 Potential proxies for CH3Br measurement

CH3Br measurements were not taken on the AMBITION cruise, as the GCD ECD

system two which was available at the time was not operational. It is possible to

hypothesise the presence of CH3Br at the sampling stations from other measurements

that were taken.

3.6.1 Pigments

A large number of different macro- (Laturnus, 1995; Laturnus et al., 1998) and micro-

algal (Saemundsdottir & Matrai, 1998; Scarratt & Moore, 1998) species have been

demonstrated to produce CH3Br in laboratory culture (table 3.2).

Certain marine phytoplankton are known to have characteristic pigments which can

be extracted from seawater samples and analysed by HPLC, giving an indication of

the presence of these groups in the samples. Table 3.3 indicates groups of organisms

and the chlorophylls, carotenoids and biliproteins that can be linked with them.

76

Class Organism Culture

collection ID Study

Diatom Chaetoceros diversum (Saemundsdottir & Matrai, 1998)

Chaetoceros atlanticus (Saemundsdottir & Matrai, 1998)

Chaetoceros calcitrans CCMP315 (Scarratt & Moore, 1998)

Dinophyte Amphidinium carterae (Saemundsdottir & Matrai, 1998)

Prorocentrum micans (Saemundsdottir & Matrai, 1998)

Prorocentrum sp. CCMP703 (Scarratt & Moore, 1998)

Prorocentrum tricornatum (Scarratt & Moore, 1998)

Prasinophyte Pynococcus provasolii (Saemundsdottir & Matrai, 1998)

Prymnesiophyte Phaeocystis sp. (Saemundsdottir & Matrai, 1998)

Phaeocystis sp. (Stefels & Van Boekel, 1993)

(Scarratt & Moore, 1998)

Haptophyte Emiliania huxleyi CCMP373 (Scarratt & Moore, 1998)

Cyanobacteria Synechococcus sp. CCMP1334 (Scarratt & Moore, 1998)

Rhodophyta Porphyridium sp. UTEX190 (Scarratt & Moore, 1998)

Table 3.2. Marine phytoplankton demonstrated to produce CH3Br in laboratory cultures. CCMP is the Provasoli-Guillard National Centre for Culture of Marine Phytoplankton, Maine, US. UTEX is the University of Texas Culture Collection of Algae.

77

Pigment Class Pigment (abbreviation) Phytoplankton Group Chlorophylls Chlorophyll a (Chla) All photosynthetic micro-

algae, except prochlorophytes.

Divinyl chlorophyll a (DvChla) Prochlorophytes. Chlorophyll b (Chlb) Green: chlorophytes,

prasinophytes, euglenophytes.

Divinyl chlorophyll b (DvChlb) Prochlorophytes. Carotenoids Peridinin (Per) Dinoflagellates. 19’-Butanoyloxyfucoxanthin (But) Some prymnesiophytes

one chrysophyte, several dinoflagellates.

Fucoxanthin (Fuc) Diatoms, prymnesiophytes, chrysophytes, raphidophytes and several dinoflagellates.

19’-Hexanoyloxyfucoxanthin (Hex) Prymnesiophytes and several dinoflagellates

Violaxanthin (Vio) Green algae: chlorophytes, prasinophytes, eustigmatophytes.

Diadinoxanthin (Ddx) Diatoms, dinoflagellates, prymnesiophytes, chrysophytes, raphidophytes, euglenophytes.

Alloxanthin (Allo) Cryptophytes. Zeaxanthin (Zea) Cyanophytes,

prochlorophytes, rhodophytes, chlorophytes, eustigmatophytes.

Lutein (Lut) Green algae: chlorophytes, prasinophytes.

Table 3.3. Linking pigment presence with classes of phytoplankton (Baker et al., 1999; Schluter & Mohlenberg, 2003; Wright et al., 1991)

78

In terms of using pigments as markers of the presence of classes of phytoplankton

whose members have been demonstrated to produce CH3Br in laboratory culture, the

pigments of interest are fucoxanthin and diadinoxanthin (diatoms, that were actually

dinoflagellates,prymnesiophytes); peridinin (dinoflagellates); 19’-

hexanoyloxyfucoxanthin (dinoflagellates and prymnesiophytes); violaxanthin and

Lutein (prasinophytes); 19’-butanoyloxyfucoxanthin and (prymnesiophytes) of those

measured on the AMBITION cruise (Fig. 3.7).

79

Fig 3.7. Pigment concentrations during the AMBITION cruise in ng L-1. Please note the changing scales of different pigments. Maximum pigment levels were 106.04 ng L-1 Alloxanthin (stn 11), 1013.69 ng L-1 19’-Butanoyloxyfucoxanthin (stn 10), 157.41 ng L-1 Diadinoxanthin (stn 10), 2165.26 ng L-1 Fucoxanthin (stn 9), 376.68 ng L-1 19’-Hexanoyloxyfucoxanthin (stn 8), 3367.1 ng L-1 Chlorophyll a, 14.83 ng L-1 Lutein (stn 10), 279.35 ng L-1 Peridinin (stn 9), and 42.6 ng L-1 Violaxanthin (stn 10). In all cases the maximum pigment levels were at the chlorophyll maximum for that station based on fluorimetry measurements (RRS Charles Darwin 132 Cruise report, ).

80

At every station pigments characteristic of clades whose members have been

demonstrated to produce CH3Br in laboratory culture could be shown to be present,

with increasing concentrations and hence abundance towards the northerly eutrophic

stations. It is possible to hypothesise that CH3Br was therefore produced in these

waters. There are important caveats however; not all members of the phytoplankton

clades shown to produce CH3Br are capable of CH3Br production; it is not known

what the physiological state of the phytoplankton was at the time of sampling as

production has been linked to stationary phase and senescence/degradation; and

pigments are not generally restricted to particular groups that have been shown to be

CH3Br producers (Saemundsdottir & Matrai, 1998; Scarratt & Moore, 1998).

3.6.2 Sea surface temperature (SST)

Sea surface temperature has been correlated with saturation and undersaturation

anomalies of CH3Br (King et al., 2002). The variability in SST has been shown to

contribute to one-half to two-thirds of the variability in methyl bromide oceanic

saturations. The remaining variability is accounted by for other factors including

biological production and degradation. Data from six cruises was fitted to two

quadratic equations for spring and summer, and autumn and winter. The equations

reproduce the saturation anomaly for CH3Br on a global scale, but fail to reproduce

accurately the anomaly as measured on regional scales. At the time of the

AMBITION cruise the equations would predict an undersaturation with respect to

atmosphere of approximately –15 to –20 %. Measurements of CH3Br in

phytoplankton blooms have demonstrated supersaturations (Baker et al., 1999;

Wingenter et al., 2004) and it is likely that this was the case in the eutrophic northern

cruise stations where phytoplankton production was abundant (see Appendix C). A

81

further limitation is that this method only indicates saturation anomaly with respect to

atmosphere. It cannot indicate whether CH3Br is produced and quickly utilised by

bacteria, or whether it is produced at a greater rate than consumption, either of which

could be measured as both super- and under-saturations.

3.7 Discussion

The difficulty with which a GC system was constructed that was capable of

measuring the extremely low CH3Br concentrations in seawater samples left us unable

to precisely correlate the presence and abundance of CH3Br with the molecular

ecological data of the presence and diversity of cmuA and hence the presence of

bacteria capable of using CH3X as sole carbon and energy sources. Methyl bromide

measurements were taken at L4 and demonstrated that levels varied from extremely

undersaturated (lowest value 7.9 % saturation or 0.23 pmol/l, January 2004) to

supersaturated (highest value 214.6 % saturation or 4.70 pmol/l, September 2003) and

that this showed some consistency with season and the abundance of phytoplankton.

The problems with GC system two and its apparent measurement of highly variable

CH3Br levels may have been due to natural variations in the levels of the compound,

as demonstrated by the measurements with system three noted above. It still remains

that there were also electronic problems with this system, which justifies the

abandonment of this system and switch to system three.

Potential proxies for the direct measurement of CH3Br were investigated in order to

gain an appreciation of the levels of the compound during the AMBITION cruise, but

found to be either qualitative (pigment measurements) or not applicable/inaccurate at

the required scale (the models of King et al., 2002).

82

In future now that the system three GC is capable of sensitive and calibrated

measurements of CH3Br it should be facile to take simultaneous samples for the

evaluation of the microbial population capable of degrading the compound. It might

also be possible to take measurements of pigment abundance alongside this in order to

validate the methodology above and estimate the abundance of CH3Br using the

simpler pigment methodology when GC systems are unavailable. It would also be

extremely interesting to investigate how many bacteria capable of utilising CH3Br are

present at L4 throughout the seasonal cycle, using quantitative molecular methods

such as real-time PCR, to see whether this correlates with the observed super-and

under-saturations of the compound in the water column.

83

Chapter 4

Enrichment and Isolation of

CH3Br-utilising bacteria

84

4 Chapter 4: Enrichment and Isolation of CH3Br-Utilising Bacteria

4.1 Introduction

Marine systems are both an important source and sink of CH3Br to and from the

atmosphere (Baker et al., 1999; Tokarczyk et al., 2003). Marine sources of CH3Br

include both micro- and macro-algae (Scarratt & Moore, 1998) and (Laturnus et al.,

1998). Marine sinks are less well understood and believed to be biological and

associated with plankton within the bacterial size range (King & Saltzman, 1997).

When this study was initiated only a single marine strain capable of utilising CH3Br

as sole carbon and energy source had been isolated; Leisingera methylohalidivorans

MB2, isolated from a marine tide-pool in California (see Chapters 1 and 7 for more

information on this strain). No open-ocean strains had been isolated. Hoeft et al.,

(2000) used marine enrichments with combinations of DMS, trimethylamine,

dimethylamine, together with CH3Br as co-substrate in order to isolate DMS and

CH3Br-degrading organisms. They obtained 4 isolates from Long Island Sound one

of which (strain LIS 3) seemed to be able to utilise CH3Br as sole source of carbon

and energy. However they concluded that degradation of CH3Br was a co-metabolic

trait. Further information is unavailable for this strain.

Thermodynamically, using Gibbs free energy values under standard conditions

(Aylward & Findlay, 1986) complete oxidation of CH3Br could provide –723.8 kJ/mol

of energy (Fig 4.1). Using the method of (Heijnen & Van Dijken, 1992), which takes

into account physiological values and a range of electron acceptors, the predicted

growth yield on CH3Br is 17.75 g dry weight/mol (± 30 %).

85

CH3Br + 1.5O2 CO2 + H2O + Br- + H+

-28.0 -16.4 -386.0 -237.2 -104.0 0

Fig. 4.1. Chemical equation for complete oxidation of CH3Br. Standard Gibbs free energy values of formation are included beneath each species.

The aim of this section of work was to enrich for and isolate bacteria capable of

utilising CH3Br as sole carbon and energy source, particularly from the Arabian Sea,

in order to demonstrate the presence of these organisms and to gain insights into their

involvement in marine CH3Br cycling.

86

4.2 Arabian Sea enrichments

During the NERC Thematic Cruise, AMBITION (Cruise CD132, aboard RRS Charles

Darwin), a large number of samples were taken for DNA extraction and molecular

analyses of CH3Br-utilising bacteria. Alongside this an array of enrichments was set

up with a range of carbon sources from all stations in order to enrich any of these

organisms that might be present.

4.2.1 Enrichment production and initial screening

Enrichments were set up in batches of twelve with the carbon sources as listed in

Table 4.1 (see Chapter 2 for more details). At each station 2 L of surface water and

water from the depth of the chlorophyll maximum was filtered and resuspended in 3

mL of water from the same sample. 100 µl of this was added to each vial of the set of

twelve. The enrichments were then stored in a constant temperature room at 20 oC to

await transport to the UK.

Vial Carbon Source 1 0.1 % (vol/vol) MeBr 2 0.5 % (vol/vol) MeBr 3 1.0 % (vol/vol) MeBr 4 50 mM MeOH 5 50 mM MeOH and 0.5 % (vol/vol) MeBr 6 10 mM Methylamine 7 10 mM Methylamine and 0.5 % (vol/vol) MeBr 8 10 mM Formate 9 10 mM Formate and 0.5 % (vol/vol) MeBr 10 10 % (vol/vol) Methane 11 2 % (vol/vol) MeCl 12 10 mM L-Methionine and 0.5 % (vol/vol) MeBr

Table 4.1. Carbon sources in enrichment vials

87

Enrichments were screened after 2 to 8 weeks (depending on whether they were

collected towards the beginning or end of the cruise), by scoring turbidity by eye (as

there was only a small amount of enrichment available it was desirable to retain all of

the sample rather than using a destructive method of biomass measurement, Table

4.2) and by gas chromatography to assess the presence or absence of CH3Br and

CH3Cl.

Station Depth (m)

1 2 3 4 5 6 7 8 9 10 11 12 Vial Number

1 5 12 1* 74 24 2 5 36 2* 62 48 3 5 60 3* 63 72 4 5 84 4* 77 96 5 5 108 5* 36 120 6 2501 132 6 5 144 6* 40 156 7 5 168 7* 49 † 180 8 5 192 8* 29 204 8 250 216 9 2.5 228 9* 7.5 † 240 10 5 † 252 10* 27 † † † † 264 11 5 276 11* 26 288 11 90 300 Table 4.2. Turbidity estimation of Arabian Sea cruise enrichments. White boxes indicate no turbidity; light blue indicates slight turbidity, through to dark blue indicating significant turbidity. The vial number at the end of each row indicates the numbering of the twelfth vial in each set. * Indicates samples considered to be at the chlorophyll maximum by CTD fluorimetry. † Indicates samples which demonstrated CH3X levels below the detection limit of the GC –FID. The two samples that are crossed were damaged during transport back to the UK.

88

The vials selected for initial maintenance were those in Table 4.3. CH3Br was added

to the headspace at 0.2 % (vol/vol), which had been found to be the highest level

tolerated without inhibition of growth in other enrichments (Schaefer et al., 2005) and

when growing CH3Br utilising strains. They were then left for a further two weeks, at

which point they were subcultured at 1 % inoculum size into larger 125 ml vials with

20 ml of 0.1X marine ANMS medium (see Chapter 2, Materials and Methods).

Enrichments on CH3Cl were supplied with 2.0 % CH3Cl as this compound is less

toxic and some CH3X-utilising bacteria have demonstrated higher substrate affinities

for this compound, as can be demonstrated by potentiometric (O2 electrode) studies

(see section 4.5).

Vial Number Conditions Station Depth (m) 179 2.0 % CH3Cl 7 49 229 0.1 % CH3Br 9 7.5 243 1.0 % CH3Br 10 5 253 0.1 % CH3Br 10 27 254 0.5 % CH3Br 10 27 255 1.0 % CH3Br 10 27 263 2.0 % CH3Cl 10 27

Table 4.3 Arabian Sea enrichments positive for CH3X utilisation.

The remaining enrichments were split into groups based on whether they displayed

turbidity and on whether they had been exposed to CH3X. Those with CH3X were

monitored for depletion of CH3X in headspace, only four further enrichments were

observed where this was the case, 165, 189, 249 and 273; all four originally enriched

with 10 mM formate and 0.5 % (vol/vol) headspace CH3Br and originating from

stations 7, 8, 10 and 11 respectively at 5 m depth.

Turbid enrichments that had been enriched with substrates other than CH3X were

pooled to form a general methylotrophic pre-enrichment and then given only 0.2 %

CH3Br. The rationale was that providing a less toxic growth substrate initially would

89

allow proliferation of CH3X utilisers that were also capable of growth on other C1

growth substrates and that when supplied with CH3Br they would utilise this more

rapidly than in the case of CH3X only enrichments. 0.1 ml of each turbid enrichment

from conditions 4, 6, 8, and 10 was added to 25 ml of 0.1 x marine ANMS with 0.2 %

(vol/vol) headspace CH3Br in a 125-ml crimp-seal vial. All enrichments were

incubated at room temperature and in the dark to discourage the growth of

phytoplankton.

4.2.2 CH3Br utilisation

The nine subcultured enrichments, together with the pooled enrichment were

examined periodically for utilisation of headspace CH3X. With media containing Cl-

at seawater concentrations (~35 g L-1) CH3Br undergoes nucleophilic substitution to

CH3Cl (Elliott & Rowland, 1993) and therefore enrichments were not considered to

be depleted of CH3X until both compounds were below the detection limit of the GC-

FID. At this point another pulse of the appropriate CH3X was added to the vial after

removing the same volume of headspace in order to keep the pressure inside the vial

constant.

The pooled enrichment stopped oxidising CH3Br after one pulse of 0.2 % (vol/vol)

and was further subcultured to fresh medium at an inoculum size of 5 % in order to

encourage oxidation. This enrichment was labelled PE2 (Pooled Enrichment 2). This

also occurred with the enrichments in table 4.3 above and they were also subcultured.

PE2 actively degraded CH3Br whereas the other subcultured enrichments failed to

oxidise any more CH3Br, either in the subculture or the original enrichment. The

remaining enrichments, all pre-enriched on Formate together with CH3Br continued

oxidising pulses of the compound for varying amounts of time (see table 4.4)

90

Enrichment Station Number of 0.2 % CH3Br pulses

Total amount CH3Br consumer (µmoles)

165 7 5 223.2 165.2 7 2 89.2 PE2 Pooled 13 580.4 189 8 2 89.2 249 10 5 223.2 273 11 6 267.9 Table 4.4. Total CH3X consumed by enrichments.

Oxidation of CH3Br by enrichment cultures can be seen in Fig 4.2. The data have

been adjusted against the chemical control (also shown), which indicates the chemical

degradation rate of CH3Br when incubated with autoclaved media, due to nucleophilic

substitution and hydrolysis. A standard curve was unavailable for this data set and so

averages of the CH3Br peak area for all other standard runs of five different

concentrations (1 %, 0.5 %, 0.2 %, 0.05 % and 0.01 %) of CH3Br were taken and a

headspace concentration calculated from the polynomial regression. The R2 value for

this regression was 0.9954.

91

Fig 4.2. Oxidation of CH3Br by four enrichments. Rates were calculated for the fastest initial portion of the graph, between 18/10/2002 and 29/10/2002. The chemical loss rate was 0.18 µM CH3Br/day. Oxidation rates were 11.32, 10.03, 8.18 and 4.32 µM CH3Br/day for enrichments 165, 189, 249 and 273 respectively, after adjusting for the chemical control.

4.3 L4 enrichments

The enrichment strategy with L4 samples was different to that of the Arabian Sea

samples. Arabian Sea samples were transferred to media, partly in order to avoid the

complications of setting up vials at sea with a wide range of substrates, two of which

(CH3Br and CH3Cl) were quite toxic. The enrichments were also very small in

volume, to keep transportation problems to a minimum. At L4 large (~1.15 l) crimp-

seal vials were used and filled with 300 ml of surface seawater samples on three

occasions, 18th April (L4.1), 20th June (L4.2), and 30th July (L4.3) 2002. Again they

were incubated at room temperature in the dark and monitored for depletion of 0.2 %

CH3Br by GC-FID. L4.1 consumed 5 pulses of 0.2 % (vol/vol) headspace CH3Br and

L4.2 and L4.3 consumed 3 pulses each, corresponding to 312.5 µmoles and

187.5 µmoles of CH3Br respectively.

92

4.4 Non-axenic phytoplankton enrichments

(Schafer et al., 2002) demonstrated that stable relationships existed between uni-algal

diatom cultures and the co-cultured bacteria and that distinct satellite bacteria

assemblages could be found with the algal cultures. Also, axenic and non-axenic

phytoplankton cultures have been demonstrated to produce CH3Br under laboratory

culture conditions (Scarratt & Moore, 1998) and it was hypothesized that it would be

an advantage in non-axenic cultures for the associated bacteria to be able to use

CH3Br as a carbon and energy source. Six cultures of the coccolithophore Emiliania

huxleyi were obtained from the culture collection of Dr. Declan Schroeder (Marine

Biological Association, UK) and flow cytometry was used to confirm whether or not

they were axenic (Table 4.5).

Strain Axenic/Non-Axenic E. huxleyi 92A Non-axenic E. huxleyi 373 Very poor growth, many bacterial sized

particles on flow cytometry E. huxleyi 373 UEA Axenic E. huxleyi 379 Very poor growth, many bacterial sized

particles on flow cytometry E. huxleyi 1516 Non-axenic E. huxleyi 1516 CCMP Non-axenic

Table 4.5. E. huxleyi culture axenicity. Strain designations refer to those of the MBA, UK culture collection.

E. huxleyi strain 1516 CCMP was used as this culture was non-axenic and grew most

readily. Two approaches were used. In approach one, the strain was grown in a 1 L

crimp-seal vial with sterile needles attached to 0.2 µm sterile acrodisc (Pall-Gelman)

filters attached to allow gas exchange. Once the culture had grown the venting

apparatus was removed and CH3Br added to a headspace concentration of 0.2 %

(vol/vol). This was then monitored for depletion of CH3Br. In approach two a

stationary phase culture of E. huxleyi 1516 CCMP was filtered through a 1.2 µm

93

47 mm cellulose nitrate membrane filter in order to remove the phytoplankton cells.

20 ml of filtrate containing the satellite bacterial population was added to a 125-ml

crimp-seal vial and given 0.2 % (vol/vol) headspace CH3Br. This vial was also

monitored for depletion of CH3Br. Neither of the enrichments demonstrated loss of

CH3Br over a period of 6 months. This approach has subsequently been successfully

used by Hendrik Schäfer (pers. comm.) to isolate dimethyl sulfide-utilising bacteria,

present as satellite organisms in non-axenic cultures.

4.4.1 Isolation strategy

The isolation strategy used was identical to that of Schaefer et al., 2005 (see also

Chapter 2, Materials and Methods), briefly 50 µl aliquots of Arabian Sea and L4

enrichments were plated in duplicate onto MAMS plates at three different dilutions

(10-2, 10-3 and 10-4) and incubated in anaerobic gas jars (Becton Dickinson) with a

CH3Br atmosphere. Once growth was observed, the colonies on one of each pair of

plates was washed into 5 ml of MAMS and assayed for the utilisation of 0.2 %

(vol/vol) headspace CH3Br. When an assay proved positive for CH3Br utilisation

colonies were picked from the corresponding sister plate, streaked to purity and

maintained for further analysis. Washings from the enrichments 165 at 10-2 and 10-3

dilutions, and the pooled enrichment subculture (PE2) at 10-2 proved positive.

4.4.2 Identification of putative CH3Br-degrading bacteria

15 colonies were picked from the three plates selected above based on differing

colony morphology within each plate. Between plates there was much duplication of

colony morphology with the same morphologies being seen on all three plates.

Strains were streaked to purity over 4-6 weeks and were generally small and slow

growing. Two strains became contaminated with fungi and were lost and MJC 3, 4

94

and 13 were extremely slow-growing and resistant to subculture. Direct PCR of the

biomass (see Chapter 2, Materials and Methods) of single colonies of the remaining

strains were used to generate 16S rRNA gene and cmuA PCR products using primer

sets f27/r1492 (Lane, 1991) and cmuAF802/cmuAR1609 respectively. All products

were run on 1 % agarose gels and gel extracted prior to direct sequencing in the case

of 16S rRNA gene PCR products, using primers f27, r1492 (both (Lane, 1991), and

341F (Muyzer et al., 1993), and cloning and sequencing in the case of cmuA PCR

products. See Table 4.6 for results.

A single strain, MJC10 gave a cmuA PCR product and the sequence grouped

phylogenetically with an uncultured marine clade from the Arabian Sea. This strain

had been identified by 16S rRNA sequencing as a Microbacterium sp., of the

suborder Micrococcineae and a Gram positive (confirmed by Gram-staining of the

isolate). MJC10 and the other two isolates identified as Microbacterium were grown

in 125 ml crimp-seal vials on both MAMS and MAMSTY media and supplied with

0.2 % and 0.1 % (vol/vol) CH3Br in the headspace. No utilisation of CH3Br was

observed over a period of 62 days. After DNA extraction, PCR amplification of

cmuA from these cultures proved impossible. It is possible that the MJC10 cmuA

PCR product was contamination, but there are indications that this was not the case.

The sequence of the product was not identical to any of the CH3X-utilising strains, or

any of the sequenced clones. Also, the negative control of the PCR reaction did not

display any contamination. Under these circumstances it could be hypothesized that

the culture was not pure and that a cmuA-possessing culture was present along with

the numerically dominant Microbacterium strain.

95

Strain Source Colony morphology 16S rRNA BLASTN result cmuA BLASTN result/ MJC1 PE2 10-2 Flat, white, adherent and

radially lobed. 100 % (1392/1392) AJ244697 Flavobacterium V4.MO.31

Negative

MJC5 PE2 10-2 Small, irregular opaque and yellow.

99 % (1340/1344) Y17227 Microbacterium oxydans

Faint PCR product of expected size

MJC6 165 10-2 ‘Fried-egg’ morphology, translucent with yellow centre

99 % (601/604) AJ244697 Flavobacterium V4.MO.31

Negative

MJC8 165 10-2 Tiny pinprick colonies, reddish brown.

99 % (1333/1336) AJ244716 Erythrobacter-like V4.BO.03

Non-specific amplification (confirmed by sequencing and BLASTN analysis)

MJC10 165 10-2 Small, irregular opaque and yellow.

99 % (1011/1012) Y17237 Microbacterium schleiferi

85 % (601/701) AY934439 Uncultured soil clone. 90 % ID/93 % Sim. AAY46974 Uncultured soil clone.

MJC11 165 10-2 Tiny pinprick colonies, reddish brown.

99 % (1338/1339) AJ244716 Erythrobacter-like V4.BO.03

Negative

MJC12 165 10-3 Flat, white, adherent and radially lobed.

99 % (1349/1355) Y17237 Microbacterium schleiferi

Negative

MJC14 165 10-3 Tiny irregular and white. 99 % (760/764) AJ294340 Erythrobacter citreus HY-6

Negative

MJC15 165 10-3 Tiny irregular and white. 99 % (1340/1341) AJ244716 Erythrobacter-like V4.BO.03

Negative

Table 4.6. Strains isolated from CH3Br enrichments of Arabian Sea samples

96

4.5 Oxygen electrode studies of H. chloromethanicum strain CM2

The CH3X-utilising strain Hyphomicrobium chloromethanicum CM2 was used to

examine the substrate affinities and reaction velocity for CH3Cl, CH3Br, and CH3I.

Oxidation rates were calculated for the substrate concentrations given in Table 4.7,

with Km and Vmax values calculated from double reciprocal Lineweaver-Burk plots

in Table 4.8. The data should be viewed only as an indication of relative rates as it is

based on a single replicate. The upper concentrations of substrate used for CH3Br and

CH3I were the highest that did not demonstrate inhibition, either by no oxidation, or a

slowing of the oxidation rate compared with a lower concentration. Substrates were

prepared by using a saturated solution of each of the compounds in sterile deionised

water and concentrations back calculated using the solubility of the compound, and

the smallest volume of these solutions that could accurately be added to the electrode

chamber determined the lower limit.

Substrate Amount of substrate (µmoles) CH3Cl 60, 120, 240, 300, 600, 900 CH3Br 90, 180, 270, 360, 540, 720 CH3I 96, 160, 320

Table 4.7. Amounts of substrate used in O2 electrode studies. It is interesting to note that the order of the upper limits in concentration of the CH3X

reflects the bond strength of the carbon-halide bond.

The mechanism of toxicity of the CH3X is by indiscriminate methylation of cellular

components, and the methylation of DNA by these compounds has been shown to be

the mechanism of carcinogenicity in murine models, with the more weakly bonded

CH3Br and CH3I being more toxic (Bolt & Gansewendt, 1993).

97

Substrate Km (µM) Vmax (nmole O2/min/mg dry weight

CH3Cl 80.97 37.58 CH3Br 124.42 45.19 CH3I 300.73 39.05

Table 4.8. Substrate affinity and maximum oxidation rate of H. chloromethanicum CM2 with CH3X.

4.6 Discussion

Of all the enrichments that were set up, from all locations, those from the Arabian Sea

that were enriched initially with formate were the most active. It is interesting to note

that formate dehydrogenase catalyses the final step in the methyl halide degradation

pathway, and perhaps enriching for the presence of this enzyme and the ability to

degrade formate also increased the proportion of the population capable of utilising

CH3Br through the CmuA pathway. However, not all the characterised CH3X

degrading isolates are capable of growth on formate, L. methylohalidivorans MB2 and

Aminobacter ciceronei IMB1 are examples of this, so co- or pre-enrichment with

formate may restrict the diversity of CH3Br-utilising bacteria present in enrichments.

A general trend in turbidity can be observed from Table 4.3, with increased turbidity

in enrichments from more Northerly stations. These waters were more productive

(for example, Station 9 had an all depth average 3H Leucine uptake of 762 pmol/l/h

and Station 1, 47 pmol/l/h) and there may therefore have been a greater number of

alternative substrates present other than those added during the enrichment procedure.

Increased biomass addition would also impact the amount of DOC (dissolved organic

carbon) available in these enrichments; as bacterial and algal cells lyse and release

labile substrates. Enrichments that actively degraded CH3X also came from stations 7

98

to 11. This could also be due to the fact that a greater inoculum density would

increase the likelihood of a sufficient initial CH3X-utilising population being present

to be stably maintained in the enrichment. It is also likely that the greater abundance

of phytoplankton and higher production of these stations (see Appendix C,

AMBITION cruise data) as compared to the more oligotrophic southern stations

resulted in higher local concentrations of CH3Br in the water column, particularly at

the chlorophyll maximum and above.

Enrichments were also screened for the presence of cmuA by the PCR. A number of

enrichments proved positive; see Chapter 6 for details of this investigation.

The failure of the Microbacterium isolate MJC10 to oxidise CH3Br was

disappointing, but unsurprising. Only a single Gram positive bacterium capable of

utilising CH3X as sole carbon and energy source has been previously isolated, strain

SAC4, from forest soil, which shared 98 % 16S rRNA identity with Nocardiodes

simplex. All other isolates have been members of the α proteobacteria. It might be

possible to test the hypothesis that the cmuA sequence amplified belonged to a low

abundance contaminating organism by carrying out a population fingerprinting

technique such as 16S rRNA TRFLP or DGGE, although the sensitivity of the

technique might be a problem. FISH with Microbacterium and Eubacterial probes

might also identify a contaminating organism at low abundance. The sequence itself

was identified of being a common clade of cmuA sequences that do not yet have a

cultured representative.

99

Generally speaking, enrichments with CH3Br from a wide range of different marine

environments have demonstrated biological degradation of the compound. The ability

to utilise CH3Br was strongly dependent on its aqueous phase concentration, with

concentrations higher than ~300 µM being inhibitory in enrichment cultures (Hoeft et

al., 2000; Schaefer et al., 2005). As calculated aqueous phase concentration is

dependent on the Henry’s law constant used, the temperature and the volume of

headspace/volume of media ratio (See Appendix B for Henry’s law calculations), it is

important to ensure that this is carefully controlled. In situ concentrations of CH3Br

are orders of magnitude less than 300 µM (see Chapter 3) and inhibition is unlikely to

occur. It would have been interesting to investigate further the amount of biomass

produced from CH3Br in enrichments and compare these to the predicted biomass

yields using the method of (Heijnen & Van Dijken, 1992).

Since this work a number of novel marine CH3X-utilising strains have been isolated

(Schaefer et al., 2005) from marine enrichments originating from L4 seawater and

Scottish coastal water, belonging to three clades, although none of them are members

of the clades found in these enrichments (see Chapter 6 for more detail).

100

Chapter 5

Methanol Dehydrogenase as a

Functional Genetic Marker

101

5 Chapter 5: Methanol Dehydrogenase as a Functional Genetic Marker

5.1 Introduction

Methanol dehydrogenase (MDH) is a pyrroloquinoline quinone-linked (PQQ-linked)

enzyme which catalyses the oxidation of methanol to formaldehyde in all Gram-

negative methylotrophs and methanotrophs that have been studied (McDonald &

Murrell, 1997). It is distinct from the alcohol dehydrogenases of Gram-positive

methylotrophs (such as Bacillus methanolicus, de Vries et al., 1992) and

methylotrophic yeasts (such as Pichia pastoris, Cregg et al., 1989). The oxidation of

methanol is a central metabolic step in Gram-negative methylotrophs, as

formaldehyde is the intermediate of both assimilative and dissimilative metabolism

(Anthony, 1982). In methanotrophs MDH is the second enzyme in the methane

oxidation pathway and oxidises the methanol produced by either the soluble or

particulate methane mono-oxygenases (sMMO and pMMO respectively).

The X-ray structure has been determined for the MDH from Methylobacterium

extorquens (Ghosh et al., 1995) and Methylophilus methylotrophus W3A1 (Xia et al.,

1996). It has an α2β2 tetrameric structure, with each α subunit containing one PQQ

molecule and one Ca2+ ion. The α subunit is approximately 66 kDa in size and the β

8.5 kDa. The α subunit has a propeller fold making up a superbarrel of eight radially

arranged β-sheets (see Fig 5.1 a). The β subunit forms a long α-helix (see Fig 5.1 b).

The genetics of methanol oxidation have been extensively studied in

Methylobacterium extorquens strain AM1 with 25 genes demonstrated to be involved

in the process, (Zhang & Lidstrom, 2003) over 5 gene clusters. Two of these encode

102

a

b

c

the MDH structural genes mxaF and mxaI, which respectively encode the α and β

proteins. A third gene, mxaG encodes a specific cytochrome cL, which is the primary

electron acceptor for MDH. The mxa genes are present in Methylobacterium

extorquens AM1 as a single operon mxaW, F, J, G, I, R, S, A, C, K, L, D, E, H and B

whose expression is controlled by the M. extorquens σ70 orthologue (Zhang &

Lidstrom, 2003). The arrangement of the genes in the cluster is also conserved in

other methanotrophs and methylotrophs.

Fig 5.1. a. α subunit of MDH with coordinated PQQ and Ca2+. b. β subunit of MDH. c. α2β2 structure of MDH. Structures downloaded from http://www.ncbi.nlm.nih.gov and redrawn with Cn3D 4.1 available free from http://ncbi.nih.gov/Structure/CN3D/cn3d.shtml.

5.1.1 MDH as a functional genetic marker

There are a large number of genes involved in methanol oxidation and hence a large

number of candidates with the potential to be used as a functional genetic marker for

103

methanol oxidation. The best studied of these, and that which has been applied most

widely, is mxaF as it has regions of significant conservation, allowing ease of primer

design separated by less conserved sequence which provide the information to

construct phylogenetic analyses of the gene. The phylogeny of mxaF follows that of

16S rRNA phylogeny within those organisms that possess one and has been used as a

functional alternative to 16S based phylogenetic markers (see Fig 5.4).

McDonald & Murrell, 1997 developed a set of PCR primers mxaF1003/mxaR1561

(primer numbering throughout follows the numbering of mxaF from

Methylobacterium organophilum strain XX) based on the three complete mxaF

sequences available at the time, Methylobacterium extorquens strain AM1,

Methylobacterium organophilum strain XX and Paracoccus denitrificans. The

primers cover several important regions of the mxaF gene encoding key functions in

the protein, including Asn 287, Asp 327, Arg 357 and Asn 420, which are part of the

active site and the tryptophan docking motifs W4 and W5 which are involved in

planar stabilisation of the structure (Ghosh et al., 1995). The primers have been

applied widely and used to assess the diversity of methylotrophs and methanotrophs

in a wide range of environments including rice plant roots (Horz et al., 2001),

methane seeps (Inagaki et al., 2004), deep-sea sediment (Wang et al., 2004),

agricultural soil (Fjellbirkeland et al., 2001), and a chemoautotrophic cave ecosystem

(Hutchens et al., 2004).

One noticeable exception to the extensive use that has been made of the primers in

other environments is the paucity of information from pelagic marine systems. There

are a number of marine methylotrophic and methanotrophic isolates (Jeong et al.,

104

2002; Waechter-Brulla et al., 1993; Chang et al., 2002; Lidstrom, 1988; Sieburth et

al., 1987), but relatively little information in comparison with environments such as

freshwater and soil, on mxaF diversity. A study looking for type II marine

methanotrophs, Rockne & Strand, 2003 focussed on using 16S rRNA gene PCR

primers rather than the available mxaF primers, which would have been suitable for

the purpose.

Since the original primer design (McDonald & Murrell, 1997) a number of further

complete mxaF sequences have been submitted to the database. This includes that of

Methylococcus capsulatus (Bath), which has been the subject of a genome-sequencing

project run by the University of Bergen and The Institute for Genomic Research.

Owing to the limited number of sequences used in the original primer design and the

fact that none of them belonged to the γ proteobacteria it was decided that they would

benefit from re-design in order to ensure that as full a diversity of sequences as

possible was detected in target environments.

Methyl halide degrading organisms Methylobacterium chloromethanicum strain CM4

and Hyphomicrobium chloromethanicum strain CM2 have both been demonstrated to

be capable of growth on methanol as sole carbon and energy source and also to

possess a MDH. It was proposed that analysis of mxaF sequences in methyl halide

degraders could provide a functional gene alternative to 16S rRNA phylogenetic

analysis, allowing finer resolution of relatedness as functional genes tend to mutate at

a higher rate than the 16S rRNA gene.

105

5.2 Sequence availability

It was decided, as was the case in the original study (McDonald & Murrell, 1997) to

use only alignments of complete mxaF sequences available at the time rather than

partial sequences in the database, most of which had been produced using the

mxaF1003/mxaR1561 pair. The advantages of using only these sequences included

the fact that any part of the sequence can be used to design primers, rather than just

that portion already covered by the current primer pair. Disregarding sequences

amplified by the original pair avoided the tendency to develop primers that merely

amplified a subset of known sequences. The complete mxaF sequences used for

primer design are listed in Table 5.1. The sequence of the Methylococcus capsulatus

(Bath) genome had recently become available and the accession number in table 5.1

refers to it. Live Bruseth of the University of Bergen, Norway made available the

mxaF sequence of M. capsulatus (Bath) used for the alignments prior to release of the

genome sequence. This was obtained after new primers had been designed and so

they were re-designed slightly to take the new sequence and alignments into account.

106

Genbank Accession

Organism Taxonomic affiliation

Reference

AF220674 Methylobacterium nodulans ORS2060

α-Proteobacteria (Sy et al., 2001)

M17339 Paracoccus denitrificans

α-Proteobacteria (Harms et al., 1987)

M31108 Methylobacterium extorquens AM1

α-Proteobacteria (Anderson et al., 1990)

M22629 Methylobacterium organophilum XX

α-Proteobacteria (Machlin & Hanson, 1988)

U41040 Methylophilus methylotrophus W3A1

β-Proteobacteria (Xia et al., 1996)

AF184915 Methylovorus sp. SS1 β-Proteobacteria (Bulygina et al., 1993)

AB004097 Hyphomicrobium methylovorum GM2

α-Proteobacteria (Tanaka et al., 1997)

AE017282* Methylococcus capsulatus BATH

γ-Proteobacteria (Ward et al., 2004)

Table 5.1. mxaF sequences used for primer development.

5.3 Alignments and primer design

The alignments were constructed using the MegAlign package from the DNAStar

suite of programs. From this candidate primers were designed by hand, looking

particularly at regions outside the current primer region so as to maximise sequence

length for phylogenetic analysis, whilst also covering the aforementioned conserved

regions. This also allowed comparison of sequences produced using the new pair

with the substantial number in the Genbank database produced with the original

primer set. Potential forward and reverse primers that were designed are listed in

Table 5.2 along with the sequences of the original primer pair and in the alignments of

Fig 5.2. Phylogenetic analysis of the sequences used in primer design can be seen in

Fig. 5.4.

107

Primer Sequence 5’-3’ Reference mxaF1003 GCGGCACCAACTGGGGCTGGT (McDonald & Murrell,

1997) mxaF1013 YTGGGGYTGGTAYGCCTAYGA This thesis mxaF1080 TGGAACGARACCATGCGTCC This thesis mxaF1101 GGCGACAACAAGTGGACSATG This thesis mxaR1561 GGGCAGCATGAAGGGCTCCC (McDonald & Murrell,

1997) mxaR1476 CCCTGGTTGTGRWARCCCAT This thesis mxaR1555 CATGAABGGCTCCCARTCCAT This thesis mxaR1590 GCRCCAACRAAGAACTGGCC This thesis mxaR1590V GCRCCVACRAAGAACTGVCC This thesis Table 5.2. mxaF primers used in this study. A further forward primer mxaF909 was also designed, but this was rejected after receipt of the Methylococcus capsulatus (Bath) mxaF sequence as it had significant mismatches. Primer numbering is based, as in McDonald & Murrell, 1997, on that of Methylobacterium organophilum XX. Primer mxaR1590 was tested in two versions, one with maximum redundancy (mxaR1590V) and one with minimum redundancy.

109

Fig. 5.2. Alignments of designed primers against the mxaF sequences used for their design. Sequences are referred to by their strain names except Paracoccus denitrificans, which is designated as Pden. Reverse primers are presented as their reverse complement and 3’ to 5’. Mismatches in any strain are in grey. With mxaR1590/V grey indicates a mismatch in mxaR1590 only and light grey indicates a mismatch in both primers.

110

5.4 Primer testing

Primers were initially tested in all possible combinations of pairs with a representative

of each of the α-, β- and γ-proteobacterial methylotrophs. Further testing of the

primers capable of amplifying these was carried out using a wide range of different

methylotrophs, including those without a methanol dehydrogenase. The PCR was

carried out with hot start at 94oC for 5 min, followed by 30 cycles of 1 min each

denaturing at 94oC, annealing at 55oC and amplification at 72oC, a final extension step

of 10 min at 72oC was included. The PCR mixes were formulated as per the standard

mix in the methods section.

5.4.1 Initial testing

Methylobacterium extorquens AM1 (α-proteobacteria), obtained from the University

of Warwick culture collection, Methylophilus methylotrophus W3A1 (β-

proteobacteria) obtained from Prof. Nigel Scrutton, University of Leicester and

Methylococcus capsulatus (Bath) (γ-proteobacteria) were used to test the primers on

mxaF containing members of each of the α, β and γ proteobacteria. Results are as

Table 5.3.

mxaR1561 mxaR1476 mxaR1555 mxaR1590 mxaR1590V mxaF1003 558 473 552 587 587 mxaF1013 548 463 αγ 542 577 α 577 mxaF1080 481 396 α 475 α 510 510 mxaF1101 460 375 αγ 454 489 α 489 Table 5.3. Expected product sizes for each of the combinations of primer and results of the first trials. For each primer pair product size in bp is shown followed by any organism not amplified by that pair with α indicating, Methylobacterium extorquens AM1, β indicating Methylophilus methylovorus W3A1 and γ indicating Methylococcus capsulatus (Bath). Primer sequences as table 5.2.

Non-specific amplification could be seen with certain primer pairs and templates.

mxaF1101 demonstrated non-specific products with all reverse primers and both α

and β templates, as did mxaF1080. The original primer pair in combination produced

111

some non-specific amplification with the β template. Conversely mxaF1013 did not

show any non-specific amplification when paired with any of the reverse primers.

Taking all these factors into consideration it was decided to investigate further primer

pairs mxaF1003/mxaR1476, mxaF1003/mxaR1555, mxaF1013/mxaR1561,

mxaF1013/mxaR1555, and mxaF1013/mxaR1590V.

5.4.2 Further testing and primer selection

The five candidate primer combinations were next used to amplify mxaF products

from environmental DNA samples. Two contrasting sets of samples were used, four

samples taken from soil and water in Movile cave, an enclosed cave ecosystem with a

1-2 % methane atmosphere in Romania (Hutchens et al., 2004), and six samples of

total marine DNA from Eilat, Israel. Selection of primer pairs was based on

amplification from the largest number of samples and again based on a lack of non-

specific binding. mxaF1003/mxaR1555 and mxaF1013/mxaR1555 worked well based

on these criteria, although products were only obtained from two of the four Movile

cave samples and only faint products obtained from the Eilat marine samples (see Fig

5.3).

112

Fig 5.3. mxaF PCR of a range of environmental samples. The two unmarked lanes contain Invitrogen 1 kb ladder. Lanes 1-14 are respectively: Negative control; M. capsulatus BATH; M. methylotrophus W3A1; M. extorquens AM1; Eilat marine samples lanes 5-10; Movile cave samples 11-14.

Amplification by these primer pairs was checked with a wide range of methylotrophs

and methanotrophs and DNA samples from non-mxaF containing methylotrophs were

used in order to check specificity. Table 5.4 lists the genomic DNA used in these

tests. All were amplified with 16S rRNA primers f27 and r1492 (Lane, 1991) and the

products sequenced to check the identity of the DNA sample. The mxaF products

were also sequenced for the same purpose.

1 2 3 4 5 6 7 8 9 10 11 12 13 14

113

Organism Phylogenetic affiliation Known to possess mxaF Methylosinus trichosporium OB3b

α-Proteobacteria Yes

Methylosinus sporium 5 α-Proteobacteria Yes Methylocystis parvus OBBP


Hyphomicrobium sp.P2* α-Proteobacteria Yes Methylobacterium sp.P3* α-Proteobacteria Yes Ancylobacter sp. SC5.10* α-Proteobacteria Yes Methylobacterium sp. PM1*


Afipia felis 25E-I† α-Proteobacteria Yes Methylophilus sp. ECd4* β-proteobacteria Yes Ralstonia sp. EHg5* β-proteobacteria No Methylococcus capsulatus BATH

γ-Proteobacteria Yes

Methylomonas methanica S1


Methylomonas rubra γ-Proteobacteria Yes Methylomicrobium album BG8


Methylomonas agile A20 γ-Proteobacteria Yes Pseudomonassp. PM2* γ-Proteobacteria No Flavobacterium sp. RD4.3*

Bacteroidetes No

Rhodococcus sp. RD6.2* High G+C Gram positive No Mycobacterium ratisbonense EM3*

High G+C Gram positive No

Arthrobacter sp. SK1.18* High G+C Gram positive No Table 5.4. Genomic DNA samples used for testing efficacy of primer pairs. All DNA was obtained from the Warwick Culture Collection (prepared by Hanif Ali), except for *, which were from Dr. Paulo De Marco, from the University of Porto, Portugal, and †, which was from Dr. Azra Moosvi from King’s College, London.

Primer pair mxaF1013/mxaR1555 failed to amplify products from Methylomonas

agile A20, but mxaF1003/mxaR1555 gave the expected products with all mxaF-

containing organisms and no products with those that do not contain mxaF.

The only exception to this was with Pseudomonas PM2, which gave an mxaF product

despite the fact that this organism is believed to contain an ExaA (Pacheco et al.,

114

2003), a PQQ-linked ethanol dehydrogenase which can be found in Pseudomonas

aeruginosa ATCC 17933 (Groen et al., 1984) and Pseudomonas putida KT2440

(Pacheco et al., 2003). On analysis of the sequenced 16S rRNA gene PCR product

from this DNA sample it was found to be that of an Ancylobacter, indicating possible

cross contamination with DNA from another sample. The original strain was

obtained and the PCR repeated, with the same result, indicating potential

contamination of the strain at source. Only a faint product was obtained with

mxaF1003/mxaR1555 and Afipia felis 25E-I, upon re-amplification with the same

primer set it was successfully sequenced and confirmed by comparison with the

Genbank sequence AY848826.

When comparing mxaF1003/mxaR1555 with mxaF1003/mxaR1561 it was found that

they amplified the genomic DNA samples identically, with the exception of that of

Afipia felis 25E-1. Upon comparing the mxaF sequence AY848826 with the sequence

of the primers it was noted that there are no mismatches with primer mxaR1555.

There are also no mismatches with all but the first base (5’ to 3’) of mxaR1561, which

is not covered by the sequence. It is impossible to ascertain whether there are any

mismatches with mxaF1003 as the sequence does not cover this area of the gene. In

their publication, Moosvi et al., 2005 report that they were able to amplify mxaF from

two of four methylotrophic Afipia isolates, including that of A. felis strain 25E-1 using

primer pair mxaF1003/mxaR1561 in contrast to the findings presented here. It is

possible that the non-amplification in this study was due to the template quality as two

amplifications were required for primer pair mxaF1003/mxaR1555 before there was

sufficient product for sequencing.

115

Fig 5.4. Maximum likelihood tree of mxaF and xoxF DNA sequences using the AxML program of ARB. Positions included in the analysis corresponded to nucleotides 922-1299 of Methylobacterium organophilum XX and the non-specific PQQ-linked alcohol dehydrogenase of Pseudomonas aeruginosa was used as an outgroup. Bootstrap values from parsimony analysis are indicated on the tree by closed circles (>95 %) and open circles (75-95 %). Species in bold were used for primer design. A = α-Proteobacterial methanotrophs, B = α-Proteobacterial methylotrophs, C = γ-Proteobacteria, D = β-Proteobacteria, E =xoxF sequences.

A

B

C

D

E

116

5.4.3 XoxF

XoxF is a putative PQQ-containing dehydrogenase found in Paracoccus denitrificans,

which has a certain level of similarity with MxaF at both the protein and DNA levels.

Similar putative dehydrogenases have been found in Methylobacterium extorquens

AM1 where it is known as MxaF’ and non methanol-utilising bacteria such as the

Rhizobia (Sy et al., 2001). With the position and number of mismatches present in

the primer binding regions non-specific amplification of xoxF was an unlikely

possibility. In order to confirm that the primers were specific for mxaF genomic

DNA from Methylobacterium extorquens AM1, which possesses both

dehydrogenases, was PCR amplified using mxaF1003 and mxaR1555. The restriction

enzyme MboII with target sequence 5’-GAAGAN8-3’ was found by computer

analysis using ARB (Ludwig et al., 2004) to be able to cut xoxF sequences and not

mxaF sequences. Digestion of the PCR product from M.extorquens resulted in the

expected banding pattern for mxaF products, with no contamination from xoxF.

5.5 Beijerinckia mobilis

Recently (Dedysh et al., 2005) published primers for the amplification of mxaF from

Beijerinckia mobilis, a heterotrophic nitrogen-fixing bacterium, previously unknown

to be capable of methylotrophy that they demonstrated to be capable of

methylotrophic growth on methanol. They were unable to obtain mxaF products

using the mxaF1003/mxaR1561 primer combination from B. mobilis, Albibacter

methylovorans DSM 13819, or Methylophaga marina ATCC 35842 and so designed

new primers, mxaF-f769, mxaF-r1392, mxaF-r1585 and mxaF-r1690. Amplification

of products from A. methylovorans was only possible with mxaF-f769 and mxaR1561,

but they report that most consistent amplification was obtained with the mxaF-f769

117

and mxaF-r1690 primer combination. The primers were designed to alignments of

the complete mxaF sequences of α Proteobacteria only and demonstrate a number of

critical mismatches with β and γ Proteobacteria, rendering these primers unsuitable

for use as functional genetic markers of methylotrophy in environmental samples.

The presence of new mxaF sequences that cover the mxaF1003 primer region in the

Genbank database allowed checking of this sequence to see whether it could be at all

improved upon. Few mismatches are introduced when alignments include the

Genbank sequences released by Dedysh et al (2005; AJ878068, AJ878070,

AJ563936, AJ878069, AJ878071, AJ878072, and AJ878073), and none of them in

positions likely to cause non-amplification of sequences. In order to be as inclusive

as possible mxaF1003 could be altered with two new redundancies to result in

mxaF1003Y, reading 5’ GCGGCACYAAYTGGGGCTGGT 3’ (see also Fig. 5.4.).

5.6 Discussion and future work

The primer pair mxaF1003/mxaR1555 show promise for use in studies of diversity of

both methylotrophic and methanotrophic organisms. The main advantage over the

current primer set is that they have been designed from a phylogentically more

diverse set of mxaF sequences and should therefore be capable of picking up a wider

range of sequences from environmental samples.

One of the aims of the work was to use the primers to amplify mxaF from marine

samples and carry out analyses on these such as clone libraries. Ideally it would have

been extremely useful to amplify mxaF products from a single sample using the

original primer pair and the newly developed pair, creating equal clone-libraries and

118

comparing the diversity of sequences in them using statistical methods, such as those

provided by the LIBSHUFF program (Singleton et al., 2001) and

http://www.arches.uga.edu/~whitman/libshuff.html) in order to prove the new set are

an improvement on the old. I was unable to complete this work within the duration of

the project, as the work with cmuA and MeBr measurements took priority. Currently

within the lab Dr. Josh Neufeld is using the new primers with marine samples and

planning to use them along with the Stable Isotope Probing technique (Radajewski et

al., 2000) in order to characterise marine methanol degrading bacteria.

119

Chapter 6

Diversity of cmuA in Marine

Environments: Clone library and TRFLP

analysis

120

Chapter 6: Diversity of cmuA in Marine Environments and TRFLP analysis 6.1 Introduction CmuA is a bifunctional protein with methyltransferase and corrinoid-binding domains.

It is the first enzyme in the CH3Cl degradation pathway elucidated in Methylobacterium

chloromethanicum CM4, an organism that is capable of growth on CH3Cl and CH3Br as

sole carbon and energy source (Vannelli et al., 1998; Vannelli et al., 1999; see Fig 6.1).

Fig 6.1. Pathway of CH3Cl degradation in Methylobacterium chloromethanicum CM4 as Vannelli et al., 1999. Numbering refers to enzyme for that particular step in the pathway: 1. CmuA, methyltransferase/corrinoid protein; 2. CmuB, methyltransferase; 3. MetF, 5,10-methylene-tetrahydrofolate reductase; 4. and 5. FolD, 5,10-methylene-tetrahydrofolate dehydrogenase/cyclohydrolase (4./5.); 6. PurU, 10-formyl-tetrahydrofolate hydrolase; 7. FDH, Formate dehydrogenase.

Carbon assimilation via serine cycle

CH3Cl

H4folate

CH H4folate

CHO H4folate

CH2 H4folate

CH3 H4folate

HCOOH

CO2

H2O

H2O

H4folate

2 H+

2 H+

2 H+

HCl

CoI

CH3 CoIII

1.

2.

3.

4.

7.

6.

5.

121

This pathway is believed to be responsible for the degradation of CH3X in other

organisms capable of growth on these compounds as sole carbon and energy sources,

such as Aminobacter ciceronei IMB1 and Aminobacter lissarensis CC495 (McDonald

et al., In Press; Woodall et al., 2001). In Hyphomicrobium chloromethanicum strain

CM4 it has been shown that cmuA- mutants are no longer capable of growth on either

CH3Cl or CH3Br as sole carbon and energy sources (Borodina et al., 2004). Schaefer et

al., 2005 isolated 13 marine CH3X-utilizing bacteria belonging to three distinct clades,

two of these clades, represented by strains 179 and 198, probably make use of the

CmuA methyltransferase pathway. The third clade and another marine CH3X-utilizing

organism, Leisingera methylohalidivorans strain MB2 (Schaefer et al., 2002), are likely

to make use of a hitherto uncharacterised pathway of CH3X degradation, seemingly not

involving CmuA since there is no evidence for presence of cmuA/CmuA in these methyl

halide degraders.

CmuA is the most conserved of the enzymes in the pathway as demonstrated by derived

protein and DNA alignments between cmuA sequences from the organisms

demonstrated to contain the pathway (McDonald et al., 2002). The arrangement of the

genes of the cmu (chloromethane-utilisation) cluster is also highly conserved between

most of these organisms, with the exception being M. chloromethanicum CM4 in which

the cmu cluster is split into two sub-clusters (see Fig 6.2).

All these factors make cmuA an ideal candidate for use as a functional genetic marker to

investigate the presence and diversity of methyl halide utilisers in the environment that

use this pathway. It has been used as such in two separate DNA-stable isotope probing

experiments with soil samples enriched with either 13CH3Br or 13CH3Cl (Miller et al.,

2004) or 13CH3Cl (Borodina et al., 2005).

122

Fig 6.2. Comparison of cmu gene clusters sequenced to date. Genes involved in the metabolism of CH3X are in blue, with cmuA in red. Genes not directly involved are in green. Organisms are referred to by their strain names; Methylobacterium chloromethanicum CM4, Aminobacter lissarensis CC495, Aminobacter ciceronei IMB1 and Hyphomicrobium chloromethanicum CM2. Strains 198 and 179 are affiliated to the Roseobacter clade of the α proteobacteria, within the Rhodobacteracaea family.

6.1.1 PCR primers for cmuA

McAnulla et al., 2001 designed PCR primers for the amplification of cmuA based on

regions of conservation in alignments of cmuA from M. chloromethanicum CM4, and H.

chloromethanicum CM2 using the CODEHOP (consensus-degenerate hybrid

oligonucleotide primers) program (Rose et al., 1998) and

http://bioinformatics.weizmann.ac.il/blocks/codehop.html). The primers were designed

with the forward primer located in the 5’ methyltransferase domain and the reverse

primer located in the 3’ corrinoid-binding domain. As this is a unique structural

arrangement, the rationale was that this would increase primer specificity and not PCR

amplify methyltransferase genes or genes containing sequences coding for corrinoid-

str. IMB-1

2 kb

II

I

str. CC495

str. CM4

str. 198

cmuB cmuC cmuA fmdB paaE hutI

cobQ cobD metF cmuB cmuC cobC

cobU folC folD purU cmuA

cmuC cmuA fmdB paaE hutI metF

cmuA fmdB paaE hutI cmuC nrdF nrdA

str. CM2

cmuB cmuC cmuA fmdB paaE hutI metF //

str. 179 cmuA fmdB paaE hutI metF

123

binding regions of other polypeptides. The primers 929f and 1669r were used to

amplify successfully a 741 bp PCR product from the two isolates used to design the

primers, newly isolated Hyphomicrobium strains and from a soil enrichment culture.

Warner, 2003 designed new PCR primers using alignments of cmuA sequences from M.

chloromethanicum CM4 and H. chloromethanicum CM2 and the recently cloned cmuA

sequences of Aminobacter ciceronei IMB1 and Aminobacter lissarensis CC495. Five

forward primers and four reverse primers were designed and primer pair

cmuAF802/cmuAR1609 was selected as the best candidate. Again this spanned the two

parts of the cmuA gene encoding two functional domains of CmuA. It was this primer

pair that was used in the two previous DNA-SIP studies (Borodina et al., 2005; Miller et

al., 2004) and was selected for use in this study.

6.2 Enrichment diversity

In order to study the diversity of cmuA in the most active marine enrichments (see

Chapter 4) 2 mL of each enrichment was centrifuged for 5 min at 13 000 rpm, the

supernatant removed and the pellet resuspended in 10 µl of sterile deionised water. This

was then boiled for 10 min in a water bath and 1 µl was used as template in PCR

reactions. PCR products were visualised on 1 % agarose (w/v) gels after EtBr staining.

Bands corresponding to the expected size of product (807 bp) were excised and the

DNA was purified using the Qiaquick Gel extraction kit (Qiagen). Clone libraries of 50

to 100 clones were constructed using the Invitrogen TOPO cloning kit. Clone libraries

were dereplicated using RFLP analysis with double digests of both EcoRI/DdeI and

EcoRI/RsaI and grouping of the clones into OTUs (operational taxonomic units) was

based on the RFLP patterns produced (Fig 6.3). OTUs were determined throughout on

a per library basis.

124

Fig. 6.3. Example EcoRI/DdeI RFLP digest of cmuA clones from enrichment L4.1.The starred lane contains Invitrogen 1 kb sizing ladder. Representative clones from each OTU were selected for bi-directional DNA sequencing

using the M13 primers for the TOPO vector. In the case of the longer

cmuAF229/cmuAR1609 inserts, additional forward and reverse sequencing reactions

were carried out using cmuAF802 and its reverse complement in order to get full

sequences.

The PCR was performed using both cmuAF802/cmuAR1609 and

cmuAF229/cmuAR1609, partly in order to compare the efficacy of the two forward

primers and partly in order to try and obtain longer inserts for sequence analysis.

Primer pair cmuAF229/cmuAR1609 covers more of the methyltransferase region of

cmuA and provides much more information about the sequence diversity in this region.

6.2.1 English Channel enrichments

Three 300 mL enrichments of seawater obtained from L4, a sampling station off the

coast of Plymouth, set up at different times of the year and enriched with 0.2 % CH3Br

were analysed by cmuA PCR as above. cmuA PCR products were obtained from L4.1,

L4.2 and L4.3 with cmuAF802/cmuAR1609, but not with cmuAF229/cmuAR1609 and a

clone library was produced from enrichment L4.1. This enrichment had been

established for the longest length of time (~8 months) and had had 5 pulses of CH3Br ,

equivalent to approximately 312 µmoles of CH3Br. It also gave the brightest product of

*

125

the three and was therefore considered the best for clone library production (see Fig

6.4).

Fig 6.4. cmuAF802/cmuAR1609 PCR products from enrichments. Lane 1 is the negative control and lane 2 the positive (H. chloromethanicum CM2). The remaining lanes 2-9 are, respectively: L4.1; L4.2; L4.3; 165; 249; 249.2; PE2 refer to Chapter 4 for details of the sources of these enrichments. Clones grouped into 2 OTUs with 73 % in OTU 1 and 27 % in OTU 2. The groupings

for this particular library are based solely on EcoRI/DdeI digests as RsaI failed to cut

any of the clones. Upon construction of phylogenetic trees, all the clones from this

cmuA library formed part of a single clade (B2 in Fig 6.5) most closely related to cmuA

sequences from Aminobacter ciceronei IMB-1 and Aminobacter strain TW23, both

isolated from woodland soils, and an uncultured soil cmuA clone, ‘chloromethane-

utilising bacterium’ 2 (AF307140, McAnulla, 2000).

6.2.2 Arabian Sea enrichments

Enrichments from the Arabian Sea AMBITION cruise were set up from concentrated

seawater samples added to tenth strength marine ANMS (ammonium nitrate mineral

salts). See Chapter 4 for details.

DNA from all the enrichments amplified with cmuAF802/cmuAR1609 gave cmuA PCR

products of varying band intensities and two of these were selected for clone library

analysis, library 27 from the pooled enrichment PE2, and library 25 from the Station 10

1 2 3 4 5 6 7 8 9

126

enrichment 249. Only DNA template from enrichment PE2 gave a cmuA PCR product

with cmuAF229/cmuAR1609 and this was also selected for clone library analysis as a

comparison with the other primer set.

The enrichment 249 cmuA clone library gave 6 OTUs, which are summarised in Table

6.1.

OTU Number of clones

% of total clones

Sequenced representatives (Genbank accession no.)

1 20 17.5 E25.21 (DQ090686), E25.2 (DQ090687) 2 87 76.3 E25.4 (DQ090685), E25.11 (DQ090690) 3 4 3.5 E25.5 (DQ090684) 4 1 0.9 E25.16 (DQ090688) 5 1 0.9 E25.45 6 1 0.9 E25.139 (DQ090689) Table 6.1. OTUs from library 25, the cmuA clone library from enrichment 249. According to phylogenetic analysis, the OTUs above split into three clades, OTUs 1, 2

and 6 form a novel clade of cmuA sequences, currently without a cmuA sequence from

an isolated representative. OTU 3 groups with Aminobacter ciceronei strain IMB-1 and

Aminobacter strain TW23. E25.16, the sole member of OTU 4, is consistently placed,

independently of tree calculation method, as related to, but separate from the same

Aminobacter cmuA cluster. It shares 94.6 % identity with cmuA from A. ciceronei strain

IMB1.

The cmuA Library 27 was constructed with DNA from pooled methylotrophic

enrichments that had been grown on a variety of different carbon sources and then

enriched with CH3Br. The PCR with primers cmuAF802/cmuAR1609 gave the most

intense PCR product of any of the enrichments, which is likely to reflect the increased

biomass in the enrichment due to the pre-enrichment step. Seven OTUs were apparent

upon RFLP analysis and are summarised in Table 6.2.

127


% of total clones


1 94 94.0 E27.1, (DQ090683), E27.2, (DQ090682), E27.3, (DQ090679), E27.4 (DQ090676)

2 1 1.0 E27.22, (DQ090681) 3 1 1.0 E27.24, (DQ090680) 4 1 1.0 E27.30, (DQ090678) 5 1 1.0 E27.32, (DQ090677) 6 1 1.0 E27.45 7 1 1.0 E27.48, (DQ090675) Table 6.2, OTUs from library 27, the cmuA clone library from enrichment PE2.

OTUs 1, 2, 3, 5, 6, and 7 form a single marine clade (A3) in cmuA phylogenetic trees.

The closest cmuA sequences from cultured CH3Br-utilsing bacteria being

hyphomicrobia. These form a separate clade with DNA sequence identity of 81.1 %

and 77.4 % respectively to cmuA sequences from Hyphomicrobium strain LAT3 and H.

chloromethanicum CM2 (E27.3 used for distance calculation). E27.22 (OTU 2),

E27.24 (OTU 3) and E27.48 (OTU 7) cmuA sequences consistently branch more deeply

than the other members of this clade, which could account for them being placed into

separate OTUs by RFLP analysis. E27.30 (OTU 4) cmuA sequence grouped with the

novel clade (B2) of marine cmuA sequences formed by OTUs 1 and 2 of the Station 10

enrichment cmuA library.

Library 9 contained the longer PCR product cmuA sequences from primer pair

cmuAF229/cmuAR1609 and the same template as for library 27. The library was

dereplicated using RFLP analysis with the same restriction enzymes as for the other

libraries. With the increased length of the cmuA sequences, this provided a finer level

of discrimination than that for the other libraries, which should be borne in mind when

examining the OTUs produced (Table 6.3).

128


% of total clones


1 58 75.3 E9.8, (DQ090668), E9.1, (DQ090674) 2 1 1.3 E9.3, (DQ090670) 3 10 14.2 E9.22, (DQ090673), E9.28, (DQ090671) 4 2 2.6 E9.27, (DQ090672) 5 1 1.3 E9.62, (DQ090669) 6 1 1.3 E9.81, (DQ090667) 7 2 2.6 E9.91, (DQ090666) 8 2 2.6 E9.92, (DQ090665) Table 6.3. OTUs from library 9, the cmuA clone library from enrichment PE2, amplified with primers cmuAF229/cmuAR1609. Despite the number of OTUs produced, all the sequences clustered together in a single

clade (A3) upon phylogenetic analysis. This was the same clade in which the majority

of library 27 cmuA clones were found. It is interesting that no clones were identified

with similarity to the Aminobacter clade unlike library 27, despite the fact that the

template DNA was identical. This could be explained stochastically as only 1.0 % of

library 27 (a single clone) grouped in this clade, but coupling this with the fact that

primer pair cmuAF229/cmuAR1609 was unable to amplify cmuA products from DNA

from any of the other enrichments suggests that it is specific for this particular clade of

sequences. Primer pair cmuAF802/cmuAR1609 is evidently capable of picking up a

wider diversity of cmuA sequences.

6.3 cmuA clone library analysis with DNA from high volumes of Arabian

Sea samples

These samples were kindly supplied by Dr. Clare Bird and Dr. Mike Wyman of the

University of Stirling, UK. The samples were taken using stand-alone pumps (SAP;

Challenger mark 2 SAP, Challenger Oceanic, UK). These pumps are automated and

pump large volumes of water for a set period of time through large (293 mm, 0.2 µm)

filters, achieving effective water sample volumes of 36 to 200 L, during this study.

DNA samples were supplied after being extracted using the following method (Mike

129

Wyman, pers. comm.). SAP filters were rinsed in 5 ml filtered seawater and the filtrate

taken up in 1 ml RNALater (Ambion) and stored at 4 oC. 0.5 ml of this was centrifuged

and DNA isolated from the resulting pellet using a Qiagen DNA extraction kit with the

DNA eluted in 100 µl sterile deionised water. 1 µl of this was used as template for PCR

amplification of cmuA, at neat and 1:10 dilutions. The effective volume of sample

represented by 1 µl of extracted DNA can be seen in Table 6.4.

Station/cast number Depth (m) Volume sampled (L)

Effective volume sampled in PCR (mL)

01/08 30 96 80.0 02/07 45 177 147.5

03/07 20 85 70.8 04/02 20 200 166.7 05/02 15 59 49.2 06/03 10 100 83.3 07/08 220 106 88.3 08/02 20 47 39.2 09/03 20 36 30.0 Table 6.4. Effective sample volumes for 1 µl volumes of DNA extracts used as templates in amplification of cmuA PCR products from SAP samples. PCR products using primer pair cmuAF802/cmuAR1609 were obtained from the

samples from stations 1 (01/08), 2 (02/07), 4 (04/02) and 9 (09/03). The cmuA PCR

products from station 2 were smaller than the expected size of 807 bp and upon test

sequencing proved not to be cmuA. The PCR products were faint and proved difficult

to clone, therefore only small libraries of 50 cmuA clones were produced from each of

the remaining PCR products. Upon RFLP analysis with EcoRI/DdeI and EcoRI/RsaI

double digests, the station 9 cmuA library was shown to contain only a single OTU.

The same OTU made up 98 % of the station 4 cmuA library with a single representative

(S4.14) in OTU 2. The station 1 library contained two OTUs: 70 % OTU 1 and 30 %

OTU 2 (see Table 6.5) neither of which were similar to those cmuA sequences in the

other two libraries.

130

Library Number of clones

% of total clones


1 (OTU 1) 35 70 S1.1, (DQ090703), S1.2, (DQ090702) 1 (OTU 2) 15 30 S1.4, (DQ090701), S1.5, (DQ090700),

S1.43, (DQ090705) 4 (OTU 1) 49 98 S4.3, (DQ090699), S4.4, (DQ090698), 4 (OTU 2) 1 2 S4.14, (DQ090704) 9 50 100 S9.1, (DQ090697) Table 6.5. OTU assignment of cmuA sequences from SAP sample clone libraries.

All the cmuA sequences retrieved from DNA from stations 4 and 9 clustered with the

highly related clade of marine cmuA sequences consisting entirely of sequences from

the two pooled enrichment libraries (A3). The station 1 derived cmuA clones grouped

with the cmuA clade formed by the station 10 enrichment cmuA library (B2).

6.4 Phylogenetic analysis

Phylogenetic trees were constructed with all available cmuA sequences. The large

number of cmuA sequences (136) combined with the length of sequence analysed (552

bp, corresponding to nucleotides 1005-1557 of Methylobacterium chloromethanicum

CM4) was towards the upper limits (150 sequences) of analysis of the ARB program

(Ludwig et al., 2004) with Maximum-likelihood analysis.

The analysis was left running for two weeks with no sign of completion, and then

aborted. Instead a parsimony tree was produced using ARB with 10 bootstraps, as

again the number of sequences involved was too large to analyse with a greater number

of bootstraps than this. Location of nodes was confirmed by Neighbour Joining

analysis using the Seqboot, Dnadist, Neighbour and Consense programs of PHYLIP

(Felsenstein, 1989; Felsenstein, 2004) with 100 bootstraps (Fig 6.5). Parsimony

bootstrap values over 75 % are marked on the tree. Major clades are labelled A1 to B4

and referred to in the text.

131

Fig. 6.5. cmuA parsimony tree of 552 bp. See text for full details and discussion. Sequences obtained in this study are bold and red. Isolates are bold.

A1

A2

A3

A4

B1

B2

B3 B4

132

As Maximum Likelihood analysis could not be carried out on the full data set, a

selection of cmuA sequences was analysed, representing each of the major clades (Fig.

6.6) in order to confirm the general tree topology seen in Fig. 6.5.

Fig. 6.6. cmuA Maximum-likelihood analysis performed using the same area of sequences as Fig. 6.5. Parsimony analysis bootstrap values (100 samplings) are indicated by closed circles (>95 %) and open circles (75-95 %).

Maximum Likelihood trees of cmuA sequences were also constructed for each of the

domains of the molecule, corresponding to bases 866-1124 (methyltransferase), 1210-

1571 (corrinoid-binding) and 1125-1209 (linker region) of the Methylobacterium

chloromethanicum CM4 cmuA sequence. All three trees were identical, with branching

order and relative positioning of sequences completely conserved. This gives an

indication that the sequences were not chimeric.

When carrying out BLASTp (Altschul et al., 1997) analysis of CmuA sequences it was

observed that the closest non-CmuA proteins are the Mono-, Di-, and Tri-methylamine

B4

B3

B2

B1

A4

A3

A1

A2

133

methyltransferases and corresponding corrinoid-binding proteins. It was alignment with

these that allowed assignment of domains of the cmuA sequences in the above analysis.

6.5 Correlation of clades with in situ populations

In terms of enrichments, correlation of cmuA diversity with actual in situ organisms is

impossible other than indicating presence of the cmuA sequence in an organism at the

particular station. Even absence cannot be assured, as the organism indicated by a

particular sequence may have been out-competed in the enrichment. Equally, an

organism that was scarce and carrying out only a small fraction of the environmental

CH3Br oxidation may have been favoured during the enrichment process, in this case

perhaps as the CH3Br concentrations used were orders of magnitude greater than

environmental concentrations.

Examination of the sequences gathered from the three SAP sample libraries from the

AMBITION cruise are more informative, as they are more representative of the in situ

community. Station 1 derived cmuA sequences (S1_x) all clustered together within

clade B1, whilst cmuA sequences from stations 4 (S4_x) and 9 (S9_x) formed a

separate, exclusively marine clade, A3. A shift in population of cmuA containing

bacteria seems to have occurred between stations 1 and 4. Interestingly the only

enrichment to show evidence of the presence of clade B1 sequences was 249, from

station 10 (E25_x), indicating that organisms containing similar cmuA sequences are

present in both the oligotrophic and eutrophic regions of the cruise track. It is possible

that this could be a bacterial species capable of existing under the two contrasting

environmental conditions exemplified by stations 1 and 10, or that this simply

highlights a lack of correlation between cmuA sequence type and phylogeny. The

sequence type of cmuA also displays no correlation between environment, with marine

sequences from the Arabian Sea sharing high identity with sequences from soil isolates.

134

6.6 Terminal restriction fragment length polymorphism analysis

6.6.1 Rationale

It seemed at this point that a wide range of different clades of cmuA sequences could be

found in the Arabian Sea DNA samples and enrichments and that it would be interesting

to investigate the location of these with respect to depth in the water column,

geographical location, and physicochemical factors. Two stations (3 and 7) had been

sampled regularly for a diel cycle, allowing investigation of diversity of cmuA

sequences at different depths in the water column in response to day/night changes.

As there were many samples to screen for the presence of cmuA, it was decided that a

rapid technique for surveying genetic diversity should be employed. There are a

number of well-established methods that would have been appropriate in this case,

including denaturing gradient gel electrophoresis (Riemann et al., 1999), terminal

restriction fragment length polymorphism (Moeseneder et al., 1999) analysis, and

length-heterogeneity PCR (Ritchie et al., 2000). The cmuA genes that had been

sequenced to date had little heterogeneity in length, which would have left L-HPCR

missing much of the potential diversity. With DGGE there is the potential to excise and

sequence the most intense bands on the gel, giving sequence information for the most

common amplicons. However, it was believed that TRFLP would prove to be the most

suitable technique as it was rapid, straight forward to develop for a new gene and

allowed easy intercomparison of samples, since standards can be run within each

sample, unlike DGGE. The large database of marine and terrestrial cmuA sequences

that had been previously collated also facilitated the development of the TRFLP

technique for assessing the diversity of environmental cmuA sequences.

135

6.6.2 TRFLP

TRFLP relies on the PCR amplification of a gene using primers labelled at the 5’ end

with a fluorescent marker. The labelled PCR products produced are then digested with

restriction enzymes. The terminal restriction fragment remains labelled, whilst all other

restriction fragments are unlabelled. A fluorescent sizing ladder is added to each

sample and running the restriction-digested products on a DNA sequencer in gene scan

mode allows sizing of the terminal restriction fragments produced. The discrimination

of clades of the gene and assessment of diversity relies on careful selection of restriction

enzymes. Splitting samples and using several different restriction enzymes can increase

discrimination, as can using a second complimentary fluorescent label on the reverse

primer. Another advantage of TRFLP is that the relative fluorescence of each TRF

(terminal restriction fragment) indicates the relative abundance of the particular PCR

product in the reaction (Osborn et al., 2000). This is not wholly quantitative as

abundance of a PCR amplified gene does not reflect the abundance of that particular

sequence in the original sample, but it does indicate which clades have the highest

relative abundance.

When using a capillary sequencer it has been noted that there is a bias towards smaller

fragments as they are favoured in the electrophoresis and this can lead to an over-

estimation of the abundance of such fragments (Moeseneder et al., 1999).

6.6.3 Development

The first part of the development process involved selection of restriction enzymes that

could discriminate between the clades of cmuA sequences that had been sequenced to

date (see Fig 6.5). Restriction enzymes that recognise 4 base restriction sites are

favoured in TRFLP analysis since enzymes with longer recognition sites tend not to cut

frequently enough.

136

An ARB (Ludwig et al., 1998) database was constructed with cmuA sequences edited to

include the forward and reverse primer sequences (as the primer forms part of the TRF

it needs to be included in order to predict the correct sizes of TRFs). Sequences that had

been produced with primer pairs other than cmuAF802/cmuAR1609 were either

trimmed (as in the case of the L9 clone sequences or the complete cmuA sequences such

as that of Aminobacter ciceronei strain IMB-1) to the same length as the other

sequences, or discarded (as in the case of soil clones AF307140, AF307141 and

AF307142). This left a standardised set of 137 cmuA sequences that could be

interrogated using the probe, user1 and user2 fields of the ARB Editor window. They

allow the user to input oligonucleotide sequences which are subsequently highlighted

wherever they are found in the sequence alignment. Restriction enzymes were

discarded if they did not discriminate well between clades, cut within the primer

sequence, or produced TRFs that were outside the 35-500 bp limit of sizing of the

ladder used. Restriction enzymes screened included all 4 base cutters available from

New England Biolabs (US), and Helena Biosciences (UK), excluding isoschizomers.

The restriction enzymes BsiYI, HaeIII and HpaII were selected using these criteria.

BsiYI provided good discrimination between different clades of cmuA in both the

forward and the reverse primer directions, HaeIII discriminated at the 5’ end; HpaII

discriminated at the 3’ end. Predicted TRFs for the members of the tree in fig 6.5 can

be seen for each of the enzymes in Table 6.6. Appendix D lists the sequences

represented by each TRF.

137

Enzyme Recognition site TRFs (bp) HaeIII 5’ C^CGG 34, 43, 53, 121, 145, 167, 271, 308, 479.

BsiYI 5’ CCNNNNN^NNGG 50, 126, 276 329, 346, 384, 397, 402, 461, 464,467,483, uncut.

BsiYI 3’ CCNNNNN^NNGG 114, 166, 171,282, 325, 335, 347, 391, 406, 417, 427, 764, uncut.

HpaII 3’ GG^CC 90, 110, 115, 135, 144, 156, 225, 330, 459, 481, 483, 625.

Table 6.6. TRF sizes of known cmuA sequences. Those in red are outside the sizing range possible when using the ROX 500 ladder. Uncut PCR products will be ~802 bp in length.

6.6.4 Method validation with standard cmuA clones

The TRFLP method was tested using three cmuA clones as standards. TOPO

(Invitrogen) cloned cmuA products of strain 179, and marine enrichment cmuA clones

PMLSW6 and PML1A4 (Schaefer et al., 2005) were used as templates in PCR reactions

with labelled primers. PCR reactions were carried out as described in Chapter 2,

Materials and methods. Several aliquots of Taq polymerase were pooled to provide a

source of Taq sufficient for a large number of reactions; it has been reported that

variation in the reproducibility of TRFLP and other PCR-based population

fingerprinting methods can be affected by variability in batches of Taq polymerase

(Osborn et al., 2000), even when obtained from the same supplier and this measure was

designed to remove this variability.

PCR primers were 5’-labelled with the fluorescein-derived dyes 6-FAM

(6-carboxyfluoroscein, cmuA802F) and HEX (6-carboxy-2’,4,4’,5’7,7’-

hexachlorofluoroscein, cmuA1609R, TagN, Newcastle). Primers were routinely

resuspended in 10 mM Tris HCl pH 8.0 rather than deionised water since more acidic

138

pHs than this cause bleaching of the fluorophore. The remainder of sample preparation

was carried out as described by (Moeseneder et al., 1999) with one change, PCR

products were loaded onto a large welled 1 % (w/v) agarose gel, excised and gel

extracted, rather than being precipitated first and then run on an agarose gel. It was

found that this did not reduce the quality of TRFLP patterns produced and also reduced

losses of PCR product. Once samples were precipitated and dried, they were split into

three aliquots for digestion in 100 µl total volumes with each of the above restriction

enzymes. Digestion was overnight at 37 oC for HaeII and HpaII and overnight at 55 oC

for BsiYI, with 5U of enzyme used in each case. Once digested the samples were

precipitated, dried and resuspended in 4 µl HiDi formamide (Applera, UK). 2 µl of the

HiDi formamide resuspended sample was mixed with a further 10 µl HiDi formamide

and ROX 500 (5-carboxy-X-rhodamine) size standard, diluted as per manufacturer’s

instructions, and loaded onto a 3100 Genetic Analyser (Applied Biosytems). The

analysis was carried out with 36 cm capillaries, using the POP4 polymer and the

standard run time was 45 min. The machine was set with the appropriate filter for

analysis of ABI dye set D. Data were initially collected and analysed using GeneScan

software, but this was found to be erratic in ‘calling’ the correct sizes for TRFs and so

GeneMapper v3.0 was consequently used in preference.

It would have been possible to use FAM, HEX, NED and TAMRA fluorescent dyes and

to have combined the products into single sample runs; the dye-sets are complimentary

with non-overlapping emission and absorption spectra. However, it was noted that with

BsiYI samples, where the forward primer was FAM labelled and the reverse was HEX

labelled, that a certain amount of dye bleed-through was evident. Peaks were produced

in the HEX detection channel at identical places, but with less intensity, as FAM peaks.

This could potentially make resolving the exact TRF difficult, particularly in the case of

139

the BsiYI 5’ TRF 346 and BsiYI 3’ TRF 347. At this time since BsiYI 5’ TRF 346 was

uncommon and part of an exclusively terrestrial clade, this problem was believed to be a

minor one and could be resolved in future by using an alternative fluorescent dye for 3’

TRFs that has emission and absorption wavelengths further removed from those of

FAM, such as NED (see Table 6.7 for dye wavelengths). Samples were therefore kept

separate rather than multiplexed in runs for the validation of the method (see Fig 6.7 for

an example TRFLP pattern and Appendix D for a full list of the TRF assignments for

each sequence).

Fig 6.7. BsiYI TRFLP pattern of clone PMLSW6 (AJ810829). The x axis is in bp and the y in relative fluorescent units. The red peaks are ROX 500 ladder, with FAM labelled TRF in blue and HEX in green. Sizing analysis was performed using the Global Southern size-calling algorithm of the Genemapper 3.0 software (Applied Biosystems, US). Fluorescent Dye Absorption maximum

(nm) Emission maximum (nm)

FAM 494 522 HEX 535 553 NED 546 575 ROX 587 607 TAMRA 560 582 Table 6.7. Absorption and Emission maxima of fluorophores for TRFLP analysis, adapted from www.appliedbiosystems.com.

140

6.7 TRFLP on environmental samples

The samples taken for DNA extraction from the AMBITION cruise are listed in

Appendix A. Each was from 2 L of seawater filtered either though 0.2 µm sterivex

cartridge filters, or through 0.2 µm Supor 200 membrane filters. Initially a number of

sterivex samples were selected for DNA preparation using the method of Somerville et

al., 1989 and amplification of cmuA was attempted with primer pair

cmuAF802/cmuAR1609 (see Table 6.8 for sample list).

Station Sample (refer to Appendix A) 1 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 13

2 17, 18 3 (Diel) 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 4 49, 50, 51, 52 ,53 5 66 6 82, 83 7 (Diel) 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 8 114, 115 9 122, 130, 131 10 138, 140 11 154

Table 6.8. AMBITION samples analysed by cmuA PCR. Both sterivex and memebrane filter samples are included. At least the chlorophyll maximum and surface water samples were used at all stations except 5 and 11.

Only non-specific PCR products were observed with these samples. Further DNA

samples were extracted using the hot-phenol method of (Schaefer & Muyzer, 2001)

with the membrane filtered samples. This was the preferred method of DNA sample

preparation as the Supor 200 filters are made from Polyethersulfone and are phenol

soluble; there is no chance of bacteria remaining attached to the filter and avoiding

lysis, which is a potential hazard when using the Sterivex filters. Despite repeat

attempts at PCR with a range of template concentrations cmuA products were not

141

obtained from any of these samples, although 16S rRNA products using primer 27f and

1492r could be obtained.

6.7.1 Celtic Sea seawater filter samples

These samples were kindly provided by Dr. Gary Smerdon of Plymouth Marine

Laboratory and were taken during a cruise aboard RRS Discovery (D261) in the Celtic

Sea from the 1st to 14th April 2002. The aim of the cruise was to follow and sample a

spring phytoplankton bloom through its formation and subsequent breakdown.

Phytoplankton blooms have been demonstrated at sites of particularly high levels of

CH3Br (Baker et al., 1999; Wingenter et al., 2004) and as such it was hoped that

bacteria capable of degrading CH3Br would also be present. The samples taken were

500 ml of water filtered through 0.2 µm nucleopore filters (see Table 6.9). DNA was

extracted using the hot-phenol method of Schaefer & Muyzer, 2001.

Station and cast no.

Station type Date of Sampling

Lat./long. Depths sampled (m)

1.12 E1 – standard 02/04/02 50o02’N 04o22’W 2 and 40 4.2 Standard 03/04/02 49o32’N 06o00’W 2 and 40 6.3 Standard 04/04/02 48o41’N 11o12’W 5 and 40 6.12 Standard 05/04/02 48o41’N 11o12’W 2 and 42 7.36 Lagrangian 09/04/02 49o37’N 10o20’W 2 and 40 7.54 Lagrangian 10/04/02 49o37’N 10o20’W 2 and 35 7.90 Lagrangian 12/04/02 49o37’N 10o20’W 2 and 35 Table 6.9. Celtic Sea samples.

Extracted DNA was used at a range of dilutions (neat, 1:10 and 1:100) for the PCR with

primer set cmuAF802/cmuAR1609. No cmuA PCR products were observed for any of

the samples. Amplification was checked by amplification of the 16S rRNA gene using

primers 27f/1492r, which proved positive in all cases, indicating the absence in DNA

samples of compounds inhibitory to the PCR.

142


Three different clades of cmuA sequences were detected during the course of this study.

One completely novel clade (A3) lacked isolated representatives, with the most closely

related sequence from isolated species being Hyphomicrobia. The Hyphomicrobia are

not known to be a marine genus, although methanol dehydrogenase sequences (mxaF)

affiliated to mxaF from Hyphomicrobium have been recovered from deep-sea

sediments, (Wang et al., 2004). The two other clades that were recovered were B1 and

B2. The cmuA sequences obtained from Arabian Sea DNA samples of enrichments and

seawater in clade B1 were distinct from the rest of the clade as supported by parsimony

and neighbour joining bootstrap values in phylogenetic analysis. They were most

closely related to cmuA sequences from a Rhodobacteracaea isolate, 179, isolated from

CH3Br enrichments of English Channel seawater, off the coast of Plymouth, indicating

a wide geographic spread of this clade of sequences. B1 also contains cmuA sequence

representatives previously amplified from soil communities (Borodina et al., 2005). All

L4 enrichment cmuA sequences clustered in clade B2, together with cmuA sequences

from isolates Aminobacter ciceronei IMB1 and Aminobacter sp. TW23, both isolated

from soils. This highlights the diversity and spread of the cmuA sequences. It would be

interesting to see whether this is reflected phylogenetically, by using a technique such

as stable-isotope probing (Radajewski et al., 2000), which has been used successfully

with both 13CH3Br and 13CH3Cl in terrestrial environments (Borodina et al., 2005;

Miller et al., 2004). An enrichment was set up with an L4 seawater sample and

13CH3Br with this intention towards the latter stages of this investigation, although it

failed to oxidise the compound.

It was interesting to discover that cmuA could not be amplified from DNA from the

smaller volume environmental samples when it could from the larger volume samples.

143

This indicates something about the abundance of these organisms within the

environment. Effective sample volumes of the SAP samples were all greater than 30 ml

in each µl of PCR template. The cmuA PCR positive samples of stations 1, 4 and 9 had

effective sample volumes in each 1 µl of DNA template of 90, 166.7 and 30 ml

respectively. DNA extracts from the 2 L cruise samples had effective sample volumes

of 10 –20 ml depending upon whether the DNA was resuspended in 50 or 100 µl

aliquots. Gaining an appreciation of the numbers of cmuA-containing organisms

present in marine systems could allow estimations of the proportion of marine CH3Br

degradation that these organisms are responsible for. It is not known how sensitive that

the cmuA PCR is in terms of numbers of gene copies capable of being detected. It

seems from these data that, independent of the limit of detection of this PCR reaction,

the cmuA containing bacteria are a small fraction of total bacterial biomass. What these

data cannot show is how active the cmuA-containing bacteria are in consumption of

marine CH3Br, so although the numbers of these organisms present may be low, their

contribution to CH3Br degradation could be proportionally greater than that of other

bacterial communities involved in this process.

144

Chapter 7

Leisingera methylohalidivorans strain

MB2 and attempts to identify cmuA

145

7 Leisingera methylohalidivorans MB2 and Attempts to Identify cmuA

7.1 Introduction

The cmuA gene successfully PCR amplified from marine DNA samples (Chapter 6

and Schaefer et al., 2005); however cmuA has not been amplified from the single

marine isolate capable of growth on CH3Br as sole source of carbon and energy that

was available at the start of this study, Leisingera methylohalidivorans MB2. This

strain was isolated by Dr. Kelly Goodwin from a tidal pool in California (Schaefer et

al., 2002) and was capable of growth on MeBr as sole source of carbon and energy.

Properties of this organism are described in Chapter 1, section 1.4.4.

Attempts to amplify cmuA PCR products from this organism had repeatedly failed

using the primers cmuAF802 and cmuAR1609. Southern hybridisation, using probes

based on random priming of cmuA PCR products amplified from Aminobacter

ciceronei IMB-1, Aminobacter lissarensis CC495, Methylobacterium

chloromethanicum CM4 and Hyphomicrobium chloromethanicum CM2 also failed to

identify a cmuA in L. methylohalidivorans MB2. This indicates that the organism

either possesses a CmuA significantly different to those of the terrestrial strains or

that the gene was not present (Warner, 2003).

SDS PAGE of cell-free extracts of strain MB2 grown with and without CH3Br on

Marine Broth 2216 (Difco) were inconclusive, and there were no demonstrateable

differences between the polypeptide profiles of cells grown under the two growth

conditions, suggesting: (i) that cmuA was not expressed; (ii) that the inducible system

had ceased to be expressed; (iii) that cmuA associated protein in strain MB2, which

146

would be in contrast to previous findings (Schaefer et al., 2002); (iv) that cmuA was

not present in this organism.

Representatives of three further clades of MeBr-utilising bacteria that were distinct

from L. methylohalidivorans MB2, have recently been isolated (Schäfer et al, 2005).

The strains isolated (179, 198 and 217) were all identified as members of the

Roseobacter group of the α-Proteobacteria according to phylogenet. Strain 179

represents a potentially novel genus, most closely related to strains implicated in

juvenile oyster disease (Boettcher et al., 1999). Strain 198 clusters within the genus

Ruegeria and strain 217 is most closely related to the genus Roseovarius. The partial

cmu clusters from strains 179 and 198, but not from strain 217, were cloned and

sequenced (Schaefer et al., 2005). Alignments of the six available complete cmuA

sequences (strains CM4, CM2, IMB1, CC495, 179 and 198) with primers cmuAF802

and cmuAR1609 demonstrated significant mismatches with the cmuA sequences from

the marine isolates, particularly with the reverse primer and strain 198 whose cmuA

sequence could not be amplified with cmuAF802/ cmuAR1609 (see figs 7.1 and 7.2).

Fig 7.1. Alignment of cmuA sequences with primer cmuAF802, 5’-3’. Position numbering is based on that of M. chloromethanicum CM4. Bases complementary to the primer are shaded black and mismatches shaded grey.

147

Fig 7.2. Alignment of cmuA sequences with primer cmuAR1609. Position numbering is based on that of M. chloromethanicum CM4. The primer target site is shown alongside the reverse complement of the primer sequence. Shading as Fig 7.1.

Therefore a new reverse primer was designed based on all six complete sequences

together with the partial sequences available in the cmuA ARB database (~100

sequences) keeping both the number of redundancies and the number of mismatches

as low as possible. This primer was designed by Dr H. Schaefer (Fig 7.3).

Fig 7.3. Alignment of cmuA sequences with primer cmuAR1244. Position numbering is based on that of M. chloromethanicum CM4. The primer target site is shown alongside the reverse complement of the primer sequence. Shading as Fig 7.1.

With the new primer combination of cmuAF802/cmuAR1244, PCR products could

still not be amplified from L. methylohalidivorans MB2, but this primer provided the

basis for my attempt to obtain the cmu cluster from this organism.

7.2 Rationale and primer design

The corrinoid-binding domain of the bifunctional enzyme CmuA is the most highly

conserved region of the molecule. The structure of corrinoid-binding domains is

148

known to be a four-helix bundle (Fig 7.4, Ludwig & Matthews, 1997) and structural

analysis of the C-terminal domain indicates that this is also the case for CmuA.

Fig 7.4. 3D-views of a four helix bundle corrinoid-binding domain with bound cobalamine. Top-down and end-on views of the binding niche are shown in a and b respectively. α-helices are shown as large pink arrows and cobalamine in ball-and-stick format. The bound cobalt of cobalamine is indicated Co. Structures downloaded from the Conserved Domain Database (see text) and redrawn with Cn3D 4.1 available from http://ncbi.nih.gov/Structure/CN3D/cn3d.shtml.

There are a number of motifs present that are conserved not only within bacterial

corrinoid-binding proteins, but also archaeal and eukaryotic, for example, the vitamin

B12 dependent human 5-methyl tetrahydrofolate-homocysteine methyltransferase

(Evans et al., 2002). BLASTp (Altschul et al., 1997) and the Conserved Domain

Database (Marchler-Bauer et al., 2005) search identifies the common motif MXXVG,

which is conserved as MKX V/I G in CmuA sequences obtained thus far. Craig

McAnulla proposed a second motif based on alignments with other corrinoid proteins

involved in methyl transfer, such as MetH, the cobalamin-dependent methionine

synthase of Escherichia coli (Old et al., 1990) and MtmC, a corrinoid protein

involved in methyl transfer from methanol to coenzyme M in Methanosarcina barkeri

a b

149

(LeClerc & Grahame, 1996; McAnulla, 2000). Within the proposed CmuA motif

NxQxxGx41SxMx28GG, the residues are believed to be involved in binding of the

corrinoid group, with the asparagine, glutamine and glycine residues forming a ligand

triad essential for enzyme activity in other corrinoid proteins (Ludwig & Matthews,

1997).

The corresponding protein sequence encoded by PCR primer cmuAR1244 is

positioned just inside the corrinoid-binding domain of cmuA. It is a feature of all the

primer pairs so far designed that they span both domains of this uniquely structured

enzyme, in order to increase specificity of the primers. This could also be responsible

for the lack of PCR product from L. methylohalidivorans. According to BLAST

searches, the most similar proteins are the mono- di- and tri-methylamine

methyltransferases and corrinoid-binding proteins of the methanogenic archaeon

Methanosarcina barkeri. These are present as separate enzymes in these organisms,

rather than the fusion of two functional domains, as with CmuA. It is possible that

this is also the case in L. methylohalidivorans and primers targeting only the

corrinoid-binding region might reveal whether this was the case. Primer cmuAR1352

(fig 7.5) was designed to amplify the corrinoid region when paired with the reverse

complement of cmuAR1244, cmuAF1224.

Fig 7.5. Alignment of cmuA sequences with primer cmuAR1352. Position numbering is based on that of M. chloromethanicum strain CM4. The primer target site is shown alongside the reverse complement of the primer sequence. Shading as Fig 7.1.

150

Primers were tested with A. ciceronei strain IMB-1 and H. chloromethanicum strain

CM2 and gave products of the expected size (128 bp) as demonstrated by gel

electrophoresis with ethidium bromide staining, running alongside Invitrogen 1kb

ladder. PCR conditions were as those in Chapter 2: Materials and Methods.

7.3 Results

A 128 bp PCR product was obtained using L. methylohalidivorans DNA as template.

This was cloned, sequenced and identified as cmuA by BLAST analysis, sharing 80 %

ID and with cmuA from A. lissarensis IMB1. Comparison was then made with the

rest of the cmuA database using ARB for phylogenetic analysis, which indicated that

the cmuA sequence from L. methylohalidivorans was different to those previously

sequenced. The cloned PCR product from L. methylohalidivorans was PCR amplified

again in order to gain enough of the PCR product for preparation of a gene probe for

Southern hybridisation analysis and to reveal the rest of the cmuA gene and cmu

cluster in this organism (probe preparation as Materials and Methods). Southern

analysis even at low washing stringencies (2 x SSC at 50 oC) failed to demonstrate

any hybridisation with the cmuA probe from L. methylohalidivorans, but the probe

bound extremely well to the positive control.

151

Fig 7.6. Autoradiograph of L. methylohalidivorans Southern analysis. The orginal EtBr stained agarose gel image can be seen. Lanes 1, 8, 11 and 13 contain 1 kb DNA ladder (Invitrogen) and lane 14 contains the positive control, H. chloromethanicum cmuA in the Invitrogen TOPO vector. Lanes 2, 3, 4, 5, 6, and 7 contain L. methylohalidivorans DNA digested with, respectively restriction enzymes EcoRI, SalI, KpnI, BamHI, PstI and HindIII. Lanes 9, 10 and 12 contained Rhodobacteraceae strain 217 DNA digested with EcoRI, SalI and KpnI respectively. The blot was washed at a stringency of 2 x SSC at 50 oC and the X-ray film was exposed for 5 days with two enhancing screens. Arrowed are ladder bands (1636 bp) that have bound the probe.

On checking the sequence of the probe it was noticed that the base changes that

rendered the sequence novel were all at positions of degenerate bases in the primer

regions. Removing the primer sequences from the phylogenetic analysis indicated

that the PCR product obtained from the L. methylohalidivorans DNA was identical to

that of A. ciceronei, presumably due to low level contamination of the genomic DNA

sample.

1 2 3 4 5 6 7 8 9 1011121314

152

7.4 Discussion

The aim of this work was to test the hypothesis that L. methylohalidivorans MB2

possessed a cmuA substantially different from those previously identified and

sequenced. Despite the fact that they did not work in the case of L.

methylohalidivorans the primer pair developed in this work will prove useful for

obtaining cmuA sequences via Southern analysis from other organisms, as

demonstrated with H. chloromethanicum CM2 as the positive control for this analysis.

As the corrinoid-binding region is so well conserved in this enzyme, this region is

ideal for avoiding the mismatches present in other parts of the molecule.

Since this work was carried out, further attempts have been made to identify cmuA in

L. methylohalidivorans. A probe generated from a novel marine CH3Br utilising

bacterium, strain 179, was used in Southern hybridisation analysis and failed to obtain

hybridisation (Schaefer et al., 2005). During the course of this investigation it

became clear that Roseovarius strain 217, as with L. methylohalidivorans, did not

possess a cmuA identifiable by PCR. It also did not contain a distinct 67 kDa protein

present in SDS PAGE analysis when grown on CH3Br. It is therefore believed that

another pathway for the utilisation of methyl halides must be operating in these

organisms. Strain 217 has been accepted for genome sequencing by the Gordon and

Betty Moore Foundation and it is anticipated that this will provide some insight into

the mechanisms involved in these non-CmuA CH3X utilisers. It would be facile to

screen a genome sequence for methyltransferases and corrinoid-binding proteins, or

perhaps for other genes in the cmu cluster, such as cmuB, cmuC or folD

153

Chapter 8

Synopsis, Discussion, and Future Work

154

8 Chapter 8: Synopsis, Discussion and Future Work

8.1 Synopsis

8.1.1 Aims

The aims of this work were to investigate marine CH3Br-utilising bacteria and can be

split into four areas:

• Measurement of environmental (pptv) concentrations of CH3Br in seawater.

• Enrichment, isolation, and characterisation of CH3Br-utilising bacteria.

• Use of molecular ecological analyses to determine the presence, distribution

and diversity of CH3Br-utilising bacteria in seawater.

• Correlation of the presence and concentration of CH3Br with the presence and

abundance of CH3Br-utilising bacteria in seawater.

Two main sampling areas were used, the Arabian Sea through the NERC Marine and

Freshwater Microbial Biodiversity thematic AMBITION cruise, and L4, a sampling

station off the Coast of Plymouth (UK). A range of approaches was used, and these

are summarised below.

8.1.2 GC analysis of CH3Br

Three different gas chromatographic systems were used in order to measure CH3Br

concentrations: a GC FID to determine the presence/absence of CH3Br in enrichment

and other cultures; a GC ECD purge and trap system for extraction and analysis of

pptv concentrations of CH3Br from seawater samples; a second GC ECD purge and

trap system. The first GC ECD system suffered from electronic problems and was

superseded by the second system, which was used successfully to gather

measurements of seawater CH3Br concentrations from L4 over part of a seasonal

155

cycle. Rapid changes in concentrations of CH3Br from supersaturated to

undersaturated with respect to atmosphere. This suggested that the compound was

being degraded quickly, presumably by biological activity as this was more rapid than

could be accounted for by chemical degradation rates. The likelihood of in situ

production of CH3Br was also high further enhancing this fact. Peaks in CH3Br

supersaturations seemed to correspond with peaks in phytoplankton abundance, which

would be in agreement with data indicating the phytoplankton are an important

marine source of CH3Br (Baker et al., 1999; Saemundsdottir & Matrai, 1998; Scarratt

& Moore, 1998; Wingenter et al., 2004).

8.1.3 Enrichment and isolation

A large array of enrichments on CH3Br, CH3Cl and combinations of other C1

compounds was set up during the AMBITION cruise. Enrichments which contained

both CH3Br and 10 mM formate were able to be maintained on CH3Br for a long

time, whereas other enrichments from Arabian seawater were less successful.

Isolation of CH3Br-utilising bacteria was attempted from the active enrichments, and

although a number of strains were isolated, including one that gave a cmuA PCR

product, none were able to oxidise CH3Br in pure culture. Further active enrichments

were obtained from L4 seawater. Non-axenic cultures of the CH3Br-producing

coccolithophore Emiliania huxleyi CCMP 1516 were investigated as a potential

source of CH3Br-utilising isolates; this was unsuccessful.

8.1.4 MxaF diversity

PCR primers for the analysis of methanol dehydrogenase large subunit (MxaF)

sequences as a molecular marker of marine methylotrophic diversity were re-

developed. A number of potential PCR primers for mxaF were designed to target a

156

wider diversity of Proteobacterial mxaF sequences. Full-length sequences of α-, β-,

and γ-Proteobacterial mxaF sequences were aligned in order to enable this. These

mxaF PCR primers were screened, resulting in the new reverse primer mxaR1555,

which proved, in conjunction with the original forward primer mxaF1003, to be able

to amplify mxaF sequences from a large number of methanol-oxidising bacteria.

Although marine environmental samples were not tested within the timescale of this

work, the mxaF PCR primers show promise for use in future studies of both

methylotroph and methanotroph diversity.

8.1.5 cmuA diversity

The diversity of cmuA sequences in the active enrichments from both the Arabian Sea

and L4 was assessed by clone library analysis. Sequences belonged to three clades,

one novel clade with no cultured representatives and two clades not previously

containing any marine sequences.

Clone libraries were also produced from cmuA PCR products amplified from DNA of

large volume seawater samples from the Arabian Sea. Phylogenetic analysis of these

cmuA sequences indicated a shift in the most common sequence types observed in

these libraries that occurs between stations one and four of the cruise. These

sequences, together with available cmuA sequences from other environments, formed

an extensive database which was used to develop Terminal Restriction Fragment

Length Polymorphism analysis as a rapid technique for screening cmuA diversity in

the large number of remaining DNA samples from the Arabian Sea cruise, and

samples from a Celtic Sea cruise. Although the TRFLP technique was successfully

applied to standard clones, no cmuA PCR products were obtained from any of the

remaining samples. This was related to the sample volume used, with cmuA products

157

easily obtained from CH3Br enrichments and large volume samples, but not from

those with sample volumes of 2 L or less. This presumably reflects the abundance of

cmuA containing organisms in the marine environment at the time of sampling.

8.1.6 Leisingera methylohalidivorans MB2

L. methylohalidivorans was the single marine isolate capable of utilising CH3Br as

sole carbon and energy source available at the beginning of this study. Although a

number of attempts had been made to reveal the presence of the CmuA pathway in

this organism, none had been successful. It was hypothesized that L.

methylohalidivorans could contain a cmuA sequence substantially different to any

other previously identified. PCR primers were designed to the highly conserved

region encoding the corrinoid-binding region of cmuA. A 128 bp PCR product was

obtained from L. methylohalidivorans MB2 and used as a probe in Southern analysis.

This failed to hybridise and on sequencing of the probe, it was discovered that

ambiguities in the primer regions of the sequence had resulted in it being mistakenly

identified as novel, whereas in fact it was 100 % identical to the sequence of

Aminobacter ciceronei IMB1, and therefore due to contamination of the PCR.


The global CH3Br cycle has yet to be fully defined. The oceans are known to be both

a source and a sink of CH3Br, but the part that CH3Br-utilising bacteria play in this

marine flux of CH3Br remains obscure. Changes in diversity of the populations

responsible for CH3Br could have repercussions for the global cycle of this compound

and it is therefore important to be able to characterise these populations and their

involvement, not only to clarify current fluxes, but also to be able to model changes in

158

the degradation rates of CH3Br with respect to changes in bacterial community

structure.

The ultimate aim of this investigation was to couple measurements of the fluxes of

CH3Br with molecular microbiological methods in order to characterise the

contribution of CH3Br-utilising bacteria to the marine CH3Br sink. This was an

ambitious aim and although not achieved, this investigation has laid firm groundwork

for further work towards this goal.

8.2.1 Measurement of CH3Br

Development of GC techniques sensitive enough to detect environmental

concentrations of CH3Br (levels of pmol/l) allowed measurements of water column

CH3Br at station L4, off the coast of Plymouth, UK. Results indicated that levels of

CH3Br rapidly switched from supersaturated to undersaturated concentrations in

seawater, perhaps reflecting the activity of CH3Br-utilising bacteria. In order to

investigate this further, there are a number of experiments that could be undertaken.

GC ECD ‘system three’ with purge and trap apparatus could be used to measure rates

of loss of CH3Br when spiked into seawater samples at environmental concentrations.

Inclusion of inhibitors such as, mercuric chloride (to measure chemical loss rates) and

acetylene or methyl tert-butyl ether (to inhibit soluble methane monooxygenase,

which is capable of co-oxidation of CH3X) would allow assignment of the total loss

rates of CH3Br to various components of the bacterioplankton. It would be extremely

useful to develop an inhibitor of CmuA for use in this experiment in order to reveal

the amount of CH3Br degradation that this pathway is responsible for. (Hoeft et al.,

2000) made use of 500 µM chloroform as an inhibitor of transmethylation,

successfully inhibiting CH3Br consumption by strain LIS-3. It should be noted that

159

this concentration of chloroform is much higher than the concentration of CH3Br that

would be present and may have other, undesirable, effects on the natural population

present in incubations. Recently (Goodwin et al., 2005) demonstrated the inhibition

of CH3Br degradation in seawater samples by 160 to 200 nM toluene and isolated a

strain Oxy6 which was capable of growth on toluene whilst co-oxidising CH3Br.

Extension of the measurement of CH3Br concentrations at station L4 in coastal waters

off Plymouth over a full seasonal cycle would allow the determination of any seasonal

effects on CH3Br fluxes. CH3Br could also be measured during diel sampling cycles,

and over more detailed depth profiles. Critical to understanding the importance of

CmuA containing bacteria to degradation of marine CH3Br would be determination of

the number of these organisms present and their activity. The successful

amplification of cmuA from large volume DNA samples and enrichments gave an

appreciation of the low numbers of these organisms present, but development of Real

Time PCR for quantitative detection of cmuA copy number would be a major

objective. This technique has already been applied successfully to detection of

functional genes of methylotrophic bacteria such as pmoA in soils (Kolb et al., 2003).

Coupling this with RNA extraction and Reverse Transcriptase PCR would allow for

enumeration of cmuA that is actively being expressed. This would be a challenging

project to attempt given the indications of low levels of cmuA present in seawater

DNA extracts.

8.2.2 Molecular techniques

Two separate attempts were made to elucidate the diversity of CH3Br-utilising marine

bacteria by molecular methods. Firstly, the primer pair cmuAF802/cmuAR1609 was

applied to marine enrichment and DNA samples from Arabian Sea and Plymouth

160

coastal seawater and a large number of marine cmuA sequences were collected.

Falling into three clades, these sequences indicated a diversity that is not currently

represented by isolated CH3Br-utilising bacteria. There is certainly more scope for

future attempts at isolating these organisms, perhaps using a wider range of media, as

only one was used in this case. Two sequences belonging to clade A3 from the

pooled Arabian Sea enrichment PE2 contained in-frame stop codons, confirmed by

resequencing. It is possible that they could have been due to PCR or cloning errors,

but also possible that they were present in an organism in this condition. It is unclear

as to whether these genes would have been expressed in the environment. A future

study could make use of the RNA Stable-Isotope Probing (Manefield et al., 2002)) in

order to gain an impression of which clades are actively responsible for 13CH3Br-

utilisation, and to use DNA Stable-Isotope-Probing in order to look at cmuA diversity

in the active portion of the population. It would be critical to identify samples in

which CH3Br is being rapidly utilised prior to use of these stable-isotope techniques

as they rely on swift utilisation of heavy isotope labelled substrates in order that the

labelled carbon does not leach into the non-CH3Br utilising microbial assemblage via

consumption of secondary metabolites, cross-feeding, or other means. There is the

added complication when using seawater samples of chemical degradation of the

labelled CH3Br to methanol and CH3Cl via hydrolysis and nucleophilic substitution

reactions, which would also serve to label non-CH3X degrading DNA/RNA.

Coupling DNA/RNA SIP with metagenomic analyses such as fosmid or BAC library

production might allow the isolation of complete cmu clusters from only that portion

of the population that was actively utilising CH3Br and may also allow identification

of non-cmu pathway degradation mechanisms. Co-localisation of phylogenetic

marker genes with functional genes can allow the identification of the organism

161

responsible. Use of these simple, but powerful techniques has previously allowed the

identification of a completely novel form of bacterial phototrophy (Beja et al., 2000).

Secondly, mxaF, the gene encoding the large subunit of methanol dehydrogenase had

PCR primers re-developed with the aim of looking at the diversity of these sequences

within marine systems. Some, but not all, CH3X-utilising bacteria (including H.

chloromethanicum CM2 and M. chloromethanicum CM4) possess a methanol

dehydrogenase and this gene could be used as a phylogenetic marker to gain insights

into the phylogeny of a subset of CH3X-utilisers.

8.2.3 CH3Br-utilising isolates and enrichments

There are a number of indications that bacteria utilising the cmu pathway are not the

only marine bacteria capable of degrading CH3Br. Methane oxidisers (Dalton &

Stirling, 1982; Stirling & Dalton, 1980), ammonia oxidisers (Rasche et al., 1990), and

propane oxidisers (Streger et al., 1999) have also been demonstrated to co-oxidise

CH3Br and are likely to contribute to marine degradation when present in this

environment.

Various attempts to demonstrate the presence of cmuA in Leisingera

methylohalidivorans MB2, including this one, have failed, although a primer for the

corrinoid-binding domain of cmuA with potential useful future applications, such as

amplification of cmuA sequences beyond the scope of the current primer set, was

designed in the process. The reason could simply be that a different pathway is being

employed in this organism to allow growth on CH3Br as sole carbon and energy

source. This pathway could be identified by techniques such as transposon

mutagenesis and the isolation of mutants unable to utilise CH3Br as sole carbon and

162

energy source. However, this would rely on the development of genetic techniques

for this organism, and attempts would be further hampered by its low biomass

production when grown on CH3Br.

During this project Schaefer et al., 2005 isolated 13 novel marine CH3Br-utilising

bacteria belonging to three clades of α-Proteobacteria. Two of these clades,

represented by Rhodobacteracaea strains 179 and 198, were demonstrated by SDS

PAGE and protein mass spectrometry analysis to express CmuA when grown on

CH3Br and cmu clusters were subsequently cloned and sequenced from these.

However, the third clade, represented by Rhodobacteracaea strain 217, did not. This

strain was also capable of utilising dimethyl sulfoniopropionate (DMSP) as sole

carbon and energy source its genome was recently sequenced through funding by the

Gordon and Betty Moore Foundation. Currently the genome is awaiting annotation.

After analysis, it might be possible to identify a candidate pathway for CH3Br-

utilisation, and this could be used to identify the CH3X-degrading system in L.

methylohalidivorans MB2.

Goodwin et al., 2005 tested the ability of toluene to inhibit CH3Br consumption by L.

methylohalidivorans MB2 and found that it did not. Toluene also did not inhibit

CH3Br consumption by the cmu pathway organism Aminobacter ciceronei IMB1. As

toluene inhibited CH3Br degradation by 29-100 % in samples from the Western and

North Atlantic, North Pacific and Southern Ocean, but failed to inhibit either of these

organisms, it would be interesting to find out the proportion of CH3Br degradation

that the pathways represented by these two organisms contribute to total marine

CH3Br degradation. The toluene and CH3Br co-oxidising strain Oxy6 isolated by

163

these investigators was placed phylogenetically close to Erythrobacter and

Porphyrobacter clusters of the Sphingomonadacaea. One of the isolates from

Arabian Sea enrichments, MJC8 was identified by 16S rRNA sequencing to be related

to the Erythrobacter genus, and although it did not demonstrate the presence of cmuA

after PCR amplification, perhaps it was co-oxidising CH3Br in a similar manner to

strain Oxy6.

What is not yet clear from any analysis carried out to date is whether CH3X are used

by marine bacteria capable of their utilisation as sole carbon and energy source, or

whether these organisms mainly make use of other available growth substrates. In

this case degradation of CH3Br might be as a top-up energy source or top-up carbon

source, but not directly support biomass production. Thermodynamically CH3Br is a

viable energy source and it has been calculated that dissolved substrates are useful

energy sources even at the vanishingly low concentrations that CH3Br is present at in

marine systems (Williams, 2000). Expression of the cmu pathway enzymes in H.

chloromethanicum CM2 was tightly regulated in response to the presence of CH3Cl

and CH3Br (Borodina et al., 2004), even when the organism was being grown on an

alternative substrate. Further work needs to be carried to investigate the importance

of CH3X as a carbon and energy source in by CH3X-utilising bacteria.

During the enrichment and isolation of CH3Br-utilising bacteria, it was noticed that

the most active enrichments from the Arabian Sea were all enriched with CH3Br

together with 10 mM formate. The enzyme formate dehydrogenase (FDH) which

catalyses the oxidation of formate to carbon dioxide is part of the cmu CH3Br

164

utilisation pathway and perhaps enrichment with formate serendipitously enriched for

this pathway.

8.3 In conclusion

During this study, a sensitive GC ECD system for measurement of seawater CH3Br

concentrations was developed, CH3Br oxidising enrichments from contrasting marine

provinces were obtained and isolation of novel CH3Br-utilising bacteria was

attempted. Primers targeting the gene encoding for the large subunit of methanol

dehydrogenase were redesigned and shown to be useful for amplifying mxaF from a

wide range of methylotrophs and methanotrophs. A wide range of different cmuA

sequences was produced by clone library analysis from both Plymouth coastal, and

Arabian Sea seawater CH3Br enrichments and samples. These were used to develop

the TRFLP technique for use with cmuA and allow the rapid screening of these

sequences in environmental DNA samples in future.

Of the aims of this work, measurements of CH3Br in seawater were made and the

presence, distribution and diversity of the cmu pathway containing CH3Br-utilising

bacteria was assessed. Marine CH3Br enrichments were successfully produced,

although novel isolates were not obtained. With more time the critical aim would be

to couple measurements of CH3Br with the molecular techniques developed here.

164

Bibliography

Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J. H., Zhang, Z., Miller, W. & Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389-3402. Anbar, A. D., Yung, Y. L. & Chavez, F. P. (1996). Methyl bromide: Ocean sources, ocean sinks, and climate sensitivity. Global Biogeochemical Cycles 10, 175-190. Anderson, D. J., Morris, C. J., Nunn, D. N., Anthony, C. & Lidstrom, M. (1990). Nucleotide sequence of the Methylobacterium extorquens AM1 moxF and moxJ genes involved in methanol oxidation. Gene 90, 173-176. Andreae, M. O. & Merlet, P. (2001). Emission of trace gases and aerosols from biomass burning. Global Biogeochemical Cycles 15, 955-966. Anthony, C. (1982). The Biochemistry of Methylotrophs. London: Academic Press. Aylward, G. H. & Findlay, T. J. V. (1986). SI chemical data, 2nd edn. Milton, Qld, Australia: John Wiley & Sons. Baker, J. M., Reeves, C. E., Nightingale, P. D., Penkett, S. A., Gibb, S. W. & Hatton, A. D. (1999). Biological production of methyl bromide in the coastal waters of the North Sea and open ocean of the northeast Atlantic. Marine Chemistry 64, 267-285. Beja, O., Aravind, L., Koonin, E. V., Suzuki, M. T., Hadd, A., Nguyen, L. P., Jovanovich, S., Gates, C. M., Feldman, R. A., Spudich, J. L., Spudich, E. N. & DeLong, E. F. (2000). Bacterial rhodopsin: Evidence for a new type of phototrophy in the sea. Science 289, 1902-1906. Boettcher, K. J., Barber, B. J. & Singer, J. T. (1999). Use of antibacterial agents to elucidate the etiology of juvenile oyster disease (JOD) in Crassostrea virginica and numerical dominance of an α-Proteobacterium in JOD-affected animals. Applied and Environmental Microbiology 65, 2534-2539. Bolt, H. M. & Gansewendt, B. (1993). Mechanisms of carcinogenicity of methyl halides. Critical Reviews in Toxicology 23, 237-253. Borodina, E., Cox, M. J., McDonald, I. R. & Murrell, J. C. (2005). Use of DNA-stable isotope probing and functional gene probes to investigate the diversity of methyl chloride-utilizing bacteria in soil. Environmental Microbiology. Borodina, E., McDonald, I. R. & Murrell, J. C. (2004). Chloromethane-dependant expression of the cmuA gene cluster of Hyphomicrobium chloromethanicum. Applied and Environmental Microbiology 70, 4177-4186. Bourque, D., Pomerleau, Y. & Groleau, D. (1995). High cell density cultivation of Methylobacterium extorquens on methanol for the production of high molecular weight PHB. Applied Microbiology and Biotechnology 44, 367-376.

165

Bulygina, E. S., Govorukhina, N. I., Netrusov, A. I., Trotsenko, Y. A. & Chumakov, K. M. (1993). Comparative studies on 5S RNA sequence and DNA-DNA hybridization of obligately and restricted facultatively methylotrophic bacteria. Systematic and Applied Microbiology 16, 85-91. Burkhill, P. H., Mantoura, R. F. C. & Owens, N. J. P. (1993). Biogeochemical cycling in the northwestern Indian Ocean: a brief overview. Deep-Sea Research Part Ii-Topical Studies in Oceanography 40, 643-649. Butler, J. H. (1994). The potential role of the ocean in regulating atmospheric CH3Br. Geophysical Research Letters 21, 185-188. Butler, J. H. (2000). Better budgets for methyl halides. Nature 403, 260-261. Chang, A. K. C., Lim, C. Y., Kim, S. W., You, H. J., Hahm, K. S., Yoon, S. M., Park, J. K. & Lee, J. S. (2002). Purification and characterization of two forms of methanol dehydrogenases from a marine methylotroph. Journal of Basic Microbiology 42, 238-245. Chistoserdova, L. & Lidstrom, M. (2002). The role of genomics in methylotrophic bacteria for understanding biogeochmical cycling. In Genes in the Environment. Edited by R. S. Hails, J. E. Beringer & H. C. J. Godfray: Blackwell publishing. Cicerone, R. J., Heidt, L. E. & Pollock, W. H. (1988). Measurements of Atmospheric Methyl-Bromide and Bromoform. Journal of Geophysical Research-Atmospheres 93, 3745-3749. Colby, J. & Zatman, L. J. (1973). Trimethylamine metabolism in obligate and facultative methylotrophs. Biochemical Journal 132, 101-112. Colby, J., Stirling, D. I. & Dalton, H. (1977). The soluble methane mono-oxygenase of Methylococcus capsulatus (Bath): Its ability to oxygenate n-alkanes, n-alkenes, ethers and alicyclic, aromatic and heterocyclic compounds. Biochemical Journal 165, 395-402. Connell-Hancock, T. L., Costello, A. M., Lidstrom, M. E. & Oremland, R. S. (1998). Strain IMB-1, a novel bacterium for the removal of methyl bromide in fumigated agricultural soils. Applied and Environmental Microbiology 64, 2899-2905. Coulter, C., Hamilton, J. T. G., McRoberts, W. C., Kulakov, L., Larkin, M. J. & Harper, D. B. (1999). Halomethane : bisulfide/halide ion methyltransferase, an unusual corrinoid enzyme of environmental significance isolated from an aerobic methylotroph using chloromethane as the sole carbon source. Applied and Environmental Microbiology 65, 4301-4312. Cregg, J. M., Madden, K. R., Barringer, K. J., Thill, G. P. & Stillman, C. A. (1989). Functional characterization of the two alcohol oxidase genes from the yeast Pichia pastoris. Molecular Cell Biology 9, 1316-1323.

166

Dalton, H. & Stirling, D. I. (1982). Co-metabolism. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 297, 481-495. Davenport, R. J., Curtis, T. P., Goodfellow, M., Stainsby, F. M. & Bingley, M. (2000). Quantitative use of fluorescent in situ hybridization to examine relationships between mycolic acid-containing actinomycetes and foaming in activated sludge plants. Applied and Environmental Microbiology 66, 1158-1166. De Bruyn, W. J. & Saltzman, E. S. (1997). The solubility of methyl bromide in pure water, 35 parts per thousand sodium chloride and seawater. Marine Chemistry 56, 51-57. De Marco, P., Pacheco, C. C., Figueiredo, A. R. & Moradas-Ferreira, P. (2004). Novel pollutant-resistant methylotrophic bacteria for use in bioremediation. FEMS Microbiology Letters 234, 75-80. de Vries, G. E., Arfman, N., Terpstra, P. & Dijkhuizen, L. (1992). Cloning, expression, and sequence analysis of the Bacillus methanolicus C1 methanol dehydrogenase gene. Journal of Bacteriology 174, 5346-5353. Dedysh, S. N., Liesack, W., Khmelemina, V. N., Suzina, N. E., Trotsenko, Y. A., Semrau, J. D., Bares, A. M., Panikov, N. S. & Tiedje, J. M. (2000). Methylocella paulstris gen. nov., sp. nov., a new methane-oxidising acidophilic bacterium from peat bogs, representing a novel subtype of serine pathway methanotrophs. International Journal of Systematic and Evolutionary Microbiology 50, 955-969. Dedysh, S. N., Smirnova, K. V., Khmelemina, V. N., Suzina, N. E., Liesack, W. & Trotsenko, Y. A. (2005). Methylotrophic autotrophy in Beijerinckia mobilis. Journal of Bacteriology 187, 3884-3888. DeLong, E. F. (2000). Resolving a methane mystery. Nature 407, 577-579. Deppenmeier, U. (2002). The unique biochemistry of methanogenesis. Progress in nucleic acid research and molecular biology 71, 223-282. Diez, B., Pedros-Alio, C., Marsh, T. L. & Massana, R. (2001). Application of denaturing gradient gel electrophoresis (DGGE) to study the diversity of marine picoeukaryotic assemblages and comparison of DGGE with other molecular techniques. Applied and Environmental Microbiology 67, 2942-2951. Doronina, N. V., Sokolov, A. P. & Trotsenko, Y. A. (1996). Isolation and initial characterization of aerobic chloromethane-utilizing bacteria. FEMS Microbiology Letters 142, 179-183. Duine, J. (1993). New developments in the biochemistry of quinoproteins in methylotrophs. In Microbial growth on C1 compounds. Edited by J. C. Murrell & D. P. Kelly. Andover: Intercept. Elliott, S. & Rowland, F. S. (1993). Nucleophilic-substitution rates and solubilities for methyl halides in seawater. Geophysical Research Letters 20, 1043-1046.

167

Elliott, S. & Rowland, F. S. (1995). Methyl halide hydrolysis rates in natural-waters. Journal of Atmospheric Chemistry 20, 229-236. Engebretson, J. J. & Moyer, C. L. (2003). Fidelity of select restriction endonucleases in determining microbial diversity by terminal-restriction fragment length polymorphism. Applied and Environmental Microbiology 69, 4823-4829. Ennis, C. A. (1998). The scientific assessment of ozone depletion. Geneva: World meteorological organisation. Evans, J. C., Huddler, D. P., Jiracek, J., Castro, C., Millian, N. S., Garrow, T. A. & Ludwig, M. L. (2002). Betaine-homocysteine methyltransferase: zinc in a distorted barrel. Structure 10, 1159-1171. Feinburg, A. P. & Vogelstein, B. (1983). A technique for radiolabelling DNA restriction endonuclease fragments to a high specific activity. Analytical Biochemistry 132, 6-13. Felsenstein, J. (1989). Phylogeny Inference Package (Version 3.2). Cladistics 5, 164-166. Felsenstein, J. (2004). PHYLIP (Phylogeny Inference Package). Seattle, US: Distributed by the author, Department of Genome Sciences, University of Washington. Ferry, J. G. (1999). Enzymology of one-carbon metabolism in methaogenic pathways. FEMS Microbiology Reviews 23, 451-456. Fetzner, S. (1998). Bacterial dehalogenation. Applied Microbiology and Biotechnology 50, 633-657. Field, J. A., Verhagen, F. J. M. & deJong, E. (1995). Natural organohalogen production by basidiomycetes. Trends in Biotechnology 13, 451-456. Fjellbirkeland, A., Torsvik, V. & Ovreas, L. (2001). Methanotrophic diversity in an agricultural soil as evaluated by denturing gradient gel elctrophoresis profiles of pmoA, mxaF and 16s rDNA sequences. Antonie van Leeuwenhoek Journal of Microbiology 79, 209-217. Freitag, T. E. & Prosser, J. I. (2003). Community structure of ammonia-oxidizing bacteria within anoxic marine sediments. Applied and Environmental Microbiology 69, 1359-1371. Gentile, I. A., Ferraris, L. & Crespi, S. (1989). The degradation of methyl bromide in some natural fresh waters. Influence of Temperature, pH and Light. Pesticide Science 25, 261-272.

168

Gerritse, J., Drzyzga, O., Kloestra, G., Keijmel, M., Wiersum, L. P., Hutson, R., Collins, M. D. & Gottschal, J. C. (1999). Influence of different electron donors and acceptors on dehalorespiration of tetrachloroethene by Desulfitobacterium frappieri TCE1. Applied and Environmental Microbiology 65, 5212-5221. Ghosh, M., Anthony, C., Harlos, K., Goodwin, M. G. & Blake, C. (1995). The refined structure of the quinoprotein methanol dehydrogenase from Methylobacterium extorquens at 1.94 A. Structure 3, 177-187. Gonzalez, J. M., Covert, J. S., Whitman, W. B., Henriksen, J. R., Mayer, F., Scharf, B., Schmitt, R., Buchan, A., Fuhrman, J. A., Kiene, R. P. & Ann Moran, M. (2003). Silicibacter pomeroyi sp nov and Roseovarius nubinhibens sp nov., dimethylsulfoniopropionate-demethylating bacteria from marine environments. International Journal of Systematic and Evolutionary Microbiology 53, 1261-1269. Goodey, J. B. (1949). The control of Anguillulina dipsaci on the seed of teazle and red clover by funigation with methyl bromide. Journal of Helminthology 23, 171-174. Goodwin, K. D., Schaefer, J. K. & Oremland, R. S. (1998). Bacterial oxidation of dibromomethane and methyl bromide in natural waters and enrichment cultures. Applied and Environmental Microbiology 64, 4629-4636. Goodwin, K. D., Tokarczyk, R., Stephens, F. C. & Saltzman, E. S. (2005). Description of toluene inhibition of methyl bromide biodegradation in seawater and isolation of a marine oxidiser that degrades methyl bromide. Applied and Environmental Microbiology 71, 3495-3503. Goodwin, K. D., Varner, R. K., Crill, P. M. & Oremland, R. S. (2001). Consumption of tropospheric levels of methyl bromide by C-1 compound-utilizing bacteria and comparison to saturation kinetics. Applied and Environmental Microbiology 67, 5437-5443. Grimsrud, E. P. & Miller, D. A. (1978). Oxygen doping of carrier gas in measurement of halogenated methanes by gas chromatography with electron capture detector. Analytical Chemistry 50, 1141-1145. Groen, B., Frank Jr, J. & Duine, A. J. (1984). Quinoprotein alcohol dehydrogenase from ethanol-grown Pseudomonas aeruginosa. Biochemical Journal 233, 921-924. Groszko, W. & Moore, R. M. (1998). Ocean-atmosphere exchange of methyl bromide: NW Atlantic and Pacific Ocean studies. Journal of Geophysical Research-Atmospheres 103, 16737-16741. Guillard, R. R. L. & Ryther, J. H. (1962). Studies of marine planktonic diatoms. I. Cyclotella nan Hustedt and Detonula confervacea Cleve. Canadian Journal of Microbiology 8, 229-239. Guillard, R. R. L. (1975). Culture of phytoplankton for feeding of marine invertebrates. In Culture of marine invertebrate animals, pp. 26-60. Edited by W. L. Smith & M. H. Chanley. New York: Plenum Press.

169

Haine, T. W. N., Watson, A. J. & Liddicoat, M. I. (1995). Chlorofluorocarbon-113 in the Northeast Atlantic. Journal of Geophysical Research-Oceans 100, 10745-10753. Harms, N., de Vries, G. E., Maurer, K., Hoogendijk, J. & Stouthamer, A. H. (1987). Isolation and nucleotide sequence of the methanol dehydrogenase structural gene from Paracoccus denitrificans. Journal of Bacteriology 169, 3969-3975. Hartmans, S., Schmuckle, A., Cook, A. M. & Leisinger, T. (1986). Methyl-Chloride - Naturally-occurring toxicant and C-1 growth substrate. Journal of General Microbiology 132, 1139-1142. Heijnen, J. J. & Van Dijken, J. P. (1992). In search of a thermodynamic description of biomass yields for the chemotrophic growth of microorganisms. Biotechnology and bioengineering 39, 833-858. Hoeft, S. E., Rogers, D. R. & Visscher, P. T. (2000). Metabolism of methyl bromide and dimethyl sulfide by marine bacteria isolated from coastal and open waters. Aquatic Microbial Ecology 21, 221-230. Horz, H. P., Yimga, M. T. & Liesack, W. (2001). Detection of methanotroph diversity on roots of submerged rice plants by molecular retrieval of pmoA, mmoX, mxaF, and 16S rRNA and ribosomal DNA, including pmoA-based terminal restriction fragment length polymorphism profiling. Applied and Environmental Microbiology 67, 4177-4185. Hutchens, E., Radajewski, S., Dumont, M. G., McDonald, I. R. & Murrell, J. C. (2004). Analysis of methanotrophic bacteria in Movile Cave by stable isotope probing. Environmental Microbiology 6, 111-120. Inagaki, F., Tsunogai, U., Suzuki, M., Kosaka, A., Machiyama, H., Takai, K., Nunoura, T., Nealson, K. H. & Horikoshi, K. (2004). Characterization of C-1-metabolizing prokaryotic communities in methane seep habitats at the Kuroshima Knoll, southern Ryukyu arc, by analyzing pmoA, mmoX, mxaF, mcrA, and 16S rRNA genes. Applied and Environmental Microbiology 70, 7445-7455. Jeong, J. H., Kim, S. W., Yoon, S. M., Park, J. K. & Lee, J. S. (2002). Characterization of the conserved region of the mxaF gene that encodes the large subunit of methanol dehydrogenase from a marine methylotrophic bacterium. Molecules and Cells 13, 369-376. Keppler, F., Eiden, R., Niedan, V., Pracht, J. & Scholer, H. F. (2000). Halocarbons produced by natural oxidation processes during degradation of organic matter. Nature 403, 298-301. Khalil, M. A. K. & Rasmussen, R. A. (1999). Atmospheric methyl chloride. Atmospheric Environment 33, 1305-1321.

170

Khalil, M. A. K., Rasmussen, R. A. & Gunawardena, R. (1993). Atmospheric methyl bromide - trends and global mass balance. Journal of Geophysical Research-Atmospheres 98, 2887-2896. Kim, H., Rao, P. S. C. & Annable, M. D. (1999). Gaseous tracer technique for estimating air-water interfacial areas and interface mobility. Journal of the Soil Science Association of America 63, 1554-1560. King, D. B. & Saltzman, E. S. (1997). Removal of methyl bromide in coastal seawater: Chemical and biological rates. Journal of Geophysical Research-Oceans 102, 18715-18721. King, D. B., Butler, J. H., Yvon-Lewis, S. A. & Cotton, S. A. (2002). Predicting oceanic methyl bromide from SST. Geophysical Research Letters 29. Kolb, S., Knief, C., Stubner, S. & Conrad, R. (2003). Quantitative detection of methanotrophs in soil by novel pmoA- targeted real-time PCR assays. Applied and Environmental Microbiology 69, 2423-2429. Krysell, M. & Nightingale, P. D. (1994). Low molecular weight halocarbons in the Humber and Rhine estuaries determined using a new purge and trap gas chromatographic method. Continental Shelf Research 14, 1311-1329. Lane, D. J. (1991). 16S/23S rRNA sequencing. In Nucleic acid techniques in bacterial systematics. Edited by E. Stackebrandt & M. Goodfellow. Chichester: J. Wiley and Sons Ltd. Laturnus, F. (1995). Release of Volatile Halogenated Organic-Compounds by Unialgal Cultures of Polar Macroalgae. Chemosphere 31, 3387-3395. Laturnus, F., Adams, F. C. & Wiencke, C. (1998). Methyl halides from Antarctic macroalgae. Geophysical Research Letters 25, 773-776. LeClerc, G. M. & Grahame, D. A. (1996). Methylcobamide:coenzyme M methyltransferase isozymes from Methanosarcina barkeri - physicochemical characterization, cloning, sequence analysis, and heterologous gene expression. Journal of Biological Chemistry 271, 18725-18731. Lee, N., Nielsen, P. H., Andreasen, K. H., Juretschko, S., Nielsen, J. L., Schleifer, K. H. & Wagner, M. (1999). Combination of fluorescent in situ hybridization and microautoradiography - a new tool for structure-function analyses in microbial ecology. Applied and Environmental Microbiology 65, 1289-1297. Lidstrom, M. (1988). Isolation and characterization of marine methanotrophs. Antonie van Leeuwenhoek Journal of Microbiology 54, 189-199. Lidstrom, M. (2001). Aerobic methylotrophic prokaryotes. In The Prokaryotes. Heidelberg: Springer-Verlag.

171

Lobert, J. M., Butler, J. H., Montzka, S. A., Geller, L. S., Myers, R. C. & Elkins, J. W. (1995). A net ink for atmospheric CH3Br in the East Pacific-Ocean. Science 267, 1002-1005. Lobert, J. M., Yvon-Lewis, S. A., Butler, J. H., Montzka, S. A. & Myers, R. C. (1997). Undersaturations of CH3Br in the Southern Ocean. Geophysical Research Letters 24, 171-172. Lovelock, J. (2000). Homage to Gaia. Padstow: Oxford Uiversity Press. Lovelock, J. E. (1963). Electron absorption detectors - technique for use in quantitative and qualitative analysis by gas chromatography. Analytical Chemistry 35, 474-481. Lovelock, J. E. (1973). Halogenated hydrocarbons in and over the Atlantic. Nature 241, 194-196. Ludwig, M. L. & Matthews, R. G. (1997). Structure-based perspectives on B12-dependant enzymes. Annual Review of Biochemistry 66, 269-313. Ludwig, W., Strunk, O., Klugbauer, S., Klugbauer, N., Weizenegger, M., Neumaier, J., Bachleitner, M. & Schleifer, K. H. (1998). Bacterial phylogeny based on comparative sequence analysis. Electrophoresis 19, 554-568. Ludwig, W., Strunk, O., Westram, R., Richter, L., Meier, H., Yadhukumar, Buchner, A., Lai, T., Steppi, S., Jobb, G., Forster, W., Brettske, I., Gerber, S., Ginhart, A. W., Gross, O., Grumann, S., Hermann, S., Jost, R., Konig, A., Liss, T., Lussmann, R., May, M., Nonhoff, B., Reichel, B., Strehlow, R., Stamatakis, A., Stuckmann, N., Vilbig, A., Lenke, M., Ludwig, T., Bode, A. & Schleifer, K. H. (2004). ARB: a software environment for sequence data. Nucleic Acids Research 32, 1363-1371. Machlin, S. M. & Hanson, R. D. (1988). Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene. Journal of Bacteriology 170, 4739-4747. Manefield, M., Whiteley, A. S., Griffiths, R. I. & Bailey, M. J. (2002). RNA stable isotope probing, a novel means of linking microbial community function to Phylogeny. Applied and Environmental Microbiology 68, 5367-5373. Manley, S. L. (2002). Phytogenesis of halomethanes: A product of selection or a metabolic accident? Biogeochemistry 60, 163-180. Mano, S. & Andreae, M. O. (1994). Emission of methyl bromide from biomass burning. Science 263, 1255-1257.

172

Marchler-Bauer, A., Anderson, J. B., Cherukuri, P. F., DeWeese-Scott, C., Geer, L. Y., Gwadz, M., He, S., Hurwitz, D. I., Jackson, J. D., Ke, Z., Lanczycki, C., Liebert, C. A., Liu, C., Lu, F., Marchler, G. H., Mullokandov, M., Shoemaker, B. A., Simonyan, V., Song, J. S., Thiessen, P. A., Yamashita, R. A., Yin, J. J., Zhang, D. & Bryant, S. H. (2005). CDD: a Conserved Domain Database for protein classification. Nucleic Acids Research 33, D192-D196. McAnulla, C. (2000).Chloromethane metabolism by Gram-negative methylotrophs. In Biological Sciences, pp. 180. Coventry: University of Warwick. McAnulla, C., McDonald, I. R. & Murrell, J. C. (2001a). Methyl chloride utilising bacteria are ubiquitous in the natural environment. FEMS Microbiology Letters 201, 151-155. McAnulla, C., Woodall, C. A., McDonald, I. R., Studer, A., Vuilleumier, S., Leisinger, T. & Murrell, J. C. (2001b). Chloromethane utilization gene cluster from Hyphomicrobium chloromethanicum strain CM2(T) and development of functional gene probes to detect halomethane-degrading bacteria. Applied and Environmental Microbiology 67, 307-316. McDonald, I. R. & Murrell, J. C. (1997). The methanol dehydrogenase structural gene mxaF and its use as a functional gene probe for methanotrophs and methylotrophs. Applied and Environmental Microbiology 63, 3218-3224. McDonald, I. R., Doronina, N. V., Trotsenko, Y. A., McAnulla, C. & Murrell, J. C. (2001). Hyphomicrobium chloromethanicum sp nov and Methylobacterium chloromethanicum sp nov., chloromethane-utilizing bacteria isolated from a polluted environment. International Journal of Systematic and Evolutionary Microbiology 51, 119-122. McDonald, I. R., Kampfer, P., Topp, E., Warner, K. L., Cox, M. J., Connell Hancock, T. L., Miller, L. G., Larkin, M. J., Ducrocq, V., Coulter, C., Harper, D. B., Murrell, J. C. & Oremland, R. S. (In Press). Aminobacter ciceronei sp. nov. and Aminobacter lissarensis sp. nov., isolated from various terrestrial environments. International Journal of Systematic and Evolutionary Microbiology. McDonald, I. R., Warner, K. L., McAnulla, C., Woodall, C. A., Oremland, R. S. & Murrell, J. C. (2002). A review of bacterial methyl halide degradation: biochemistry, genetics and molecular ecology. Environmental Microbiology 4, 193-203. Mellouki, A., Talukdar, R. K., Schmoltner, A. M., Gierczak, T., Mills, M. J., Solomon, S. & Ravishankara, A. R. (1992). Atmospheric lifetimes and ozone depletion potentials of methyl bromide (CH3Br) and dibromomethane (CH2Br2). Geophysical Research Letters 19, 2059-2062. Miller, L. G., Connell, T. L., Guidetti, J. R. & Oremland, R. S. (1997). Bacterial oxidation of methyl bromide in fumigated agricultural soils. Applied and Environmental Microbiology 63, 4346-4354.

173

Miller, L. G., Warner, K. L., Baesman, S. M., Oremland, R. S., McDonald, I. R., Radajewski, S. & Murrell, J. C. (2004). Degradation of methyl bromide and methyl chloride in soil microcosms: Use of stable C isotope fractionation and stable isotope probing to identify reactions and the responsible microorganisms. Geochimica et Cosmochimica Acta 68, 3271-3283. Moeseneder, M. M., Arrieta, J. M., Muyzer, G., Winter, C. & Herndl, G. J. (1999). Optimization of terminal-restriction fragment length polymorphism analysis for complex marine bacterioplankton communities and comparison with denaturing gradient gel electrophoresis. Applied and Environmental Microbiology 65, 3518-3525. Moosvi, S. A., Pacheco, C. C., McDonald, I. R., De Marco, P., Pearce, D. A., Kelly, D. P. & Wood, A. P. (2005). Isolation and properties of methane-sulfonate degrading Afipia felis from Antarctica and comparison with other strains of A. felis. Environmental Microbiology 7, 22. Murrell, J. C. & McDonald, I. R. (2000). Methylotrophy. In Encyclopedia of microbiology, pp. 245-255. London: Academic Press. Muyzer, G., De Waal, E. C. & Uitterlinden, A. G. (1993). Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Applied and Environmental Microbiology 59, 695-700. Nightingale, P. D., Malin, G. & Liss, P. S. (1995). Production of chloroform and other low-molecular-weight halocarbons by some species of macroalgae. Limnology and Oceanography 40, 680-689. Oakley, C. J. & Murrell, J. C. (1988). nifH genes in obligate methane oxidising bacteria. FEMS Microbiology Letters 49. Old, I. G., Margarita, D., Glass, R. E. & Saint Girons, I. (1990). Nucleotide sequence of the metH gene of Escherichia coli K-12 and comparison with that of Salmonella typhimurium LT2. Gene 87, 15-21. Osborn, A. M., Moore, E. R. B. & Timmis, K. N. (2000). An evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis for the study of microbial community structure and dynamics. Environmental Microbiology 2, 39-50. Pacheco, C. C., Passos, J. F., Moradas-Ferreira, P. & De Marco, P. (2003). Strain PM2, a novel methylotrophic fluorescent Pseudomonas sp. FEMS Microbiology Letters 227, 279-285. Pernthaler, A. & Amann, R. (2004). Simultaneous fluorescence in situ hybridization of mRNA and rRNA in environmental bacteria. Applied and Environmental Microbiology 70, 5426-5433. Platt, U. & Honninger, G. (2003). The role of halogen species in the troposphere. Chemosphere 52, 325-338.

174

Radajewski, S., Ineson, P., Parekh, N. R. & Murrell, J. C. (2000). Stable-isotope probing as a tool in microbial ecology. Nature 403, 646-649. Ragsdale, N. & Vick, K. (2001). The U.S. Search for methyl bromide alternatives. Pesticide Outlook December, 244-248. Rappe, M. S., Connon, S. A., Vergin, K. L. & Giovannoni, S. J. (2002). Cultivation of the ubiquitous SAR11 marine bacterioplankton clade. Nature 418, 630-633. Rasche, M. E., Hyman, M. R. & Arp, D. J. (1990). Biodegradation of halogenated hydrocarbon fumigants by nitrifying bacteria. Applied and Environmental Microbiology 56, 2568-2571. Redeker, K. R., Andrews, J., Fisher, F., Sass, R. & Cicerone, R. J. (2002). Interfield and intrafield variability of methyl halide emissions from rice paddies. Global Biogeochemical Cycles 16, art. no.-1125. Rhew, R. C., Miller, B. R. & Weiss, R. F. (2000). Natural methyl bromide and methyl chloride emissions from coastal salt marshes. Nature 403, 292-295. Rhew, R. C., Ostergaard, L., Saltzman, E. S. & Yanofsky, M. F. (2003). Genetic control of methyl halide production in Arabidopsis. Current Biology 13, 1809-1813. Riemann, L., Steward, G. F., Fandino, L. B., Campbell, L., Landry, M. R. & Azam, F. (1999). Bacterial community composition during two consecutive NE Monsoon periods in the Arabian Sea studied by denaturing gradient gel electrophoresis (DGGE) of rRNA genes. Deep-Sea Research Part Ii-Topical Studies in Oceanography 46, 1791-1811. Ritchie, N. J., Schutter, M. E., Dick, R. P. & Myrold, D. D. (2000). Use of length heterogeneity PCR and fatty acid methyl ester profiles to characterize microbial communities in soil. Applied and Environmental Microbiology 66, 1668-1675. Rockne, K. J. & Strand, S. E. (2003). Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for Type II α-proteobacteria methanotrophs. Journal of Environmental Science and Health Part a- Toxic/Hazardous Substances & Environmental Engineering 38, 1877-1887. Rose, T. M., Schultz, E. R., Henikoff, J. G., Pietrokovski, S., McCallum, C. M. & Henikoff, S. (1998). Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences. Nucleic Acids Research 26, 1628-1635. Saemundsdottir, S. & Matrai, P. A. (1998). Biological production of methyl bromide by cultures of marine phytoplankton. Limnology and Oceanography 43, 81-87. Saini, H. S., Attieh, J. M. & Hanson, A. D. (1995). Biosynthesis of halomethanes and Methanethiol by higher-plants via a novel methyltransferase reaction. Plant Cell and Environment 18, 1027-1033.

175

Sambrook, J. & Russell, D. (2001). Molecular cloning: a laboratory manual. Cold Spring Harbour, New York: Cold Spring Harbor Laboratory Press. Sauer, K., Harms, U. & Thauer, R. K. (1997). Methanol:coenzyme M methyltransferase from Methanosarcina barkeri; purification, properties and encoding genes of the corrinoid protein MT1. European Journal of Bacteriology 243, 670-677. Scarratt, M. G. & Moore, R. M. (1998). Production of methyl bromide and methyl chloride in laboratory cultures of marine phytoplankton II. Marine Chemistry 59, 311-320. Schäfer, H. & Muyzer, G. (2001). Denaturing gradient gel electrophoresis in marine microbial ecology. In Methods in Microbiology, Volume 30, pp. 425-468: Academic Press. Schäfer, H., McDonald, I. R., Nightingale, P. D. & Murrell, J. C. (2005). Evidence for the presence of a CmuA methyltransferase pathway in novel marine methyl halide-oxidising bacteria. Environmental Microbiology 7, 839-852. Schaefer, J. K. & Oremland, R. S. (1999). Oxidation of methyl halides by the facultative methylotroph strain IMB-1. Applied and Environmental Microbiology 65, 5035-5041. Schaefer, J. K., Goodwin, K. D., McDonald, I. R., Murrell, J. C. & Oremland, R. S. (2002). Leisingera methylohalidivorans gen. nov., sp. nov., a marine methylotroph that grows on methyl bromide. International Journal of Systematic and Evolutionary Microbiology 52, 851-859. Schäfer, H., Abbas, B., Witte, H. & Muyzer, G. (2002). Genetic diversity of 'satellite' bacteria present in cultures of marine diatoms. FEMS Microbiology Ecology 42, 25-35. Schluter, L. & Mohlenberg, F. (2003). Detecting presence of phytoplankton groups with non-specific pigment signatures. Journal of Applied Phycology 15, 465-476. Sieburth, J. M., Johnson, P. W., Eberhardt, M. A., Sieracki, M. E., Lidstrom, M. & Laux, D. (1987). The 1st methane-oxidizing bacterium from the upper mixing layer of the deep ocean – Methylomonas pelagica sp. nov. Current Microbiology 14, 285-293. Singh, H. B. & Kanakidou, M. (1993). An investigation of the atmospheric sources and sinks of methyl bromide. Geophysical Research Letters 20, 133-136. Singleton, D. R., Furlong, M. A., Rathbun, S. L. & Whitman, W. B. (2001). Quantitative comparisons of 16S rDNA sequence libraries from environmental samples. Applied and Environmental Microbiology 67, 4373-4376. Somerville, C. C., Knight, I. T., Straube, W. L. & Colwell, R. R. (1989). Simple, rapid method for direct isolation of nucleic acids from aquatic environments. Applied and Environmental Microbiology 55, 548-554.

176

Stefels, J. & Van Boekel, W. H. M. (1993). Production of DMS from dissolved DMSP in axenic cultures of the marine phytoplankton species Phaeocystis sp. Marine Ecology-Progress Series 97, 11-18. Stirling, D. I. & Dalton, H. (1980). Oxidation of dimethyl ether, methyl formate, and bromomethane by Methylococcus capsulatus (Bath). Journal of General Microbiology 116, 277-283. Streger, S. H., Condee, C. W., Togna, A. P. & Deflaun, M. F. (1999). Degradation of hydrohalocarbons and brominated compounds by methane- and propane-oxidizing bacteria. Environmental Science & Technology 33, 4477-4482. Studer, A., McAnulla, C., Buchele, R., Leisinger, T. & Vuilleumier, S. (2002). Chloromethane-induced genes define a third C-1 utilization pathway in Methylobacterium chloromethanicum CM4. Journal of Bacteriology 184, 3476-3484. Studer, A., Vuilleumier, S. & Leisinger, T. (1999). Properties of the methylcobalamin : H(4)folate methyltransferase involved in chloromethane utilization by Methylobacterium sp strain CM4. European Journal of Biochemistry 264, 242-249. Swanson, A. L., Blake, N. J., Dibb, J. E., Albert, M. R., Blake, D. R. & Rowland, F. S. (2002). Photochemically induced production of CH3Br, CH3I, C2H5I, ethene, and propene within surface snow at Summit, Greenland. Atmospheric Environment 36, 2671-2682. Sy, A., Giraud, E., Jourand, P., Garcia, N., Willems, A., de Lajudie, P., Prin, Y., Neyra, M., Gillis, M., Boivin-Masson, C. & Dreyfus, B. (2001). Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes. Journal of Bacteriology 183, 214-220. Tanaka, Y., Yoshida, T., Watanabe, K., Izumi, Y. & Mitsunaga, T. (1997). Cloning and analysis of methanol oxidation genes in the methylotroph Hyphomicrobium methylovorum GM2. FEMS Microbiology Letters 154, 397-401. Thompson, A. S., Owens, N. J. P. & Murrell, J. C. (1995). Isolation and characterisation of methanesulfonic acid degrading bacteria from the marine environment. Applied and Environmental Microbiology 61, 2388-2393. Tokarczyk, R. & Saltzman, E. S. (2001). Methyl bromide loss rates in surface waters of the North Atlantic Ocean, Caribbean Sea, and eastern Pacific Ocean (8 degrees-45 degrees N). Journal of Geophysical Research-Atmospheres 106, 9843-9851. Tokarczyk, R., Goodwin, K. D. & Saltzman, E. S. (2003). Methyl chloride and methyl bromide degradation in the Southern Ocean. Geophysical Research Letters 30, art. no.-1808.

177

Vannelli, T., Messmer, M., Studer, A., Vuilleumier, S. & Leisinger, T. (1999). A corrinoid-dependent catabolic pathway for growth of a Methylobacterium strain with chloromethane. Proceedings of the National Academy of Sciences of the United States of America 96, 4615-4620. Vannelli, T., Studer, A., Kertesz, M. & Leisinger, T. (1998). Chloromethane metabolism by Methylobacterium sp. strain CM4. Applied and Environmental Microbiology 64, 1933-1936. Varner, R. K., Crill, P. M. & Talbot, R. W. (1999). Wetlands: a potentially significant source of atmospheric methyl bromide and methyl chloride. Geophysical Research Letters 26, 2433-2435. Waechter-Brulla, D., DiSpirito, A. A., Chistoserdova, L. & Lidstrom, M. (1993). Methanol oxidation genes in the marine methanotroph Methylomonas sp. strain A4. Journal of Bacteriology 175, 3767-3775. Walker, S. J., Weiss, R. F. & Salameh, P. K. (2000). Reconstructed histories of the annual mean atmospheric mole fractions for the halocarbons CFC-11, CFC-12, CFC113 and carbon tetrachloride. Journal of Geophysical Research-Atmospheres 105, 14285-14296. Wang, P., Wang, F. P., Xu, M. X. & Xiao, X. (2004). Molecular phylogeny of methylotrophs in a deep-sea sediment from a tropical west Pacific Warm Pool. FEMS Microbiology Ecology 47, 77-84. Ward, N., Larsen, O., Sakwa, J., Bruseth, L., Khouri, H., Durkin, A. S., Dimitrov, G., Jiang, L., Scanlan, D., Kang, K. H., Lewis, M., Nelson, K. E., Methe, B., Wu, M., Heidelberg, J. F., Paulsen, I. T., Fouts, D., Ravel, J., Tettelin, H., Ren, Q., Read, T., DeBoy, R. T., Seshadri, R., Salzberg, S. L., Jensen, H. B., Birkeland, N. K., Nelson, W. C., Dodson, R. J., Grindhaug, S. H., Holt, I., Eidhammer, I., Jonasen, I., Vanaken, S., Utterback, T., Feldblyum, T. V., Fraser, C. M., Lillehaug, J. R. & Eisen, J. A. (2004). Genomic insights into methanotrophy: the complete genome sequence of Methylococcus capsulatus (Bath). PLoS Biology 2, e303. Warner, K. L. (2003).The molecular biology and ecology of aerobic methyl halide utilisers. In Biological Sciences, pp. 219. Coventry: University of Warwick. Warner, K. L., Larkin, M. J., Harper, D. B., Murrell, J. C. & McDonald, I. R. (In Press). Analysis of genes involved in methyl halide degradation in Aminobacter lissarensis CC495. FEMS Microbiology Letters. Whittenbury, R., Phillips, K. C. & Wilkinson, J. F. (1970). Enrichment, isolation and some properties of methane utilising bacteria. Journal of General Microbiology 61, 205-218.

178

Widdel, F. G., Kohring, W. & Mayer, F. (1983). Studies on dissimilatory sulphate-reducing bacteria that decompose fatty acids. III. Characterisation of the filamentous gliding Desulfonema limicola gen. nov., sp. nov. and Desulfonema sp. nov. Archives of Microbiology 134, 286-294. Williams, P. J. l. B. (2000). Heterotrophic bacteria and the dynamics of dissolved organic material. In Microbial ecology of the oceans. Edited by D. L. Kirchman. New York: John Wiley and Sons. Wingenter, O. W., Haase, K. B., Strutton, P., Friedrich, G., Meinardi, S., Blake, D. R. & Rowland, F. S. (2004). Changing concentrations of CO, CH4, C5H8, CH3Br, CH3I, and dimethyl sulfide during the Southern Ocean Iron Enrichment Experiments. Proceedings of the National Academy of Sciences of the United States of America 101, 8537-8541. Woodall, C. A., Warner, K. L., Oremland, R. S., Murrell, J. C. & McDonald, I. R. (2001). Identification of methyl halide-utilizing genes in the methyl bromide-utilizing bacterial strain IMB1 suggests a high degree of conservation of methyl halide-specific genes in gram- negative bacteria. Applied and Environmental Microbiology 67, 1959-1963. Wright, S. W., Jeffrey, S. W., Mantoura, R. F. C., Llewellyn, C. A., Bjornland, T., Repeta, D. & Welschmyer, N. (1991). Improved HPLC method for the analysis of chloropylls and carotenoids from marine phytoplankton. Marine Ecology-Progress Series 77, 183-196. Xia, Z. X., Dai, W. W., Zhang, Y. F., White, S. A., Boyd, G. D. & Mathews, F. S. (1996). Determination of the gene sequence and the three-dimensional structure at 2.4 angstrom resolution of methanol dehydrogenase from Methylophilus W3A1. Journal of Molecular Biology 259, 480-501. Yagi, K., Williams, J., Wang, N. Y. & Cicerone, R. J. (1995). Atmospheric methyl bromide (CH3Br) from agricultural soil fumigations. Science 267, 1979-1981. Yates, S. R., Gan, J. & Papiernik, S. K. (2003). Environmental fate of methyl bromide as a soil fumigant. In Reviews of Environmental Contamination and Toxicology, Vol 177, pp. 45-122. New York: SPRINGER-VERLAG. Yates, S. R., Wang, D., Gan, J., Ernst, F. F. & Jury, W. A. (1998). Minimizing methyl bromide emissions from soil fumigation. Geophysical Research Letters 25, 1633-1636. Yaws, C., Yang, C. H. & Pan, X. (1991). Henry's law constants for 362 organic compounds in water. Chemical Engineering Science 98. Yokouchi, Y., Ikeda, M., Inuzuka, Y. & Yukawa, T. (2002). Strong emission of methyl chloride from tropical plants. Nature 416, 163-165. Yung, Y. L., Pinto, J. P., Watson, R. T. & Sander, S. P. (1980). Atmospheric ozone perturbations in the lower stratosphere. Journal of Atmospheric Science 37, 339-353.

179

Zhang, M. & Lidstrom, M. E. (2003). Promoters and transcripts for genes involved in methanol oxidation in Methylobacterium extorquens AM 1. Microbiology-Sgm 149, 1033-1040.

180

Appendices

181

A AMBITION Data

A.1 Data source

Data was obtained from the Biological Oceanography Data Centre, Liverpool, which

collated the data from RRS Charles Darwin cruise CD132 participants. The data is

to be made generally available in CD format. Data is credited to each of the cruise

participants involved below and the cruise report and data CD should be consulted

for details of methods. As there were several casts per station it was necessary to

select one per station for the sake of graphical representation. The most consistent

cast was referred to as the biogeochemistry cast and was carried out at dawn on every

station; data from this cast was used to produce the graphs below unless otherwise

stated. Station and cast numbers are in Table A.1 below.

Station Cast Location, Lat./Long. 1 1 00o54.3’S 64o08.5’E 2 1 00o00.9’S 67o00.0’E 3 9 03o47.8’N 67o00.0’E 4 6 07o36.0’N 67o00.0’E 5 6 11o24.0’N 67o00.0’E 6 7 15o12.0’N 67o00.0’E 7 11 19o00.0’N 67o00.0’E 8 5 20o55.0’N 63o40.0’E 9 5 23o33.7’N 59o54.2’E 10 6 24o20.0’N 58o10.0’E 11 6 26o00.0’N 56o35.1’E Table A.1. Location of casts used for data analyses.

It is worth noting that certain measurements were not taken at either the beginning or

end of the cruise, mainly due to the nature of the equipment or methods involved that

require time to set up and pack away for transport to and from the UK. The depth of

the measurements made also varies from station to station. The maximum is usually

250-300 m although at the later stations this is considerably reduced reflecting the

shallowing water.

182

A.2 Physicochemical Data

184

A.3 Productivity

186

A.4 Microorganism abundance

187

B List of Samples from the AMBITION Cruise

B.1 List of DNA Samples

ID No.

Station no.

Date Location Cast Depth (m)

Filter type Note

1 1 03/09/01 00o54’S 64o08’E 01 5 Supor Surface 2 1 03/09/01 00o54’S 64o08’E 01 74 Supor DCM 3 1 03/09/01 00o54’S 64o08’E 01 1 Supor 4 1 03/09/01 00o54’S 64o08’E 01 10 Supor 5 1 03/09/01 00o54’S 64o08’E 01 25 Supor 6 1 03/09/01 00o54’S 64o08’E 01 50 Supor 7 1 03/09/01 00o54’S 64o08’E 01 60 Supor 8 1 03/09/01 00o54’S 64o08’E 01 100 Supor 9 1 04/09/01 00o54’S 64o08’E 10 75 Supor DCM 10 1 04/09/01 00o54’S 64o08’E 10 1 Supor 11 1 04/09/01 00o54’S 64o08’E 10 10 Supor 12 1 04/09/01 00o54’S 64o08’E 10 25 Supor 13 1 04/09/01 00o54’S 64o08’E 10 65 Supor 14 1 04/09/01 00o54’S 64o08’E 10 85 Supor 15 1 04/09/01 00o54’S 64o08’E 10 140 Supor 16 1 04/09/01 00o54’S 64o08’E 11 5 Supor Surface 17 2 05/09/01 00o01’S 67o00’E 01 5 Supor Surface 18 2 05/09/01 00o01’S 67o00’E 01 62 Supor DCM 19 2 05/09/01 00o01’S 67o00’E 01 1 Supor 20 2 05/09/01 00o01’S 67o00’E 01 10 Supor 21 2 05/09/01 00o01’S 67o00’E 01 25 Supor 22 2 05/09/01 00o01’S 67o00’E 01 50 Supor 23 2 05/09/01 00o01’S 67o00’E 01 80 Supor 24 2 05/09/01 00o01’S 67o00’E 01 100 Supor 25 2 06/09/01 00o01’S 67o00’E 10 1 Sterivex 26 2 06/09/01 00o01’S 67o00’E 10 5 Sterivex Surface 27 2 06/09/01 00o01’S 67o00’E 10 10 Sterivex 28 2 06/09/01 00o01’S 67o00’E 10 25 Sterivex 29 2 06/09/01 00o01’S 67o00’E 10 50 Sterivex DCM 30 2 06/09/01 00o01’S 67o00’E 10 60 Sterivex 31 2 06/09/01 00o01’S 67o00’E 10 100 Sterivex 32 2 06/09/01 00o01’S 67o00’E 10 150 Sterivex 33 3 07/09/01 03o48’N 67o00 E 01 1 Sterivex Diel 1 34 3 07/09/01 03o48’N 67o00 E 01 70 Sterivex Diel 1 35 3 07/09/01 03o48’N 67o00 E 02 1 Sterivex Diel 2 36 3 07/09/01 03o48’N 67o00 E 02 70 Sterivex Diel 2 37 3 08/09/01 03o48’N 67o00 E 04 1 Sterivex Diel 3 38 3 08/09/01 03o48’N 67o00 E 04 71 Sterivex Diel 3 39 3 08/09/01 03o48’N 67o00 E 05 1 Sterivex Diel 4 40 3 08/09/01 03o48’N 67o00 E 05 70 Sterivex Diel 4 41 3 09/09/01 03o48’N 67o00 E 09 5 Supor Surface

188

ID No.

Station No.

Date Location Cast Depth Filter type Note

42 3 09/09/01 03o48’N 67o00 E 09 63 Supor DCM 43 3 09/09/01 03o48’N 67o00 E 09 1 Supor 44 3 09/09/01 03o48’N 67o00 E 09 10 Supor 45 3 09/09/01 03o48’N 67o00 E 09 25 Supor 46 3 09/09/01 03o48’N 67o00 E 09 50 Supor 47 3 09/09/01 03o48’N 67o00 E 09 80 Supor 48 3 09/09/01 03o48’N 67o00 E 09 100 Supor 49 4 10/09/01 07o35’N 67o00 E 02 5/1 Sterivex Surface 50 4 10/09/01 07o35’N 67o00 E 02 66 Sterivex DCM 51 4 10/09/01 07o35’N 67o00 E 02 90 Sterivex 52 4 11/09/01 07o35’N 67o00 E 06 5 Supor Surface 53 4 11/09/01 07o35’N 67o00 E 06 77 Supor DCM 54 4 11/09/01 07o35’N 67o00 E 06 1 Supor 55 4 11/09/01 07o35’N 67o00 E 06 10 Supor 56 4 11/09/01 07o35’N 67o00 E 06 25 Supor 57 4 11/09/01 07o35’N 67o00 E 06 50 Supor 58 4 11/09/01 07o35’N 67o00 E 06 65 Supor 59 4 11/09/01 07o35’N 67o00 E 06 90 Supor 60 5 12/09/01 11o06’N 66o59 E 02 5 Supor 61 5 12/09/01 11o06’N 66o59 E 02 5 Supor 0.45 62 5 12/09/01 11o06’N 66o59 E 02 60 Supor 63 5 12/09/01 11o06’N 66o59 E 02 60 Supor 0.45 64 5 12/09/01 11o06’N 66o59 E 02 100 Supor 65 5 12/09/01 11o06’N 66o59 E 02 100 Supor 0.45 66 5 13/09/01 11o06’N 66o59 E 06 5 Supor Surface 67 5 13/09/01 11o06’N 66o59 E 06 36 Supor DCM 68 5 13/09/01 11o06’N 66o59 E 06 1 Supor 69 5 13/09/01 11o06’N 66o59 E 06 10 Supor 70 5 13/09/01 11o06’N 66o59 E 06 25 Supor 71 5 13/09/01 11o06’N 66o59 E 06 50 Supor 72 5 13/09/01 11o06’N 66o59 E 06 80 Supor 73 5 13/09/01 11o06’N 66o59 E 06 100 Supor 74 6 14/09/01 15o12’N 67o00 E 02 5 Sterivex Surface 75 6 14/09/01 15o12’N 67o00 E 02 35 Sterivex DCM 76 6 14/09/01 15o12’N 67o00 E 02 60 Sterivex 77 6 14/09/01 15o12’N 67o00 E 02 120 Sterivex 78 6 14/09/01 15o12’N 67o00 E 02 202 Sterivex 79 6 14/09/01 15o12’N 67o00 E 02 701 Sterivex 80 6 14/09/01 15o12’N 67o00 E 02 1600 Sterivex 81 6 14/09/01 15o12’N 67o00 E 02 2501 Sterivex 82 6 15/09/01 15o12’N 67o00 E 07 5 Supor Surface 83 6 15/09/01 15o12’N 67o00 E 07 40 Supor DCM 84 6 15/09/01 15o12’N 67o00 E 07 10 Supor 85 6 15/09/01 15o12’N 67o00 E 07 20 Supor 86 6 15/09/01 15o12’N 67o00 E 07 50 Supor 87 6 15/09/01 15o12’N 67o00 E 07 75 Supor

189

ID No.

Station No.


88 7 16/09/01 19o00’N 67o00 E 03 5 Sterivex Diel 1 89 7 16/09/01 19o00’N 67o00 E 03 47 Sterivex Diel 1 90 7 16/09/01 19o00’N 67o00 E 04 5 Sterivex Diel 2 91 7 16/09/01 19o00’N 67o00 E 04 50 Sterivex Diel 2 92 7 17/09/01 19o00’N 67o00 E 05 5 Sterivex Diel 3 93 7 17/09/01 19o00’N 67o00 E 05 50 Sterivex Diel 3 94 7 17/09/01 19o00’N 67o00 E 06 5 Sterivex Diel 4 95 7 17/09/01 19o00’N 67o00 E 06 52 Sterivex Diel 4 96 7 17/09/01 19o00’N 67o00 E 07 5 Sterivex Diel 5 97 7 17/09/01 19o00’N 67o00 E 07 50 Sterivex Diel 5 98 7 18/09/01 19o00’N 67o00 E 11 5 Supor Surface 99 7 18/09/01 19o00’N 67o00 E 11 49 Supor DCM 100 7 18/09/01 19o00’N 67o00 E 11 10 Supor 101 7 18/09/01 19o00’N 67o00 E 11 20 Supor 102 7 18/09/01 19o00’N 67o00 E 11 40 Supor 103 7 18/09/01 19o00’N 67o00 E 11 60 Supor 104 7 18/09/01 19o00’N 67o00 E 11 80 Supor 105 7 18/09/01 19o00’N 67o00 E 11 100 Supor 106 8 19/09/01 20o55’N 63o40 E 02 5 Sterivex Surface 107 8 19/09/01 20o55’N 63o40 E 02 10 Sterivex 108 8 19/09/01 20o55’N 63o40 E 02 18 Sterivex 109 8 19/09/01 20o55’N 63o40 E 02 21 Sterivex DCM 110 8 19/09/01 20o55’N 63o40 E 02 40 Sterivex 111 8 19/09/01 20o55’N 63o40 E 02 60 Sterivex 112 8 19/09/01 20o55’N 63o40 E 02 150 Sterivex 113 8 19/09/01 20o55’N 63o40 E 02 250 Sterivex 114 8 20/09/01 20o55’N 63o40 E 05 5 Supor Surface 115 8 20/09/01 20o55’N 63o40 E 05 29 Supor DCM 116 8 20/09/01 20o55’N 63o40 E 05 250 Supor 117 8 20/09/01 20o55’N 63o40 E 05 10 Supor 118 8 20/09/01 20o55’N 63o40 E 05 20 Supor 119 8 20/09/01 20o55’N 63o40 E 05 50 Supor 120 8 20/09/01 20o55’N 63o40 E 05 70 Supor 121 8 20/09/01 20o55’N 63o40 E 05 100 Supor 122 9 22/09/01 23o33’N 59o54 E 02 5 Supor CM 123 9 22/09/01 23o33’N 59o54 E 02 10 Supor 124 9 22/09/01 23o33’N 59o54 E 02 20 Supor 125 9 22/09/01 23o33’N 59o54 E 02 40 Supor 126 9 22/09/01 23o33’N 59o54 E 02 100 Supor 127 9 22/09/01 23o33’N 59o54 E 02 210 Supor 128 9 22/09/01 23o33’N 59o54 E 02 230 Supor 129 9 22/09/01 23o33’N 59o54 E 02 250 Supor CM 130 9 23/09/01 23o33’N 59o54 E 05 2.5 Supor CM 131 9 23/09/01 23o33’N 59o54 E 05 7.5 Supor 132 9 23/09/01 23o33’N 59o54 E 05 10 Supor 133 9 23/09/01 23o33’N 59o54 E 05 20 Supor

190

ID No.

Station No.


134 9 23/09/01 23o33’N 59o54 E 05 40 Supor 135 9 23/09/01 23o33’N 59o54 E 05 70 Supor 136 9 23/09/01 23o33’N 59o54 E 05 90 Supor 137 9 23/09/01 23o33’N 59o54 E 05 110 Supor 138 10 24/09/01 24o20’N 58o10 E 02 5 Supor 139 10 24/09/01 24o20’N 58o10 E 02 20 Supor 140 10 24/09/01 24o20’N 58o10 E 02 29 Supor DCM 141 10 24/09/01 24o20’N 58o10 E 02 55 Supor 142 10 24/09/01 24o20’N 58o10 E 02 60 Supor 143 10 24/09/01 24o20’N 58o10 E 02 70 Supor 144 10 24/09/01 24o20’N 58o10 E 02 100 Supor 145 10 24/09/01 24o20’N 58o10 E 02 120 Supor 146 10 25/09/01 24o20’N 58o10 E 06 5 Supor Surface 147 10 25/09/01 24o20’N 58o10 E 06 27 Supor DCM 148 10 25/09/01 24o20’N 58o10 E 06 15 Supor 149 10 25/09/01 24o20’N 58o10 E 06 20 Supor 150 10 25/09/01 24o20’N 58o10 E 06 36 Supor 151 10 25/09/01 24o20’N 58o10 E 06 55 Supor 152 10 25/09/01 24o20’N 58o10 E 06 65 Supor 153 10 25/09/01 24o20’N 58o10 E 06 90 Supor 154 11 26/09/01 26o00’N 56o35 E 02 5 Supor Surface 155 11 26/09/01 26o00’N 56o35 E 02 15 Supor 156 11 26/09/01 26o00’N 56o35 E 02 31 Supor CM 157 11 26/09/01 26o00’N 56o35 E 02 40 Supor 158 11 26/09/01 26o00’N 56o35 E 02 60 Supor 159 11 26/09/01 26o00’N 56o35 E 02 75 Supor 160 11 26/09/01 26o00’N 56o35 E 02 80 Supor 161 11 26/09/01 26o00’N 56o35 E 02 92 Supor Sal. max. 162 11 27/09/01 26o00’N 56o35 E 06 5 Supor Surface 163 11 27/09/01 26o00’N 56o35 E 06 26 Supor DCM 164 11 27/09/01 26o00’N 56o35 E 06 90 Supor Sal. max. 165 11 27/09/01 26o00’N 56o35 E 06 15 Supor 166 11 27/09/01 26o00’N 56o35 E 06 19 Supor 167 11 27/09/01 26o00’N 56o35 E 06 40 Supor 168 11 27/09/01 26o00’N 56o35 E 06 60 Supor 169 11 27/09/01 26o00’N 56o35 E 06 80 Supor Table B.1. List of AMBTION DNA samples. Notes are as follows: Surface, The sample was treated as the surface water sample, usually ~5 m; DCM, Deep Chlorophyll Maximum; CM, Chlorophyll Maximum; Sal. max., Salinity maximum, noted only in areas of high salinity; Diel, the sample was part of a diel sampling cycle; 0.45, Indicates the use of 0.45 µm filters to sample a different size fraction.

191

B.2 List of Enrichments Set-up On the AMBITION Cruise

ID No. Substrate Key Station Date Cast Depth (m) 1 1 1 03/09/01 1 5 2 2 1 03/09/01 1 5 3 3 1 03/09/01 1 5 4 4 1 03/09/01 1 5 5 5 1 03/09/01 1 5 6 6 1 03/09/01 1 5 7 7 1 03/09/01 1 5 8 8 1 03/09/01 1 5 9 9 1 03/09/01 1 5 10 10 1 03/09/01 1 5 11 11 1 03/09/01 1 5 12 12 1 03/09/01 1 5 13 1 1 03/09/01 1 74 14 2 1 03/09/01 1 74 15 3 1 03/09/01 1 74 16 4 1 03/09/01 1 74 17 5 1 03/09/01 1 74 18 6 1 03/09/01 1 74 19 7 1 03/09/01 1 74 20 8 1 03/09/01 1 74 21 9 1 03/09/01 1 74 22 10 1 03/09/01 1 74 23 11 1 03/09/01 1 74 24 12 1 03/09/01 1 74 25 1 2 05/09/01 1 5 26 2 2 05/09/01 1 5 27 3 2 05/09/01 1 5 28 4 2 05/09/01 1 5 29 5 2 05/09/01 1 5 30 6 2 05/09/01 1 5 31 7 2 05/09/01 1 5 32 8 2 05/09/01 1 5 33 9 2 05/09/01 1 5 34 10 2 05/09/01 1 5 35 11 2 05/09/01 1 5 36 12 2 05/09/01 1 5 37 1 2 05/09/01 1 62 38 2 2 05/09/01 1 62 39 3 2 05/09/01 1 62 40 4 2 05/09/01 1 62 41 5 2 05/09/01 1 62 42 6 2 05/09/01 1 62 43 7 2 05/09/01 1 62 44 8 2 05/09/01 1 62

192

ID No. Substrate Key Station Date Cast Depth (m) 45 9 2 05/09/01 1 62 46 10 2 05/09/01 1 62 47 11 2 05/09/01 1 62 48 12 2 05/09/01 1 62 49 1 3 09/09/01 9 5 50 2 3 09/09/01 9 5 51 3 3 09/09/01 9 5 52 4 3 09/09/01 9 5 53 5 3 09/09/01 9 5 54 6 3 09/09/01 9 5 55 7 3 09/09/01 9 5 56 8 3 09/09/01 9 5 57 9 3 09/09/01 9 5 58 10 3 09/09/01 9 5 59 11 3 09/09/01 9 5 60 12 3 09/09/01 9 5 61 1 3 09/09/01 9 63 62 2 3 09/09/01 9 63 63 3 3 09/09/01 9 63 64 4 3 09/09/01 9 63 65 5 3 09/09/01 9 63 66 6 3 09/09/01 9 63 67 7 3 09/09/01 9 63 68 8 3 09/09/01 9 63 69 9 3 09/09/01 9 63 70 10 3 09/09/01 9 63 71 11 3 09/09/01 9 63 72 12 3 09/09/01 9 63 73 1 4 11/09/01 6 5 74 2 4 11/09/01 6 5 75 3 4 11/09/01 6 5 76 4 4 11/09/01 6 5 77 5 4 11/09/01 6 5 78 6 4 11/09/01 6 5 79 7 4 11/09/01 6 5 80 8 4 11/09/01 6 5 81 9 4 11/09/01 6 5 82 10 4 11/09/01 6 5 83 11 4 11/09/01 6 5 84 12 4 11/09/01 6 5 85 1 4 11/09/01 6 77 86 2 4 11/09/01 6 77 87 3 4 11/09/01 6 77 88 4 4 11/09/01 6 77 89 5 4 11/09/01 6 77 90 6 4 11/09/01 6 77 91 7 4 11/09/01 6 77

193


194


195

ID No. Substrate Key Station Date Cast Depth (m) 186 6 8 20/09/01 5 5 187 7 8 20/09/01 5 5 188 8 8 20/09/01 5 5 189 9 8 20/09/01 5 5 190 10 8 20/09/01 5 5 191 11 8 20/09/01 5 5 192 12 8 20/09/01 5 5 193 1 8 20/09/01 5 29 194 2 8 20/09/01 5 29 195 3 8 20/09/01 5 29 196 4 8 20/09/01 5 29 197 5 8 20/09/01 5 29 198 6 8 20/09/01 5 29 199 7 8 20/09/01 5 29 200 8 8 20/09/01 5 29 201 9 8 20/09/01 5 29 202 10 8 20/09/01 5 29 203 11 8 20/09/01 5 29 204 12 8 20/09/01 5 29 205 1 8 20/09/01 5 250 206 2 8 20/09/01 5 250 207 3 8 20/09/01 5 250 208 4 8 20/09/01 5 250 209 5 8 20/09/01 5 250 210 6 8 20/09/01 5 250 211 7 8 20/09/01 5 250 212 8 8 20/09/01 5 250 213 9 8 20/09/01 5 250 214 10 8 20/09/01 5 250 215 11 8 20/09/01 5 250 216 12 8 20/09/01 5 250 217 1 9 23/09/01 5 2.5 218 2 9 23/09/01 5 2.5 219 3 9 23/09/01 5 2.5 220 4 9 23/09/01 5 2.5 221 5 9 23/09/01 5 2.5 222 6 9 23/09/01 5 2.5 223 7 9 23/09/01 5 2.5 224 8 9 23/09/01 5 2.5 225 9 9 23/09/01 5 2.5 226 10 9 23/09/01 5 2.5 227 11 9 23/09/01 5 2.5 228 12 9 23/09/01 5 2.5 229 1 9 23/09/01 5 7.5 230 2 9 23/09/01 5 7.5 231 3 9 23/09/01 5 7.5 232 4 9 23/09/01 5 7.5

196

ID No. Substrate Key Station Date Cast Depth (m) 233 5 9 23/09/01 5 7.5 234 6 9 23/09/01 5 7.5 235 7 9 23/09/01 5 7.5 236 8 9 23/09/01 5 7.5 237 9 9 23/09/01 5 7.5 238 10 9 23/09/01 5 7.5 239 11 9 23/09/01 5 7.5 240 12 9 23/09/01 5 7.5 241 1 10 25/09/01 6 5 242 2 10 25/09/01 6 5 243 3 10 25/09/01 6 5 244 4 10 25/09/01 6 5 245 5 10 25/09/01 6 5 246 6 10 25/09/01 6 5 247 7 10 25/09/01 6 5 248 8 10 25/09/01 6 5 249 9 10 25/09/01 6 5 250 10 10 25/09/01 6 5 251 11 10 25/09/01 6 5 252 12 10 25/09/01 6 5 253 1 10 25/09/01 6 27 254 2 10 25/09/01 6 27 255 3 10 25/09/01 6 27 256 4 10 25/09/01 6 27 257 5 10 25/09/01 6 27 258 6 10 25/09/01 6 27 259 7 10 25/09/01 6 27 260 8 10 25/09/01 6 27 261 9 10 25/09/01 6 27 262 10 10 25/09/01 6 27 263 11 10 25/09/01 6 27 264 12 10 25/09/01 6 27 265 1 11 27/09/01 6 5 266 2 11 27/09/01 6 5 267 3 11 27/09/01 6 5 268 4 11 27/09/01 6 5 269 5 11 27/09/01 6 5 270 6 11 27/09/01 6 5 271 7 11 27/09/01 6 5 272 8 11 27/09/01 6 5 273 9 11 27/09/01 6 5 274 10 11 27/09/01 6 5 275 11 11 27/09/01 6 5 276 12 11 27/09/01 6 5 277 1 11 27/09/01 6 26 278 2 11 27/09/01 6 26 279 3 11 27/09/01 6 26

197

ID No. Substrate Key Station Date Cast Depth (m) 280 4 11 27/09/01 6 26 281 5 11 27/09/01 6 26 282 6 11 27/09/01 6 26 283 7 11 27/09/01 6 26 284 8 11 27/09/01 6 26 285 9 11 27/09/01 6 26 286 10 11 27/09/01 6 26 287 11 11 27/09/01 6 26 288 12 11 27/09/01 6 26 289 1 11 27/09/01 6 90 290 2 11 27/09/01 6 90 291 3 11 27/09/01 6 90 292 4 11 27/09/01 6 90 293 5 11 27/09/01 6 90 294 6 11 27/09/01 6 90 295 7 11 27/09/01 6 90 296 8 11 27/09/01 6 90 297 9 11 27/09/01 6 90 298 10 11 27/09/01 6 90 299 11 11 27/09/01 6 90 300 12 11 27/09/01 6 90 Table B.2. List of AMBTION enrichments. Conditions refer to those in Table 2.3 of the Materials and methods.

198

C Henry’s Law

Throughout this thesis calculations of the concentrations of gases added to gas-tight

vials were made using Henry’s Law based on the dimensionless Henry’s Law

constants of MeBr, MeCl and methane. Henry’s law constants very with temperature

and are determined empirically and therefore can only be an approximation of the

actual concentration. They also assume that the gas in the headspace of a vial and

the gas in the aqueous phase are at equilibrium, which is not necessarily the case

with consumption or production of the gases, and that the liquid phase is pure water

rather than media as in this case.

Henry’s law constants for CH3Br and CH3Cl were calculated for the particular

temperature required using the Henry’s Law calculator available at the following

URL: http://www.epa.gov/athens/learn2model/part-two/onsite/esthenry.htm. The

constant for methane was obtained from Kim et al., 1999, quoting Yaws et al., 1991.

It was only available for 25 oC and this should be borne in mind when incubation

temperatures differ from this value.

An Excel spreadsheet was set up which had inputs (in yellow in Figure C.1) of the

dimensionless Henry’s Law constant at the relevant temperature, the volume of

headspace (mL), the volume of media (mL), the headspace concentration (% vol/vol)

and the temperature (oC). In the example below the media concentration of a 1L vial

containing 300 mL media at 20 oC is calculated for 0.2 % (vol/vol) MeBr. The

section to the right of the table not in bold contains the sub-calculations required

prior to the final one. The gas constant is temperature dependant and therefore

recalculated for each Henry’s Law calculation based on the equation P V = n R T,

199

where P is atmospheric pressure in N m-2 (101325 N m-2), V is the volume, n is the

number of moles (in this case 1), R is the universal gas constant, 8.314 when using N

m-2 as units of pressure, and T is temperature in oK.

Fig. C.1. Excel spreadsheet for Henry’s Law calculations

Henry's Law Constant (at relevant temp)

0.221 Headspace times Henry 154.7

Initial Headspace % 0.2 Above times media volume

454.7

Headspace volume 700 Headspace % times headspace volume

140

Volume of medium 300 Temp. in Kelvin 293.15 Temp in degrees C 20 Gas constant 24.05377844 % Total gas in medium 0.307895316 Concentration of gas in media in µM

128.00289

200

D TRF assignment of cmuA sequences

Sequence Clade HaeII F TRF

BsiYI F TRF

BsiYI R TRF

HpaII R TRF

Total

AY934476 A1 167 Uncut Uncut 156 323 AY934475 A1 167 Uncut Uncut 156 323 AY934471 A1 167 Uncut Uncut 156 323 AY934470 A1 167 Uncut Uncut 156 323 AY934459 A1 167 Uncut Uncut 156 323 AY934469 A1 167 Uncut Uncut 156 323 AY934462 A1 167 Uncut Uncut 156 323 H. chloromethanicum CM2

A1 167 Uncut Uncut 156 323

AY439205 A1 167 Uncut Uncut 156 323 Hyphomicrobium sp. 30 A1 167 Uncut Uncut 156 323 Hyphomicrobium sp. S4 ND 167 Uncut Uncut 156 323 AY934477 A1 167 Uncut Uncut 156 323 AY934454 A1 167 Uncut Uncut 156 323 AY934462 A1 167 Uncut Uncut 156 323 AY934472 A1 167 Uncut Uncut 156 323 AY934434 A4 145 Uncut Uncut 225 370 AY934448 A4 308 Uncut Uncut 156 464 Hyphomicrobium sp. LAT3

A4 53 Uncut Uncut 481 534

M. chloromethanicum CM4

Root 479 Uncut Uncut 110 589

AY439210 B3 34 126 325 135 620 AY439209 B3 34 126 325 135 620 AY439207 B3 34 126 325 135 620 AY934427 B3 34 126 325 135 620 AY439203 B3 34 126 325 135 620 AY934447 B3 34 126 325 135 620 AY934437 B3 34 126 325 135 620 AY934445 B3 34 126 325 135 620 AY934443 B3 34 126 325 135 620 A. lissarensis CC495 B3 34 126 325 135 620 AY934438 A4 145 Uncut Uncut 483 628 AY934430 A4 145 Uncut Uncut 483 628 AY439211 B3 43 126 325 135 629 DQ090684 B2 34 384 114 115 647 AY934474 B3 34 126 166 459 785 AY934473 A1 167 Uncut Uncut 625 792 DQ090704 A3 145 276 347 90 858 DQ090705 B1 53 329 171 330 883 AJ810831 B4 121 467 172 135 895 AJ810833 B4 121 467 172 135 895 AJ810832 B4 121 467 172 135 895 AY439208 B2 53 384 335 135 907

201

AY439206 B2 53 384 335 135 907 AY439201 B2 53 384 335 135 907 DQ090675 A3 145 276 347 144 912 DQ090668 A3 145 276 347 144 912 DQ090677 A3 145 276 347 144 912 DQ090669 A3 145 276 347 144 912 DQ090683 A3 145 276 347 144 912 DQ090667 A3 145 276 347 144 912 DQ090672 A3 145 276 347 144 912 DQ090680 A3 145 276 347 144 912 DQ090699 A3 145 276 347 144 912 DQ090665 A3 145 276 347 144 912 DQ090666 A3 145 276 347 144 912 DQ090676 A3 145 276 347 144 912 DQ090671 A3 145 276 347 144 912 DQ090670 A3 145 276 347 144 912 DQ090674 A3 145 276 347 144 912 DQ090673 A3 145 276 347 144 912 DQ090697 A3 145 276 347 144 912 DQ090679 A3 145 276 347 144 912 DQ090698 A3 145 276 347 144 912 Rhodobacteracaea 179 B1 43 402 347 135 927 AY934461 B1 43 402 347 135 927 AY934456 B1 43 402 347 135 927 AY439204 B1 34 50 764 135 983 AY934467 A2 121 461 347 135 1064 AY934466 A2 121 461 347 135 1064 AY934464 A2 121 461 347 135 1064 AY934463 A2 121 461 347 135 1064 AJ810828 A1 121 461 347 135 1064 AJ810829 A1 121 461 347 135 1064 AJ810830 A1 121 461 347 135 1064 AY934460 A2 121 461 347 135 1064 DQ090681 A3 308 276 347 144 1075 AY934457 A2 121 461 347 156 1085 AY934458 A2 121 461 347 156 1085 DQ090689 B1 53 329 391 330 1103 DQ090686 B1 53 329 391 330 1103 DQ090702 B1 53 329 391 330 1103 DQ090690 B1 53 329 391 330 1103 DQ090687 B1 53 329 391 330 1103 DQ090685 B1 53 329 391 330 1103 DQ090703 B1 53 329 391 330 1103 DQ090701 B1 53 329 391 330 1103 DQ090700 B1 53 329 391 330 1103 AY934440 A4 145 483 166 483 1277 AY934446 A4 145 329 347 459 1280 DQ090694 B2 34 384 406 483 1307

202

DQ090678 B2 34 384 406 483 1307 DQ090693 B2 34 384 406 483 1307 DQ090691 B2 34 384 406 483 1307 DQ090696 B2 34 384 406 483 1307 DQ090692 B2 34 384 406 483 1307 DQ090695 B2 34 384 406 483 1307 A. ciceronei IMB-1 B2 34 384 406 483 1307 DQ090688 B2 34 384 406 483 1307 AY934436 A4 145 346 347 483 1321 AY934441 A4 145 464 282 483 1374 AY439212 B1 271 397 417 330 1415 AY439202 B1 271 397 417 330 1415 AY439200 B1 271 397 417 330 1415 AY934442 A4 145 384 406 483 1418 Hyphomicrobium sp. SAC1

ND 167 384 427 459 1437

AY934453 A4 145 464 347 483 1439 AY934429 A4 145 464 347 483 1439 AY934478 A4 145 464 347 483 1439 AY934454 A4 145 464 347 483 1439 AY934435 A4 145 464 347 483 1439 AY934435 A4 145 464 347 483 1439 AY934433 A4 145 464 347 483 1439 AY934481 A4 145 464 347 483 1439 AY934426 A4 145 464 347 483 1439 AY934428 A4 145 464 347 483 1439 AY934442 A4 145 464 347 483 1439 AY934480 A4 145 464 347 483 1439 AY934479 A4 145 464 347 483 1439 AY934444 A4 145 464 347 483 1439 AY934432 A4 145 464 347 483 1439 AY934439 A4 145 464 347 483 1439 AY934450 A4 145 464 347 483 1439 AY934448 A4 145 464 347 483 1439 Table D.1. Clade affiliation of cmuA TRFs based on in silico analysis of database cmuA sequences.

Marine Methyl Halide Utilising Bacteria

Documents

Transcript of Marine Methyl Halide Utilising Bacteria