Making GO Annotations For Fungal Genomes A brief overview.

Making GO Annotations For Fungal Genomes

A brief overview

Outline of Topics• Intro

• Overview of Overall Annotation Pipeline

• Introduction to the Gene Ontologies (GO)

• Making GO Annotations

• Submitting GO Annotations

• GO Tool - AmiGO

Intro & Overview of Overall Sequence and

Annotation Pipeline

Karen Christie

Saccharomyces Genome DatabasesStanford University

1.00E+05

1.00E+06

1.00E+07

1.00E+08

1.00E+09

1.00E+10

1.00E+11

1.00E+12

Dec-82Dec-83Dec-84Dec-85Dec-86Dec-87Dec-88Dec-89Dec-90Dec-91Dec-92Dec-93Dec-94Dec-95Dec-96Dec-97Dec-98Dec-99Dec-00Dec-01Dec-02Dec-03Dec-04Dec-05Dec-06

Growth in 2006 Percent of Total3.50 x 1010 nucs 23.2%

Total Nucleotides at GenBank/EMBL/DDBJincluding Whole Genome Shotgun

NCBI created by Congress

Dec 20061.52E+11

WGS section started

EBI created at Hinxton

Saccharomyces cerevisiaeHaemophilus influenzae

Caenorhabditis elegans

Drosophila melanogaster

Mus musculus

Homo sapiens

Fungal Genomes being sequenced at Broad Institute

Fungal Genomes being sequenced by JGI

Published Literature

PubMed: over 15 million citations

Basic search: secondary metabolism → 109580

Limit search:secondary metabolism (published in the last 1 year) → 5440

Boolean operators:secondary metabolism AND Aspergillus → 479

Numbers as of 3/21/2007

Gene Ontology Objectives• GO represents categories used to classify

specific parts of our biological knowledge:– Biological Process– Molecular Function– Cellular Component

• GO develops a common language applicable to any organism

• GO terms can be used to annotate gene products from any species, allowing comparison of information across species

My genome is sequenced!

ATGTCTTTTTTAAGTGCATCGATGTCCTGGGGGCTTAGTATAATGCTCCCCGAGCTTCCTAGCGCTTAGTGCATTAGACTAGGGCCAAAATGACTACTGTTCTTAAAGTACTAGTACTTACTACGCCCTGTTTCTTTCTTCTTCTAAAAGACTAACTAAGTGCTAGTCTAGATCTACTATTACTACCCTACCTACTATACTAGACTAATTACCAACCCCTAGGGTACTAAATTTGCCTAGTTTACGTAGCGTTCTTAAAACGTACTAGATTACCGTACTAGGGACGTACTAAGGTACTAG…

What do I do now?

• Sequence of genes/genome

• Primary Annotation - the location and structure of genes

• Secondary Annotation - the functions of the genes

Overview of Sequencing/Annotation Pipeline

ATGCTTCCTGATTTTGCCCTGGACTTCGCTTGTATAAATTCATTGCACC…

GO process: terrequinone A biosynthesis

GO function: methyltransferase activity

Enzyme Commission: 2.1.1.-alcohol dehydrogenase

Who will be annotating?

• Just you?

• A single group?

• A consortium of groups?

The number of people and groups participating

and the funding will affect some decisions on

whether to set up a database or use flatfiles.

Do you (or your group) have gene calls for your sequence?

yes no

yes

yes

no no

Make automated or manual gene calls

TIGR’s Eukaryotic Annotation course

very useful

Are the protein predictions submitted to GenBank/DDBJ/EMBL?

Submit gene/protein calls to GenBank/DDBJ/EMBL

GOA will make GO annotations (IEA) usingautomated methods

Resources to make functional annotations?

Contact GO Consortium for advice,training, help with coordination, etc.

Set up pipeline for any automated annotationsnot being done by GOA

Manual GO annotationsfrom literature, or fromsequence similarity methods

GOA will collect all GO annotationsand submit them to GOC

You (or your group) collects all GOannotations and submits them to GOC

GOA will maintain annotation file You (or your group) maintains annotation file

UniProtKB contains translationsof all coding regions in GenBank/DDBJ/EMBL

Decide who will collate all GO annotations into one file

Automated Eukaryotic Gene Annotation

Genome Sequence

Repeat masked sequence

Gene finders Database comparisons

Combined consensus prediction

EST based refinement(adjust exons, UTRs, alternative splicing)

Automated Gene Annotation

EST Database

Develop a training set

TwinscanGeneZillaglimmerHMMAugustusFgeneshetc.

AAT_aaAAT_natRNA ScanGMAPSim4etc.

Gene predictions

Repeat masker

Genome alignments

Based on TIGR course

Manual Gene Annotation?

1st Question - Is it in the budget?

Manual annotation can be a lot better

than automated, but is a lot more

expensive and time consuming!

Based on TIGR Eukaryotic Annotation course

Manual Gene Annotation Tools

• Viewer only– Gbrowse

• Editors– Apollo (requires a database)– Manatee (requires a database)– Artemis (runs on flat files)

Based on TIGR Eukaryotic Annotation course

Eukaryotic Gene Annotation

At the end of the procedure, you’ll have:• Gene calls• Protein predictions• Unique IDs for your genes

This last is important. Gene IDs are unambiguous. Gene names are frequently ambiguous. You’ll also need IDs in order to submit GO annotations.

Example:

Gene Name: SP119242 hits in Entrez nucleotide 1 hit

Gene ID: NM_138473

Ready to make Functional Annotations!

• Questions – What’s your budget?– How much literature is available?

• Automated annotations– Faster, cheaper– Often less specific

• Manual annotations– Time consuming & more expensive– Precise and accurate


yes no

yes

yes

no no



very useful

Are the protein predictions submitted to GenBank/DDBJ/EMBL?








Decide who will collate all GO annotations into one fileDecide who will collate all GO annotations into one file

Introduction to GO

Rama Balakrishnan

Saccharomyces Genome Database

Stanford University, CA

A Common Language for Annotation of Genes from

Yeast, Flies and Mice

The Gene Ontologies

…and Plants and Worms

…and Humans

…and anything else!

http://www.geneontology.org/

What’s in a name?

• What is a cell?

Cell

Image from http://microscopy.fsu.edu

What’s in a name?

• The same name can be used to describe different concepts

What’s in a name?

What’s in a name?

• Glucose synthesis• Glucose biosynthesis• Glucose formation• Glucose anabolism• Gluconeogenesis

• All refer to the process of making glucose from simpler components

What’s in a name?

• The same name can be used to describe different concepts

• A concept can be described using different names

Comparison is difficult – in particular across species or across databases

What’s in a name?

• Rad54 (S. cerevisiae)• Okra (D. melanogaster)• Rhp54(S. pombe)

What do these genes products have in common?

ATP dependent helicase involved in DNA recombination, repair

What is the Gene Ontology?

A (part of the) solution: - A controlled vocabulary that can be applied

to all organisms - Used to describe gene products - proteins

and RNA - in any organism

What is Ontology?

• Dictionary: A branch of metaphysics concerned with the nature and relations of being.

• Barry Smith: The science of what is, of the kinds and structures of objects, properties, events, processes and relations in every area

of reality.

1606 1700s

So what does that mean?

From a practical view, ontology is the representation of something we know about. “Ontologies" consist of a

representation of things, that are detectable or directly observable, and the relationships between those things.

Ontology

Includes:

1. A vocabulary of terms (names for concepts)

2. Definitions

3. Defined logical relationships to each other

How does GO work?

• What does the gene product do? – Molecular Function

• Why does it perform these activities? – Process

• Where does it act?– Location in the cell, cellular component

What information might we want to capture about a gene product?

• Molecular Function = elemental activity/task– the tasks performed by individual gene products; examples are

carbohydrate binding and ATPase activity

• Biological Process = biological goal or objective

– broad biological goals, such as mitosis or purine metabolism, that are accomplished by ordered assemblies of molecular functions

• Cellular Component = location or complex– subcellular structures, locations, and macromolecular complexes; examples

include nucleus, telomere, and RNA polymerase II holoenzyme

The 3 Gene Ontologies

Cellular Componentwhere a gene product acts

Molecular Functionactivities or “jobs” of a gene product

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

glucose-6-phosphate isomerase activity

insulin bindinginsulin receptor

activity

drug transporter activity

Molecular Function

• A gene product may have several functions; a function term refers to a single reaction or activity, not a gene product.

• Sets of functions make up a biological process.

Biological Process

cell division

transcription

limb development Courtship behavior

Function (what) Process (why)

Drive nail (into wood) Carpentry

Drive stake (into soil) Gardening

Smash roach Pest Control

Clown’s juggling object Entertainment

Example: Gene Product = hammer

term: gluconeogenesis

id: GO:0006094

definition: The formation of glucose from noncarbohydrate precursors, such as pyruvate, amino acids and glycerol.

Synonym: glucose biosynthesis

What’s in a GO term?

No GO Areas

• GO covers ‘normal’ functions and processes– No pathological processes– No experimental conditions

• NO evolutionary relationships• NO gene products• NOT a system of nomenclature for

genes

Ontology Structure

• The Gene Ontology is structured as a hierarchical directed acyclic graph (DAG)

• Terms can have more than one parent and zero, one or more children

• Terms are linked by two relationships– is-a– part-of

Chromosome

Cytoplasmic chromosome

Mitochondrialchromosome

Plastid chromosome

Nuclear chromosome

A child is a subset or instances of

a parent’s elements

Parent-Child Relationships

One-to-many parental relationshipMany-to-many parental relationship

Each child has only one parent

Each child may have one or more parents

Parent-Child Relationships

DAG: Directed Acyclic Graph

[other organelles]

chromosome

Intracellular organelle

nucleus

nuclear chromosome

cell part

cellular_component

mitochondrial chromosome

[Other types of chromosomes]

is_a

part_of

A Sample DAG

True Path Rule

• The path from a child term all the way up to its top-level parent(s) must always be true

cell cytoplasm

chromosome nuclear chromosome cytoplasmic chromosome mitochondrial chromosome

nucleus nuclear chromosome

is-a

part-of

•Terms become obsolete when they are removed or redefined

•GO IDs are never deleted from the ontologies

•For every obsoleted term, a comment is added to explains why the term is now obsolete

Ensuring Stability in a Dynamic Ontology

Obsolete Cellular ComponentObsolete Molecular Function

Biological Process

Obsolete Biological Process

Molecular FunctionCellular Component

Why modify the GO?

• GO reflects current knowledge of biology

• Biology drives changes to the ontologies

term: MAPKKK cascade (mating sensu Saccharomyces)

goid: GO:0007244

definition: OBSOLETE. MAPKKK cascade involved in transduction of mating pheromone signal, as described in Saccharomyces.

definition_reference: PMID:9561267

comment: This term was made obsolete because it is a gene product specific term. To update annotations, use the biological process term 'signal transduction during conjugation with cellular fusion ; GO:0000750'.

Obsolete terms

definition: MAPKKK cascade involved in transduction of mating pheromone signal, as described in Saccharomyces

• Access gene product functional information

• Do cross species comparison

• Find how much of a proteome is involved in a process/ function/ component

•Provide a link between biological knowledge and …

• gene expression profiles

• proteomics data

What can scientists do with GO?

Whole genome analysis(J. D. Munkvold et al., 2004)

Microarray analysis

Using GO to Aid Microarray Analysis

Orthogonal to existing ontologies to facilitate combinatorial approaches- Share unique identifier space- Include definitions

• Anatomies

• Cell Types

• Sequence Attributes (SO)

• Temporal Attributes

• Phenotypes

• Diseases

• More….

http://obo.sourceforge.net

Beyond GO – Open Biomedical Ontologies

GO Annotations: What are they and how are they made?

Maria Costanzo

Saccharomyces and Candida Genome DatabasesStanford University

Let’s Get Started!

• What is an annotation?• Annotation approaches• Strategies for identifying literature to

annotate• Strategies for reading a paper for

annotation• Strategies for annotating a gene and a

genome

What is a GO annotation?

• A annotation is a piece of information associated with a gene product

• A gene product is usually a protein but can be a functional RNA

• A GO annotation is a Gene Ontology term associated with a gene product

Anatomy of a GO annotation

Gene Product

GO Term

IMP, IGI, IPI, ISS, IDA, IEP, TAS, NAS, ND, RCA, IC, IEA

Evidence Code

Reference

IMP inferred from mutant phenotypeIGI inferred from genetic interactionIPI inferred from physical interactionISS inferred from sequence similarityIDA inferred from direct assayIEP inferred from expression patternIC inferred by curatorTAS traceable author statementNAS non-traceable author statementND no biological data availableIEA inferred from electronic annotation

http://www.geneontology.org/doc/GO.evidence.html

Evidence Codes for GO AnnotationsEvidence Codes for GO Annotations

Additional annotation information

• WITH/FROM: supporting info for the evidence code– IPI, IGI, ISS, IEA, IC– Contains the interacting or similar gene product

• QUALIFIER: describes the GO term– NOT– contributes to (used with Molecular Function terms)– colocalizes with (used with Cellular Component terms)

Approaches for annotation of a genome

1. Automated/Electronic approaches

2. Manual approaches

3. Combinatorial approach

Electronic Annotation

• Generate annotations relatively quickly & cheaply

• Annotation derived without human validation– Sequence similarity, e.g. BLAST search ‘hits’,HMMs, etc.– Mapping file, e.g. interpro2go, ec2go, etc.

• Useful For:– genomes that don’t have extensive literature– groups with limited curatorial resources

Electronic Annotation

• Often based on sequence similarity

• Document the method used in a abstract– unpublished abstract in your own database

– unpublished abstract submitted to GO references collection

• Annotation is not reviewed by human• IEA evidence code

Combinatorial Approach, e.g. using sequence similarity

1. Alignments published in literature

2. Analysis using full length protein

3. Analysis using protein domains

Example IEA Annotations from dictyBase

Example unpublished reference

Manual annotation

• Created by scientific curators• Time intensive• Utilizes

– published literature– sequence comparison data

• Aided by curation tools– Manatee (open source from TIGR)– Apollo (open source from GMOD)– Artemis (open source)

Literature Source1. PubMed

- National Library of Medicine, National Institutes of Health- http://ncbi.nlm.nih.gov

2. Agricola - United States Department of Agriculture, National

Agricultural Library- http://agricola.nal.usda.gov

3. Embase- Elsevier- http://www.embase.com

4. Biosis - Thomson

- http://www.biosis.org5. Unpublished (e.g. for internal sequence analysis methods)

- abstract in your own database- unpublished abstract submitted to GO references

collection

http://dictybase.org/

http://flybase.bio.indiana.edu/

Example Annotation

GO Term

Gene Product

nek2

centrosomeGO:0005813

Reference

PMID: 11956323

Evidence Code

IDAInferred fromDirect Assay

1. Species name

2. Gene/gene product names:daf-12, spo11, Sonic hedgehog

3. Process AND species: embryonic development AND elegans

4. Function AND species:transcription factor AND mays

5. Cellular component AND species (genus):plasma membrane AND Drosophila

What to Search For in Published Literature?

GO Annotation: GMOD Tools for Enhancing Information Retrieval

GMOD – Generic Software Components for Model Organism Databases

- http://www.gmod.org/home

- Literature search tools:PubSearch – http://www.gmod.org/?q=node/44

PubFetch - http://www.gmod.org/?q=node/84

Textpresso – http://www.textpresso.org- full text of articles- semantic categories

http://www.genedb.org/

http://www.sanger.ac.uk/Projects/S_pombe/

http://www.ebi.ac.uk/uniprot/

GO Annotation: Strategies for Identifying Literature for Curation

1. Primary research literature with new experimental data- Mutant phenotypes – process- Activity assays – function- Localization studies – component

2. Computational analyses- Phylogenetic analysis – function (ISS)- Domain analysis

3. Review articles- Summarizes and cites primary literature (TAS)

Which parts of the paper are most important?

• Experimental Results• Results: Figures, Tables, Text• Materials and Methods

• Introductory information• Abstract

• Explanatory text (use with caution)• (Introduction) – mostly TAS information• (Discussion)

Reading papers as curator,rather than as a bench scientist

• Don’t be swayed by the speculations or theories that may appear in the Discussion.

• Focus on the actual results vs. the possible, but not proven, implications of those results.

• Read for details and contact authors if key identifiers are missing.

How to find a GO term to use?

• Web based tools-– AmiGO browser (http://www.godatabase.org)– QuickGO (http://www.ebi.ac.uk/ego/)

• Downloadable tool (https://sourceforge.net/projects/geneontology/)– OBO-Edit (must also download the ontology file)

Extracting Information from a paper

Sample text from PMID: 12374299

In this study, we report the isolation and molecular characterization of the B. napus PERK1 cDNA, that is predicted to encode a novel receptor-like kinase. We have shown that like other plant RLKs, the kinase domain of PERK1 has serine/threonine kinase activity, In addition, the location of a PERK1-GTP fusion protein to the plasma membrane supports the prediction that PERK1 is an integral membrane protein…these kinases have been implicated in early stages of wound response…

Example Manual Annotations from SGD

Annotation from published literature

1. Focus on known genes

2. Identify literature relevant to that genea. using gene names, species name

3. Complete annotation set for a genea. annotate available experimental datab. annotations to root nodes indicate

nothing is known

[other organelles]

chromosome

Intracellular organelle

nucleus

nuclear chromosome

cell part

cellular_component

mitochondrial chromosome

[Other types of chromosomes]

is_a

part_of

Annotating genes to GO terms and the True Path Rule

RAD51 RAD52

The True Path Rule Applied to Annotations

Are all paths to the root true for my gene product?

• Yes, great, annotate

• No?– Is there a term I can use where all paths

will be true– Does the ontology structure need to be

changed?

I don’t see terms in the ontology to describe the biology of my species

• Source Forge (SF) tracker for term related issueshttps://sourceforge.net/projects/geneontology/

• Send an email to the GO mailing list• Content meetings

– Organized by the consortium if the ontology related issues can’t be resolved over email/SF

– Look for announcements on the GO website, mailing lists

http://pamgo.vbi.vt.edu

1. Develop GO terms for functions, processes and structures used by microbes in their associations with plants and animals

• fungi, oomycetes, bacteria, nematodes• 472 terms recently added to GO

2. Create reference genomes by manual annotation of selected microbe genomes

• in progress

3. Training workshops• July 26, 2007. IS-MPMI Workshop, Sorrento,

Italy• August 8-10, 2007. Virginia Bioinformatics

Institute- travel funds available for students and

postdocs

GO Terms needed: Secondary Metabolism

• The fungal community is going to need to add new terms: – secondary metabolism pathways– possibly other areas

• Fungal species so far annotated have not had secondary metabolism pathways, so no terms have been created to represent these areas

• The GO Consortium will be very happy to work with the fungal community to create the needed terms

Contributing GO Annotations

Karen Christie

Saccharomyces Genome DatabasesStanford University


yes no

yes

yes

no no



very useful

Are the gene/protein predictions submitted to GenBank/DDBJ/EMBL?









GOA will maintain annotation file You (or your group) maintains annotation file


Decide who will collate all GO annotations into one fileDecide who will collate all GO annotations into one file


yes no

yes no no

Make automated or manual gene callsAre the protein predictions submitted to GenBank/DDBJ/EMBL?





GOA will maintain annotation file



yes no

yes

yes

no

Make automated or manual gene callsAre the protein predictions submitted to GenBank/DDBJ/EMBL?








You (or your group) maintains annotation file


Decide who will collate all GO annotations into one file

I have my annotations, what next?

DB: Source of the ID in column 2Examples- SGD, MGI, UniProt

Symbol like Brr2, DDX21_HUMAN

that means something to a biologist, not an ID

ID for the gene or gene_productExamples - FBgn0015331, MGI:99240, SPAC9.03c

Object_Type - gene, transcript, protein, protein_structure, or complex, should match the ID

gene_association file - format info at http://www.geneontology.org/GO.annotation.shtml#file

mailto:[email protected]

DB source DB Object ID Object Symbol Qualifier GOID DB:reference Ev_code With/From Aspect DB object Name Synonym Object_type Taxon ID Date Assigned bySGD S000004660 AAC1 GO:0005743 SGD_REF:S000050955|PMID:2167309 TAS C ADP/ATP translocatorYMR056C gene taxon:4932 20010118 SGDSGD S000004660 AAC1 GO:0005471 SGD_REF:S000050955|PMID:2167309 IDA F ADP/ATP translocatorYMR056C gene taxon:4932 20010213 SGDSGD S000004660 AAC1 GO:0006839 SGD_REF:S000050955|PMID:2167309 IGI SGD:S000000126 P ADP/ATP translocatorYMR056C gene taxon:4932 20040226 SGDSGD S000004660 AAC1 GO:0009060 SGD_REF:S000050955|PMID:2167309 IGI SGD:S000000126 P ADP/ATP translocatorYMR056C gene taxon:4932 20040226 SGDSGD S000000289 AAC3 GO:0005743 SGD_REF:S000045889|PMID:2165073 ISS SGD:S000000126|SGD:S000004660C ADP/ATP translocatorYBR085W|ANC3 gene taxon:4932 20040226 SGDSGD S000000289 AAC3 GO:0005471 SGD_REF:S000045889|PMID:2165073 ISS SGD:S000000126|SGD:S000004660F ADP/ATP translocatorYBR085W|ANC3 gene taxon:4932 20040226 SGDSGD S000000289 AAC3 GO:0009061 SGD_REF:S000045889|PMID:2165073 IGI SGD:S000000126 P ADP/ATP translocatorYBR085W|ANC3 gene taxon:4932 20040226 SGDSGD S000000289 AAC3 GO:0009061 SGD_REF:S000052497|PMID:1915842 IGI SGD:S000000126|SGD:S000004660P ADP/ATP translocatorYBR085W|ANC3 gene taxon:4932 20040226 SGDSGD S000000289 AAC3 GO:0009061 SGD_REF:S000045889|PMID:2165073 IEP P ADP/ATP translocatorYBR085W|ANC3 gene taxon:4932 20040226 SGDSGD S000003916 AAD10 GO:0008372 SGD_REF:S000069584 ND C aryl-alcohol dehydrogenase (putative)YJR155W gene taxon:4932 20010119 SGDSGD S000003916 AAD10 GO:0018456 SGD_REF:S000042151|PMID:10572264 ISS F aryl-alcohol dehydrogenase (putative)YJR155W gene taxon:4932 20020902 SGDSGD S000003916 AAD10 GO:0006081 SGD_REF:S000042151|PMID:10572264 ISS P aryl-alcohol dehydrogenase (putative)YJR155W gene taxon:4932 20020902 SGDSGD S000005275 AAD14 GO:0008372 SGD_REF:S000069584 ND C aryl-alcohol dehydrogenase (putative)YNL331C gene taxon:4932 20010119 SGDSGD S000005275 AAD14 GO:0018456 SGD_REF:S000042151|PMID:10572264 ISS F aryl-alcohol dehydrogenase (putative)YNL331C gene taxon:4932 20020902 SGDSGD S000005275 AAD14 GO:0006081 SGD_REF:S000042151|PMID:10572264 ISS P aryl-alcohol dehydrogenase (putative)YNL331C gene taxon:4932 20020902 SGDSGD S000005525 AAD15 GO:0008372 SGD_REF:S000069584 ND C aryl-alcohol dehydrogenase (putative)YOL165C gene taxon:4932 20010119 SGDSGD S000005525 AAD15 GO:0018456 SGD_REF:S000042151|PMID:10572264 ISS F aryl-alcohol dehydrogenase (putative)YOL165C gene taxon:4932 20020902 SGDSGD S000005525 AAD15 GO:0006081 SGD_REF:S000042151|PMID:10572264 ISS P aryl-alcohol dehydrogenase (putative)YOL165C gene taxon:4932 20020902 SGDSGD S000001837 AAD16 GO:0008372 SGD_REF:S000069584 ND C YFL057C gene taxon:4932 20020902 SGDSGD S000001837 AAD16 GO:0018456 SGD_REF:S000042151|PMID:10572264 ISS F YFL057C gene taxon:4932 20020902 SGDSGD S000001837 AAD16 GO:0006081 SGD_REF:S000042151|PMID:10572264 ISS P YFL057C gene taxon:4932 20020902 SGDSGD S000000704 AAD3 GO:0008372 SGD_REF:S000069584 ND C aryl-alcohol dehydrogenase (putative)YCR107W gene taxon:4932 20010119 SGDSGD S000000704 AAD3 GO:0018456 SGD_REF:S000042151|PMID:10572264 ISS F aryl-alcohol dehydrogenase (putative)YCR107W gene taxon:4932 20020902 SGDSGD S000000704 AAD3 GO:0006081 SGD_REF:S000042151|PMID:10572264 ISS P aryl-alcohol dehydrogenase (putative)YCR107W gene taxon:4932 20020902 SGD

These columns may be empty

Sample gene-associations file

What tools/infrastructure do you need to record annotations?

• Excel spread sheet (simple, easy, small scale)

OR

• Database– FileMaker Pro, Access (Simple databases)– ORACLE, Sybase, or MySQL (Relational

databases)

How do I share my gene_associations file?

• Provide them to the larger community by submitting your annotations to the GO project

• What information should I submit to GO?– Gene_association file– Short file with info about submitting group

• Where should I submit the data?– Contact the GOC to establish a contact for your group – [email protected]

Databases contributing annotations include:

– dictyBase (Dictyostelium discoideum) – FlyBase (Drosophila melanogaster) – GeneDB (Schizosaccharomyces pombe, Plasmodium falciparum,

Leishmania major and Trypanosoma brucei) – UniProt Knowledgebase (Swiss-Prot/TrEMBL/PIR-PSD) and InterPro

databases – Gramene (grains, including rice, Oryza) – Mouse Genome Database (MGD) and Gene Expression Database (GXD)

(Mus musculus) – Rat Genome Database (RGD) (Rattus norvegicus)– Reactome– Saccharomyces Genome Database (SGD) (Saccharomyces cerevisiae) – The Arabidopsis Information Resource (TAIR) (Arabidopsis thaliana) – The Institute for Genomic Research (TIGR): databases on several bacterial

species – WormBase (Caenorhabditis elegans) – Zebrafish Information Network (ZFIN): (Danio rerio)

http://www.gramene.org/

http://www.yeastgenome.org/

http://www.arabidopsis.org/

http://www.tigr.org/

http://www.ebi.ac.uk/GOA/proteomes.html


Annotation coverage

Annotation Coverage by Genome

GO Current Annotations

http://www.geneontology.org/GO.current.annotations.shtml

GO Current Annotations: Filtered Files


GO Current Annotations: Unfiltered Files


GOA Proteome Species Specific Files


Resources offered by the GO project

• Website (http://www.geneontology.org)– Lots of documentation– Tools, tutorials and software

• Mailing list ([email protected])• Help email address ([email protected])• GO project on SourceForge

(https://sourceforge.net/projects/geneontology)– Submit suggestions, e.g. new ontology terms, etc.– Download tools, e.g. OBO-Edit

• AmiGO browser (http://amigo.geneontology.org)• GO database

AmiGO Tutorial

Rama Balakrishnan

Saccharomyces Genome Database Stanford University

What is AmiGO?

• Web application that allows you to:

– browse the ontologies

– view annotations from various species

– compare sequences using BLAST (GOst)

AmiGO

http://amigo.geneontology.org

Basic Search

AmiGO Search Results: GO Terms

Term Details Page

Gene Product Details and Annotations

Is_a relationship

Part_of relationship

Leaf node or no children

Node has been opened, can be clicked to closeNode has children, can be clicked to view children

pie chart summary of the numbers of gene products associated to

any immediate descendants of this term in the tree.

Annotations associated with a termAnnotation data are from the gene_associations file submitted by the annotating groups

AmiGO Advanced Search

Filters

BLAST• Blast a protein sequence against all gene products that have a GO

annotation

• Can be accessed from the AmiGO Home page (front page)

BLAST can also be accessed from the annotations section

AmiGO Help

Contact us

• We welcome your input• Please send suggestions, bugs to us• [email protected]

Acknowledgements

The people of the GO Consortium:

Making GO Annotations For Fungal Genomes A brief overview.

Documents

Transcript of Making GO Annotations For Fungal Genomes A brief overview.