EXCRECIÓN DE OOQUISTES DE Cryptosporidium spp. y Eimeria ...
Mapping and expression of microneme genes in Eimeria tenella
-
Upload
rachel-ryan -
Category
Documents
-
view
215 -
download
2
Transcript of Mapping and expression of microneme genes in Eimeria tenella
Mapping and expression of microneme genes in Eimeria tenella
Rachel Ryan, Martin Shirley, Fiona Tomley*
Division of Molecular Biology, Institute for Animal Health, Compton, Berkshire, RG20 7NN, UK
Received 17 August 2000; received in revised form 1 September 2000; accepted 1 September 2000
Abstract
Microneme organelles are located at the apical tip of invading stages of all apicomplexan parasites and they contain proteins that are
critical for parasite adhesion to host cells. In this paper, we have utilised the process of oocyst sporulation in Eimeria tenella to investigate the
timing of expression of components of the microneme organelle, at both mRNA and protein levels. Two time-course studies showed that
there is a high level of synchrony in the sporulation process, especially during the time period when sporozoites are formed. Western blotting
showed that the expression of ®ve microneme proteins (EtMIC1±5) is differentially regulated and highly co-ordinated during sporulation
with the proteins being detected only towards the end of the process, as the sporozoites matured within the sporocysts. In contrast, mRNA for
all ®ve of these microneme proteins was detected some 10±12 h earlier in sporulation than when the corresponding proteins were seen.
Overall these data suggest that the expression of proteins destined for the microneme is regulated both at the transcriptional and translational
level. The single copy genes encoding EtMIC1±5 are not clustered on the genome, but are found on four different chromosomes. q 2000
Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved.
Keywords: Eimeria; Microneme; Gene; Expression; Organisation; Sporulation
1. Introduction
Micronemes are secretory organelles that are located at
the anterior end of invasive stages of all apicomplexan para-
sites [1]. Morphological, biochemical and functional
evidence has shown that some microneme proteins function
as specialised adhesins, which are essential for substrate-
dependent parasite motility and attachment to host cells
[2]. Secretion of microneme proteins occurs via the parasite
apical tip [3,4] and is stimulated by contact with host cells
[3,5,6] and regulated, in Toxoplasma gondii, by parasite
cytoplasmic free Ca21 [3]. Microneme secretion is unaf-
fected by treatment with Brefeldin A [7] indicating that
the organelles contain a pre-formed store of proteins
which are rapidly released onto the parasite surface at the
appropriate time for invasion.
Little is known about the formation of microneme orga-
nelles or of the regulation of microneme protein expression,
but from ultrastructural studies it is clear that micronemes are
formed afresh during each successive stage of the life cycle.
For example, during ®rst generation schizogony the micro-
nemes, together with the pellicle, conoid and subpellicular
microtubules of the invading sporozoite, gradually disappear
[8] and new micronemes, probably originating from the golgi
apparatus, appear late in schizogony, when daughter mero-
zoites separate from the residuum [9,10]. In agreement with
this scenario, the Eimeria tenella microneme proteins
EtMIC2 and 5 gradually disappear during early schizogony
but are detected later as merozoites mature, suggesting that
microneme protein expression is co-ordinated and occurs
only when micronemes are being assembled in readiness
for the next round of host cell invasion [6,11].
Sporulation of the eimerian oocyst results in the forma-
tion of sporozoites and has some merits for the study of gene
expression during the formation of a discrete, invasive life-
cycle stage. For example, sporulation can be carried out
under controlled conditions and samples withdrawn for
analysis at any time, and newly synthesised proteins are
produced within tough cysts that can be rendered surface-
sterile and free from contaminating host material and debris.
RNA and protein synthesis in semi-permeabilised oocysts of
E. tenella has been demonstrated by incorporation of uridine
and leucine into trichloroacetic acid (TCA) insoluble frac-
tions [12] and a range of studies have shown major changes
in mRNA and protein abundance during sporulation [13±
16]. In this paper, we have used the process of E. tenella
sporulation to investigate the timing of expression of
components of the microneme organelles at the mRNA
International Journal for Parasitology 30 (2000) 1493±1499
0020-7519/00/$20.00 q 2000 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved.
PII: S0020-7519(00)00116-8
www.parasitology-online.com
* Corresponding author. Tel.: 144-1635-577-276; fax: 144-1635-577-
263.
E-mail address: ®[email protected] (F. Tomley).
and protein level. We also report the chromosomal locations
of ®ve genes encoding microneme proteins.
2. Materials and methods
2.1. Parasites
Starter cultures of oocysts of the Weybridge (W) and
Wisconsin (Wis) strains of E. tenella were kindly provided
by Janet Catchpole, Veterinary Laboratories Agency, UK
and Dr TK Jeffers, Eli Lilly and Co, USA, respectively.
Oocysts were propagated, recovered, sporulated and broken
to yield sporozoites that were puri®ed over columns of
nylon wool and DE-52 [17]. For the sporulation time-course
studies, freshly recovered oocysts were suspended at
2.5 £ 105 ml21 in 2% w/v aqueous potassium dichromate
and decanted into 5 l ¯asks, with no more than 2 l of suspen-
sion in each ¯ask. The oocysts were sporulated at room
temperature (ca. 258C), with continuous bar magnet stirring
and vigorous forced aeration through rubber airlines. At
sampling times, an aliquot of oocyst suspension was
removed and the oocysts pelleted by centrifugation,
surface-sterilised using sodium hypochlorite [17], washed
several times in water and stored in 1 mM sodium dithionite
at 48C. Oocysts from each sample were mounted onto glass
slides in 90% glycerol in 100 mM Tris pH 7.6 for photo-
graphing at £ 400 magni®cation or in 100 mM Tris pH 7.6
for photographing at £ 1000 magni®cation by differential
interference contrast microscopy.
2.2. Antibodies
Micronemes were prepared from freshly excysted, puri-
®ed sporozoites by sonication and sucrose density gradient
ultracentrifugation as described previously [18]. Microneme
proteins were separated by one and two-dimensional sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-
PAGE), visualised by staining in aqueous Coomassie bril-
liant blue and harvested by electro-elution. Hyperimmune
sera were prepared in rabbits against ®ve microneme
proteins, designated EtMIC1±5.
2.3. Recovery and analysis of proteins from oocysts
Oocysts (107) were suspended in 300 ml phosphate-
buffered saline (PBS), pH 7.6 and 30 ml proteinase inhibitor
cocktail (Sigma P2714) in a 1.5 ml eppendorf tube. Three
hundred microlitres of #8 glass ballotini (Fisons) were added
and the contents of the tube vortexed vigorously. Oocyst
breakage was monitored by microscopic examination and
the vortexing continued until no intact oocysts, sporocysts
or sporozoites could be seen. After three rounds of freeze-
thawing, the oocyst lysate was centrifuged at 14 000 £ g and
the supernatant harvested and sonicated for three bursts of 20
s at 10 mm amplitude. The concentration of solubilised
protein was determined by spectrophotometry and lysates
stored at 2708C. Proteins were analysed by SDS-PAGE elec-
trophoresis and Western blotting. Brie¯y, samples contain-
ing 500 ng protein were boiled in SDS-PAGE sample buffer
[19] containing 1 mM dithiothreitol (DTT). Proteins were
separated on 10% SDS-PAGE minigels and transferred to
nitrocellulose ®lters by semi-dry electroblotting. Non-speci-
®c binding sites were blocked by incubation for 1 h in 5% w/v
milk powder in PBS then ®lters were probed with rabbit
antisera against E. tenella microneme proteins followed by
goat anti-rabbit IgG conjugated to alkaline phosphatase.
Antigen-antibody interactions were visualised by incubation
in nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl-
phosphate, as described previously [20].
2.4. Recovery of RNA from oocysts
Oocysts (2.5 £ 107) were suspended in 200 ml RNAse-
free water in a 1.5 ml eppendorf tube and 200 ml of sterilised
#8 glass ballotini beads were added. After oocyst breakage,
as described above, the supernatant was harvested and RNA
extracted using a detergent-based total RNA extraction kit
(PureScript, Gentra Systems, supplied by Flowgen) accord-
ing to the manufacturer's instructions. Residual DNA in the
preparation was removed by adding 4 U RNAse-free
DNAse (Invitrogen) for each 1 mg of RNA and incubating
at 378C for 10 min. DNAse was inactivated by incubation at
658C for 5 min and the RNA stored at 2708C in diethylpyr-
ocarbonate-treated water until use.
2.5. Reverse transcription-polymerase chain reaction (RT-
PCR)
Messenger RNAs speci®c for microneme genes EtMIC1±
5, were ampli®ed from total RNA preparations by RT-PCR.
Reverse transcriptions to produce ®rst strand cDNAs were
done from 8 mg samples of total RNA using random hexa-
nucleotide primers and Moloney murine leukaemic virus
reverse transcriptase in a ProSTARe kit (Stratagene).
Mock ®rst strand syntheses were also carried out in which
reverse transcriptase was omitted. All ®rst strand reactions
were used in polymerase chain reaction (PCR) ampli®ca-
tions with oligonucleotides speci®c for individual micro-
neme genes and for EtACTIN. The primers and predicted
sizes of products are shown in Table 1.
2.6. Pulsed ®eld gel electrophoresis and Southern blotting
Chromosomal DNA was prepared from sporozoites of E.
tenella in agarose blocks as previously described [21] and
loaded into the slots of 0.6% TBE agarose gels (Seakem ME
or SeaPlaque low melting point agarose, FMC BioProducts)
cast onto 21 cm square glass plates. Electrophoresis was
carried out in a CHEF DR11 cell (Bio-Rad) at 45 V for
®rstly 240 h with a ramped pulse time of 1800±6500 s,
then 48 h with a pulse time of 2500 s and ®nally 30 h
with a pulse time of 300±1700 s. DNA was stained with
ethidium bromide and blotted onto nylon ®lters (Hybond-
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±14991494
N, Amersham) as described previously [21]. DNA frag-
ments excised from pBluescript recombinant plasmids,
and corresponding to the coding regions of microneme
proteins EtMIC1±5, were 32P-labelled by random priming
(Prime-Itw II, Stratagene) and hybridised to ®lters at 658C in
0.5 M sodium phosphate, pH 7.2, 5% SDS. Filters were
washed three times at high stringency (0.1% SDS, 0.1 £standard saline citrate (SSC)) then exposed to X-ray ®lm
(XB-200, X-ograph imaging systems) at 2708C using inten-
sifying screens (Harmer, London).
3. Results
3.1. Synchrony of development and oocyst morphology
during sporulation
It has been reported that oocyst sporulation in eimerians
can be asynchronous [22] such that internal structures show
heterogeneity in their morphological appearance at a single
time point. To investigate the extent of variation in our
system we examined low-power micrographs of oocysts
(Fig. 1) and to get a more detailed picture of oocyst
morphology we also examined high-power micrographs
(Fig. 2). The ®rst time course experiment had sampling
times over a 3 day period and the second covered a narrower
time-span during the critical period in which sporoblasts and
sporozoites matured inside the oocyst. In the ®rst experi-
ment, at 0 h of sporulation the cytoplasm of the sporont in
the majority of oocysts was contracted away from the oocyst
wall and the central position was occupied by the nucleus
(Figs. 1 and 2A). At 6 h, 60% of oocysts looked the same as
at 0 h but for 25% the cytoplasm had constricted further
(Figs. 1 and 2A), suggesting that nuclear divisions were
complete [23] and a further 15% of oocysts had progressed
to the two sporont stage. By 12 h, blasting to the four cell
stage had occurred in the great majority of the oocysts (Figs.
1 and 2A) but the stage of development varied with 20%
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499 1495
Fig. 1. Morphology of oocysts during sporulation. Oocysts were removed at various times, pelleted by centrifugation, surface-sterilised with sodium
hypochlorite and stored in 1mM sodium dithionite at 48C. Oocysts from each sampling point were wet-mounted onto glass slides in 90% glycerol and viewed
at 400 £ magni®cation by differential interference microscopy.
Table 1
Oligonucleotide primers used for the ampli®cation of microneme-speci®c products in RT-PCR analysis, including primer sequence and predicted size of
products
Gene Primers Sequence (5 0±3 0) Product size (bp)
EtMIC1 Mic23 TTGGTCATGACTGACGGC 1100
Tsp5D GTGCAAGCTTAGCATGGAACTTCATTGCATC
EtMIC2 Mic2rr5.1 GAGCGAACGGGACTTCATTG 800
Mic2rr3.1 ACTCTGCTTGAACCTCTTCC
EtMIC3 Mic3g TGTCGCTGTCAATGACCGCTTGAA 500
Mic3b GAGGCCGCGGGGCCAGGCTGTGTA
EtMIC4 Mic4rr5.1 CCACGCCTCTTGTGCCAACA 1200
Mic4rr3.1 GAAGGTGGTGTTGTCGTCGC
EtMIC5 Pjb6 TTCCGTCAGGGCGTTGGATAC 400
Pjb7 ACTTCGTAGGCCGAAGGGCTG
EtACTIN Act1 CTGTGAGAAGAACCGGGTGCTCTTC 350
Act8rr CGTGCGAAAATGCCGGACGAAGAG
being at the `pyramid stage' and 80% having sporoblasts in
their ®nal shape. By 24 h, four sporocysts, each containing
two apparently mature sporozoites, were clearly visible
within the oocysts (Figs. 1 and 2A) and no further morpho-
logical changes were seen at 36, 60 and 72 h (Figs. 1 and
2A). Thus, whilst we observed some variation in the degree
of cytoplasmic contraction at 0 h and considerable hetero-
geneity in the rate of development to the two-cell stage at 6
h, a good degree of synchrony was achieved by 12 h and
maintained throughout the rest of the sporulation period.
Overall, around 10% of the oocysts remained completely
unsporulated and 90% proceeded to full sporulation by 24
h. This is very similar to the degree of synchrony previously
reported during sporulation of E. tenella [24]. To examine
more closely the morphological changes that occurred
during sporocyst and sporozoite formation, the second
time course experiment was carried out with samples
removed between 13 and 29.5 h. In this experiment, a simi-
lar high level of synchrony was seen at all time points under
low power microscopy (data not shown). Thus the sporula-
tion of oocysts of E. tenella appeared suf®ciently synchro-
nous with regard to the main events, for utility in a study of
the expression of microneme genes. In terms of morphology
during the second time course experiment, the oocysts at 13
h closely resembled those at 12 h in the ®rst experiment,
with four sporoblasts containing granular material (Fig. 2B).
By 15.5 h, blasts were developing into elliptical shape and
by 18 h these had developed into sporocysts, which did not
contain discernible sporozoites (Fig. 2B). By 22.5 h the
stieda bodies of the sporoblasts were fully formed and
mature sporozoites were clearly visible within the sporo-
cysts (Fig. 2B). The time-scale of morphological events
for the sporulation of E. tenella (Wis) reported in this
study is similar, but not identical, to that reported for
Eimeria maxima [23]. Similar temperatures of incubation
were used for both studies, but the development of E. tenella
during the ®rst 6 h was faster than that of E. maxima. In fact,
E. tenella oocysts at 6 h were at a stage comparable with
those of E. maxima at 11 h of sporulation. The reason for
this difference is not known, but oocysts of E. maxima are
larger than those of E. tenella and are more dif®cult to break
by vortexing with glass balls. Thus, it is possible that
gaseous exchange across the oocyst wall of E. maxima is
less ef®cient than that of E. tenella.
3.2. The appearance of microneme proteins
Lysates were prepared from oocysts harvested throughout
each time course experiments and examined by SDS-PAGE
and Western blotting using antibodies speci®c for ®ve differ-
ent microneme proteins, EtMIC1±5 (Fig. 2). All ®ve proteins
were present in oocysts harvested at 22.5 h of sporulation and
at all later times. EtMIC4 was detected, very faintly, at 6 and
12 h in the ®rst time course (Fig. 2A) and at 18 h in the second
(Fig. 2B) and EtMIC3 was detected very faintly at 18 h. This
suggests that these proteins may be expressed, at a low level,
at earlier times than the other three microneme proteins that
were examined. From examination of high-power photomi-
crographs, the oocyst morphology at 22.5 h corresponded to
the earliest sampling time at which fully formed sporozoites
could be seen within the sporocysts.
3.3. Chromosomal localisation of genes encoding
microneme proteins
Since there was a high level of synchronicity in the detec-
tion of the ®ve microneme proteins during sporulation, the
chromosomal localisation of genes encoding these proteins
was determined to see whether they are clustered in the
genome (Fig. 3). Probes corresponding to genes EtMIC1±
5 were hybridised to Southern blots of separated chromo-
somes of E. tenella. Each probe hybridised to a single chro-
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±14991496
Fig. 2. Detection of microneme proteins during oocyst sporulation. Oocysts
were broken by mechanical shearing and protein samples (500 mg) exam-
ined by Western blotting using monospeci®c antibodies against microneme
proteins EtMIC1±5. Experiment 1: samples taken from 0±72 h, covering the
whole of a sporulation time course. Experiment 2: samples taken from 13±
29.5 h, during which time sporoblasts and sporozoites mature within the
oocyst.
mosome band and the analysis indicated that EtMIC1 is on
chromosome 12, EtMIC2 on chromosome 9, EtMIC3 on
chromosome 3, EtMIC4 on chromosome 5 and EtMIC5 on
chromosome 9. Thus there is no clustering of genes encod-
ing EtMIC proteins within the genome.
3.4. Expression of microneme-speci®c mRNAs during
sporulation
To determine whether the co-ordination of microneme
protein expression during sporulation is likely to be
controlled at the level of transcription or translation, total
RNA was isolated from oocysts sampled during the time
course experiments and subjected to speci®c RT-PCR reac-
tions (Fig. 4). Before use, RNA preparations were checked
for quality by electrophoresis and quanti®ed by spectropho-
tometry (data not shown). To check that all RT-PCR reac-
tions were working, primers speci®c for the EtACTIN gene,
which is expressed constitutively, were included in each
reaction. Controls lacking RT were set up for each reaction
to ensure that contaminating residual genomic DNA did not
contribute to the PCR signals. No signals were obtained in
any of these RT negative controls (data not shown). Messen-
ger RNAs speci®c for each of EtMIC1±5 were detected in
oocysts from 12 h of sporulation and remained detectable
throughout the remainder of the time course (Fig. 4A,B).
For EtMIC3 and 4, distinct signals were also detected at 6 h
of sporulation (Fig. 4A). These RT-PCR reactions were
carried out several times from batches of RNA prepared
on three separate occasions and the same pattern of
mRNA expression was detected on each occasion. Thus, it
seems that all the microneme speci®c mRNAs are expressed
from the time of sporoblast formation onwards and that
those for EtMIC3 and 4 are switched on a few hours earlier
than those for the remaining genes that were examined.
4. Discussion
For apicomplexan parasites, successful progression
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499 1497
Fig. 3. Chromosomal localisations of EtMIC1±5. Chromosomes of two
strains of E. tenella were separated by pulsed ®eld gel electrophoresis
(PFGE) and stained with ethidium bromide (left panel, lhs, E. tenella
Wey; rhs, E. tenella Wis). Numbers assigned to chromosomes, which
range in size from 1 (chromosome 1) to 7 Mbp (chromosome 14), are
indicated by arrows. The line of origin is at the top of the ®gure and the
PFGE conditions gave separation of the major chromosomes without any
compression zone just below the origin. Chromosomes of E. tenella Wis
and Wey from gels subjected to identical PFGE conditions were transferred
to ®lters and probed with sequences from EtMIC1±5. Probes and their
chromosomal locations are given below the panels; the panel on the right
was probed with both EtMIC4 and 5 and the asterisk denotes hybridisation
due to EtMIC5. The chromosomal locations of EtMIC3±5, which hybri-
dised to bands that contain two chromosomes under the conditions shown,
were con®rmed using gels run under different PFGE conditions (data not
shown). The hybridisation of EtMIC3 to chromosome 9 and EtMIC5 to
chromosome 14 of the Wis strain was not reproducible.
Fig. 4. Detection of microneme-speci®c RNA during oocyst sporulation.
Oocysts were broken by mechanical shearing and total RNA extracted as
described in Section 2. Eight microgram samples of RNA were subjected to
RT-PCR reactions using primers speci®c for EtACTIN and for each EtMIC
gene. Control reactions, in which RT was omitted, were done on all samples
and were negative (data not shown). (A) Experiment 1. (B) Experiment 2.
through the life-cycle is dependent upon the ability of tran-
siently extracellular zoites to rapidly invade host cells
within which they will replicate. In this paper, we have
explored the utility of oocyst sporulation in E. tenella for
examining the expression of genes encoding proteins that
reside in the microneme, a specialised sub-cellular organelle
that is important in the early part of the invasion process.
Dramatic morphological changes occur within the oocyst
during sporulation that culminate in the production of inva-
sive sporozoites. During the time of sporocyst and sporo-
zoite formation, sporulation is highly synchronous and
around 90% of the culture proceeds to full sporulation by
24 h. Thus, samples taken from time-course experiments
should give valuable insights into patterns of speci®c gene
expression during the differentiation process.
From Western blotting it is clear that there is a good degree
of co-ordination in the timing of expression of microneme
proteins. EtMIC4 was detected at low levels from 6 h, and
EtMIC3 detected at low levels from 18 h. However, from
22.5 h onwards, coinciding with the time at which sporozoite
maturation occurred, all ®ve of the microneme proteins
examined were detected strongly. This pattern of expression
is similar to that seen for EtMIC2 and 5 during ®rst genera-
tion schizogony, when the proteins are detected only from the
time at which daughter merozoites are forming [6,11]. Thus,
it appears that expression of microneme proteins is a regu-
lated process and that they are made predominantly during
zoite maturation when, presumably, microneme organelles
are formed. Since there is no clustering of microneme genes
in the E. tenella genome, this regulation is not due to posi-
tional effects.
To determine whether oocyst sporulation time courses are
useful for examining gene expression at the mRNA level, a
series of RT-PCR reactions was carried out. Using primers
for EtACTIN, a single copy gene, a PCR product of the
predicted size was obtained with RNA samples taken
throughout the time-courses, con®rming that this gene is
expressed constitutively. In contrast, mRNAs for EtMIC1±
5 were not detected until 6 or 12 h into sporulation, indicating
that there is regulation of expression between the unsporu-
lated and the sporulating oocyst stages. Whether this
temporal regulation is due to differences in transcription
between the stages, or is due to post-transcriptional effects,
such as differential mRNA turnover, remains to be deter-
mined. Interestingly, mRNAs for EtMIC3 and 4 were
detected earlier than those for EtMIC1, 2 and 5, which corre-
lates with the slightly earlier detection of these two proteins
by Western blotting. For all of the micronemes (MICs),
protein was not detected until some 10±12 h after detection
of speci®c mRNAs, indicating that post-transcriptional
factors are important in the regulation of microneme protein
expression. Whether this is due to post-transcriptional
effects, or differences in mRNA translation during sporula-
tion also remains to be determined.
Overall, this study has shown that the oocyst offers a
convenient, synchronous system for analysing speci®c
products of gene expression during the differentiation of
the invasive sporozoite. A disadvantage of the system may
prove to be the impermeability of the oocyst wall, which
could limit its utility for metabolic labelling and/or inhibitor
studies. However, following sodium hypochlorite and
dimethyl sulphoxide (DMSO) treatment, it has been
reported that labelled nucleotides and amino acids can be
introduced into the oocyst [12]. Therefore, in combination
with speci®c antibodies and DNA sequences, it may be
possible to use the model of oocyst sporulation for more
detailed studies on the transcription, translation and proces-
sing of target proteins.
Acknowledgements
We would like to thank Philip Brown for the EtMIC5
primers and Janene Bumstead and Karen Billington for
technical advice. RR is supported by an IAH research
studentship.
References
[1] Dubremetz JF, Garcia-Reguet N, Conseil V, Fourmaux MN. Apical
organelles and host-cell invasion by Apicomplexa. Int J Parasitol
1998;28:1007±13.
[2] Tomley FM, Soldati DS. Mix and match modules: structure and func-
tion of microneme proteins in apicomplexan parasites. Parasitol
Today 2000, in press.
[3] Carruthers VB, Sibley LD. Mobilization of intracellular calcium
stimulates microneme discharge in Toxoplasma gondii. Mol Micro-
biol 1999;31:421±8.
[4] Bumstead JM, Tomley FM. Induction of secretion and surface
capping of microneme proteins in Eimeria tenella. Mol Biochem
Parasitol 2000;110:311±21.
[5] Entzeroth R, Kerckhoff H, Konig A. Microneme secretion in Cocci-
dia: confocal laser scanning and electron microscope study of Sarco-
cystis muris in cell culture. Eur J Cell Biol 1992;59:405±13.
[6] Tomley FM, Bumstead JM, Billington KJ, Dunn PP. Molecular clon-
ing and characterization of a novel acidic microneme protein (Etmic-
2) from the apicomplexan protozoan parasite, Eimeria tenella. Mol
Biochem Parasitol 1996;79:195±206.
[7] Wan KL, Carruthers VB, Sibley LD, Ajioka JW. Molecular charac-
terisation of an expressed sequence tag locus of Toxoplasma gondii
encoding the micronemal protein MIC2. Mol Biochem Parasitol
1997;84:203±14.
[8] Chobotar B, Scholtyseck E, SeÂnaud J, Ernst JV. A ®ne structural study
of asexual stages of the murine coccidium Eimeria ferrisi Levine and
Ivens 1965. Z Parasitenkd 1975;45:291±306.
[9] Dubremetz JF. Genesis of merozoites in the coccidian, Eimeria neca-
trix. Ultrastructural study. J Protozool 1975;22:71±84.
[10] Dubremetz JF, Elsner YY. Ultrastructural study of schizogony of
Eimeria bovis in cell cultures. J Protozool 1979;26:367±76.
[11] Brown PJ, Billington KJ, Bumstead JM, et al. A microneme protein
from Eimeria tenella with homology to the apple domains of coagu-
lation factor XI and plasma pre-kallikrein. Mol Biochem Parasitol
2000;107:91±102.
[12] Wang CC, Stotish RL. Changes of nucleic acids and proteins in the
oocysts of Eimeria tenella during sporulation. J Protozool
1975;22:438±43.
[13] Sutton CA, Shirley MW, Wisher MH. Characterization of coccidial
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±14991498
proteins by two-dimensional sodium dodecyl sulphate-polyacryla-
mide gel electrophoresis. Parasitology 1989;99:175±87.
[14] Ellis J, Thurlby T. Changes in the messenger RNA population during
sporulation of Eimeria maxima. Parasitology 1991;102:1±8.
[15] Tomley F. Antigenic diversity of the asexual developmental stages of
Eimeria tenella. Parasite Immunol 1994;16:407±13.
[16] Abrahamsen MS, Johnson RR, Clark TG, White MW. Developmental
regulation of an Eimeria bovis mRNA encoding refractile body-asso-
ciated proteins. Mol Biochem Parasitol 1994;68:25±34.
[17] Shirley MW. Eimeria species and strains of chickens. In: Eckert J,
Braun R, Shirley MW, Coudert P, editors. Biotechnology ± guidelines
on techniques in coccidiosis research. Luxembourg: European
Commission, 1995. pp. 1±24.
[18] Tomley F. Techniques for isolation and characterization of apical
organelles from Eimeria tenella sporozoites. Methods 1997;13:171±6.
[19] Laemmli UK. Cleavage of structural proteins during the assembly of
the head of bacteriophage T4. Nature 1970;227:680±5.
[20] Kawazoe U, Tomley FM, Frazier JA. Fractionation and antigenic
characterization of organelles of Eimeria tenella sporozoites. Parasi-
tology 1992;104:1±9.
[21] Shirley MW. The genome of Eimeria tenella: further studies on its
molecular organisation. Parasitol Res 1994;80:366±73.
[22] Ferguson DJ, Birch-Andersen A, Hutchinson WM, Siim JC. Light and
electron microscopy on the sporulation of the oocysts of Eimeria
brunetti. II. Development into the sporocyst and formation of the
sporozoite. Acta Pathol Microbiol Scand B 1978;86:13±24.
[23] Canning EU, Anwar M. Studies on meiotic division in coccidial and
malarial parasites. J Protozool 1968;15:290±8.
[24] Wang CC. Inhibition of the respiration of Eimeria tenella by quino-
lone coccidiostats. Biochem Pharmacol 1976;25:343±9.
R. Ryan et al. / International Journal for Parasitology 30 (2000) 1493±1499 1499