1617

Journal of Cell Science 108, 1617-1627 (1995)Printed in Great Britain © The Company of Biologists Limited 1995

Mapping the distribution of Golgi enzymes involved in the construction of

complex oligosaccharides

Catherine Rabouille, Norman Hui, Felicia Hunte, Regina Kieckbusch, Eric G. Berger*, Graham Warren andTommy Nilsson†

Cell Biology Laboratory, Imperial Cancer Research Fund, 44 Lincoln’s Inn Fields, London, WC2A 3PX, UK

*Present address: Physiologisches Institut, Universität Zürich, Switzerland†Author for correspondence

The distribution of β1,2 N-acetylglucosaminyltransferase I(NAGT I), α1,3-1,6 mannosidase II (Mann II), β1,4 galac-tosyltransferase (GalT), α2,6 sialyltransferase (SialylT)was determined by immuno-labelling of cryo-sections fromHeLa cell lines. Antibody labelling in the HeLa cell line wasmade possible by stable expression of epitope-tagged formsof these proteins or forms from species to which specificantibodies were available. NAGT I and Mann II had thesame distribution occupying the medial and trans cisternaeof the stack. GalT and SialylT also had the same distribu-

tion but they occupied the trans cisterna and the trans-Golgi network (TGN). These results generalise our earlierobservations on the overlapping distribution of Golgienzymes and show that each of the trans compartments ofthe Golgi apparatus in HeLa cells contains unique mixturesof those Golgi enzymes involved in the construction ofcomplex, N-linked oligosaccharides.

Key words: Golgi apparatus, trans-Golgi network,glycosyltransferase, mannosidase, TGN38

SUMMARY

INTRODUCTION

The construction of complex, bi-antennary, N-linked oligosac-charides involves the sequential action of enzymes located indifferent parts of the Golgi apparatus (for reviews, see Kornfeldand Kornfeld, 1985; Roth, 1991). α1,2 mannosidase I continuesthe trimming of mannose residues that started in the endoplas-mic reticulum (ER) leaving a penta-mannose core to which thefirst N-acetylglucosamine is added by β1,2 N-acetylglu-cosaminyltransferase I (NAGT I). α1,3-1,6 mannosidase II(Mann II) removes two more mannose residues permittingaddition of the final N-acetylglucosamine by β1,2 N-acetylglu-cosaminyltransferase II. Each branch can then be elongated bythe addition of galactose by β1,4 galactosyltransferase (GalT)and sialic acid by α2,6 sialyltransferase (SialylT). Fucose mayalso be added prior to or following the addition of sialic acid.

GalT was the first of these enzymes to be localised, first tothe trans cisterna (Roth and Berger, 1982) and later to thetrans-Golgi network (TGN) (Lucocq et al., 1989; Nilsson etal., 1993). SialylT was found to localise to the trans Golgicisterna and the TGN (Roth et al., 1985) and to have the samedistribution in most though not all cells (Roth et al., 1986).NAGT I was found in medial cisternae (Dunphy et al., 1985)as, more recently, was Mann II (Velasco et al., 1993). Thelocation of these enzymes strongly supported the idea thatproteins undergoing transport moved through the stack in acis to trans direction, sampling each of the compartments inturn.

The fact that most of these enzymes were usually found in

two adjacent cisternae was taken as evidence of cisternal dupli-cation. This interpretation was supported by the observationthat the number of cisternae in the Golgi stack can vary widelyfrom tissue to tissue and from organism to organism (seeFawcett, 1981). To investigate the possibility of cisternalduplication, we examined, using immunogold electronmicroscopy, the distribution of NAGT I and GalT in HeLacells. Each enzyme was found in two, adjacent cisternae but,contrary to expectation, both were present in the trans cisterna(Nilsson et al., 1993). In other words, the two enzymes had anoverlapping distribution such that each cisterna contained aunique mixture of enzymes not a unique set. In order to gen-eralise these observations and obtain further evidence againstcisternal duplication and in favour of each cisterna having aunique composition, we have extended our observations toother Golgi enzymes. To do this we have generated a series ofstable HeLa cell lines expressing either epitope-taggedenzymes or ones to which antibodies were available.

MATERIALS AND METHODS

Stable cell linesHeLa cell lines expressing either human NAGT I (Kumar et al., 1990)tagged with a myc-epitope or murine Mann II (Moremen and Robbins,1991) have been described elsewhere (Nilsson et al., 1993, 1994).

Human SialylT (Grundmann et al., 1990) was tagged with a VSV-G epitope (underlined) (Kreis, 1986; Soldati and Perriard, 1991) usingPCR (Saiki et al., 1988) to introduce the epitope immediately prior tothe stop codon. Primers used were:

1618 C. Rabouille and others

N C

N C

N C

N C

NC

GalT

NAGT I

MannII

SialylT

TGN38

6

5

24

9

34 19

17

20

21

23 418

1124

354

380

287

Fig. 1. Topology of the hybrid proteins stably expressed in HeLacells. Parental HeLa cells were selected for stable expression ofNAGT I, Mann II, SialylT or TGN 38 (together with SialylT). Thetopology of the endogenous GalT is presented for comparison. Thenumbers (from left to right) refer to the length (not to scale) of thecytoplasmic tail, the membrane-spanning domain, the lumenaldomain and the epitope tag (where present). Note that all the Golgienzymes are type II proteins whereas TGN38 is type I.

Table 1. Stable HeLa cell lines used in this studyAntibody used to detect the Expression level relative

Cell line Origin of expressed protein Epitope tag stably-expressed protein(s) to endogenous protein*

NAGT I-HeLa Human myc 9E.10 monoclonal 4-foldMann II-HeLa Mouse None Polyclonal anti-murine Mann II 6-foldSialylT-HeLa Human VSV-G P5D4 monoclonal 50 to 100-foldTGN38/SialylT-HeLa SialylT Human VSV-G P5D4 monoclonal 10-fold

TGN38 Rat None Polyclonal anti-rat TGN38 2.5-fold

*Measured by the increase in enzyme activity (NAGT I and SialylT) or by comparing the linear density of gold labelling over the Golgi with that in NRK cells(Mann II and TGN38).

Parental HeLa cells were transfected with pSRα containing the appropriate cDNA and stable lines selected as described in Materials and Methods.

5′GTCGACGGATCCACCATGATTCACACCAACCTGAAG3′;and

5′GTCGACGGATCCTTACTTTCCCAGCCTGTTCATCTCTA-TATCGGTGTAAGGGCAGTGAATGGTCCGGAAGCC3′.

The PCR product was sequenced and subcloned into the BamHIsite of pSRα (DNAX, Palo Alto, CA).

A full length cDNA encoding rat TGN38 (Luzio et al., 1990) wasdigested with HindIII and complementary oligonucleotides encodinga BamHI site were introduced immediately following the stop codon.The complementary oligonucleotides were:

5′AGCTTTGAG3′ and 5′GATCCTCAA3′.The coding region of TGN38 was then excised and subcloned into

the BamHI site of pCMUIV (Nilsson et al., 1989). HeLa cells were transfected with tagged SialylT in pSRα either

alone or together with TGN38 in pCMUIV. Transfection and isolationof stable lines was carried out essentially as described previously(Nilsson et al., 1994). Table 1 summarises relevant properties of theHeLa cell lines used.

Membrane fractionation and western blottingSialylT-HeLa and TGN38/SialylT-HeLa cells were grown inDulbecco’s modified Eagle’s medium (DMEM) (Gibco) supple-mented with 10% foetal calf serum, penicillin (100 µg/ml), strepto-mycin (100 µg/ml) and geneticin (500 µg/ml) (Gibco). Approximately109 cells were used to isolate Golgi membranes (Balch et al., 1984)which were purified at least 10-fold over homogenate assayed byGalT activity (Bretz and Stäubli, 1977). Protein concentration wasdetermined using the BCA protein assay kit (Pierce Chemical Co,Rockford, IL). SDS-PAGE was carried out essentially as describedby Blobel and Dobberstein (1975) and western blotting as describedpreviously (Nilsson et al., 1993). SialylT was assayed as described byDunphy et al. (1981) using asialo-transferrin as the substrate.

Immunogold electron microscopy Cells were fixed either in 2% paraformaldehyde and 0.2% glu-taraldehyde in 0.1 M phosphate buffer, pH 7.4, or in 0.5% glu-taraldehyde in the same buffer containing 0.2 M sucrose andprocessed as described previously (Rabouille et al., 1993). Briefly,cells were embedded in 10% gelatine and small blocks were infusedwith 2.3 M sucrose and frozen in liquid nitrogen. Ultra-thin cryosec-tions were cut on an Ultracut E microtome with FC4E cryo-attach-ment and transferred onto collodion-carbon coated, copper or nickel,100-mesh grids. All antibodies and gold conjugates were diluted in0.5% fish skin gelatine in PBS.

The following primary antibodies were used: the 9E.10 mousemonoclonal antibody which recognises the c-myc epitope (Evan et al.,1985) at the C-terminus of NAGT I; a rabbit polyclonal antibodyrecognising rat Mann II (Moremen et al., 1991); a rabbit polyclonalantibody (N11) recognising human GalT (Watzele et al., 1991); theP5D4 mouse monoclonal antibody which recognises the VSV-G tag(Kreis, 1986; Soldati and Perriard, 1991) at the C-terminus of SialylT;and a rabbit polyclonal antibody recognising rat TGN38 (Luzio et al.,1990). Goat anti-mouse antibodies coupled to gold (Biocell Research

Laboratories, Cardiff, UK) were used to detect the primary mono-clonal antibodies whereas goat anti-rabbit antibodies coupled to gold(Biocell Research Laboratories, Cardiff, UK) or Protein A gold (fromDept of Cell Biology, Utrecht School of Medicine, Utrecht, theNetherlands) were used to detect primary polyclonal antibodies.

Two protocols were used for double-labelling experiments. Whenone of the primary antibodies was a monoclonal and the other a poly-clonal, they were mixed together for the initial incubation with thesection. Each of the secondary antibodies was then added sequentially(Nilsson et al., 1993). When both antibodies were polyclonal, incu-bation with the first primary antibody was followed by goat anti-rabbitor Protein A coupled to one size of gold. Sections were then fixed for15 minutes in 4% paraformaldehyde and the second primary antibodyadded followed by goat anti-rabbit or Protein A coupled to a differentsize of gold (Slot et al., 1991).

Grids were stained with 2% neutral uranyl acetate and embeddedin 2% methyl cellulose containing 0.4% uranyl acetate as described

1619Mapping the distribution of resident Golgi proteins

Fig. 2. Western blotting of the SialylT-HeLa and TGN38/SialylT-HeLa cell lines. Golgi membranes were isolated from each cell line,fractionated by SDS-PAGE, blotted and probed for TGN38 (lane3)and/or SialylT (lanes 1 and 2). Equal amounts were loaded in eachlane.

Fig. 3. Immunofluorescence microscopy of the SialylT-HeLa andTGN38/SialylT-HeLa cell lines. (A) SialylT-HeLa cells were fixed,permeabilised and labelled for SialylT. Note specific labelling of acompact, juxta-nuclear reticulum. (B) TGN38/SialylT-HeLa cellswere fixed, permeabilised and labelled for TGN38. Note the punctatelabelling in addition to labelling of a compact, juxta-nuclearreticulum. Bar, 10 µm.

kDa

54kDa

58kDa

by Tokuyasu (1980). Grids were examined at 80 kV using a PhilipsCM10 electron microscope. Pictures were taken at a magnification of15.5 or 21 K.

QuantitationDefinitions The compartments of the Golgi apparatus were defined as describedpreviously (Nilsson et al., 1993; Ponnambalam et al., 1994). Briefly,the trans or T cisterna is defined as the last continuous cisterna on theside of the Golgi stack that labels for GalT. Since the Golgi stack inHeLa cells typically contains three cisterna, the T-1 cisterna most likelycorresponds to the medial cisterna and the T-2 to the cis cisterna. TheT+1 compartment is the TGN and comprises a tubulo-reticular networkclosely apposed to the trans face of the trans cisterna. It differs fromthe CGN (T-3) in having clathrin-coated (Pearse and Robinson, 1990)in addition to COP-coated buds. Clathrin coats have a different mor-phology and thickness to COP coats (Orci et al., 1984, 1985; Oprins etal., 1993). Nevertheless, it was occasionally difficult to distinguish theTGN from the CGN so double-labelling for GalT and the test enzymewas used in preliminary experiments to define the polarity of the stack.

Relative distribution The relative distribution of gold particles over the TGN and eachcisterna was estimated by counting the number of gold particlesfalling within the boundary of each structure. The boundary of acisterna was defined as the cisternal membrane. The boundary of theTGN was defined as the interface between the outermost membranesof the tubulo-reticular network and the immediately adjacentamorphous cytoplasm and was drawn on each micrograph. Onoccasion this boundary would include profiles of budded vesicleswhich were included in the quantitation whilst other structures (e.g.vacuolar endosomes) were omitted.

Linear density The linear density of gold particles/µm membrane was estimated asdescribed previously for the T, T-1 and T-2 cisternae (Nilsson et al.,1993). The boundary of the TGN was drawn on each micrograph and

the surface density was estimated by the point-hit method (Weibel,1979; Ponnambalam et al., 1994). The length of every portion ofmembrane within this boundary was estimated by the intersectionmethod (Weibel, 1979; Nilsson et al., 1993). Since the ratio of surfacedensity to length was found to be constant (0.062±0.02) betweendifferent cell lines, the membrane length in most experiments was cal-culated from the surface density and this ratio.

The grid had a 5 mm spacing and the micrograph a final magnifi-cation that varied from 50 to 100 K. The linear density was calculatedby dividing the number of gold particles by the membrane length.

Indirect immunofluorescenceTGN38/SialylT-HeLa cells were grown to 70% confluency on coverslips and incubated for 2 hours in the presence of 10 µg/ml cyclo-heximide. Cells were fixed and permeabilised essentially as describedby Louvard et al. (1982). Bound primary antibodies were visualisedusing secondary antibodies coupled either to Texas Red (Vector Lab-oratories, Inc., Burlingame, CA) or FITC (Dakopatts, Copenhagen).Cells were visualised using a Zeiss Axiophot Epifluorescence micro-scope and photographed directly using Ilford black and white film.

1620 C. Rabouille and others

RESULTS

Characterisation of the stable cell linesGalT was the only endogenous enzyme under study that couldbe readily detected in cryo-sections of HeLa cells usingaffinity-purified antibodies to the deglycosylated protein(Watzele et al., 1991). Detection of the other enzymes wasmade possible by transfecting the parental HeLa cell line withthe PSRα plasmid containing the appropriate cDNA (seeMaterials and Methods) and selecting stable cell lines in thepresence of geneticin. Clones were picked at random andimmunofluorescence microscopy was used to select thoseclones expressing approximately equal amounts of protein inall cells as described by Nilsson et al. (1994). Expressedprotein was detected using either specific polyclonal antibodiesor monoclonal antibodies to an epitope tag engineered onto theC-terminus of the enzyme (Table 1). The structure andtopology of the proteins under study is summarised in Fig. 1.

Stable HeLa cell lines expressing NAGT I (Nilsson et al.,1993) and Mann II (Nilsson et al., 1994) have been charac-terised previously. Cells expressing SialylT either alone ortogether with TGN38 were characterised by western blotting.As shown in Fig. 2 (lanes 1 and 2), Golgi membranes fromeither cell line expressed a single protein of 54 kDa. This ishigher than the 47 kDa reported for the protein from rat liver(Weinstein et al., 1987) and presumably reflects increased gly-cosylation in HeLa cells. The converse was true for TGN38 inthe TGN38/SialylT-HeLa cells. A single protein of 58 kDa wasexpressed (Fig. 2, lane 3), lower than the 85-95 kDa reportedfor the heterogeneously sialylated protein from NRK cells(Luzio et al., 1990).

Immunofluorescence microscopy of these two cell lines alsogave the expected pattern. SialylT was localised to a compactreticulum on one side of the nucleus in both SialylT-HeLa cells(Fig. 3A) and TGN38/SialylT-HeLa cells (data not shown).TGN38 was present in the same structure but also in punctatestructures throughout the cell cytoplasm which likely representperipheral endosomes (Ponnambalam et al., 1994) (Fig. 3B).

Table 2. Distribution of GalT and Sialyl T between theGolgi stack and the TGN in different cell lines

Percentagedistribution

of gold particlesTotal number of (%)gold particles/

Cell line Enzyme Golgi apparatus Golgi stack TGN

Parental-HeLa GalT 35±15 33±14 67±14Mann II -Hela GalT 40±19 31±13 69±13NAGT1-HeLa GalT 38±17 33±15 67±15SialylT-HeLa GalT 36±21 28±18 72±18

SialylT 44±30 30±10 70±10TGN38/SialylT-HeLa GalT 34±11 34±14 66±14

SialylT 3±1.5 32 68

Cryo-sections from the different cell lines were labelled for either GalT orSialylT. Gold particles (350 to 800) over 10 to 20 Golgi apparatus werecounted and the results expressed either as the total or as the percentage overthe Golgi stack or TGN ± s.e.m.

In the case of SialylT in the TGN38/SialylT-HeLa cell line the number ofgold particles was too few to permit an estimation of the s.e.m. In this casethe distribution of 78 gold particles in 30 cells from two experiments wasdetermined.

The expression levels relative to endogenous protein wereestimated in one of two ways and are summarised in Table 1.For NAGT I and SialylT the activity of the enzyme wasmeasured and compared to the expression level of the endoge-nous protein in the parental HeLa cell line. Mann II activitycould not be estimated in the same way because there were toomany contaminating activities in whole cell homogenates. Thelevel was, therefore, estimated by immuno-gold microscopyand compared with the level of the endogenous protein in NRKcells. The same procedure was used for TGN38 which has noknown activity that could be measured.

The level of over-expression varied widely (Table 1). At thelower end was TGN38 (2.5-fold), NAGT I (4-fold) and MannII (6-fold). At the higher end was SialylT which was expressed10-fold over endogenous levels in the TGN38/SialylT-HeLacell line and 50-100-fold in the SialylT-HeLa cell line. Inter-estingly the difference in expression levels between these twocell lines had no effect on the distribution of the protein withinthe Golgi apparatus. As shown in Table 2, 68% of the SialylTwas present in the TGN in the TGN38/SialylT-HeLa cell linecompared with 70% in the SialylT-HeLa cell line. Similarresults were also obtained when the Mann II-HeLa cell linewas compared with another clone expressing the protein at a3-fold lower level (2-fold over NRK cells) (data not shown).

The effect of expressed proteins on endogenous Golgi proteinswas determined by measuring the distribution of endogenousGalT within the Golgi apparatus by immuno-gold microscopy.In the parental cell line, 33±14% of the GalT was present in thestack, the rest in the TGN. As shown in Table 2 this was notchanged significantly by stable expression of any of the proteins.The level of GalT in the stack in the stable cell lines ranged from28 to 34%. Furthermore, the level of GalT in each of the stablecell lines was not affected by expression of any of the otherproteins since the total number of gold particles/Golgi apparatusonly varied between 34 and 40 (Table 2).

Immuno-gold microscopyAn extensive series of experiments was carried out to establishthe distribution of the four Golgi enzymes and TGN38. One ofthem, GalT was used as the reference marker for each of theothers. We had earlier shown that the distribution of NAGT Ioverlapped that of GalT (Nilsson et al., 1993); Mann II wasfound to overlap the distribution of GalT in the exactly sameway (Fig. 4A) showing, by inference, that it had the same dis-tribution as NAGT I. In contrast, Sialyl T had exactly the samedistribution as GalT (Fig. 4B).

To provide a more quantitative measure of the distribution,we performed single labelling of all the cell lines and applieda Stereological method described earlier (Nilsson et al., 1993)in which the trans-most, or T cisterna of the stack was definedas the last continuous cisterna on the side of the stack thatlabelled for GalT. This cisterna was used as the referencepoint for all other compartments. The T-1 and T-2 cisternaemost likely represent the medial and cis cisternae, respec-tively. This is because there are typically three cisternae in thestack in HeLa cells (Nilsson et al., 1993). The T-3 compart-ment likely represents the CGN but was not readily identifiedin many cross sections and was, for the most part, unlabelledfor any of the Golgi proteins under study. It was not consid-ered further.

1621Mapping the distribution of resident Golgi proteins

Fig. 4. Distribution ofMann II/GalT andSialylT/GalT by doublelabel immunogoldmicroscopy. Thin frozensections of (A) Mann II-Hela or (B) SialylT-HeLa cells were double-labelled so as to revealthe location of (A) MannII (15 nm Protein Agold) and GalT (10 nmProtein A gold); (B)GalT (goat anti-rabbitcoupled to 5 nm gold)and SialylT (goat anti-mouse coupled to 10 nmgold). In A, note thatGalT is present in theTGN (asterisk) and thetrans cisterna,overlapping thedistribution of Mann II,which is found in thetrans and medialcisternae. In contrast, inB, GalT co-distributeswith SialylT, beingpresent in both the transcisterna and the TGN(asterisk). The primaryantibodies are listed inMaterials and Methodsand Table 1. Tubularextensions (smallarrows, Klumperman etal., 1993) of vacuolarendosome (E) are notlabelled. They can bedistinguished from theCOP-coated vesicles(large arrows, Oprins etal., 1993) due to theirdenser content and theirlack of coat. N, nuclearenvelope; M,mitochondrion; G, Golgicisternae. Bar, 200 nm.

1622 C. Rabouille and others

1623Mapping the distribution of resident Golgi proteins

The T+1 compartment represents the TGN which is a pleo-morphic structure comprising flattened, cisternal elementsabutting the trans cisterna linked to extensive tubulo-reticular

Fig. 5. Distribution of the stably expressed proteins by single label immulisted in Table 1 were labelled so as to reveal the location of: (A) NAGTProtein A gold); (C) SialylT (goat anti-mouse coupled to 10 nm gold); aand B, the gold is mainly restricted to the stacked Golgi cisternae (G) whprimary antibodies are listed in Materials and Methods and Table 1. E, vnuclear envelope. Bars, 200 nm.

elements that emanate a considerable distance from the stack.This structure was quantitated as described in Materials andMethods.

nogold microscopy. Thin frozen sections of the stable HeLa cell lines I (goat anti-mouse coupled to 10 nm gold); (B) Mann II (10 nmnd (D) TGN38 (goat anti-rabbit coupled to 10 nm gold). Note that in Aereas, in C and D, the vast majority is over the TGN (asterisks). Theacuolar endosome; ER, endoplasmic reticulum; M, mitochondrion; N,

1624 C. Rabouille and others

Distribution of NAGT I and Mann IILabelling for NAGT I was restricted almost exclusively to theGolgi stack with little label over the TGN or other membrane

Fig. 6. Quantitative distribution of GalT and the stably expressedproteins. Proteins were localised as described in Table 2 and Fig. 4and the distribution of gold particles over the TGN, T (trans), T-1(medial) and T-2 (cis) cisternae was determined and expressed eitheras a relative distribution (A) or a linear density (B). 250-1200 goldparticles were counted over 15-20 Golgi apparatus in two separateexperiments and two grids and the results are presented as the mean± s.e.m.

compartments (Fig. 5A). More than 65% of the labelling (Fig.6A) was present over two adjacent cisternae on the trans sideof the stack (Nilsson et al., 1993). Mann II was also presentover two cisternae on one side of the stack (Fig. 5B) whichwas shown to be the trans side by double-labelling for GalT(Fig. 4A). More than 75% of the labelling was present over themedial and trans cisternae (Fig. 6A).

The linear density of labelling for both NAGT I and MannII in the medial and trans cisternae was at least 2 times higherthan in the cis cisterna and 5-7 times higher than in the TGN(Fig. 6B).

Distribution of GalT and SialylTLabelling for both SialylT (Fig. 5C) and GalT was restrictedto the trans cisterna and the TGN. There was little labellingover the medial or cis cisternae. About 20% of labelling forGalT and SialylT was present in the trans cisterna and about70% in the TGN (Fig. 6A). The co-distribution of these twoenzymes was confirmed by double-labelling SialylT-HeLacells for both GalT and SialylT (Fig. 4B).

Quantitation showed that the linear density of both GalT andSialylT in the trans cisterna was about 4.5 times that in themedial cisterna and about 20 times that in the cis cisterna (Fig.6B). The average linear density in the TGN was lower thanthat in the trans cisterna even though it contained about 70%of both enzymes. This is because the TGN has a much longermembrane length.

Distribution of TGN38TGN38 was originally described as a marker for the TGN inNRK cells (Luzio et al., 1990) and, when expressed either tran-siently at low levels (Ponnambalam et al., 1994) or stably (Fig.5D) in HeLa cells, it is also present almost exclusively in theTGN. As shown in Fig. 6A, fully 90% of TGN38 was presentin the TGN in the TGN38/SialylT-HeLa cell line. The lineardensity in the TGN was 7 times higher than that in the transcisterna and 30 times higher than in the medial cisterna. Nonecould be detected in the cis cisterna (Fig. 6B).

DISCUSSION

The work described in this paper both confirms and extendsour earlier observations on the overlapping distribution ofNAGT I and GalT (Nilsson et al., 1993) to include both MannII and SialylT. The four enzymes fell into two groups: NAGTI co-distributed with Man II whereas GalT co-distributed withSialylT. The overlap was in the trans cisterna which had allfour enzymes.

Stable cell linesAs before, considerable care was taken to ensure that the stablyexpressed protein had the same distribution in HeLa cells asthe endogenous protein and did not alter the distribution ofother Golgi enzymes. First, the origin of the cDNAs was eitherhuman (NAGT I, SialylT) or a closely related mammal (MannII - murine, TGN38 - rat). The sequence similarity betweenGolgi enzymes from different mammals is typically in excessof 90% (for review, see Kleene and Berger, 1993). Second, theepitope tag, when present, was placed at the C-terminus, as faraway as possible from the membrane-spanning domain that

1625Mapping the distribution of resident Golgi proteins

contains the signal for retention (for references, see Machamer,1993). Third, the level of expression was in all but one caseless than or equal to 10 times the level of the endogenousprotein. Since none of the Golgi enzymes constitute more thana few per cent of Golgi membrane, such an increase could rea-sonably be expected to have a minimal effect on the distribu-tion of the protein. In fact, the one exception showed that con-siderable over-expression had no effect on the distribution.SialylT was expressed at 10 times the endogenous level inTGN38/SialylT-HeLa cells but at 50-100 times in SialylT-HeLa cells, yet the distribution of SialylT between the transcisterna and the TGN was almost exactly the same in both celllines (Table 1). Lastly, the distribution of GalT was checkedin each of the stable cell lines. The results showed clearly thatnone of the stably expressed proteins affected the distributionof at least this one Golgi protein.

Co-distribution of enzymesThe co-distribution of NAGT I and Mann II is in agreementwith earlier work. Relocation of NAGT I to the ER by attach-ment of an ER retrieval signal causes accumulation of Mann IIin the ER, and relocation of Mann II has a similar effect onNAGT I pointing to a very specific association between thesetwo enzymes (Nilsson et al., 1994). When rat liver Golgi stacksare extracted with Triton X-100, most of the NAGT I and MannII remain in the Triton pellet whereas most of the markers fromother parts of the Golgi are released into the supernatant(Slusarewicz et al., 1994). Even earlier work showed thatNAGT I and Mann II co-fractionated on sucrose gradients asdid GalT and SialylT, but at a lower density of sucrose (Dunphyand Rothman, 1983; Goldberg and Kornfeld, 1983). Interest-ingly, the two sets of peaks overlapped in agreement with theoverlap of all four enzymes in the trans cisterna. At that timethe aim was to show that Golgi enzymes were in separate com-partments so the overlap was either ignored or put down to alimitation in the resolution of the technique.

The co-distribution of GalT and SialylT agrees with mostbut not all published work. Though early biochemical studiesshowed that both enzymes co-fractionated on sucrose gradients(Dunphy and Rothman, 1983), studies on recycling proteinssuggested that they were in different compartments (Duncanand Kornfeld, 1988; Huang and Snider, 1993). This discrep-ancy might reflect the fact that CHO cells were used for theseexperiments and there is evidence in this cell line that GalTand SialylT are in different compartments (Chege and Pfeffer,1991). It will be important to confirm this using the approachwe have used for HeLa cells.

Earlier microscopic studies, both immuno-gold andimmunofluorescence, also suggested that GalT and SialylTwere present in different compartments (see Berger et al., 1993,for references) but this discrepancy was due, at least in part, tothe use of antibodies that recognised oligosaccharides as wellas the enzyme polypeptide chain. The most recent immunoflu-orescence data show that GalT and SialylT co-localise almostentirely at the immunofluorescence level (Berger et al., 1993)and the data presented in this paper, also using antibodies tothe polypeptide chain of GalT, show exact co-localisation byhigh resolution immuno-gold microscopy.

Mechanism of overlapThe mechanism that generates the overlapping distribution is

unclear but one possibility relates to the recent finding thatselective re-distribution of NAGT I and Mann II from theGolgi to the ER resulted in the disappearance of the Golgi stack(Nilsson et al., 1994). This strongly suggests that theseenzymes (and perhaps others in the same cisternae) areinvolved in maintaining the structure of the stack. A simplemodel would be for these enzymes to interact with each otheracross the intercisternal space which means that they wouldhave to be present in adjacent cisternae. The overlapping dis-tribution of Golgi enzymes would, therefore, reflect thestacking mechanism of Golgi cisternae. A simple functionalconsequence of this arrangement is that transported proteinswould meet the same set of enzymes twice. If they failed to bemodified the first time, there would be a second chance.

Though the majority of enzyme was present in two adjacentcompartments there was often significant amounts in theflanking cisternae. One possibility is that these enzymesrepresent that portion of the protein being recycled. Noretention mechanism is perfect and enzymes might be expectedto leak into transport vesicles. These might then be recycled ashas been shown for both soluble and membrane proteins of theER (for review, see Nilsson and Warren, 1994). There areseveral Golgi proteins that appear to recycle though theretrieval signal has not been identified (Alcalde et al., 1994;Johnston et al., 1994). Another possibility is that overlappingenzymes interact weakly with each other. As an example, relo-cation of NAGT I to the ER not only caused re-location ofMann II but also some of the GalT (Nilsson et al., 1994). Thepresence of some GalT and SialylT in the medial cisternamight then be explained by such an interaction. One last pos-sibility is that the distribution is the consequence of a retentionmechanism based on the increasing thickness of the lipidbilayer through the Golgi stack (Bretscher and Munro, 1993).Golgi enzymes would move until the length of the spanningdomain matched the thickness of the bilayer. The increment inthickness might, however, be sufficiently small to permit accu-mulation in several adjacent and flanking cisternae.

ConclusionsContinued mapping of the Golgi apparatus in HeLa cells hasstrengthened the idea that it is a precisely defined structure.The Golgi enzymes involved in the construction of complex,N-linked oligosaccharides are not restricted to single cisternaebut, so far, they are restricted to two adjacent ones. The over-lapping distribution may reflect the structural organisation ofthe stack. It is, however, clear that the distribution of Golgienzymes does vary from tissue to tissue and from organism toorganism (Roth et al., 1986; Velasco et al., 1993). Thissuggests that the mechanism governing the localisation ofGolgi enzymes is subject to another layer of control. The mostobvious would be post-translational modifications such asphosphorylation, and work is presently underway to test thispossibility.

We are indebted to Dr Paul Luzio (Cambridge, UK) and Dr GeorgeBanting (Bristol, UK) for kindly providing us with the cDNA andantibodies for TGN38; Dr Thomas Kreis (Geneva, Switzerland) forthe P5D4 hybridoma; Dr Kelley Moremen (Athens, Georgia) forMann II polyclonal antibodies; and Dr Sean Munro (Cambridge, UK)for cDNA encoding SialylT. We also thank the oligosynthesis facilityat Clare Hall for high quality oligonucleotides; the photography

1626 C. Rabouille and others

department for high quality reproductions; and Drs Tom Misteli, VasPonnambalam and Francis Barr for critical comments and helpful dis-cussions.

REFERENCES

Alcalde, J., Egea, G. and Sandoval I. V (1994). gp74 a membraneglycoprotein of the cis-Golgi network that cycles through the endoplasmicreticulum and intermediate compartment J. Cell Biol. 124, 649-665.

Balch, W. E., Dunphy, W. G, Braell, W. A. and Rothman, J. E. (1984).Reconstitution of the transport of protein between successive compartmentsof the Golgi measured by the coupled incorporation of N-acetylglucosamine.Cell 39, 405-16.

Blobel, G. and Dobberstein. B. (1975). Transfer of proteins acrossmembranes. I. Presence of proteolytically processed and unprocessednascent immunoglobulin light chains on membrane-bound ribosomes ofmurine myeloma. J. Cell Biol. 67, 835-51.

Berger, E. G., Grimm, K., Bächi, T., Bosshart, H., Kleene, R. and Watzele,M. (1993). Double immunofluorescence staining of α2, 6 sialyltransferaseand β1, 4 galactosyltransferase in monensin treated cells: Evidence fordifferent Golgi compartments? J. Cell. Biochem. 52, 275-288.

Bretscher, M. S. and Munro, S. (1993). Cholesterol and the Golgi apparatus.Science 261, 1280-1.

Bretz, R. and Stäubli, W. (1977). Detergent influence of rat livergalactosyltransferase activities towards different acceptors. Eur. J. Biochem.77, 181-192.

Chege, N. W. and Pfeffer, S. R. (1990). Compartmentation of the Golgicomplex: Brefeldin-A distinguishes trans Golgi cisternae from the transGolgi network. J. Cell Biol. 111, 893-899.

Duncan, J. R. and Kornfeld, S. (1988). Intracellular movement of twomannose-6-phosphate receptors: Return to the Golgi apparatus. J. Cell Biol.106, 617-628.

Dunphy, W. G., Fries, E., Urbani, L. J. and Rothman, J. E. (1981). Early andlate functions associated with the Golgi apparatus reside in distinctcompartments Proc. Nat. Acad. Sci. USA 78, 7453-7457.

Dunphy, W. G. and Rothman, J. E. (1983). Compartmentation of asparagine-linked oligosaccharides processing in the Golgi apparatus. J. Cell Biol. 97,270-275.

Dunphy, W. G., Brands, R. and Rothman, J. E (1985). Attachment ofterminal N-acetylglucosamine to asparagine-linked oligosaccharides occursin central cisternae of the Golgi stack. Cell 40, 463-72.

Evan, G. I., Lewis, G. K., Ramsay, G. and Bishop, J. M. (1985). Isolation ofmonoclonal-antibodies specific for human c-myc proto-onco-gene product.Mol. Cell. Biol. 5, 3610-3616.

Fawcett, D. W. (1981). The Cell. 2nd edn. W. B. Saunders Company,Philadelphia, PA 19105, USA.

Goldberg, D. E. and Kornfeld, S. (1983). Evidence for extensive subcellularorganisation of asparagine-linked oligosaccharide processing and lysosomalenzyme phosphorylation. J. Biol. Chem. 258, 3159-65.

Grundmann, U. G., Nerlich, C., Rein, T. and Zettlmeissl, G. (1990).Complete cDNA sequence encoding human β-galactoside α-2, 6-sialyltransferase. Nucl. Acids Res. 18, 667.

Huang, K. M. and Snider, M. D. (1993). Glycoprotein recycling to thegalactosyltransferase compartment of the Golgi complex J. Biol. Chem. 268,9302-9310.

Johnston, P. A., Stieber, A. and Gonatas, N. K (1994). A hypothesis on thetraffic of MG160, a medial Golgi sialoglycoprotein, from the trans-Golginetwork to the Golgi cisternae J. Cell Sci. 107, 529-537.

Kleene, R. and Berger, E. G. (1993). The molecular and cell biology ofglycosyltransferases. Biochim. Biophys. Acta. 1154, 283-325.

Klumperman, J., Hille, A., Veenendaal, T., Oorschot, V., Stoorvogel, W.,von Figura, K. and Geuze, H. J. (1993). Differences in the endosomaldistributions of the two mannose-6-phosphate receptors. J. Cell Biol. 121,997-1010.

Kreis, T. E. (1986). Microinjected antibodies against the cytoplasmic domainof vesicular stomatitis virus glycoprotein block its transport to the cellsurface. EMBO J. 5, 931-941.

Kornfeld, R. and Kornfeld, S. (1985). Assembly of asparagine-linkedoligosaccharides. Annu. Rev. Biochem. 50, 631-664.

Kumar, R., Yang, J., Larsen, R. D. and Stanley, P. (1990). Cloning andexpression of N-acetylglucosaminyltransferase I, the medial Golgi

transferase that initiates complex N-linked carbohydrate formation. Proc.Nat. Acad. Sci. USA 87, 9948-52.

Louvard, D., Reggio, H. and Warren, G. (1982). Antibodies to the Golgicomplex and the rough endoplasmic reticulum. J. Cell Biol. 92, 92-107.

Lucocq, J. M., Berger, E. G. and Warren, G. (1989). Mitotic Golgi fragmentsin HeLa cells and their role in the reassembly pathway. J. Cell Biol. 109, 463-474.

Luzio, J. P., Brake, B., Banting, G., Howell, K. E., Braghetta, P. andStanley. K. K. (1990). Identification, sequencing and expression of anintegral membrane protein of the trans-Golgi network (TGN38). Biochem. J.270, 97-102.

Machamer, C. E. (1993). Targeting and retention of Golgi membrane proteins.Curr. Opin. Cell Biol. 5, 606-12.

Moremen, K. W. and Robbins, P. W. (1991). Isolation, characterisation, andexpression of cDNAs encoding murine α-mannosidase II, a Golgi enzymethat controls conversion of high mannose to complex N-glycans. J. Cell.Biol. 115, 1521-34.

Moremen, K. W., Touster, O. and Robbins, P. W. (1991). Novel purificationof the catalytic domain of Golgi α-mannosidase II. Characterisation andcomparison with the intact enzyme. J. Biol. Chem. 266, 16876-85.

Nilsson, T., Jackson, M. and Peterson, P. A. (1989). Short cytoplasmicsequences serve as retention signals for transmembrane proteins in theendoplasmic reticulum. Cell 58, 707-18.

Nilsson, T., Pypaert, M., Hoe, M. H., Slusarewicz, P., Berger, E. G. andWarren, G. (1993). Overlapping distribution of two glycosyltransferases inthe Golgi apparatus of HeLa cells. J. Cell Biol. 120, 5-13.

Nilsson T., Hoe, M. H., Slusarewicz, P., Rabouille, C., Watson, R., Hunte,F., Watzele, G., Berger, E. G. and Warren, G. (1994). Kin recognitionbetween medial Golgi enzymes in HeLa cells. EMBO J. 13, 562-74.

Nilsson, T. and Warren, G. (1994). Retention and retrieval in the endoplasmicreticulum and the Golgi apparatus. Curr. Opin. Cell Biol. 6, 517-521.

Oprins, A., Duden, R., Kreis, T. E., Geuze, H. J. and Slot, J. W. (1993). β-COP localises mainly to the cis-Golgi side in exocrine pancreas. J. Cell Biol.121, 49-59.

Orci, L., Halban, P., Amherdt, M., Ravazzola, M., Vassalli, J. D. andPerrelet, A. (1984). A clathrin-coated, Golgi-related compartment of theinsulin secreting cell accumulates proinsulin in the presence of monensin.Cell 39, 39-47.

Orci, L., Ravazzda, M., Amherdt, M., Louvard, D. and Perrelet, A. (1985).Clathrin-immunoreactive sites in the Golgi apparatus are concentrated at thetrans pole in polypeptide hormone-secreting cells. Proc. Acad. Nat. Sci. USA92, 5385-5389.

Pearse, B. M. and Robinson, M. S. (1990). Clathrin, adaptors, and sorting.Annu. Rev. Cell Biol. 6, 151-171.

Ponnambalam, S., Rabouille, C., Luzio, J. P., Nilsson, T. and Warren, G.(1994). The TGN38 glycoprotein contains two non-overlapping signals thatmediate localisation to the trans-Golgi network. J. Cell Biol. 125, 253-268.

Rabouille, C., Strous, G. J., Crapo, J. D., Geuze, H. J. and Slot, J. W.(1993). The differential degradation of two cytosolic proteins as a tool tomonitor autophagy in hepatocytes by immunocytochemistry. J. Cell Biol.120, 897-908

Roth, J. and Berger, E. G. (1982). Immunocytochemical localisation ofgalactosyltransferase in HeLa cells: codistribution with thiaminepyrophosphatase in trans-Golgi cisternae. J. Cell Biol. 93, 223-229.

Roth, J., Taatjes, D. J., Lucocq, J. M., Weinstein, J. and Paulson, J. C.(1985). Demonstration of an extensive trans-tubular network continuouswith the Golgi apparatus stack that may function in glycosylation. Cell 43,287-295.

Roth, J., Taatjes, D. J., Weinstein, J., Paulson, J. C., Greenwell, P. andWatkins, W. M. (1986). Differential subcompartmentation of terminalglycosylation in the Golgi apparatus of intestinal absorptive and goblet cells.J. Biol. Chem. 261, 14307-12.

Roth, J. (1991). Localisation of glycosylation sites in the Golgi apparatus usingimmunolabeling and cytochemistry. J. Electron Microsc. Tech. 17, 121-31.

Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G.T. and Erlich, H. A. (1988). Primer-directed enzymatic amplification ofcDNA with a thermostable DNA polymerase. Science 239, 487-491.

Slot, J. W., Geuze, H. J., Gigengack, S., Lienhard, G. E. and James, D. E.(1991). Immunolocalisation of the insulin regulatable glucose transporter inbrown adipose tissue of the rat. J. Cell Biol. 113, 123-135.

Slusarewicz, P., Nilsson, T., Hui, N., Watson, R. and Warren, G. (1994).Isolation of an intercisternal matrix that binds medial Golgi enzymes. J. CellBiol. 124, 405-414.

Soldati, T. and Perriard, J. C. (1991). Intracompartmental sorting of essential

1627Mapping the distribution of resident Golgi proteins

myosin light chains: molecular dissection and in vivo monitoring by epitopetagging. Cell 66, 277-89.

Tokuyasu, K. T. (1980). Immunochemistry on ultrathin frozen sections.Histochem. J. 12, 381-403.

Velasco, A., Hendricks, L., Moremen, K. W., Tulsiani, D. R. P., Touster, O.and Farquhar, M. G. (1993). Cell type-dependent variations in thesubcellular distribution of α-mannosidase I and II. J. Cell Biol. 122, 39-51.

Watzele, G., Bachofner, R. and Berger, E. G. (1991). Immunocytochemicallocalisation of the Golgi apparatus using protein-specific antibodies togalactosyltransferase. Eur. J. Cell Biol. 56, 451-8.

Weibel, E. R. (1979). Stereological Methods. I. Practical Methods forMorphometry. Academic Press, London.

Weinstein, J., Lee, E. U., McEntee, K., Lai, P. H. and Paulson, J. C. (1987).Primary structure of β-galactoside α2, 6-sialyltransferase. Conversion ofmembrane-bound enzyme to soluble forms by cleavage of the NH2-terminalsignal anchor. J. Biol Chem. 262, 17735-43.

(Received 13 December 1994 - Accepted 18 January 1995)