Mapping and expression of microneme genes in Eimeria tenella

Mapping and expression of microneme genes in Eimeria tenella

Rachel Ryan, Martin Shirley, Fiona Tomley*

Division of Molecular Biology, Institute for Animal Health, Compton, Berkshire, RG20 7NN, UK

Received 17 August 2000; received in revised form 1 September 2000; accepted 1 September 2000

Abstract

Microneme organelles are located at the apical tip of invading stages of all apicomplexan parasites and they contain proteins that are

critical for parasite adhesion to host cells. In this paper, we have utilised the process of oocyst sporulation in Eimeria tenella to investigate the

timing of expression of components of the microneme organelle, at both mRNA and protein levels. Two time-course studies showed that

there is a high level of synchrony in the sporulation process, especially during the time period when sporozoites are formed. Western blotting

showed that the expression of ®ve microneme proteins (EtMIC1±5) is differentially regulated and highly co-ordinated during sporulation

with the proteins being detected only towards the end of the process, as the sporozoites matured within the sporocysts. In contrast, mRNA for

all ®ve of these microneme proteins was detected some 10±12 h earlier in sporulation than when the corresponding proteins were seen.

Overall these data suggest that the expression of proteins destined for the microneme is regulated both at the transcriptional and translational

level. The single copy genes encoding EtMIC1±5 are not clustered on the genome, but are found on four different chromosomes. q 2000

Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved.

Keywords: Eimeria; Microneme; Gene; Expression; Organisation; Sporulation

1. Introduction

Micronemes are secretory organelles that are located at

the anterior end of invasive stages of all apicomplexan para-

sites [1]. Morphological, biochemical and functional

evidence has shown that some microneme proteins function

as specialised adhesins, which are essential for substrate-

dependent parasite motility and attachment to host cells

[2]. Secretion of microneme proteins occurs via the parasite

apical tip [3,4] and is stimulated by contact with host cells

[3,5,6] and regulated, in Toxoplasma gondii, by parasite

cytoplasmic free Ca21 [3]. Microneme secretion is unaf-

fected by treatment with Brefeldin A [7] indicating that

the organelles contain a pre-formed store of proteins

which are rapidly released onto the parasite surface at the

appropriate time for invasion.

Little is known about the formation of microneme orga-

nelles or of the regulation of microneme protein expression,

but from ultrastructural studies it is clear that micronemes are

formed afresh during each successive stage of the life cycle.

For example, during ®rst generation schizogony the micro-

nemes, together with the pellicle, conoid and subpellicular

microtubules of the invading sporozoite, gradually disappear

[8] and new micronemes, probably originating from the golgi

apparatus, appear late in schizogony, when daughter mero-

zoites separate from the residuum [9,10]. In agreement with

this scenario, the Eimeria tenella microneme proteins

EtMIC2 and 5 gradually disappear during early schizogony

but are detected later as merozoites mature, suggesting that

microneme protein expression is co-ordinated and occurs

only when micronemes are being assembled in readiness

for the next round of host cell invasion [6,11].

Sporulation of the eimerian oocyst results in the forma-

tion of sporozoites and has some merits for the study of gene

expression during the formation of a discrete, invasive life-

cycle stage. For example, sporulation can be carried out

under controlled conditions and samples withdrawn for

analysis at any time, and newly synthesised proteins are

produced within tough cysts that can be rendered surface-

sterile and free from contaminating host material and debris.

RNA and protein synthesis in semi-permeabilised oocysts of

E. tenella has been demonstrated by incorporation of uridine

and leucine into trichloroacetic acid (TCA) insoluble frac-

tions [12] and a range of studies have shown major changes

in mRNA and protein abundance during sporulation [13±

16]. In this paper, we have used the process of E. tenella

sporulation to investigate the timing of expression of

components of the microneme organelles at the mRNA

International Journal for Parasitology 30 (2000) 1493±1499

0020-7519/00/$20.00 q 2000 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved.

PII: S0020-7519(00)00116-8

www.parasitology-online.com

* Corresponding author. Tel.: 144-1635-577-276; fax: 144-1635-577-

263.

E-mail address: ®[email protected] (F. Tomley).

and protein level. We also report the chromosomal locations

of ®ve genes encoding microneme proteins.

2. Materials and methods

2.1. Parasites

Starter cultures of oocysts of the Weybridge (W) and

Wisconsin (Wis) strains of E. tenella were kindly provided

by Janet Catchpole, Veterinary Laboratories Agency, UK

and Dr TK Jeffers, Eli Lilly and Co, USA, respectively.

Oocysts were propagated, recovered, sporulated and broken

to yield sporozoites that were puri®ed over columns of

nylon wool and DE-52 [17]. For the sporulation time-course

studies, freshly recovered oocysts were suspended at

2.5 £ 105 ml21 in 2% w/v aqueous potassium dichromate

and decanted into 5 l ¯asks, with no more than 2 l of suspen-

sion in each ¯ask. The oocysts were sporulated at room

temperature (ca. 258C), with continuous bar magnet stirring

and vigorous forced aeration through rubber airlines. At

sampling times, an aliquot of oocyst suspension was

removed and the oocysts pelleted by centrifugation,

surface-sterilised using sodium hypochlorite [17], washed

several times in water and stored in 1 mM sodium dithionite

at 48C. Oocysts from each sample were mounted onto glass

slides in 90% glycerol in 100 mM Tris pH 7.6 for photo-

graphing at £ 400 magni®cation or in 100 mM Tris pH 7.6

for photographing at £ 1000 magni®cation by differential

interference contrast microscopy.

2.2. Antibodies

Micronemes were prepared from freshly excysted, puri-

®ed sporozoites by sonication and sucrose density gradient

ultracentrifugation as described previously [18]. Microneme

proteins were separated by one and two-dimensional sodium

dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-

PAGE), visualised by staining in aqueous Coomassie bril-

liant blue and harvested by electro-elution. Hyperimmune

sera were prepared in rabbits against ®ve microneme

proteins, designated EtMIC1±5.

2.3. Recovery and analysis of proteins from oocysts

Oocysts (107) were suspended in 300 ml phosphate-

buffered saline (PBS), pH 7.6 and 30 ml proteinase inhibitor

cocktail (Sigma P2714) in a 1.5 ml eppendorf tube. Three

hundred microlitres of #8 glass ballotini (Fisons) were added

and the contents of the tube vortexed vigorously. Oocyst

breakage was monitored by microscopic examination and

the vortexing continued until no intact oocysts, sporocysts

or sporozoites could be seen. After three rounds of freeze-

thawing, the oocyst lysate was centrifuged at 14 000 £ g and

the supernatant harvested and sonicated for three bursts of 20

s at 10 mm amplitude. The concentration of solubilised

protein was determined by spectrophotometry and lysates

stored at 2708C. Proteins were analysed by SDS-PAGE elec-

trophoresis and Western blotting. Brie¯y, samples contain-

ing 500 ng protein were boiled in SDS-PAGE sample buffer

[19] containing 1 mM dithiothreitol (DTT). Proteins were

separated on 10% SDS-PAGE minigels and transferred to

nitrocellulose ®lters by semi-dry electroblotting. Non-speci-

®c binding sites were blocked by incubation for 1 h in 5% w/v

milk powder in PBS then ®lters were probed with rabbit

antisera against E. tenella microneme proteins followed by

goat anti-rabbit IgG conjugated to alkaline phosphatase.

Antigen-antibody interactions were visualised by incubation

in nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl-

phosphate, as described previously [20].

2.4. Recovery of RNA from oocysts

Oocysts (2.5 £ 107) were suspended in 200 ml RNAse-

free water in a 1.5 ml eppendorf tube and 200 ml of sterilised

#8 glass ballotini beads were added. After oocyst breakage,

as described above, the supernatant was harvested and RNA

extracted using a detergent-based total RNA extraction kit

(PureScript, Gentra Systems, supplied by Flowgen) accord-

ing to the manufacturer's instructions. Residual DNA in the

preparation was removed by adding 4 U RNAse-free

DNAse (Invitrogen) for each 1 mg of RNA and incubating

at 378C for 10 min. DNAse was inactivated by incubation at

658C for 5 min and the RNA stored at 2708C in diethylpyr-

ocarbonate-treated water until use.

2.5. Reverse transcription-polymerase chain reaction (RT-

PCR)

Messenger RNAs speci®c for microneme genes EtMIC1±

5, were ampli®ed from total RNA preparations by RT-PCR.

Reverse transcriptions to produce ®rst strand cDNAs were

done from 8 mg samples of total RNA using random hexa-

nucleotide primers and Moloney murine leukaemic virus

reverse transcriptase in a ProSTARe kit (Stratagene).

Mock ®rst strand syntheses were also carried out in which

reverse transcriptase was omitted. All ®rst strand reactions

were used in polymerase chain reaction (PCR) ampli®ca-

tions with oligonucleotides speci®c for individual micro-

neme genes and for EtACTIN. The primers and predicted

sizes of products are shown in Table 1.

2.6. Pulsed ®eld gel electrophoresis and Southern blotting

Chromosomal DNA was prepared from sporozoites of E.

tenella in agarose blocks as previously described [21] and

loaded into the slots of 0.6% TBE agarose gels (Seakem ME

or SeaPlaque low melting point agarose, FMC BioProducts)

cast onto 21 cm square glass plates. Electrophoresis was

carried out in a CHEF DR11 cell (Bio-Rad) at 45 V for

®rstly 240 h with a ramped pulse time of 1800±6500 s,

then 48 h with a pulse time of 2500 s and ®nally 30 h

with a pulse time of 300±1700 s. DNA was stained with

ethidium bromide and blotted onto nylon ®lters (Hybond-

R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±14991494

N, Amersham) as described previously [21]. DNA frag-

ments excised from pBluescript recombinant plasmids,

and corresponding to the coding regions of microneme

proteins EtMIC1±5, were 32P-labelled by random priming

(Prime-Itw II, Stratagene) and hybridised to ®lters at 658C in

0.5 M sodium phosphate, pH 7.2, 5% SDS. Filters were

washed three times at high stringency (0.1% SDS, 0.1 £standard saline citrate (SSC)) then exposed to X-ray ®lm

(XB-200, X-ograph imaging systems) at 2708C using inten-

sifying screens (Harmer, London).

3. Results

3.1. Synchrony of development and oocyst morphology

during sporulation

It has been reported that oocyst sporulation in eimerians

can be asynchronous [22] such that internal structures show

heterogeneity in their morphological appearance at a single

time point. To investigate the extent of variation in our

system we examined low-power micrographs of oocysts

(Fig. 1) and to get a more detailed picture of oocyst

morphology we also examined high-power micrographs

(Fig. 2). The ®rst time course experiment had sampling

times over a 3 day period and the second covered a narrower

time-span during the critical period in which sporoblasts and

sporozoites matured inside the oocyst. In the ®rst experi-

ment, at 0 h of sporulation the cytoplasm of the sporont in

the majority of oocysts was contracted away from the oocyst

wall and the central position was occupied by the nucleus

(Figs. 1 and 2A). At 6 h, 60% of oocysts looked the same as

at 0 h but for 25% the cytoplasm had constricted further

(Figs. 1 and 2A), suggesting that nuclear divisions were

complete [23] and a further 15% of oocysts had progressed

to the two sporont stage. By 12 h, blasting to the four cell

stage had occurred in the great majority of the oocysts (Figs.

1 and 2A) but the stage of development varied with 20%

R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499 1495

Fig. 1. Morphology of oocysts during sporulation. Oocysts were removed at various times, pelleted by centrifugation, surface-sterilised with sodium

hypochlorite and stored in 1mM sodium dithionite at 48C. Oocysts from each sampling point were wet-mounted onto glass slides in 90% glycerol and viewed

at 400 £ magni®cation by differential interference microscopy.

Table 1

Oligonucleotide primers used for the ampli®cation of microneme-speci®c products in RT-PCR analysis, including primer sequence and predicted size of

products

Gene Primers Sequence (5 0±3 0) Product size (bp)

EtMIC1 Mic23 TTGGTCATGACTGACGGC 1100

Tsp5D GTGCAAGCTTAGCATGGAACTTCATTGCATC

EtMIC2 Mic2rr5.1 GAGCGAACGGGACTTCATTG 800

Mic2rr3.1 ACTCTGCTTGAACCTCTTCC

EtMIC3 Mic3g TGTCGCTGTCAATGACCGCTTGAA 500

Mic3b GAGGCCGCGGGGCCAGGCTGTGTA

EtMIC4 Mic4rr5.1 CCACGCCTCTTGTGCCAACA 1200

Mic4rr3.1 GAAGGTGGTGTTGTCGTCGC

EtMIC5 Pjb6 TTCCGTCAGGGCGTTGGATAC 400

Pjb7 ACTTCGTAGGCCGAAGGGCTG

EtACTIN Act1 CTGTGAGAAGAACCGGGTGCTCTTC 350

Act8rr CGTGCGAAAATGCCGGACGAAGAG

being at the `pyramid stage' and 80% having sporoblasts in

their ®nal shape. By 24 h, four sporocysts, each containing

two apparently mature sporozoites, were clearly visible

within the oocysts (Figs. 1 and 2A) and no further morpho-

logical changes were seen at 36, 60 and 72 h (Figs. 1 and

2A). Thus, whilst we observed some variation in the degree

of cytoplasmic contraction at 0 h and considerable hetero-

geneity in the rate of development to the two-cell stage at 6

h, a good degree of synchrony was achieved by 12 h and

maintained throughout the rest of the sporulation period.

Overall, around 10% of the oocysts remained completely

unsporulated and 90% proceeded to full sporulation by 24

h. This is very similar to the degree of synchrony previously

reported during sporulation of E. tenella [24]. To examine

more closely the morphological changes that occurred

during sporocyst and sporozoite formation, the second

time course experiment was carried out with samples

removed between 13 and 29.5 h. In this experiment, a simi-

lar high level of synchrony was seen at all time points under

low power microscopy (data not shown). Thus the sporula-

tion of oocysts of E. tenella appeared suf®ciently synchro-

nous with regard to the main events, for utility in a study of

the expression of microneme genes. In terms of morphology

during the second time course experiment, the oocysts at 13

h closely resembled those at 12 h in the ®rst experiment,

with four sporoblasts containing granular material (Fig. 2B).

By 15.5 h, blasts were developing into elliptical shape and

by 18 h these had developed into sporocysts, which did not

contain discernible sporozoites (Fig. 2B). By 22.5 h the

stieda bodies of the sporoblasts were fully formed and

mature sporozoites were clearly visible within the sporo-

cysts (Fig. 2B). The time-scale of morphological events

for the sporulation of E. tenella (Wis) reported in this

study is similar, but not identical, to that reported for

Eimeria maxima [23]. Similar temperatures of incubation

were used for both studies, but the development of E. tenella

during the ®rst 6 h was faster than that of E. maxima. In fact,

E. tenella oocysts at 6 h were at a stage comparable with

those of E. maxima at 11 h of sporulation. The reason for

this difference is not known, but oocysts of E. maxima are

larger than those of E. tenella and are more dif®cult to break

by vortexing with glass balls. Thus, it is possible that

gaseous exchange across the oocyst wall of E. maxima is

less ef®cient than that of E. tenella.

3.2. The appearance of microneme proteins

Lysates were prepared from oocysts harvested throughout

each time course experiments and examined by SDS-PAGE

and Western blotting using antibodies speci®c for ®ve differ-

ent microneme proteins, EtMIC1±5 (Fig. 2). All ®ve proteins

were present in oocysts harvested at 22.5 h of sporulation and

at all later times. EtMIC4 was detected, very faintly, at 6 and

12 h in the ®rst time course (Fig. 2A) and at 18 h in the second

(Fig. 2B) and EtMIC3 was detected very faintly at 18 h. This

suggests that these proteins may be expressed, at a low level,

at earlier times than the other three microneme proteins that

were examined. From examination of high-power photomi-

crographs, the oocyst morphology at 22.5 h corresponded to

the earliest sampling time at which fully formed sporozoites

could be seen within the sporocysts.

3.3. Chromosomal localisation of genes encoding

microneme proteins

Since there was a high level of synchronicity in the detec-

tion of the ®ve microneme proteins during sporulation, the

chromosomal localisation of genes encoding these proteins

was determined to see whether they are clustered in the

genome (Fig. 3). Probes corresponding to genes EtMIC1±

5 were hybridised to Southern blots of separated chromo-

somes of E. tenella. Each probe hybridised to a single chro-


Fig. 2. Detection of microneme proteins during oocyst sporulation. Oocysts

were broken by mechanical shearing and protein samples (500 mg) exam-

ined by Western blotting using monospeci®c antibodies against microneme

proteins EtMIC1±5. Experiment 1: samples taken from 0±72 h, covering the

whole of a sporulation time course. Experiment 2: samples taken from 13±

29.5 h, during which time sporoblasts and sporozoites mature within the

oocyst.

mosome band and the analysis indicated that EtMIC1 is on

chromosome 12, EtMIC2 on chromosome 9, EtMIC3 on

chromosome 3, EtMIC4 on chromosome 5 and EtMIC5 on

chromosome 9. Thus there is no clustering of genes encod-

ing EtMIC proteins within the genome.

3.4. Expression of microneme-speci®c mRNAs during

sporulation

To determine whether the co-ordination of microneme

protein expression during sporulation is likely to be

controlled at the level of transcription or translation, total

RNA was isolated from oocysts sampled during the time

course experiments and subjected to speci®c RT-PCR reac-

tions (Fig. 4). Before use, RNA preparations were checked

for quality by electrophoresis and quanti®ed by spectropho-

tometry (data not shown). To check that all RT-PCR reac-

tions were working, primers speci®c for the EtACTIN gene,

which is expressed constitutively, were included in each

reaction. Controls lacking RT were set up for each reaction

to ensure that contaminating residual genomic DNA did not

contribute to the PCR signals. No signals were obtained in

any of these RT negative controls (data not shown). Messen-

ger RNAs speci®c for each of EtMIC1±5 were detected in

oocysts from 12 h of sporulation and remained detectable

throughout the remainder of the time course (Fig. 4A,B).

For EtMIC3 and 4, distinct signals were also detected at 6 h

of sporulation (Fig. 4A). These RT-PCR reactions were

carried out several times from batches of RNA prepared

on three separate occasions and the same pattern of

mRNA expression was detected on each occasion. Thus, it

seems that all the microneme speci®c mRNAs are expressed

from the time of sporoblast formation onwards and that

those for EtMIC3 and 4 are switched on a few hours earlier

than those for the remaining genes that were examined.

4. Discussion

For apicomplexan parasites, successful progression


Fig. 3. Chromosomal localisations of EtMIC1±5. Chromosomes of two

strains of E. tenella were separated by pulsed ®eld gel electrophoresis

(PFGE) and stained with ethidium bromide (left panel, lhs, E. tenella

Wey; rhs, E. tenella Wis). Numbers assigned to chromosomes, which

range in size from 1 (chromosome 1) to 7 Mbp (chromosome 14), are

indicated by arrows. The line of origin is at the top of the ®gure and the

PFGE conditions gave separation of the major chromosomes without any

compression zone just below the origin. Chromosomes of E. tenella Wis

and Wey from gels subjected to identical PFGE conditions were transferred

to ®lters and probed with sequences from EtMIC1±5. Probes and their

chromosomal locations are given below the panels; the panel on the right

was probed with both EtMIC4 and 5 and the asterisk denotes hybridisation

due to EtMIC5. The chromosomal locations of EtMIC3±5, which hybri-

dised to bands that contain two chromosomes under the conditions shown,

were con®rmed using gels run under different PFGE conditions (data not

shown). The hybridisation of EtMIC3 to chromosome 9 and EtMIC5 to

chromosome 14 of the Wis strain was not reproducible.

Fig. 4. Detection of microneme-speci®c RNA during oocyst sporulation.

Oocysts were broken by mechanical shearing and total RNA extracted as

described in Section 2. Eight microgram samples of RNA were subjected to

RT-PCR reactions using primers speci®c for EtACTIN and for each EtMIC

gene. Control reactions, in which RT was omitted, were done on all samples

and were negative (data not shown). (A) Experiment 1. (B) Experiment 2.

through the life-cycle is dependent upon the ability of tran-

siently extracellular zoites to rapidly invade host cells

within which they will replicate. In this paper, we have

explored the utility of oocyst sporulation in E. tenella for

examining the expression of genes encoding proteins that

reside in the microneme, a specialised sub-cellular organelle

that is important in the early part of the invasion process.

Dramatic morphological changes occur within the oocyst

during sporulation that culminate in the production of inva-

sive sporozoites. During the time of sporocyst and sporo-

zoite formation, sporulation is highly synchronous and

around 90% of the culture proceeds to full sporulation by

24 h. Thus, samples taken from time-course experiments

should give valuable insights into patterns of speci®c gene

expression during the differentiation process.

From Western blotting it is clear that there is a good degree

of co-ordination in the timing of expression of microneme

proteins. EtMIC4 was detected at low levels from 6 h, and

EtMIC3 detected at low levels from 18 h. However, from

22.5 h onwards, coinciding with the time at which sporozoite

maturation occurred, all ®ve of the microneme proteins

examined were detected strongly. This pattern of expression

is similar to that seen for EtMIC2 and 5 during ®rst genera-

tion schizogony, when the proteins are detected only from the

time at which daughter merozoites are forming [6,11]. Thus,

it appears that expression of microneme proteins is a regu-

lated process and that they are made predominantly during

zoite maturation when, presumably, microneme organelles

are formed. Since there is no clustering of microneme genes

in the E. tenella genome, this regulation is not due to posi-

tional effects.

To determine whether oocyst sporulation time courses are

useful for examining gene expression at the mRNA level, a

series of RT-PCR reactions was carried out. Using primers

for EtACTIN, a single copy gene, a PCR product of the

predicted size was obtained with RNA samples taken

throughout the time-courses, con®rming that this gene is

expressed constitutively. In contrast, mRNAs for EtMIC1±

5 were not detected until 6 or 12 h into sporulation, indicating

that there is regulation of expression between the unsporu-

lated and the sporulating oocyst stages. Whether this

temporal regulation is due to differences in transcription

between the stages, or is due to post-transcriptional effects,

such as differential mRNA turnover, remains to be deter-

mined. Interestingly, mRNAs for EtMIC3 and 4 were

detected earlier than those for EtMIC1, 2 and 5, which corre-

lates with the slightly earlier detection of these two proteins

by Western blotting. For all of the micronemes (MICs),

protein was not detected until some 10±12 h after detection

of speci®c mRNAs, indicating that post-transcriptional

factors are important in the regulation of microneme protein

expression. Whether this is due to post-transcriptional

effects, or differences in mRNA translation during sporula-

tion also remains to be determined.

Overall, this study has shown that the oocyst offers a

convenient, synchronous system for analysing speci®c

products of gene expression during the differentiation of

the invasive sporozoite. A disadvantage of the system may

prove to be the impermeability of the oocyst wall, which

could limit its utility for metabolic labelling and/or inhibitor

studies. However, following sodium hypochlorite and

dimethyl sulphoxide (DMSO) treatment, it has been

reported that labelled nucleotides and amino acids can be

introduced into the oocyst [12]. Therefore, in combination

with speci®c antibodies and DNA sequences, it may be

possible to use the model of oocyst sporulation for more

detailed studies on the transcription, translation and proces-

sing of target proteins.

Acknowledgements

We would like to thank Philip Brown for the EtMIC5

primers and Janene Bumstead and Karen Billington for

technical advice. RR is supported by an IAH research

studentship.

References

[1] Dubremetz JF, Garcia-Reguet N, Conseil V, Fourmaux MN. Apical

organelles and host-cell invasion by Apicomplexa. Int J Parasitol

1998;28:1007±13.

[2] Tomley FM, Soldati DS. Mix and match modules: structure and func-

tion of microneme proteins in apicomplexan parasites. Parasitol

Today 2000, in press.

[3] Carruthers VB, Sibley LD. Mobilization of intracellular calcium

stimulates microneme discharge in Toxoplasma gondii. Mol Micro-

biol 1999;31:421±8.

[4] Bumstead JM, Tomley FM. Induction of secretion and surface

capping of microneme proteins in Eimeria tenella. Mol Biochem

Parasitol 2000;110:311±21.

[5] Entzeroth R, Kerckhoff H, Konig A. Microneme secretion in Cocci-

dia: confocal laser scanning and electron microscope study of Sarco-

cystis muris in cell culture. Eur J Cell Biol 1992;59:405±13.

[6] Tomley FM, Bumstead JM, Billington KJ, Dunn PP. Molecular clon-

ing and characterization of a novel acidic microneme protein (Etmic-

2) from the apicomplexan protozoan parasite, Eimeria tenella. Mol

Biochem Parasitol 1996;79:195±206.

[7] Wan KL, Carruthers VB, Sibley LD, Ajioka JW. Molecular charac-

terisation of an expressed sequence tag locus of Toxoplasma gondii

encoding the micronemal protein MIC2. Mol Biochem Parasitol

1997;84:203±14.

[8] Chobotar B, Scholtyseck E, SeÂnaud J, Ernst JV. A ®ne structural study

of asexual stages of the murine coccidium Eimeria ferrisi Levine and

Ivens 1965. Z Parasitenkd 1975;45:291±306.

[9] Dubremetz JF. Genesis of merozoites in the coccidian, Eimeria neca-

trix. Ultrastructural study. J Protozool 1975;22:71±84.

[10] Dubremetz JF, Elsner YY. Ultrastructural study of schizogony of

Eimeria bovis in cell cultures. J Protozool 1979;26:367±76.

[11] Brown PJ, Billington KJ, Bumstead JM, et al. A microneme protein

from Eimeria tenella with homology to the apple domains of coagu-

lation factor XI and plasma pre-kallikrein. Mol Biochem Parasitol

2000;107:91±102.

[12] Wang CC, Stotish RL. Changes of nucleic acids and proteins in the

oocysts of Eimeria tenella during sporulation. J Protozool

1975;22:438±43.

[13] Sutton CA, Shirley MW, Wisher MH. Characterization of coccidial


proteins by two-dimensional sodium dodecyl sulphate-polyacryla-

mide gel electrophoresis. Parasitology 1989;99:175±87.

[14] Ellis J, Thurlby T. Changes in the messenger RNA population during

sporulation of Eimeria maxima. Parasitology 1991;102:1±8.

[15] Tomley F. Antigenic diversity of the asexual developmental stages of

Eimeria tenella. Parasite Immunol 1994;16:407±13.

[16] Abrahamsen MS, Johnson RR, Clark TG, White MW. Developmental

regulation of an Eimeria bovis mRNA encoding refractile body-asso-

ciated proteins. Mol Biochem Parasitol 1994;68:25±34.

[17] Shirley MW. Eimeria species and strains of chickens. In: Eckert J,

Braun R, Shirley MW, Coudert P, editors. Biotechnology ± guidelines

on techniques in coccidiosis research. Luxembourg: European

Commission, 1995. pp. 1±24.

[18] Tomley F. Techniques for isolation and characterization of apical

organelles from Eimeria tenella sporozoites. Methods 1997;13:171±6.

[19] Laemmli UK. Cleavage of structural proteins during the assembly of

the head of bacteriophage T4. Nature 1970;227:680±5.

[20] Kawazoe U, Tomley FM, Frazier JA. Fractionation and antigenic

characterization of organelles of Eimeria tenella sporozoites. Parasi-

tology 1992;104:1±9.

[21] Shirley MW. The genome of Eimeria tenella: further studies on its

molecular organisation. Parasitol Res 1994;80:366±73.

[22] Ferguson DJ, Birch-Andersen A, Hutchinson WM, Siim JC. Light and

electron microscopy on the sporulation of the oocysts of Eimeria

brunetti. II. Development into the sporocyst and formation of the

sporozoite. Acta Pathol Microbiol Scand B 1978;86:13±24.

[23] Canning EU, Anwar M. Studies on meiotic division in coccidial and

malarial parasites. J Protozool 1968;15:290±8.

[24] Wang CC. Inhibition of the respiration of Eimeria tenella by quino-

lone coccidiostats. Biochem Pharmacol 1976;25:343±9.


Mapping and expression of microneme genes in Eimeria tenella

Documents

Transcript of Mapping and expression of microneme genes in Eimeria tenella