Manolis Kellis modENCODE analysis group January 11, 2007 Part 1: Target identification: comparative...
-
Upload
poppy-holland -
Category
Documents
-
view
221 -
download
0
Transcript of Manolis Kellis modENCODE analysis group January 11, 2007 Part 1: Target identification: comparative...
Manolis KellismodENCODE analysis group
January 11, 2007
Part 1: Target identification: comparative vs. exprmt.
(really the topic for today)
Part 2: Target validation (optional)
Part 3: Motif discovery (optional)
Part 4: Enhancer identification (optional)
Part 1
Identifying targets using
comparative genomics
Evolutionary signatures of motif instances
• Allow for motif movements– Sequencing/alignment errors– Loss, movement, divergence
• Measure branch-length score– Sum evidence along branches– Close species little contribution
BLS: 25% Mef2:YTAWWWWTAR BLS: 83%
Motif confidence selects functional instancesTranscription factor motifs
Confidence
microRNA motifs
Confidence
Increasing BLS Increasing confidence
Confidence selects functional regions
Confidence selects in vivo bound sites
High sensitivity
Confidence selects positive strand
Increasing BLS Increasing confidence
Confidence selects functional regions
Initial regulatory network for an animal genome
• ChIP-grade quality– Similar functional
enrichment– High sens. High spec.
• Systems-level– 81% of Transc. Factors– 86% of microRNAs– 8k + 2k targets– 46k connections
• Lessons learned– Pre- and post- are
correlated (hihi/lolo)– Regulators are heavily
targeted, feedback loop
Network captures literature-supported connections
Network captures co-expression supported edges
Red = co-expressed
Grey = not co-expressed
Named = literature-supported
Bold = literature-supported46% of edges
are supported (P=10-3)
ChIP vs. conservation: similar power / complementary
• Together: best
complementary
• Bound but not conserved: reduced enrichmnt
Selects functional
• All-ChIP vs. All-cons: similar enr.
Similar power
• Cons-only vs. ChIP-all: similar
Additional sites
Part 2
Cool story of miRNA targets
for a new anti-sense miRNA
Surprise: miR-Anti-sense function
• A single miRNA locus transcribed from both strands• Both processed to mature miRNAs: mir-iab-4, miR-iab-4AS (anti-sense)• The two miRNAs show distinct expression domains (mutually exclusive)• The two show distinct Hox targets – another Hox master regulator
Surprise: miR-Anti-sense function
• Mis-expression of mir-iab-4S & AS: altereswings homeotic transform.
• Stronger phenotype for AS miRNA• Sense/anti-sense pairs as general
building blocks for miRNA regulation• 9 new anti-sense miRNAs in mouse
halterewing
wing
haltereSensory bristles
wing
w/bristles
sense Antisense
WT
No
te:
C,D
,E s
ame
mag
nif
icat
ion
Part 3 (optional)
Discovering motifs
Evolutionary signatures for regulatory motifs
• Individual motif instances are preferentially conserved• Measure conservation across entire genome
– Over thousands of motif instances Increased discovery power– Couple to rapid enumeration and rapid string search
De novo discovery of regulatory motifs
Known
engrailed
site
(footprint)
D.mel
D. ere
D. ana
D. pse.
5’-UTR 3’-UTR
D.mel CAGCT--AGCC-AACTCTCTAATTAGCGACTAAGTC-CAAGTCD.sim CAGCT--AGCC-AACTCTCTAATTAGCGACTAAGTC-CAAGTCD.sec CAGCT--AGCC-AACTCTCTAATTAGCGACTAAGTC-CAAGTCD.yak CAGC--TAGCC-AACTCTCTAATTAGCGACTAAGTC-CAAGTCD.ere CAGCGGTCGCCAAACTCTCTAATTAGCGACCAAGTC-CAAGTCD.ana CACTAGTTCCTAGGCACTCTAATTAGCAAGTTAGTCTCTAGAG ** * * *********** * **** * **
Consensus MCS Matches to known Expression enrichment Promoters Enhancers
1 CTAATTAAA 65.6 engrailed (en) 25.4 2
2 TTKCAATTAA 57.3 reversed-polarity (repo) 5.8 4.2
3 WATTRATTK 54.9 araucan (ara) 11.7 2.6
4 AAATTTATGCK 54.4 paired (prd) 4.5 16.5
5 GCAATAAA 51 ventral veins lacking (vvl) 13.2 0.3
6 DTAATTTRYNR 46.7 Ultrabithorax (Ubx) 16 3.3
7 TGATTAAT 45.7 apterous (ap) 7.1 1.7
8 YMATTAAAA 43.1 abdominal A (abd-A) 7 2.2
9 AAACNNGTT 41.2 20.1 4.3
10 RATTKAATT 40 3.9 0.7
11 GCACGTGT 39.5 fushi tarazu (ftz) 17.9
12 AACASCTG 38.8 broad-Z3 (br-Z3) 10.7
13 AATTRMATTA 38.2 19.5 1.2
14 TATGCWAAT 37.8 5.8 2
15 TAATTATG 37.5 Antennapedia (Antp) 14.1 5.4
16 CATNAATCA 36.9 1.8 1.7
17 TTACATAA 36.9 5.4
18 RTAAATCAA 36.3 3.2 2.8
19 AATKNMATTT 36 3.6 0
20 ATGTCAAHT 35.6 2.4 4.6
21 ATAAAYAAA 35.5 57.2 -0.5
22 YYAATCAAA 33.9 5.3 0.6
23 WTTTTATG 33.8 Abdominal B (Abd-B) 6.3 6
24 TTTYMATTA 33.6 extradenticle (exd) 6.7 1.7
25 TGTMAATA 33.2 8.9 1.6
26 TAAYGAG 33.1 4.7 2.7
27 AAAKTGA 32.9 7.6 0.3
28 AAANNAAA 32.9 449.7 0.8
29 RTAAWTTAT 32.9 gooseberry-neuro (gsb-n) 11 0.8
30 TTATTTAYR 32.9 Deformed (Dfd) 30.7
Power of evolutionary signatures for motif discovery
Ability to discover full dictionary of regulatory motifs de novo
Tissue-specific enrichment and clustering
• Infer candidate functions for novel motifs• Reveal ‘modules’ of co-operating motifs
Functional clusters emerge
Discovered motifs show positional biases
• May represent new core promoter elements• Show enrichment in distinct functional categories
Recognizing functional motifs in coding regions
• Challenge: – Overlapping selective pressures– Most ‘motifs’ from di-codon biases– Hundreds of motifs due to noise
• Solution: – Test each frame offset separately– Di-codon biases Frame biased– True motifs Frame unbiased
• Result: – Top 20 motifs 11 miRNA seeds– (before: 11 seeds in 200+ motifs)
miRNAs
Top motifs
Ability to distinguish overlapping pressures
Evidence of miRNA targeting in coding reg.
miRNA targeting in protein-coding regions
• MicroRNA seeds are specifically selected
• Coding & 3’UTRs show same conservation profile
Part 4 (optional)
Characterizing enhancers
Developmental enhancer identification in Drosophila
• Supported by tiling arrays and regulatory motifs (nucleotide resolution)
• Identify nearly all known enhancers (20 of 22 highly bound)
Bound in vivo. Conserved D/Tw/Sn motifs in 12 flies. Clear DV expression pattern (lacZ/end).
• Large number of novel enhancers (428 Dorsal/Twi/Sna). They validate!
Surprise 1: AP genes targeted by DV regulators
• Novel DorsoVentral enhancers in known AntPosterior genes– Bound in vivo by DV genes (by all three DV master regulators)– Show evolutionarily conserved motifs for all three DV factors– Yet, found in known AP genes, with clear AP expression patterns
Integration of DV and AP patterning networks
Surprise 2: Some silent genes show Pol II binding
• Distinct modes of Pol II occupancy– Active genes (27%): Pol II throughout the gene, transcribing– Repressed genes (37%): Pol II simply absent, no expression
• Third class (12%): Pol II found only at the TSS, stalled– Qualitatively different: abundantly bound, but strongly punctate– Genes not expressed: known repressed genes, confirmed by arrays– Enriched in development, neurogenesis, ectoderm, muscle differ.
• Hypothesis: Developmental genes poised for expression– Reminiscent of ‘bivalent’ K4/K27 domains in mammals
Active Repressed Poised
Surprise 3: Master regulators also bind downstream targets
• Abundant feed-forward loops in DV patterning
• Cooperation of master reg. & downstream reg.
Manolis Kellis - modENCODE analysis - summary
• Part 1: Target identification– Comp. vs. Expt: each has unique advantages– Bound & not conserved appear less functional!
• Part 2: Target validation (for anti-sense miRNA)– It’s nice when expected outcome comes true– Need more collaborations for target validation
• Part 3: Motif discovery– Methods for genome-wide motif discovery– Expect increased power in bound regions
• Part 4: Enhancer identification– Many new enhancers – with motifs & validation– AP / DV system cross-talk – expect dense network– PolII stalling: spatial dynamics matter
Who’s actually doing the work
Alex Stark
Collaborators: Targets Sushmita Roy @ UNM
iab-4AS Natascha Bushati, Steve Cohen @ EMBLJulius Brennecke, Greg Hannon @ CSHLCalvin Jan, David Bartel @ Whitehead
Enhancers Julia Zeitlinger, Rick Young @ WhiteheadRobert Zinzen, Mike Levine @ UC Berkeley
PouyaKheradpour
JuliaZeitlinger
Main contributors: