Maintenance of Dimer Conformation by the Dengue Virus …jvi.asm.org/content/88/14/7998.full.pdf ·...

Maintenance of Dimer Conformation by the Dengue Virus CoreProtein �4-�4= Helix Pair Is Critical for Nucleocapsid Formation andVirus Production

Pak-Guan Teoh,a,b Zhi-Shun Huang,b Wen-Li Pong,b Po-Chiang Chen,b Huey-Nan Wub

Molecular Cell Biology, Taiwan International Graduate Program, Academia Sinica and Graduate Institute of Life Science, National Defense Medical Center, Taipei, Taiwana;Institute of Molecular Biology, Academia Sinica, Taipei, Taiwanb

ABSTRACT

The virion of dengue virus (DENV) is composed of a viral envelope covering a nucleocapsid formed by a complex of viralgenomic RNA and core protein (CP). DENV CP forms a dimer via the internal �2 and �4 helices of each monomer. Pairing of�2-�2= creates a continuous hydrophobic surface, while the �4-�4= helix pair joins the homodimer via side-chain interactions ofthe inner-edge residues. However, the importance of dimer conformation and the �4 helix of DENV CP in relation to its func-tion are poorly understood. Loss of association between CP and lipid droplets (LDs) due to mutation suggests that the CP hydro-phobic surface was not exposed, offering a possible explanation for the absence of dimers. Further assays suggest the connectionbetween CP folding and protein stability. Attenuation of full-length RNA-derived virus production is associated with CP muta-tion, since no significant defects were detected in virus translation and replication. The in vitro characterization assays furtherhighlighted that the �4-�4= helix pair conformation is critical in preserving the overall �-helical content, thermostability, anddimer formation ability of CP, features correlated with the efficiency of nucleocapsid formation. Addition of Tween 20 improvesin vitro nucleocapsid-like particle formation, suggesting the role of the LD in nucleocapsid formation in vivo. This study pro-vides the first direct link between the �4-�4= helix pair interaction and the CP dimer conformation that is the basis of CP func-tion, particularly in nucleocapsid formation during virion production.

IMPORTANCE

Structure-based mutagenesis study of the dengue virus core protein (CP) reveals that the �4-�4= helix pair is the key to main-taining its dimer conformation, which is the basis of CP function in nucleocapsid formation and virus production. Attenuationof full-length RNA-derived virus production is associated with CP mutation, since no significant defects in virus translation andreplication were detected. In vitro inefficiency and size of nucleocapsid-like particle (NLP) formation offer a possible explana-tion for in vivo virus production inefficiency upon CP mutation. Further, the transition of NLP morphology from an incompletestate to an intact particle shown by �4-�4= helix pair mutants in the presence of a nonionic detergent suggests the regulatory roleof the intracellular lipid droplet (LD) in CP-LD interaction and in promoting nucleocapsid formation. This study provides thefirst direct link between the �4-�4= helix pair interaction and CP dimer conformation that is the fundamental requirement of CPfunction, particularly in nucleocapsid formation during virion production.

Viruses of the Flaviviridae family are enveloped and have amonopartite, linear, and positive-polarity single-stranded

RNA genome. A member of this family in the Flavivirus genus,Dengue virus (DENV), is the most important human arthropod-borne viral pathogen, putting 3 billion people at risk and resultingin 50 million to 100 million infections and around 22,000 deathsannually (1). No specific treatment is available, partly due to a lackof detailed understanding of the virus life cycle. The DENV ge-nome is �11 kb in length and is flanked by 5= and 3= untranslatedregions (UTR) with a 5= cap but no 3= polyadenylated tail. Thegenome encodes a polyprotein that is processed co- and posttrans-lationally by host and viral proteases to generate three structuralproteins, including the core, precursor membrane (prM), and en-velope (E) proteins, and seven nonstructural proteins, NS1,NS2A, NS2B, NS3, NS4A, NS4B, and NS5 (2).

Core protein (CP) is the first translated protein generated bythe polyprotein. A signal peptide at the C terminus of CP facili-tates the translocation of the subsequent prM protein into thelumen of the endoplasmic reticulum (ER) (2). The mature form ofCP (100 amino acids [aa]) is liberated from the ER membrane

upon viral NS2B/NS3 protease cleavage (3, 4). The N-terminalcoding sequence of CP, which overlaps with cis-acting RNA ele-ments, is required for virus replication and translation (5, 6). TheDENV virion is �50 nm in diameter and contains an outer glyco-protein shell that is composed of M and E proteins on the surface,a host-derived lipid bilayer, and the nucleocapsid embeddedwithin (7, 8). The internal nucleocapsid has a relatively poorlyordered structure compared to its external icosahedral glycopro-tein shell (7–9). CP is the building block of the nucleocapsid, andit has been postulated that multiple copies of CP and one copy ofthe RNA genome form one nucleocapsid. The replication and

Received 3 April 2014 Accepted 28 April 2014

Published ahead of print 7 May 2014

Editor: R. M. Sandri-Goldin

Address correspondence to Huey-Nan Wu, [email protected].

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JVI.00940-14

7998 jvi.asm.org Journal of Virology p. 7998 – 8015 July 2014 Volume 88 Number 14

on June 28, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

http://dx.doi.org/10.1128/JVI.00940-14

http://jvi.asm.org

http://jvi.asm.org/

assembly events of DENV occur within the same compartment ofcytoplasmic virus-induced membranous structures (10), and vi-rion assembly appears to occur through the budding of nucleo-capsid into the ER lumen, acquiring the membrane-anchoredprM and E proteins (10).

The structure of flavivirus CP suggests the function of thestructural features (11, 12). The N terminus of DENV CP is un-structured, and the remaining 80% of the protein contains four�-helices (�1 to �4) and forms a dimer in solution (11, 13). TheCP dimer is formed by two pairs of antiparallel helices, �2-�2= and�4-�4=, through extensive hydrophobic interaction (11). Thedimer conformation and surface positive charge distribution ofDENV CP suggest that nucleocapsid assembly occurs throughlipid membrane interaction on the �2-�2= hydrophobic surfaceand genome RNA interaction on the other positively charged sur-face, the �4-�4= surface (11). CP interacts with RNA nonspecifi-cally, and the RNA chaperone activity displayed by flavivirus CPmay play an important role in assisting nucleocapsid formation(14, 15).

The disordered N-terminal region of DENV CP is reportedto be important in virus production (16). Several conservedresidues within the N-terminal region, the �1 helix, the loopbetween the �1 and �2 helices, and the �2 helix are involved inthe interaction between CP and lipid droplets (LDs), likely viaan LD surface protein, perilipin 3 (TIP47) (17, 18). The CP-LDinteraction prompts the conformational rearrangement of theCP dimer and enables access of the �2-�2= hydrophobic sur-face to the LD (17). The DENV CP-LD association is essentialfor virus production (19). These studies (17, 19) have suggestedthat the CP dimer displays a certain degree of plasticity, partic-ularly from the N-terminal region to the �2 region, whereas the�3 and �4 helices do not undergo significant changes uponbinding of the LD at the N-terminal region (17). Structuralpreservation of the �3 and �4 helices might be explained by theextensive hydrophobic interaction among the side chainswithin the inner edge of �4-�4= to stabilize the dimer confor-mation (11). Further, the locations of basic residues on the CPsurface, particularly the �4-�4= surface, were preserved. Col-lectively, all these findings underlined the role played by �4 inmaintaining CP structural integrity to display the features ofbasic and hydrophobic surfaces.

In the present study, we examined the importance of the �4coiled-coil-like structure of DENV CP for the function of nucleo-capsid formation and virion assembly using a structure-basedmutagenesis strategy. In vivo protein stability and in vitro charac-terization experiments suggested that disruption of the �4-�4=helix pair affects protein stability and overall conformation. Ad-ditionally, the unstable �4-�4= helix pair CP mutants were unableto interact with the LD, suggesting that their �2-�2= hydrophobicsurface was not exposed and the formation of the dimer was pre-vented. Attenuation of virus production efficiency upon CP mu-tation appeared to be associated with less-efficient nucleocapsidformation. To our knowledge, this is the first study providing adirect link between the disruption of �4-�4=helix pair interaction,leading to overall protein structural changes, and the impairmentof protein function. Importantly, the study establishes a strongcorrelation between CP dimer conformation and its function asthe building block for the nucleocapsid.

MATERIALS AND METHODSCells and virus. The baby hamster kidney fibroblast cell line BHK-21 wasmaintained in Dulbecco’s modified Eagle’s medium (DMEM) (Invitro-gen) supplemented with 10% heat-inactivated fetal bovine serum (FBS)and 2% penicillin-streptomycin. The Aedes albopictus cell clone C6/36 wasmaintained in RPMI 1640 medium (Invitrogen) supplemented with 10%FBS, 2 mM L-glutamine, 0.1 mM nonessential amino acids, 1 mM sodiumpyruvate, and 2% penicillin-streptomycin. All cells were cultured at 37°C(BHK-21) or 28°C (C6/36) with 5% CO2. DENV-2 strain PL046(GenBank accession number AJ968413.1) was used in this study. In thiswork, a constructed recombinant full-length infectious clone of DENV-2PL046 is referred to as the wild type (WT). For in vivo virus characteriza-tion study, DENV-2 strain 16681 (GenBank accession no. AJ87411.1) wasused.

Plasmids and constructs. Standard molecular biology techniqueswere used. DENV genome RNA was obtained from virus stock using theQIAamp viral RNA minikit (Qiagen). Reverse transcription-PCR (RT-PCR) was carried out to obtain DENV cDNA. Primers used for RT-PCRamplification were designed according to the conserved sequences of pub-lished DENV-2 sequences. The multiple cloning site of Escherichia coli-yeast shuttle vector pRS424 was engineered to become pRS424-LK3,which has unique restriction enzyme sites in the order SacI, BstEII, XmaI,MluI, and ClaI. Different DENV cDNA fragments were cloned into thepRS424-LK3 vector.

DENV cDNA fragment A, containing a SacI site, the SP6 promoter,the coding sequence of DENV nucleotides (nt) 1 to 3206, and a BstEII site,was generated by multiple steps. Construct pRS424-A�, with an in-framedeletion of the prM and E protein coding sequence (DENV nt 462 to2355), was obtained by overlapping PCR from DENV cDNA followed bycloning into the pRS424-LK3 vector. The retention of the N-terminal 2amino acids of the prM protein and the C-terminal 26 amino acids of theE protein allowed the viral polyprotein to retain the correct topologyacross the endoplasmic reticulum for viral polyprotein processing. Con-struct pRS424-A�N, with a NotI site inserted into DENV nt 2355 of con-struct pRS424-A�, was obtained by site-directed mutagenesis (SDM).The DENV prM-E gene was cloned into the NotI site of construct pRS424-A�N to generate construct pRS424-AN. Both NotI sites were then re-moved via SDM, restoring the DENV-2 strain PL046 genome sequence toobtain construct pRS424-A. The extra SacI and BstEII sites within the prMgene were silenced through SDM, retaining the native amino acid resi-dues, to obtain construct pRS424-AdSdB (fragment A).

DENV cDNA fragment B (BstEII site–DENV nt 3196 to 5481–XmaIsite), fragment C (XmaI site–DENV nt 5476 to 8130 –MluI site), andfragment F (MluI site–DENV nt 8125 to 10723–ClaI site) were individu-ally cloned into the pGEM-Teasy vector by TA cloning and then sub-cloned into the pRS424-LK3 vector to generate construct pRS424-B, con-struct pRS424-C, and construct pRS424-F, respectively. ConstructpRS424-Fb was derived from construct pRS424-F by inserting a uniqueBamHI site into nt 10316 of DENV cDNA via SDM. A hepatitis delta viruscis-cleaving ribozyme coding sequence (RzD) was inserted between the 3=terminus of the DENV genome and the unique ClaI site. To generate thereplication-defective mutant (GDDm), the protein sequence of NS5662GDD664 was mutated to 662GAA664. Details of amino acid and nucleo-tide changes upon mutation are listed in Table 1.

To generate a DENV full-length infectious (FL) clone, DNA fragmentsA, B, C, and F from the pRS424-AdSdB, pRS424-B, pRS424-C, andpRS424-F constructs, respectively, were sequentially assembled. CP mu-tants were generated through SDM of construct pRS424-AdSdB, and thechanges in the CP sequence are listed in Table 1. Internal deletion of CP aa26 to 96 (�C, or �26 –96) was created by introducing a new SalI site at nt378 followed by self-ligation with another SalI site at nt 165 to remove theinternal region. The manipulated A fragments were cloned into the WTFL replicon with the aid of SacI and BstEII. The mini-expression cassettefor mature CP is a truncated form of the viral genome that encodes only amature form of CP (DENV-2 nt 97 to 396) and two copies of the hemag-

DENV Core Protein Alpha 4 Helix Pair

July 2014 Volume 88 Number 14 jvi.asm.org 7999


.org/D

ownloaded from

http://www.ncbi.nlm.nih.gov/nuccore?term=AJ968413.1

http://jvi.asm.org

http://jvi.asm.org/

glutinin (HA) tag, flanked by the 5= and 3= untranslated regions (UTRs),DENV-2 nt 1 to 96 and nt 10270 to 10723, respectively. The translation ofHA fusion CP was driven by the native DENV-2 RNA elements on the 5=and 3= terminal regions of the DENV genome. All constructs were clonedand propagated in E. coli strain JM101. Sequences of all clones were vali-dated using primers covering various regions of the DENV genome. Thesequence of the DENV-2 PL046 strain infectious clone has been depositedin GenBank (see below), and the infectious clone is available to qualifiedresearchers upon request.

In vitro RNA synthesis and RNA transfection. Plasmid templates tobe used for in vitro transcription were linearized with ClaI at 37°C over-night. The 5=-capped transcripts were synthesized in vitro from ClaI-lin-earized plasmids using the AmpliCap SP6 High Yield Message Maker kit

(Cellscript) according to the manufacturer’s protocol. The amount oftranscribed RNA was quantified by using a spectrophotometer, and theRNA integrity was examined using formaldehyde-agarose gel (1.5% aga-rose) electrophoresis. A total of 10 �g of FL RNA or 5 �g of mini-CP RNAwith 5 �g of BHK-21 total cell RNA was electroporated into 2 � 106

BHK-21 cells using the Gene Pulser Xcell electroporation system (Bio-Rad) according to the manufacturer’s instructions (140 V, 25 ms, 1 pulse).The transfected cells were resuspended in DMEM with 10% FBS andincubated at 37°C with 5% CO2.

Immunofluorescence assay. Cells grown on glass coverslips werefixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for15 min and washed with PBS. For the lipid droplet association assay, fixedcells were permeated with 0.02% TX-100 for 5 min and washed in PBS.Permeated cells were blocked with 5% bovine serum albumin (BSA) inPBS and incubated with mouse monoclonal anti-HA antibody (1:300)overnight at 4°C. Antibody-labeled cells were examined by using Cy5-conjugated goat anti-mouse IgG (1:400) for 2 h at room temperature.Cells were counterpermeated with 0.1% TX-100 for 5 min before stainingwith Nile Red (1:1,000) for 30 min at room temperature. Alternatively,fixed cells were permeated with 0.1% Triton X-100 (TX-100) for 5 minand a wash in PBS. After blocking with 5% BSA in PBS, cells were incu-bated with rabbit polyclonal anti-NS3 (1:300), mouse monoclonal anti-E(3H5-1) (1:300), mouse monoclonal anti-CP (1:100), or mouse mono-clonal anti-double-stranded RNA (dsRNA) (J2; Biological Research Cen-ter of the Hungarian Academy of Sciences) (1:1,000) antibody for 4 h atroom temperature or overnight at 4°C. Antibody-labeled cells were de-tected by cyanine 5 (Cy5)- or fluorescein isothiocyanate (FITC)-conju-gated goat anti-rabbit or mouse IgG (1:400 for Cy5 and 1:300 for FITC)for 2 h at room temperature. Cells were then stained with 4=,6-diamidino-2-phenylindole (DAPI) prior to PBS washing before mounting. Cells werevisualized using a Zeiss 510 LSM confocal microscope. Stacking of three-dimensional (3D) images and 3D surfaces were generated using Imaris7.6.5 software from multiple continuous sections (0.35 �m/section) fromZ-section analysis. Further, the intensity and volume of CP staining ofeach cell that contained at least 8 LDs were determined, and the LD withinthe cells that had a CP density of staining intensity per volume (voxel) ofat least 65 arbitrary units (AU) was analyzed using Imaris 7.6.5 software toconfirm the CP-LD interaction. Colocalization of CP and LD was ana-lyzed by determining the surface area of LD (%) colocalized with CP.

Western blot analysis. Cell lysate was prepared using passive lysisbuffer (Promega) according to the manufacturer’s protocols. Total pro-tein was resolved by SDS-PAGE. Western transfer to nitrocellulose mem-branes was performed. After blocking with 5% skim milk, the blot wasincubated with mouse monoclonal anti-HA (8G5F) antibody (1:5,000),rabbit polyclonal anti-NS3 antibody (1:5,000), rabbit polyclonal anti-DENV-3 CP antibody (1:1,000), or anti-glyceraldehyde-3-phosphate de-hydrogenase (GAPDH) (1:5,000) followed by horseradish peroxidase(HRP)-conjugated goat anti-mouse or rabbit IgG (1:5,000). The blot wasprocessed for detection with a commercial enhanced chemiluminescence(ECL) detection system. For cycloheximide (CHX) treatment, mini-CPRNA-electroporated BHK-21 cells were divided equally, with 2 � 106 cellswere seeded for each time point and incubated at 37°C. Culture mediumwas replaced with culture medium containing 1 mg/ml of CHX at 4 hposttransfection (hpt). Cell lysates were harvested at the indicated timepoints and subjected to SDS-PAGE for Western detection using mousemonoclonal anti-HA antibody.

Expression and purification of recombinant CP. For recombinantCP purification, a plasmid expressing the mature form of DENV-3 (strainPhilippines/H87/1956) CP was constructed in a modified pET21b vectorin which a stop codon was inserted upstream of the His tag coding se-quence (15). Vectors for the expression of CP mutants were generatedusing site-directed mutagenesis (SDM) (Table 1). CP was expressed in E.coli 41(DE3) cells and purified as described below. Several bacterial colo-nies were precultured in 45 ml of LB broth containing 100 mg/ml ampi-cillin overnight at 37°C. A third of the overnight culture was subcultured

TABLE 1 Mutants and mutated nucleotides of dengue virus CP andNS5

Original fragmentor mutation(s) Nucleotide (amino acid) sequencea

DENV-2 CP �1 187ACAAAGAGA195 (30TKR32)K31A/R32A 187ACggccgcC195 (30TAA32)

DENV-2 CP �2 232CUGUUCAUGGCCCUGGUGGCGUUCCUU258

(46LFMALVAFL54)L46A/L50A/F53A/

L54A

232gcGUUCAUGGCCgcGGUGGCGgcCgcU258

(46AFMAAVAAA54)

DENV-2 CP �2 250GCGUUCCUU258 (52AFL54)F53A/L54A 250GCGgcCgcU258 (52AAA54)

DENV-2 CP �4 328AUCAACGUCUUGAGA342 (78INVLR82)I78S/L81Sb 328ucCAACGUCUcuAGA342 (78SNVSR82)

DENV-2 CP �4 349AGGAAA354 (85RK86)R85A/K86A 349gcGgcA354 (85AA86)

DENV-2 CP �4 370CUG372 (L92)L92S 370ucG372 (S92)

DENV-2 163GUGUCGACU171//373AACgcgUcGAcCAGG387

(23VST25//93NASTR97)�26–96 (�C)c 163GUGUCG168_382AcCAGG387 (23VST25-R97)

DENV-3 CP �1 185GCGAAGUUC193 (30AKR32)K31A/R32A 185GCGgcGgca193 (30AAA32)

DENV-3 CP �4 326AUUAAGGUCUUA337 (78IKVL81)I78S/L81S 326ucUAAGGUCucA337 (78SKVS81)

DENV-3 CP �4 368CUG370 (L92)L92S 368ucG370 (S92)

DENV-2 9547AUCAGUGGAGAUGAUUGUGUU9567

(660ISGDDCV666)NS5 GDDm 9547AUCAGUGGAGcUGcUUGUGUU9567

(660ISGAACV666)a The amino acids encoded by their corresponding nucleotide sequence are shown inparentheses. The bottom line for each pair of sequences represents the coding andamino acid sequence after mutation. The mutated nucleotides are shown in lowercase,and the mutated amino acids are underlined. The superscript and subscript numbersrepresent the nucleotide numbers of the DENV genome and the amino acid numbers ofthe DENV CP or NS5 protein, respectively.b An XbaI site (underlined) was introduced into the mutation site by site-directedmutagenesis.c A SalI site was introduced into the WT sequence by site-directed mutagenesis. The SalIsite sequences are underlined. The double slash represents a discontinuous sequence.

Teoh et al.

8000 jvi.asm.org Journal of Virology


.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

to 1.5 liter of culturing medium at 37°C for �3 h until the A600 reached 0.5to 0.7. CP expression was induced by application of 1 mM isopropyl-�-D-thiogalactopyranoside (IPTG) at 37°C for 5.5 h. Bacterial pellets wereharvested by centrifugation and disrupted by using a Microfluidizer inbuffer A (50 mM HEPES, pH 7.9, 1 mM EDTA, 15% sucrose, and 10 mMphenylmethanesulfonyl fluoride [PMSF]). Lysate was then pelleted, andthe supernatant was filtered through a 0.45-�m filter. NaCl was added tothe filtered bacterial cell lysate to a final concentration of 0.4 M NaCl. Aphosphocellulose (PC) column was preequilibrated with 0.4 M NaCl-buffer C (50 mM HEPES, pH 8.0, 1 mM EDTA, and 10% glycerol) beforebacterial cell lysate loading. The PC column was washed with 0.4 M NaCl-buffer C (without urea) followed by 0.4 M NaCl-buffer C with 6 M urea.Multiple washing steps were carried out by washing the column withdecreasing urea concentrations of 4 M, 2 M, and 1 M in 0.4 M NaCl-bufferC. Another two washing steps were conducted using 0.8 M NaCl-buffer Cand 0.9 M NaCl-buffer C in the absence of urea. Purified CP was elutedwith 1.5 M NaCl-buffer C containing no urea. Fractions containing CPwere snap-frozen in liquid nitrogen and stored for further characteriza-tion work. Protein concentrations were determined by Bradford assay.

Size exclusion chromatography. The oligomeric state of CP in solu-tion was analyzed by a Superdex 75 10/300 GL high-performance columnusing an Äkta fast-protein liquid chromatograph (FPLC) system (GEHealthcare) according to the manufacturer’s instructions. A total of 30 �gpurified CP in a 180-�l total volume was applied to the column in buffercontaining 50 mM Tris (pH 7.5) and 0.2 M NaCl at a flow rate of 0.5ml/min. Protein elution profiles at 280 nm UV absorption were recorded.Collected fractions (400 �l/fraction) were applied to nitrocellulose paperby slot blotting. CP was detected using rabbit polyclonal anti-DENV-3 CPantibody and HRP-conjugated anti-rabbit IgG antibody.

Cross-linking of CP. For the cross-linking study, recombinant CP waspurified as described previously (15). For cross-linking of purified pro-tein, a volume of 10 �l containing the purified CP dissolved in 50 mMHEPES, pH 7.9, 0.1 M NaCl, 1 mM EDTA, and 2% glycerol was preincu-bated for 15 min at 25°C. The cross-linking reaction was initiated by theaddition of 2.5 �l glutaraldehyde (electron microscopy grade). After in-cubation for 5 min at 25°C, the reaction was terminated by the addition of2.5 �l of 1 M Tris-HCl (pH 8.0). Samples were subsequently resolved by15% SDS-PAGE and transferred to nitrocellulose paper for Western de-tection using rabbit polyclonal anti-DENV-3 CP antibody.

CD spectroscopy. The circular dichroism (CD) spectrum of CP (10�M) in 5 mM HEPES buffer (pH 7.9), 0.2 M NaCl, and 1% glycerol wasrecorded on an Aviv model 400 CD spectrometer (Aviv Biomedical, Inc.).Measurements were taken in a rectangular quartz cuvette of 2-mm pathlength (AVIV Biomedical, Inc.). Spectra were recorded in the 190- to250-nm-wavelength range with 1-nm-increment intervals at 25°C. Tenscans were performed to obtain the average spectra, and the data weresmoothed for baseline correction using the software provided by the man-ufacturer. Melting curves were recorded at 222 nm from 25°C to 90°Cwith a heating rate of 1°C/min; measurements were obtained at one-de-gree intervals.

Extracellular and intracellular virus preparation. A total of 1 � 106

FL RNA-transfected BHK-21 cells were seeded on 6-cm dishes with 4 mlof 2% FBS DMEM and incubated at 37°C. For cell lysate harvest at 4 hpt,1 � 106 cells/well were seeded in 12-well plates. At 24 hpt, the culture dishwas switched to 30°C for further incubation until 96 hpt. Cultural fluid(CF) of FL RNA-transfected cells was filtered and stored at �80°C. Trans-fected cells were trypsinized and washed twice with PBS via centrifuga-tion. Cell pellets were resuspended in 1 ml complete culture medium andsubjected to multiple freeze-thaw cycles. Cell lysate fluid (CLF) and celldebris were separated by centrifugation at 5,000 � g for 5 min. CollectedCF and CLF were subjected to focus-forming assay (FFA) or plaque assayas described below.

FFA and plaque assay. The 12-well plate was seeded with BHK-21 cellsat a density of 1 � 105 cells per well and incubated overnight at 37°C toproduce a confluent monolayer. The cell monolayers were inoculated

with 100 �l of serially diluted inoculums, CF or CLF. Viral adsorption wascarried out for 2 h at 37°C. Cells were washed with PBS at the conclusionof adsorption, followed by overlaying the monolayer with culture con-taining 2% FBS and 1.2% Avicel RC-591 (FMC BioPolymer). After 72 h ofincubation at 37°C, the overlay medium was removed from the wells andfixed for 15 min in 4% formaldehyde in PBS, followed by PBS washing andblocking with 5% BSA for 1 h at room temperature. Cells were then incu-bated with rabbit polyclonal anti-NS3 antibody (1:300) for 4 h at roomtemperature or overnight at 4°C. Antibody-labeled cells were detected byincubation of the cells for 2 h with Cy3-conjugated goat anti-rabbit IgG(1:300). Fluorescent foci comprising more than 5 cells were counted foreach well, and the viral titers are expressed as fluorescent focus-formingunits (FFU) per �g of electroporated RNA. For plaque assay, an �80%confluent monolayer was cultivated on 6-well plates inoculated with 200�l of serially diluted inoculums as described above. After virus adsorptionfor 2 h at 37°C, cells were washed with PBS, followed by overlaying withculture medium containing 2% FBS and 1% low-melting agarose. After 7days of incubation at 30°C, 10% formaldehyde was added to the well, andthe plate was rocked for at least 4 h until the agarose layer detached fromthe well. The agarose layer was removed, and the cell monolayer wasstained with crystal violet.

Determination of viral growth kinetics. A monolayer of BHK-21 cellsin a 6-well dish was infected with virus at a multiplicity of infection (MOI)of 0.1 and cultured for 96 h in 2 ml of 2% FBS DMEM. Every 12 h, 500 �lof CF was removed and replaced with fresh 2% FBS DMEM. Collected CFwas subjected to titer determination by FFA.

In vitro NLP assembly. Different DENV RNA fragments were synthe-sized in vitro for the nucleocapsid-like particle (NLP) assembly experi-ment. FL RNA corresponds to the full-length DENV genome, which has asize of 10.7 kb; 180 RNA and 374 RNA contain nt 1 to 180 and nt 1 to374 of DENV genome, respectively; �393 RNA contains nt 1 to 393 of theminus sense of the DENV genome; 374/�393 is the preannealed dsRNAof 374 RNA and �393 RNA. Purified DENV-3 CP (1 or 2 �M) wasmixed with RNA (30 ng/�l) in 10 �l reaction buffer containing 10 mMHEPES (pH 7.5), 0.2 M NaCl, and 0% to 0.02% Tween 20 and incubatedat room temperature for 1 h. Reaction mixtures were applied to a 400-mesh Formvar/carbon film nickel grid (Electron Microscopy Sciences)and incubated for 2 min, followed by staining with 2% uranyl acetate(UA) for 45 s. NLP were observed using a Tecnai G2 Spirit Twin electronmicroscope (FEI) and were photographed with a charge-coupled-device(CCD) Camera (Gatan). Several independent experiments were carriedout, and electron micrographs of at least 100 particles were collected fromeach experiment. To assess NLP-forming efficiency, the number of NLPcounted from 20 to 45 2.5-�m2 grid areas was determined. For immuno-gold staining, the grid with NLP was stained with rabbit polyclonal anti-DENV-3 CP antibody (1:150) or rabbit polyclonal anti-NS3 antibody(1:150), followed by application of 12-nm gold particle-conjugated anti-rabbit IgG (1:40) prior to UA staining.

For sucrose gradient centrifugation, the reaction mixture was loadedon top of 5 to 40% discontinuous sucrose gradients and ultracentrifugedat 38,000 rpm for 90 min at 4°C using a SW 41Ti rotor (Beckman). Sucrosesolutions were prepared in TNE buffer (50 mm Tris–HCl, pH 7.5, 0.1 MNaCl, and 0.1 mM EDTA). Fractions of 500 �l (each) were collected fromthe top to the bottom of the gradient, and 50 �l of the fractions weresubjected to immuno-slot blot hybridization to determine the NLP dis-tribution using anti-DENV-3 CP antibody. The remaining fractions(�400 �l) were concentrated using a Vivaspin 500 concentrator (GEHealthcare), followed by electron microscopy (EM) examination.

Virus preparation and characterization. C6/36 cells were inoculatedwith DENV-2 strain 16681 at an MOI of 0.02 and cultured in 2% FBS. CFwere harvested at day 8 postinoculation and replaced with new culturalmedium. At day 16 postinoculation, CF were filtered and subjected to titerdetermination by FFA. Filtered CF was precipitated with 8% polyethyleneglycol (PEG) (molecular mass, 8,000 kDa) and 0.4 M NaCl at 4°C over-night. The mixture was subjected to centrifugation at 10,000 � g at 4°C for




.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

Teoh et al.



.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

30 min. Virus pellet was resuspended in 50 to 120 �l of TNE buffer. Virus(�2 � 106 FFU) was subjected to 0.02% TX-100 treatment or mocktreated for 5 min at 25°C for EM examination. Particles were identified insingle-blinded fashion in at least three independent experiments, andelectron micrographs of at least 50 particles were collected in each exper-iment. Measurement of particle size, the average of perpendicular diam-eters of each particle, was performed for virion-size or nucleocapsid-sizeparticles in multiple fields. Immunogold detection was performed usinganti-E (HB46) monoclonal antibody to identify the particle of virus.

For sedimentation analysis �5 � 106 FFU of virus, with or without0.02% TX-100 treatment, was subjected to 5 to 40% discontinuous su-crose gradient centrifugation as described above. Fractions were collectedfrom the top to the bottom of the gradient, and 20 �l out of 500 �l of thecollected fractions were subjected to immuno-slot blot hybridization us-ing anti-E (4G2) monoclonal antibody. Collected fractions were furtherdiluted to a �12.5% sucrose concentration using TNE buffer, followed bycentrifugation at 100,000 rpm for 2.5 h at 4°C using a TLA 100.2 rotor(Beckman). Pellet was resuspended in 10 �l of TNE buffer, followed byEM examination.

Nucleotide sequence accession number. The sequence of theDENV-2 PL046 strain infectious clone has been deposited in GenBankunder accession number KJ734727.

RESULTSDesign of CP mutants. The structural properties of flavivirus CPare highly conserved, particularly the distribution of chargedamino acids and the internal hydrophobic sequence (Fig. 1A).DENV CP contains four �-helices (�1 to �4) and exists as a dimerin solution (11, 13). The N-terminal region of DENV CP is un-structured, and the remaining 80% of the protein is responsiblefor the formation of homodimers (Fig. 1B, C, and D). The inter-action between the �2 and �4 helices of two monomers in anantiparallel orientation via �2-�2= and �4-�4= interactions is nec-essary for dimerization (11) and ultimately result in exposure ofhydrophobic and basic surfaces. The exposure of these surfaces onthe CP dimer, in addition to the membrane and genomic RNAinteractions, has suggested it functions as the building block of thenucleocapsid. The joining of the �2-�2= helix pair forms a hydro-phobic cleft (Fig. 1B), and the rest of the hydrophobic residues ofCP serve to stabilize the overall protein conformation. Mean-while, the basic residues of CP are scattered on the surface (Fig.1C), and it has been previously shown that the highest density ofpositive charges resides on the �4-�4= surface (11). Although join-ing of �2 from each monomer forms a continuous �2-�2= hydro-phobic surface, the antiparallel homodimer structure is mainly

joined by the side chains of hydrophobic residues I78, L81, I88,L92, and L95 within the inner edge of helix �4 of one monomerwith their counterparts in another monomer to form the �4-�4=coiled-coil-like structure (Fig. 1D) (11).

From the CP dimer structure data, we suspected the �4-�4=helix pair to be the key element of CP structure and function.Apart from stabilizing the dimer conformation through inner-helix �4-�4= conformation, the high basic density on the �4-�4=surface implicates it as the major RNA binding region (11). Toexamine the association of dimer conformation and CP function,several CP mutants were created via site-directed mutagenesis. Inbrief, the first two nucleotides of each codon were modified, leav-ing the third nucleotide unchanged, to create mutants with single,double, or triple codon mutations (Table 1). The conserved hy-drophobic residues I78, L81, and L92 along the �4-�4= inner edgewere replaced with the hydrophilic residue serine to weaken the�4-�4= hydrophobic interaction, resulting in the I78S/L81S/L92S,I78S/L81S, and L92S mutants. To examine the importance of thebasic charge on the �4-�4= surface, the dibasic residues R85 andK86 at the center of the �4-�4= surface were mutated to alanine tocreate an R85A/K86A mutant. The dibasic residues of K31 andR32 on the opposite surface (�1 surface) were mutated to createthe K31A/R32A mutant to determine the importance of these twobasic residues in CP function. Since the �2-�2= hydrophobic sur-face is important for CP-LD interaction and virus production(19), several residues located on the �2-�2= surface were mutatedto alanine to reduce the hydrophobicity, to generate F53A/L54Aand L46A/L50A/F53A/L54A mutants. These identified structuralfeatures of CP were manipulated to gain a better understanding ofCP function.

LD association provides insight into CP conformation. First,we sought to obtain more insight on DENV CP structural featuresin relation to their functions. CP dimer structure revealed a fold inwhich the hydrophobic and basic surfaces were exposed (11). Be-sides possessing membrane association ability (20), the internalhydrophobic region of DENV CP, particularly the surfaces of the�2-�2= helices, has been shown to possess lipid droplet (LD) as-sociation ability (19). In addition to playing an important role invirus production (16), the disordered and basic residue-rich N-terminal region of CP has been reported to bind to the LD, leadingto a local conformation change of some basic residues in the Nterminus and several residues residing in �1, in the loop linking�1 and �2, and in the central hydrophobic region. This confor-

FIG 1 Structural analysis of DENV-2 CP. (A) Alignment of mosquito-borne flavivirus CP sequences. Multiple sequence alignments of CP generated using theBioEdit software program (37) are shown. The �-helical structures �1 to �4 of DENV-2 CP (11) and WNV CP (12) are indicated above and below the amino acidsequences, respectively. The conserved internal hydrophobic region of flavivirus CP is shaded in gray. The conserved residues examined here are underlined.DENV-2, dengue type 2 (a, strain PL046; b, strain 16681); DENV-3, dengue type 3 (strain Philippines/H87/1956); DENV-1, dengue type 1 (strain BR/97-111);DENV-4, dengue type 4 (strain 814669); YFV, yellow fever virus (strain 17D); JEV, Japanese encephalitis virus (strain 826306); KUN, Kunjin (strain MRM61C);WNV, West Nile virus (strain NY99). (B, C, D, and E) Structure of DENV-2 CP. The N-terminal (aa 1 to 20) region of DENV CP is unstructured, while theremaining (aa 21 to 100) residues compose four �-helices (�1, �2, �3, and �4) connected by short loops, resulting in the dimer observed in solution. Contactbetween �2 and �4 of each monomer forming �2-�2= and �4-�4= helix pairs contributes to the antiparallel dimer conformation of DENV CP (11). Side chainsof hydrophobic residues L, V, I, M, P, and F within the structure are highlighted, and residues 46, 50, 53, and 54 are marked in panel B. Side chains of basic residuesR and K within the structure are highlighted, and the basic residues 31, 32, 82, 85, and 86 are marked in panel C. Residues 71 to 100 of the CP dimer show thehydrophobic side-chain interactions that form the �4-�4= interface and the high density of positive charge on the surface of the two edges of �4-�4= dimer. TheR and K side chains are shown in black sticks, while the side chains of the L, V, I, M, and F residues are shown in gray sticks in panel D. The structural view in panelD is a 90° rotation about the horizontal axis of the structures in panels B, C, and E. CP dimer structure and residues, including R5, K6, R9, and R18 in theN-terminal region (not shown), undergo chemical shift perturbations upon interaction with a lipid droplet. Highlighted in panel E are R22, S24, and T25 in �1,G40 in the loop between �1 and �2, and R49, V51, F53, and K54 in �2, which undergo chemical shift perturbation upon interaction with a lipid droplet (17).Labels for dimer subunits are designated by primes (=). N and C represent two termini, and �1, �2, �3, and �4 are four alpha helices. All pictures were reproducedfrom the data under PDB ID code 1R6R using the PyMOL software program.




.org/D

ownloaded from

http://www.ncbi.nlm.nih.gov/nuccore?term=KJ734727

http://jvi.asm.org

http://jvi.asm.org/

mational change ultimately permits the LD access to the �2-�2=hydrophobic region (Fig. 1E) (17).

We exploited the interaction with LDs to gain insight intoDENV CP conformation upon mutation, focusing on evaluatingthe CP-LD association to indicate the exposure of the �2-�2= hy-drophobic surface. The expression of CP was induced using anengineered mini-expression cassette to represent the mature formof CP (1 to 100 aa) in BHK-21 cells (Fig. 2). Since our availableanti-CP antibodies were not suitable for Western detection, twocopies of the HA tag were inserted at the C terminus of CP tocreate an HA fusion CP. The construct is a truncated form of theviral genome that encodes only a HA fusion CP, and the transla-tion was driven by the native DENV-2 RNA elements in the 5= and3= terminal regions of the DENV genome. Detection of intracel-lular mature CP was possible using both anti-CP and anti-HAantibodies. Mutations in DENV-2 CP listed in Table 1 were intro-duced into the mini-HA fusion CP coding sequence through site-directed mutagenesis. To mimic intracellular virus translation, thein vitro-transcribed mini-RNA encoding the HA fusion CP waselectroporated into BHK-21 cells and fixed at 8 h posttransfection(hpt). The designed L46A/L50A/F53A/L54A quadruple �2 mu-tant was used as a non-LD association control. CP staining wasdetected mainly in the nuclear compartment by 0.1% TX-100 per-

meation (not shown). To detect the CP located at the same cyto-plasmic compartment with LD, mild permeation was performed.CP was detected in the cytoplasm under 0.02% TX-100 perme-ation conditions using anti-HA antibody. Additional permeationwas performed with 0.1% TX-100 after antibody probing butprior to Nile Red staining to avoid smearing of the LD stain under0.02% TX-100 permeation. LD association was characterized bycolocalization of the HA signal of CP surrounding or overlappingwith the Nile Red stain of LD.

The interaction between CP and LD was examined in a singleconfocal microscopy plane (Fig. 3, panel 1) and using Z sectioning(0.35 �m/section) (Fig. 3, panel 2). Most of the cytoplasmic LDswere associated with CP, showing their intracellular colocaliza-tions in cells expressing the WT, the K31A/R32A and R85A/K86Amutants, and the �4-�4= helix pair L92S single mutant (Fig. 3,panels 1 and 2). It is likely that these CP mutations retained theintegrity of �2-�2= hydrophobic surface for LD interaction. Sim-ilar LD association was not observed in the I78S/L81S and I78S/L81S/L92S �4-�4= helix pair double and triple mutants, respec-tively (Fig. 3, panels 1 and 2), suggesting that disruption of the�4-�4= helix pair affects the exposure of �2-�2= hydrophobic sur-faces and CP-LD interaction. The F53A/L54A double hydropho-bic mutant retained its LD association ability, while no CP-LD

FIG 2 Constructs used in this study. The mini-expression cassette (Mini) of CP is a truncated form of the viral genome that encodes the mature CP (100 aa) fusedwith two copies of the HA tag at its C terminus. The HA fusion CP coding sequence is flanked by viral 5= and 3=UTRs. The translation was initiated by the genomeRNA elements on the UTRs and its own initiation codon. The full-length infectious clone (FL) was constructed by assembly of different intermediate cDNAfragments (A, B, C, and F) with the aid of unique restriction sites, as indicated (see Materials and Methods for details). An SP6 promoter was placed upstream ofthe 5=UTR to drive in vitro transcription, and a hepatitis delta virus cis-cleaving ribozyme coding sequence (RzD) was inserted at the 3= terminal sequence of thegenome to produce a precise 3= end of synthetic RNA. To mimic the DENV intracellular translation, RNA transcripts were synthesized in vitro from ClaI-linearized plasmids, followed by electroporation.

Teoh et al.



.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

association was observed for the L46A/L50A/F53A/L54A quadru-ple hydrophobic mutant, indicating that these four residues areimportant for LD association (Fig. 3, panels 1 and 2).

To gain a better understanding of the interaction between CPand LD, we next generated 3D images by stacking the continuousZ-sectioned images of Fig. 3, panel 2, to view the HA tag and NileRed signals as surface using the Imaris 7.6.5 software program.Partial sectioning of the CP surface covering the LD surface re-vealed the mode of interaction between CP and the LD (Fig. 3,

panel 3). The 3D images revealed that CP of the WT and theK31A/R32A, R85A/K86A, L92S, and F53A/L54A mutants was dis-tributed in clusters within the cytoplasm, colocalizing with a LDby enveloping it fully or partially, whereas CP of the L46A/L50A/F53A/L54A, I78S/L81S/L92S, and I78S/L81S mutants was dis-persed throughout the cytoplasmic compartment and was locatedproximally to the LD without covering it. To perform objectivequantification of the CP-LD interaction, the CP staining intensityand volume (voxel) of each cell that contained at least 8 LDs were

FIG 3 The lipid droplet (LD) association ability of CP suggests the exposure of the �2-�2= hydrophobic region. CP mini-RNA (5 �g) was electroporated intoBHK-21 cells (2 � 106 cells) and cultured at 37°C with 5% CO2. Approximately 4 � 105 cells were seeded on glass coverslips in 12-well plates and were fixed at8 hpt. Fixed cells were permeated with 0.02% TX-100, followed by probing with mouse monoclonal anti-HA antibody (for CP). After secondary fluoresceinCy5-conjugated goat anti-mouse IgG probing, cells were counterpermeated with 0.1% TX-100 prior to Nile Red staining (for LD). Nuclei were stained with DAPI(blue). Cells were visualized using a Zeiss 510 LSM confocal microscope. Panel 1, colocalization of CP-LD in a single plane; panel 2, stacking of 3D imagesreconstructed from multiple continuous images from Z sectioning (0.35 �m/section); panel 3, 3D surface derived from 3D image of panel 2; sectioning of CPsignal revealed the CP-LD interaction (left) and the original image before undergoing sectioning (right); panels 2 and 3 were generated using the Imaris 7.6.5software; panel 4, CP staining intensity and volume (voxel) of each cell that contains at least 8 LDs were determined, and cells with a CP density of at least 65 AUwere selected to determine the surface area of each LD (%) colocalized with CP using Imaris 7.6.5 software. The average surface area of each LD (%) colocalizedwith CP and the CP density per cell were indicated.




.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

determined using the Imaris 7.6.5 software program. To avoid lowexpression of CP that might affect the evaluation of CP-LD inter-action, cells with a CP density of staining intensity per volume(voxel) of at least 65 arbitrary units (AU) were selected, and all theLD within the cells was analyzed by determining the surface area ofLD (%) colocalized with CP. The surface area of LD in cells ex-pressing CP of the WT and K31A/R32A, R85A/K86A, L92S, andF53A/L54A mutants had more than 50% of CP colocalization,whereas the surface area of LD in cells expressing I78S/L81S/L92S,I78S/L81S, and L46A/L50A/F53A/L54A mutants had less than12% of CP colocalization (Fig. 3, panel 4). The CP-LD associationability suggests that the exposed hydrophobic surface of CP isassociated with its dimer conformation in vivo.

Since mutations of significant residues may affect protein sta-bility, we next examined protein stability in vivo. Mini-expressioncassettes containing full-length and mutant CP RNA was electro-porated into BHK-21 cells, followed by cycloheximide (CHX)treatment 4 h later. Cell lysates were harvested at different timepoints post-CHX treatment, followed by Western blotting withanti-HA antibody. The WT and other CP mutants carrying sub-stitutions for selected dibasic surface residues (K31A/R32A andR85A/K86A) and surface hydrophobic residues (F53A/L54A andL46A/L50A/F53A/L54A) were relatively stable (Fig. 4). Amongthe mutations of the �4 helix pair interacting residues, the singlemutant L92S was relatively stable, while the double (I78S/L81S)and triple (I78S/L81S/L92S) mutants were vulnerable to proteindegradation (Fig. 4). This suggests that the interaction of residuesalong the �4 helix pair correlates with protein stability, and pro-tein instability suggested that CP conformation might be affectedupon mutation. Collectively, these findings pointed out the asso-ciation of protein stability and CP folding.

Dimer conformation and �-helical configuration of CP. Wenext attempted to express and purify recombinant protein. How-ever, relatively low levels of CP expression in E. coli cells made thepurification work unfeasible. Previously, the RNA chaperone ac-

tivity of CP was characterized using purified recombinant CP ofDENV-3 (15). Besides having 70% sequence identity and 80%sequence similarity between DENV-2 and DENV-3 CP (Fig. 1A),the amino acid sequence is conserved across the studied muta-tions. Hence, site-directed mutagenesis was performed to gener-ate several DENV-3 CP mutants (Table 1), and recombinantDENV-3 CP was expressed and purified from E. coli. To charac-terize the impact of mutations on the �4-�4= helix pair inner edgeon protein conformation, the WT and L92S, I78S/L81S, and I78S/L81S/L92S mutant proteins were purified. The dibasic mutants ofK31A/R32A and R85A/K86A CP, which are located at the oppo-site surface from �1 and �4, respectively, were included since theydisplayed LD association abilities and were relatively stable in vivo.The purification of the R85A/K86A mutant, however, was notpossible due to the low expression level (not shown).

Recombinant CP was purified to near-homogeneity (Fig. 5A).To determine the oligomeric state of CP in its native form, sizeexclusion column chromatography was performed. A total of 30�g of purified protein was subjected to column separation, andfractions were collected. After applying the eluate to a nitrocellu-lose filter by slot blotting, CP in each fraction was detected usingthe anti-DENV-3 CP antibody. The chromatograms of elutedprotein showed that each of the WT, K31A/R32A, and L92S CPforms was eluted in the same fraction, confirming that their pro-tein sizes and shapes were similar (Fig. 5B and C). Additionally,these CP proteins were eluted between the reference fractions ofBSA and trypsinogen, suggesting that the WT and the K31A/R32Aand L92S mutants exist in dimer form (Fig. 5B and C). However,I78S/L81S CP and I78S/L81S/L92S CP were detected in almost allthe fractions (Fig. 5C), suggesting that these CP mutants werenonuniform in size. From their elution profile, they may exist invarious conformations ranging from monomers to large aggre-gates.

To verify the oligomeric state of CP, cross-linking was per-formed using purified CP (Fig. 5D). The results suggested thatWT, K31A/R32A, and L92S CP exist primarily as dimers (Fig. 5D).However, the I78S/L81S and I78S/L81S/L92S proteins tended toform large aggregates in the presence of very low concentrations ofcross-linker (Fig. 5D). The dimer conformation appeared to beone of the intermediate forms prior to aggregate formation, whichwas nondetectable using anti-DENV-3 CP antibody (Fig. 5D).The cross-linking and antibody detection profile of the I78S/L81Sand I78S/L81S/L92S forms suggested that their protein conforma-tions varied from those of the WT and the K31A/R32A and L92Smutants, underscoring the importance of the inner-edge hydro-phobic side chains of �4-�4= helix pair for CP dimer formation.

We next examined the structure and thermostability of puri-fied recombinant CP by determining their far-UV circular dichr-oism (CD) spectrum and midpoint of thermal transition (Tm).WT, K31A/R32A, and L92S CP showed double minima at 208 nmand 222 nm, indicating they are �-helical proteins (Fig. 5E). Boththe I78S/L81S and I78S/L81S/L92S mutants lost the double min-ima profile, suggesting the overall folding of the protein waschanged (Fig. 5E). The denaturation curve derived from the ellip-ticity changes at 222 nm upon heating indicated that WT andK31A/R32A CP had a broad thermal transition profile with a mid-point of thermal transition (Tm) above 65°C (Fig. 5F), suggestingthat their �-helical content and protein stability are similar. TheTm of L92S CP was decreased to around 50°C (Fig. 5F). This sug-gested that CP dimer integrity can be affected by a single residue

FIG 4 In vivo stability of CP. CP mini-RNA-transfected cells were treated withcycloheximide (CHX) at 4 hpt and harvested at the indicated time pointspost-CHX treatment. Cell lysate from approximate 4 � 105 cells at each timepoint was subjected to 15% SDS-PAGE and Western detection. CP was probedwith mouse monoclonal anti-HA antibody followed by HRP-conjugated anti-mouse antibody. GAPDH detection served as the loading control. The resultsare representative of at least three independent experiments.

Teoh et al.



.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

change in the inner edge of the �4-�4= helix pair. These findingsfurther confirmed that the pairing of �4 is the key element for CPdimer conformation that appears to be associated with proteinfolding and stability in vivo.

CP mutations attenuate infectious virus production. Themutational analysis indicated that single mutations could dramat-ically alter the conformation of the CP, which led us to examinethe effect of these changes on the virus life cycle. A full-lengthinfectious clone (FL) of DENV-2 strain PL046, the WT, was con-structed (Fig. 2) (see above for the GenBank accession number ofthe FL infectious clone). To examine the role of CP conformationon infectious virus production, the designed mutations were in-troduced into the CP open reading frame (ORF) in the FL context.Transcripts of FL RNA were then electroporated into BHK-21cells to characterize their virus life cycle events. Viral componentsof the E protein, NS3 protein, and dsRNA were detectable in thecytoplasm by immunofluorescence 48 hpt in all but the GDDmreplication-defective NS5 mutant (Fig. 6A). This indicated that FLof WT and all the CP mutants were successfully replicating withinthe cells, since the presence of dsRNA is a hallmark of viral RNAreplication. Further, the presence of dsRNA in in-frame-deletedCP and prM-E replicons (Fig. 6A) indicated that DENV structuralproteins are not required for virus replication.

Virus life cycle events require the orchestration of differentviral components and are highly correlated with viral protein lev-els under replication-dependent translation. Since CP is the firsttranslated protein of the genome, viral protein NS3 detection wasperformed at early time points postelectroporation to examine thetranslation among different FL replicons. Similar NS3 protein lev-els were detected at 4 hpt, indicating that there was no significantdefect in translation efficiency and protein processing amongthese FL replicons (Fig. 6B). The processing of CP in cells was notstudied because our CP antibody was unsuitable for Western de-tection (data not shown).

To investigate the effect of engineered CP mutants in infectiousvirus production, extracellular virus of FL RNA-transfected cellswas determined at 96 hpt by immunofluorescent focus-formingassay (FFA). Extracellular viruses produced by WT and K31A/R32A, R85A/K86A, L92S, and F53A/L54A mutants were detected(Fig. 6C). The virus production efficiency of these CP mutants wasattenuated, although all of them showed no significant defect inpolyprotein processing, translation, and replication. Intracellularviruses were detected in extracellular virus-producing CP mutants(Fig. 6C). No detectable infectious virus was formed in I78S/L81S,I78S/L81S/L92S, and L40A/L50A/F53A/L54A mutants (Fig. 6C),suggesting that these mutations impaired virus production. Theresults observed for the I78S/L81S and I78S/L81S/L92S mutantsunderscore the importance of the �4-�4= helix pair in CP func-tion, while the defect seen in the L40A/L50A/F53A/L54A mutantfurther emphasized the importance of the hydrophobic surface invirus production. The titer of extracellular virus was higher thanthat of intracellular virus, suggesting no significant defect in virusrelease. Since no significant differences were revealed in the testedvirus life cycle events as well as the characterization approachesabove, attenuation of virus production of CP mutants was mostlikely due to modifications of its structure that are essential forvirus production.

Sizes and morphologies of plaques and immunofluorescentfoci were then examined. A significant degree of variability sug-gested that virus production efficiency and infectivity of these vi-

ruses also varied (Fig. 6D). The mutants that formed plaques alsoinduced regional cell death, suggesting that their virus productionand infectivity are relatively more efficient. However, the K31A/R32A and R85A/K86A mutants produced foci but not plaques,suggesting reduced infectivity.

Using our CP antibody, we next examined the localization ofCP, looking for clues to its structural changes. No significant dif-ferences were observed in CP localization among WT, R85A/K86A, and L92S clones (Fig. 6A). Under normal permeation con-ditions, CP was detected within the nucleus, and cytoplasmic CPwas not detected even under mild permeation conditions (notshown). Unfortunately this prevented observation of the interac-tion between the CP and LD in the FL clone. While slight struc-tural changes in CP following amino acid mutation might not berevealed by the above approaches, failure of the antibody to detectany level of CP suggested that the antibody recognition site mightbe altered or completely abolished by mutation. In addition, theimpairment in virus production might correlate with the dimin-ished availability of functional CP for nucleocapsid formation.

To further characterize the FL WT virus, the FL WT RNA-derived virus from BHK-21 cells and DENV-2 PL046 virus wereamplified in C6/36 mosquito cells for 10 days. Harvested culturalfluid (CF) was subjected to BHK-21 cells infection at a multiplicityof infection (MOI) of 0.1 and cultured for 96 h. To determine thegrowth kinetics of both viruses, harvested CF was subjected to FFAevery 12 h for titer determination. The growth curve revealed thatthe growth kinetics of FL WT-derived virus is similar to that ofDENV-2 PL046 (Fig. 6E). Further characterization on immuno-fluorescent detection of viral components (NS3 protein, dsRNA, Eprotein, and CP) (Fig. 6F) and plaque and immunofluorescentfocus morphology determination (Fig. 6G) indicated that theirreplication efficiency and infectivity were similar. Hence, the con-structed FL WT is applicable for further characterization work tostudy DENV-2 PL046.

In vitro assembly of NLP. The nucleocapsid is formed in anear-neutral environment within the cytoplasmic membranouscompartment, and the maturation of the virion occurs along thesecretory pathway for egress in the gradually-reduced-pH envi-ronment (21). It is speculated that nucleocapsid formation re-quires the binding of viral RNA to the basic surface of the CPdimer. To test the RNA binding affinity of the CP mutant, anelectrophoretic mobility shift assay (EMSA) was performed as de-scribed previously (15). No significant difference was observed inthe RNA binding affinities of different CP mutants (not shown).Recombinant DENV-3 CP was then subjected to in vitro nucleo-capsid formation to more closely examine the interaction betweenCP and RNA. Our experiments analyzing the formation of nu-cleocapsid-like particles (NLP) were carried out in the absence ofmembranes, similar to the condition of a previous study ofDENV-2 CP (22).

To determine the specificity and optimal conditions for in vitroassembly, recombinant CP (WT) was reacted with different spe-cies of RNA to permit NLP formation and then examined by elec-tron microscopy (Fig. 7A). CP was able to form NLP with differentlengths of positive-sense DENV RNA, which were 10,723 nt (FLRNA), 180 nt, and 374 nt. Formation of NLP with the nega-tive-sense �393 RNA suggested that DENV CP has no specificitytoward the positive or negative strands of DENV RNA (Fig. 7A).No NLP was detected in the absence of CP, suggesting that CP andRNA are cooperating with each other to form the NLP. To deter-




.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

Teoh et al.



.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

mine NLP formation using dsRNA, the 374 and �393 RNAswere preannealed prior to the in vitro assembly reaction. No NLPwas detected in the presence of dsRNA (Fig. 7A), suggesting thatCP assembles only single-stranded RNA (ssRNA). Further, im-munogold staining was performed to identify the complex com-ponent of the NLP (Fig. 7B). The anti-DENV-3 CP antibody butnot the anti-DENV NS3 antibody recognized the NLP surface,revealing that the NLP contains CP. No NLP was detected in theabsence of RNA, and the DENV-3 CP immunogold signal wasscattered all over the grid (Fig. 7B). This implies that the forma-tion of a CP-only particle is not possible due to the high positivecharge of CP (11).

Since nonionic detergent has been previously reported to im-prove in vitro CP oligomerization (13), Tween 20 was applied toour NLP assembly reaction. Proceeding with in vitro assemblyreactions in the presence of Tween 20, we observed that FL RNAand WT CP, as well as the L92S, I78S/L81S, and I78S/L81S/L92S�4 mutant CPs, were able to form a complete NLP in the presenceof 0.02% Tween 20 (Fig. 7C1 to 7C4, 0.02% Tween 20).

Further, although no significant differences in the NLP mor-phology of WT or L92S CP was observed in the absence or pres-ence of 0.02% Tween 20 (Fig. 7C1 and 7C2), the L92S mutantexhibited attenuated in vivo virus production (Fig. 6C). To com-pare NLP formation efficiency between WT CP and L92S CP, thetotal amounts of NLP within a number of grid areas (NLP/area)were compared. In the absence of Tween 20, the number of NLPformed by the L92S mutant was relatively lower than that for theWT (Fig. 7D). However, in the presence of 0.016% and 0.02%Tween 20, NLP formation efficiency between WT CP and L92S CPas evaluated by NLP/area was similar (Fig. 7D). Although appli-cation of Tween 20 was observed to restore NLP formation effi-ciency for L92S CP, similar efficiency was observed for WT CP inthe absence of Tween 20 (Fig. 7D). This finding underscores thatthe native conformation of WT CP is optimal for NLP formation,whereas L92S CP requires the assistance of Tween 20 to restore itsfunction, suggesting its native conformation is altered.

Interestingly, there was a gradual improvement in NLP forma-tion in the I78S/L81S and I78S/L81S/L92S CP mutants in the pres-ence of Tween 20. More complete NLP were formed in the pres-ence of 0.02% Tween 20, while NLP were incomplete or arrestedin an intermediate form at 0% and 0.016% of Tween 20 (Fig. 7C3and C4). Taken together with the results of the biochemical assaysdemonstrating that both the I78S/L81S and I78S/L81S/L92S CPmutants lost the native CP conformations necessary for both sta-bility and dimer formation (Fig. 4 and 5B to E), this suggests thatNLP formation efficiency is also impacted by the conformation ofCP. Further, electron micrographs of the different stages of NLPformation of I78S/L81S CP and I78S/L81S/L92S CP (Fig. 7C3 andC4) also suggest that Tween 20 is improving in vitro NLP forma-tion, resulting in more intact and uniformly sized NLP. All of theCP characterization work described above provides an explana-

tion for the defect in virion production efficiency exhibited by the�4 mutant CPs. These findings further conclude that �4-�4= he-lix-pair formation is critical for CP function.

The NLP formation ability of WT CP was further characterizedusing short 180 RNA (Fig. 7E). No NLP was detected in theabsence of Tween 20 (not shown). Interestingly, in the presence ofTween 20, the NLP formed by 180 RNA were larger than theNLP formed by FL RNA, with an average diameter of 67.6 17.7nm (average for 198 NLP) and 49.5 11.7 nm (average for 277NLP), respectively. This suggested that genome-length RNA isable to efficiently coordinate the binding of CP and neutralizeCP surface charge, resulting in smaller NLP. WT CP was able toform NLP with FL RNA but not short 180 RNA in the absenceof Tween 20 (Fig. 7C1 and E). This further implied that ge-nome-length RNA is much more efficient in NLP assemblythan short RNA.

Characterization of NLP and envelope-free nucleocapsid. Inorder to gain insight into the property of NLP, in vitro-assembledNLP was subjected to 5 to 40% discontinuous sucrose gradientcentrifugation. Fractions from top to bottom were collected forslot blotting followed by NLP detection using anti-DENV-3 CPantibody. Interestingly, NLP was detected at fraction 20 of thesucrose gradient, which corresponded with the buoyant density of1.15 g/ml in sucrose, with an average size of 51.2 9.4 nm (n �117) (Fig. 8A). Selected fractions 10, 16, and 20 were concentratedusing a Vivaspin 500 concentrator (GE Healthcare). Electronmicroscopy and immunogold detection using anti-DENV-3CP antibody confirmed that the NLP in fraction 20 containedCP (Fig. 8A).

In order to study the nucleocapsid of DENV, PEG-purifiedvirus of DENV-2 strain 16681 was subjected to TX-100 treatmentto remove the viral membrane (23). The virus preparation wastreated with 0.02% TX-100 for 5 min at 25°C and loaded on amesh nickel grid, followed by negative staining. EM of the mock-treated virus showed spherical particles with an average diameterof 49.0 3.4 nm (n � 119), whereas the particles of 0.02% TX-100-treated virus were relatively smaller, with an average diameterof 32.5 2.2 nm (n � 99) (Fig. 8B, top). Envelope-free nucleo-capsid-like particles were recognized by irregular and relativelysmaller particles than the virion. Immunogold staining was per-formed using anti-E (HB46) antibody to identify the observedparticles (Fig. 8B, bottom). However, our CP antibody was un-suitable for immunogold staining to recognize the envelope-freenucleocapsid-like particles or CP-RNA complex under EM.Hence, in vitro assembly using envelope-free nucleocapsid iso-lated from DENV was not performed. No particle was observedfor virus treated with TX-100 for 15 min (not shown), suggestingdissociation of envelope-free nucleocapsid.

To further characterize the property of DENV particles, TX-100-treated virus as mentioned above was subjected to 5 to 40%discontinuous sucrose gradient centrifugation followed by slot

FIG 5 In vitro characterization of recombinant CP from DENV-3. (A) Purified recombinant DENV-3 CP (1.5 �g) resolved by 15% SDS-PAGE and stained withCoomassie blue. (B and C) Chromatogram of purified CP (30 �g) run on a Superdex 75 10/300 GL size exclusion column. Protein elution profiles at 280-nm UVabsorption were recorded, and bovine serum albumin (BSA) (66 kDa), trypsinogen (24 kDa), and lysozyme (14.3 kDa) served as protein molecular massstandards (B). Collected fractions from size exclusion chromatography were blotted on a nitrocellulose membrane, and CP was probed with rabbit polyclonalanti-DENV-3 CP antibody followed by HRP-conjugated anti-rabbit antibody (C). (D) Cross-linking to determine the oligomeric state of purified CP. CP (2 �g)was treated with glutaraldehyde at the indicated concentrations for 5 min at 25°C. Proteins were resolved by 15% SDS-PAGE for Western detection. (E) CP CDspectrum. Spectra were measured with 10 �M purified at 25°C. The observed ellipticity value was plotted against wavelength. (F) CP melting curve. The thermaltransition of purified CP was recorded at 222 nm, and the observed ellipticity value at 222 nm as a function of temperature was plotted.




.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

Teoh et al.



.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

blot hybridization using anti-E (4G2) antibody. A shift of E pro-tein distribution to the top of the gradient indicated the removal ofE protein-anchored viral membrane (Fig. 8C, top). CP distribu-tion in the gradient remained elusive, since our CP antibody wasunsuitable for immunoblot detection. Particles contained in frac-tions 16 and 20, with buoyant densities of 1.11 g/ml and 1.15 g/mlin sucrose, respectively, were pelleted down by sucrose cushioncentrifugation and examined under EM (Fig. 8C, bottom). Viri-on-sized particles were detected in fraction 16 of mock-treatedvirus with an average size of 50.4 4.1 nm (n � 53), and nucleo-capsid-size particles were detected in fraction 20 of TX-100 treatedvirus, with an average size of 37.6 4.8 nm (n � 70). Sedimenta-tion of nucleocapsid-sized particles at a 40% sucrose concentra-tion suggested the presence of envelope-free nucleocapsid infraction 20, since the in vitro-assembled NLP (Fig. 8A) was de-tected in the same sucrose concentration. Further, the two parti-cles share similar morphology. However, the DENV envelope-freenucleocapsid-like particle is relatively smaller than the in vitro-assembled NLP, albeit irregular in shape. Thus, involvement ofother proteins or host factors, which are absent in the in vitroassembly reaction, during in vivo nucleocapsid formation to pro-duce the optimal-size nucleocapsid offers a possible explanationfor the slightly larger size of in vitro-assembled NLP.

DISCUSSION

Truncation studies of flavivirus CP suggested that the protein ex-hibits a certain degree of flexibility in virus production, providedits membrane association and RNA binding abilities are retained(24–28). However, truncations altering the structure of CP ob-scure the precise importance of specific elements of the internalstructure. Therefore, point mutations through base substitutionsoffer an alternative approach to study the role of conservedinternal structural features of CP while preserving the overallprotein conformation. To determine the global influence of the�4-�4= helix pair in CP function and in particular while main-taining the dimerization ability, selected �4-�4= inner-edgeresidues were replaced. To our knowledge, this is the first studythat correlates the �4-�4= helix pair of DENV CP with its func-tion in nucleocapsid formation and virus production. In thisstudy, we found that the C-terminal, �4 region of CP is impor-tant for maintaining the CP dimer conformation that is thebase of CP stability and function.

Structure-based mutagenesis in this study shed light on thefunction of CP structural features in virus production. Mutationof I78, L81, and L92 impaired the CP dimer formation ability and

was found to be associated with the issue of CP integrity. Thisindicates that the inner-edge hydrophobic residues of �4-�4= sig-nificantly contribute to DENV CP dimer formation. The chargedistribution of the DENV CP dimer is not uniform, and the sol-vent-exposed �4-�4= surface has the highest basic charge density(11). In this study, mutation of basic residues K31/R32 and R85/K86 on the surface of �1 and �4, respectively, attenuated virusproduction. Although only 4 out of 52 basic residues within theCP dimer were replaced by nonbasic residues, the reduction invirus production efficiency suggested that these residues are play-ing an important role in coordinating nucleocapsid formation.

Currently, there is no mechanistic explanation describing howCP regulates incorporation of RNA during assembly. The oli-gomerization mechanism of DENV CP, possibly on the basis ofdimerization, has remained elusive since there are no distinctstructures in nucleocapsid organization within an infectious virusparticle (7–9), and no packaging signal in the viral genome hasbeen identified. The RNA binding of CP is electrostatic and non-specific (15). This implies that the CP dimer could bind to eitherpositive or negative strands of genomic RNA during viral replica-tion. The nonspecific RNA binding feature of CP can be overcomeby the microenvironment provided by the membranous compart-ments for virus replication and nucleocapsid formation that areinduced upon virus infection (10). Positive-strand RNA appearedto be relatively more accessible than negative-strand RNA, sincemost of the negative-strand RNA existed in the replicative-inter-mediate form, hybridizing with positive-strand RNA (29). Addi-tionally, our in vitro nucleocapsid formation study showed nointeraction between CP and dsRNA to form a nucleocapsid-likeparticle (NLP) (Fig. 7A), which shed light on the specificity ofcytosolic viral proteins. This suggested that although CP and NS5(the viral RNA-dependent RNA polymerase) are located withinthe same compartments, CP particles are able to avoid competingwith NS5 for the same genome template by discriminating againstthe single-stranded genome for virion assembly from the replica-tive-form (double-stranded) RNA for replication. In this study,the in vitro assembly reaction occurred at pH 7.5, close to theintracellular pH value suitable for nucleocapsid formation. How-ever, no NLP was observed in an acidic pH 6.0 environment (notshown).

Due to the large positive charge on the CP dimer, oligomeriza-tion of CP dimers into a protein-only core is unlikely (11). Wefound no NLP in vitro in the absence of RNA (Fig. 7B). Moreover,the sites of RNA replication and virion assembly are adjacent toeach other in virus-infected cells, implying that the orchestration

FIG 6 Characterization of FL RNA in BHK-21 cells. (A) Immunofluorescence detection of intracellular viral components of FL RNA-electroporated cells at 48h posttransfection. Viral components in infected cells were detected using rabbit polyclonal anti-NS3 antibody, mouse monoclonal dsRNA antibody, mousemonoclonal anti-E antibody, or mouse monoclonal anti-DENV-2 CP antibody. Protein staining was performed with FITC-conjugated goat anti-rabbit antibodyfor NS3 or Cy5-conjugated goat anti-mouse antibody for dsRNA, E, and CP. (B) Translation of transfected FL RNA. Cell lysate from approximately 2 � 105 cellswere prepared at 4 hpt for Western detection of viral NS3 protein expression. GAPDH detection served as the loading control. (C) Extracellular and intracellularvirus production. Viral titers in CF (extracellular fraction) and cell lysate (intracellular fraction) at 96 h post-FL RNA transfection were determined byfocus-forming assay. Viral titers are expressed in FFU/�g of electroporated RNA. Data are a representative result of titer determination in triplicates from onetransfection experiment. (D) Plaque morphology (upper panel) and focus morphology (lower panel) of virus-producing FL RNAs. Collected CF at 96 h post-FLRNA transfection was subjected to plaque assay and focus-forming assay. (E) Growth kinetics of FL WT-derived virus and DENV-2 PL046. A monolayer ofBHK-21 cells in a 6-well dish was infected with virus at an MOI of 0.1 and cultured for 96 h. Titer of virus in cultural fluid (CF) at the indicated periodpostinfection was determined by FFA. The viral titer is expressed in FFU/ml of CF. Data were obtained from average results of titer determination in triplicatesfrom two independent infections. (F) Immunofluorescence detection of intracellular viral components at 24 h post-virus infection in BHK-21 cells. Cells wereinfected with FL WT-derived virus and DENV-2 PL046 at an MOI of 1 for 24 h. Viral components in infected cells were detected by immunofluorescence assay(IFA) as described above. (G) Plaque (upper panel) and focus (lower panel) morphologies of FL WT-derived and DENV-2 PL046 viruses. Collected CF at 96 hpost-virus infection was subjected to plaque assay and focus-forming assay.




.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

Teoh et al.



.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

of events involving genome packaging and RNA replication oc-curred rapidly, since full virions but no intermediate particleswere detected within the ER vesicles (10). However, the in vitro-assembled NLP appeared to be larger than the ordinary DENVenvelope-free nucleocapsid (Fig. 7), suggesting that other cellularor viral components might be necessary for the formation of astandard-sized nucleocapsid in vivo. Hence, the glycoprotein en-velope of the prM-E complex, which has a distinct icosahedralstructure (7–9), might restrict the size of the nucleocapsid to beembedded within the virion. This suggests that the oversized nu-

cleocapsid, which was unable to fit into the envelope shell, mightlead to reduce infectious virion production. It can be further ex-trapolated that encapsidation of a shorter or truncated viral ge-nome into the virion can be prevented, since a standard nucleo-capsid size is required to fit inside the virion. Besides providinginsight into charge neutralization as a suggested mode for nucleo-capsid formation, the in vitro NLP assembly experiment furtherimplies that efficiency and formation of an optimal-sized nucleo-capsid are the important issues during nucleocapsid formation.However, the nucleation events, including the copackaging of

FIG 7 In vitro assembly of nucleocapsid-like particles (NLP). (A) Representative electron micrograph of NLP assembled from wild-type (WT) CP and differentRNAs. The in vitro assembly reaction of WT CP (2 �M) and FL RNA, 180 RNA, 394 RNA, �393 RNA, or 374/�393 dsRNA (30 ng/�l each) was performedin the standard assembly buffer containing 10 mM HEPES (pH 7.5), 0.2 M NaCl, and 0.02% Tween 20. The no-CP control contained FL RNA alone. The gridwas stained with 2% UA. Scale bar, 200 nm. (B) Immunogold staining of in vitro-assembled NLP. The assembly reaction of WT CP (2 �M) plus FL RNA (30 ng/�leach) (top panel) or WT CP (2 �M) alone (bottom panel) was performed in the standard assembly buffer. The grid was probed with rabbit polyclonalanti-DENV-3 CP antibody or rabbit polyclonal anti-DENV NS3 polyclonal antibody and 12-nm gold particle-conjugated anti-rabbit IgG prior to UA staining.Scale bar: 100 nm, top panel; 500 nm, bottom panel. (C1 to C4) Representative electron micrographs of NLP, showing the impact of the nonionic detergentTween 20 and CP �4 mutation on NLP assembly with FL RNA. The assembly reaction of WT CP (C1), L92S CP (C2), I78S/L81S CP (C3), or I78S/L81S/L92S CP(C4) (1 �M each) and FL RNA (30 ng/�l) was performed in the presence of the indicated concentration of Tween 20. Scale bar, 100 nm. (D) Summary of the effectof Tween 20 on NLP assembly of WT CP and L92S mutant CP (1 �M each) with the FL RNA (30 ng/�l). The average value the standard deviation of NLPnumber per grid area (2.5 �m2) and the total number of examined grid areas are shown. (E) Representative images and immunogold staining of NLP formedfrom WT CP (2 �M) with the 180 RNA (30 ng/�l) in the presence of 0.02% Tween 20. Scale bar, 100 nm.

FIG 8 Characterization of NLP and envelope-free nucleocapsid. (A) Analysis of in vitro-assembled NLP by sucrose gradients. The NLP of WT CP and FL RNAwas assembled as described in the legend to Fig. 7 and subjected to 5 to 40% discontinuous sucrose gradient centrifugation. Fractions were collected for slotblotting, followed by NLP detection using anti-DENV-3 CP antibody. Sucrose gradient concentrations with the corresponding fraction numbers are indicated.Concentrated fractions 10, 16, and 20 were subjected to EM and immunogold detection using anti-DENV-3 CP polyclonal antibody followed by 12-nm goldparticle-conjugated anti-rabbit IgG prior to UA staining. The “�” control is the 40% sucrose in TNE buffer, and the “” control is input of assembled NLP. Thebuoyant density for the fractions and average size of total examined particles are indicated. (B) Representative electron micrographs of DENV-2 particle. Toppanel, mock-treated or 0.02% TX-100-treated DENV-2 16681 virus stained by 1% UA average particle size is indicated. Bottom panel, immunogold-stainedmock-treated or 0.02% TX-100-treated DENV-2 16681 virus probed with mouse monoclonal anti-E (HB46) antibody followed by 12-nm gold particle-conjugated anti-mouse IgG prior to UA staining. Scale bar, 50 nm. (C) Analysis of DENV-2 particles by sucrose gradient. Top panel, mock-treated or 0.02%TX-100-treated DENV-2 16681 virus was subjected to 5 to 40% discontinuous sucrose gradient centrifugation followed by slot blot analysis using anti-E (4G2)antibody. The “�” control is 40% sucrose in TNE buffer, and the “” control is DENV. Bottom panel, representative electron micrographs of particles containedin fractions 16 and 20 precipitated down by sucrose cushion centrifugation. The buoyant density and average size of total examined particles are indicated. Scalebar, 50 nm.




.org/D

ownloaded from

http://jvi.asm.org

http://jvi.asm.org/

prM and E proteins during virion assembly, have yet to be deter-mined.

DENV CP is a small basic protein that has nuclear localizationability (30, 31). When CP is liberated from the membrane afterNS2B/NS3 cleavage, initial binding to an LD might serve to retainthe availability of CP in the cytoplasm, although CP tends to belocalized to and retained in the nucleus due to its size and basiccharge-rich feature, respectively (31). Previously, the internal hy-drophobic surface of CP was reported to be important for LDassociation and virus production, whereas the unstructured N-terminal region appears to be important for LD binding and localconformation rearrangement upon LD binding (17, 19). Since nomodification of the N-terminal region was done for all CP mu-tants, the loss of CP-LD interaction in the quadruple hydrophobicmutant (L46A/L50A/F53A/L54A), which includes the two previ-ously reported hydrophobic residues (19), suggested that the ini-tial CP-LD interaction in the N-terminal region is transient andthe interaction on the �2-�2= hydrophobic surface is relativelystable. In addition, CP-LD interaction contributed by the expo-sure of the �2-�2= hydrophobic surface suggested CP exists as adimer in the cell. Further in vitro assays revealed that pairing of �4is the basis for CP folding and stability. So far, no direct evidenceis available to support the notion that the LD plays an importantrole in DENV virion assembly, as shown in hepatitis C virus(HCV) (32–34). Recent reports showing the interaction of theunstructured N terminus and central hydrophobic regions of CPwith LD surface proteins suggest that the LD acts as a scaffold toregulate the availability of CP in the cytoplasmic compartment(17, 18). Hence, it appeared that the impairment of CP-LD asso-ciation ability might be caused by a more global defect duringnucleocapsid formation rather than membrane association or LDtargeting alone (35). Although the exact mechanism is yet unclear,the in vitro experiments showing enhanced NLP formation in thepresence of Tween 20 provide evidence of the importance of non-ionic detergent for in vitro assembly. One possibility is that Tween20 might be mimicking the role of an intracellular LD. This furthersuggests that the LD assists the CP-RNA complex in forming anoptimally sized nucleocapsid that will precisely fit into the core ofthe prM-E complex during virion formation. This adds furthersupport for our conjecture that the CP-LD interaction, and bynecessity the �2-�2= hydrophobic surface, are essential for virusproduction (19).

Collectively, a model for nucleocapsid formation and virionassembly was proposed. Binding of the N-terminal region of CP toLD triggers local conformational rearrangement, exposing theconcave hydrophobic surface for optimal CP-LD interaction. CPbinds to the LD through interaction with the LD surface protein(e.g., perilipin 3, TIP47), leading to a positively charged surface onthe LD (18). The LD regulates the availability of CP for bindingwith positive-sense and single-stranded viral genome RNA re-leased from the replication complex (RC) within the nearby virus-induced vesicles to form the CP-RNA complex. This event hap-pens within the microenvironment of LD and virus-induced ERmembrane-derived vesicles (10) in the cytoplasm. CP might re-cruit more CP to neutralize the viral RNA negative charge, leadingto the collapse of the RNA within the CP-RNA complex. Bindingof RNA to CP on the LD surface during the charge-neutralizingprocess would increase the local phosphate group concentrationon the LD surface, and consequently the gradient molecular equi-librium switch will decrease CP-LD binding, leading to the de-

tachment of the CP-RNA complex from the LD (18). Further,improvement of NLP formation in the presence of a nonionicdetergent, as observed in our in vitro study, suggests a possibleadditional role for LD in vivo of making the CP-RNA complexmore intact and uniform in size. The two membrane-anchoredprM and E proteins aggregate and undergo structural organiza-tion at the luminal site of the ER to form a spherical virion enve-lope. During this process, the membrane-interacting CP-RNAcomplex on the other cytosolic site of the ER became more packedand condensed approaching the lipid bilayer of the ER. Eventu-ally, the CP-RNA complex or nucleocapsid buds into the ER lu-men and is packaged within the virion. Hence, it is suggested thatthe process of CP-RNA complex formation toward producing astable nucleocapsid particle is a rapid and continuous event. Anoptimal-size nucleocapsid will fit into the virion core for infec-tious virion production, or else empty virus-like particles will beproduced. The details describing the nucleocapsid formationmechanism might be revealed when higher-resolution structuresof DENV or flavivirus CP-RNA complex are available. Recently, itwas reported that DENV CP binds specifically to very low densitylipoproteins suggesting the formation of lipoviroparticles, whichmay be a novel step in the DENV life cycle (36). Finally, this studyprovides the first direct link between the �4-�4= helix pair inter-action and the CP dimer conformation that is the basic require-ment of CP function and in particular contribute to nucleocapsidformation during virion production.

ACKNOWLEDGMENTS

We thank C. C. King of the College of Public Health, National TaiwanUniversity, Taiwan, for DENV-2 (strain PL046), Y. L. Yang of the Depart-ment of Biological Science and Technology, National Chiao Tung Uni-versity, Taiwan, for DENV-3 (strain Philippines/H87/1956), the late H. Y.Lei of the College of Medicine, National Cheng-Kung University, Taiwan,for mouse monoclonal anti-DENV-2 CP antibody, S. C. Cheng of theInstitute of Molecular Biology, Academia Sinica, Taiwan, for anti-HAantibody, and H. C. Wu of the Institute of Cellular and Organismic Biol-ogy, Academia Sinica, Taiwan, and H. W. Chen of the National HealthResearch Institute, Taiwan, for the anti-E (4G2) and anti-E (HB46) anti-bodies, respectively. We extend our gratitude for technical assistance withimmunofluorescence analysis and EM offered by the Imaging Core Facil-ity of the Institute of Molecular Biology, Academia Sinica, Taiwan, and toPao-Yin Chiang for CP structure generation. We are grateful to AndreAnaPena and N. Gopal Naik for English editing.

This work was supported by a grant from the Ministry of Science andTechnology, Taiwan, and Academia Sinica, Taiwan.

REFERENCES1. Guzman A, Istúriz RE. 2010. Update on the global spread of dengue. Int.

J. Antimicrob. Agents 36(Suppl 1):S40 –S42. http://dx.doi.org/10.1016/j.ijantimicag.2010.06.018.

2. Mukhopadhyay S, Kuhn RJ, Rossmann MG. 2005. A structural perspec-tive of the flavivirus life cycle. Nat. Rev. Microbiol. 3:13–22. http://dx.doi.org/10.1038/nrmicro1067.

3. Lobigs M. 1993. Flavivirus premembrane protein cleavage and spike het-erodimer secretion require the function of the viral proteinase NS3. Proc.Natl. Acad. Sci. U. S. A. 90:6218 – 6222. http://dx.doi.org/10.1073/pnas.90.13.6218.

4. Amberg SM, Nestorowicz A, McCourt DW, Rice CM. 1994. NS2B-3proteinase-mediated processing in the yellow fever virus structural region:in vitro and in vivo studies. J. Virol. 68:3794 –3802.

5. Alvarez DE, de Lella Ezcurra AL, Fucito S, Gamarnik AV. 2005. Role ofRNA structures present at the 3=UTR of dengue virus on translation, RNAsynthesis, and viral replication. Virology 339:200 –212. http://dx.doi.org/10.1016/j.virol.2005.06.009.

Teoh et al.



.org/D

ownloaded from

http://dx.doi.org/10.1016/j.ijantimicag.2010.06.018

http://dx.doi.org/10.1016/j.ijantimicag.2010.06.018

http://dx.doi.org/10.1038/nrmicro1067

http://dx.doi.org/10.1038/nrmicro1067

http://dx.doi.org/10.1073/pnas.90.13.6218

http://dx.doi.org/10.1073/pnas.90.13.6218

http://dx.doi.org/10.1016/j.virol.2005.06.009


http://jvi.asm.org

http://jvi.asm.org/

6. Clyde K, Barrera J, Harris E. 2008. The capsid-coding region hairpinelement (cHP) is a critical determinant of dengue virus and West Nilevirus RNA synthesis. Virology 379:314 –323. http://dx.doi.org/10.1016/j.virol.2008.06.034.

7. Zhang W, Chipman PR, Corver J, Johnson PR, Zhang Y, Mukhopad-hyay S, Baker TS, Strauss JH, Rossmann MG, Kuhn RJ. 2003. Visual-ization of membrane protein domains by cryo-electron microscopy ofdengue virus. Nat. Struct. Biol. 10:907–912. http://dx.doi.org/10.1038/nsb990.

8. Zhang X, Ge P, Yu X, Brannan JM, Bi G, Zhang Q, Schein S, Zhou ZH.2013. Cryo-EM structure of the mature dengue virus at 3.5-A resolution.Nat. Struct. Mol. Biol. 20:105–110. http://dx.doi.org/10.1038/nsmb.2463.

9. Kuhn RJ, Zhang W, Rossmann MG, Pletnev SV, Corver J, Lenches E,Jones CT, Mukhopadhyay S, Chipman PR, Strauss EG, Baker TS,Strauss JH. 2002. Structure of dengue virus: implications for flavivirusorganization, maturation, and fusion. Cell 108:717–725. http://dx.doi.org/10.1016/S0092-8674(02)00660-8.

10. Welsch S, Miller S, Romero-Brey I, Merz A, Bleck CKE, Walther P,Fuller SD, Antony C, Krijnse-Locker J, Bartenschlager R. 2009. Com-position and three-dimensional architecture of the dengue virus replica-tion and assembly sites. Cell Host Microbe 5:365–375. http://dx.doi.org/10.1016/j.chom.2009.03.007.

11. Ma L, Jones CT, Groesch TD, Kuhn RJ, Post CB. 2004. Solutionstructure of dengue virus capsid protein reveals another fold. Proc. Natl.Acad. Sci. U. S. A. 101:3414 –3419. http://dx.doi.org/10.1073/pnas.0305892101.

12. Dokland T, Walsh M, Mackenzie JM, Khromykh AA, Ee KH, WangS. 2004. West Nile virus core protein: tetramer structure and ribbonformation. Structure 12:1157–1163. http://dx.doi.org/10.1016/j.str.2004.04.024.

13. Jones CT, Ma LX, Burgner JW, Groesch TD, Post CB, Kuhn RT. 2003.Flavivirus capsid is a dimeric alpha-helical protein. J. Virol. 77:7143–7149.http://dx.doi.org/10.1128/JVI.77.12.7143-7149.2003.

14. Ivanyi-Nagy R, Lavergne JP, Gabus C, Ficheux D, Darlix JL. 2008. RNAchaperoning and intrinsic disorder in the core proteins of Flaviviridae.Nucleic Acids Res. 36:712–725. http://dx.doi.org/10.1093/nar/gkm1051.

15. Pong WL, Huang ZS, Teoh PG, Wang CC, Wu HN. 2011. RNA bindingproperty and RNA chaperone activity of dengue virus core protein andother viral RNA-interacting proteins. FEBS Lett. 585:2575–2581. http://dx.doi.org/10.1016/j.febslet.2011.06.038.

16. Samsa MM, Mondotte JA, Caramelo JJ, Garmanik AV. 2011. Uncou-pling cis-acting RNA elements from coding sequences revealed a require-ment of the N-terminal region of dengue virus capsid protein in virusparticle formation. J. Virol. 86:1046 –1058. http://dx.doi.org/10.1128/JVI.05431-11.

17. Martins IC, Gomes-Neto F, Faustino AF, Carvalho FA, Carneiro FA,Bozza PT, Mohana-Borges R, Castanho MARB, Almeida FCL, SantosNC, Da Poian AT. 2012. The disordered N-terminal region of denguevirus capsid protein contains a lipid-droplet-binding motif. Biochem. J.444:405– 415. http://dx.doi.org/10.1042/BJ20112219.

18. Carvalho FA, Carneiro FA, Martins IC, Assunção-Miranda I, FaustinoAF, Pereira RM, Bozza PT, Castanho MARB, Mohana-Borges R, DaPoian AT, Santos C. 2012. Dengue virus capsid protein binding to hepaticlipid droplets (LD) is potassium ion dependent and is mediated by LDsurface proteins. J. Virol. 86:2096 –2108. http://dx.doi.org/10.1128/JVI.06796-11.

19. Samsa MM, Mondotte JA, Iglesias NG, Assunção-Miranda I, Barbosa-Lima G, Da Poian AT, Bozza PT, Gamarnik AV. 2009. Dengue viruscapsid protein usurps lipid droplets for viral particle formation. PLoSPathog. 5:e1000632. http://dx.doi.org/10.1371/journal.ppat.1000632.

20. Markoff L, Falgout B, Chang A. 1997. A conserved internal hydrophobicdomain mediates the stable membrane integration of the dengue viruscapsid protein. Virology 233:105–117. http://dx.doi.org/10.1006/viro.1997.8608.

21. Yu IM, Zhang W, Holdway HA, Li L, Kostyuchenko VA, Chipman PR,

Kuhn RJ, Rossmann MG, Chen J. 2008. Structure of the immaturedengue virus at low pH primes proteolytic maturation. Science 319:1834 –1837. http://dx.doi.org/10.1126/science.1153264.

22. López C, Gil L, Lazo L, Menéndez I, Marcos E, Sánchez J, Valdés I,Falcón V, de la Rosa M, Márquez G, Guillén G, Hermida L. 2009. Invitro assembly of nucleocapsid-like particles from purified recombinantcapsid protein of dengue-2 virus. Arch. Virol. 154:695– 698. http://dx.doi.org/10.1007/s00705-009-0350-8.

23. Kiermayr S, Kofler RM, Mandl CW, Messner P, Heinz FX. 2004.Isolation of capsid protein dimers from the tick-borne encephalitis flavi-virus and in vitro assembly of capsid-like particles. J. Virol. 78:8078 – 8084.http://dx.doi.org/10.1128/JVI.78.15.8078-8084.2004.

24. Kofler RM, Heinz FX, Mandl CW. 2002. Capsid protein C of tick-borneencephalitis virus tolerates large internal deletions and is a favourabletarget for attenuation of virulence. J. Virol. 76:3534 –3543. http://dx.doi.org/10.1128/JVI.76.7.3534-3543.2002.

25. Kofler RM, Leitner A, O’Riordain G, Heinz FX, Mandl CW. 2003.Spontaneous mutations restore the viability of tick-borne encephalitis vi-rus mutants with large deletions in protein C. J. Virol. 77:443– 451. http://dx.doi.org/10.1128/JVI.77.1.443-451.2003.

26. Schlick P, Taucher C, Schittl B, Tran JL, Kofler RM, Schueler W, vonGabain A, Meinke A, Mandl CW. 2009. Helices alpha2 and alpha3 ofWest Nile virus capsid protein are dispensable for assembly of infec-tious virions. J. Virol. 83:5581–5591. http://dx.doi.org/10.1128/JVI.02653-08.

27. Zhu W, Qin C, Chen S, Jiang T, Yu M, Yu X, Qin E. 2007. Attenuateddengue 2 viruses with deletions in capsid protein derived from an infec-tious full-length cDNA clone. Virus Res. 126:226 –232. http://dx.doi.org/10.1016/j.virusres.2007.03.004.

28. Patkar CG, Jones CT, Chang YH, Warrier R, Kuhn RJ. 2007. Functionalrequirements of the yellow fever virus capsid protein. J. Virol. 81:6471–6481. http://dx.doi.org/10.1128/JVI.02120-06.

29. Westaway EG. 1987. Flavivirus replication strategy. Adv. Virus Res. 33:45–90. http://dx.doi.org/10.1016/S0065-3527(08)60316-4.

30. Wang SH, Syu WJ, Huang KJ, Lei HY, Yao CW, King CC, Hu ST.2002. Intracellular localization and determination of a nuclear local-ization signal of the core protein of dengue virus. J. Gen. Virol. 83:3093–3102.

31. Sangiambut S, Keelapang P, Aaskov J, Puttikhunt C, Kasinrerk W,Malasit P, Sittisombut N. 2008. Multiple regions in dengue virus capsidprotein contribute to nuclear localization during virus infection. J. Gen.Virol. 89:1254 –1264. http://dx.doi.org/10.1099/vir.0.83264-0.

32. Boulant S, Montserret R, Hope RG, Ratinier M, Targett-Adams P,Lavergne JP, Penin F, McLauchlan J. 2006. Structural determinants thattarget the hepatitis C virus core protein to lipid droplets. J. Biol. Chem.281:22236 –22247. http://dx.doi.org/10.1074/jbc.M601031200.

33. Boulant S, Targett-Adams P, McLauchlan J. 2007. Disrupting the asso-ciation of hepatitis C virus core protein with lipid droplets correlates witha loss in production of infectious virus. J. Gen. Virol. 88:2204 –2213. http://dx.doi.org/10.1099/vir.0.82898-0.

34. Miyanari Y, Atsuzawa K, Usuda N, Watashi IK, Hishiki T, Zayas M,Bartenschlager R, Wakita T, Hijikata M, Shimitohno K. 2007. The lipiddroplet is an important organelle for hepatitis C virus production. Nat.Cell Biol. 9:1089 –1097. http://dx.doi.org/10.1038/ncb1631.

35. Fischl W, Bartenschlager R. 2011. Exploitation of cellular pathways byDengue virus. Curr. Opin. Microbiol. 14:470 – 475. http://dx.doi.org/10.1016/j.mib.2011.07.012.

36. Faustino AF, Carvalho FA, Martins IC, Castanho MARB, Mohana-Borges R, Almeida FCL, Da Poian AT, Santos NC. 2014. Denguevirus capsid protein interacts specifically with very low-density lipo-proteins. Nanomedicine 10:247–255. http://dx.doi.org/10.1016/j.nano.2013.06.004.

37. Hall TA. 1999. BioEdit: a user-friendly biological sequence alignmenteditor and analysis program for Windows 95/98/NT. Nucleic Acids Symp.Ser. 41:95–98.




.org/D

ownloaded from



http://dx.doi.org/10.1038/nsb990

http://dx.doi.org/10.1038/nsb990

http://dx.doi.org/10.1038/nsmb.2463

http://dx.doi.org/10.1016/S0092-8674(02)00660-8

http://dx.doi.org/10.1016/S0092-8674(02)00660-8

http://dx.doi.org/10.1016/j.chom.2009.03.007

http://dx.doi.org/10.1016/j.chom.2009.03.007

http://dx.doi.org/10.1073/pnas.0305892101

http://dx.doi.org/10.1073/pnas.0305892101

http://dx.doi.org/10.1016/j.str.2004.04.024

http://dx.doi.org/10.1016/j.str.2004.04.024

http://dx.doi.org/10.1128/JVI.77.12.7143-7149.2003

http://dx.doi.org/10.1093/nar/gkm1051

http://dx.doi.org/10.1016/j.febslet.2011.06.038

http://dx.doi.org/10.1016/j.febslet.2011.06.038



http://dx.doi.org/10.1042/BJ20112219



http://dx.doi.org/10.1371/journal.ppat.1000632

http://dx.doi.org/10.1006/viro.1997.8608

http://dx.doi.org/10.1006/viro.1997.8608

http://dx.doi.org/10.1126/science.1153264

http://dx.doi.org/10.1007/s00705-009-0350-8

http://dx.doi.org/10.1007/s00705-009-0350-8








http://dx.doi.org/10.1016/j.virusres.2007.03.004

http://dx.doi.org/10.1016/j.virusres.2007.03.004


http://dx.doi.org/10.1016/S0065-3527(08)60316-4

http://dx.doi.org/10.1099/vir.0.83264-0

http://dx.doi.org/10.1074/jbc.M601031200



http://dx.doi.org/10.1038/ncb1631

http://dx.doi.org/10.1016/j.mib.2011.07.012

http://dx.doi.org/10.1016/j.mib.2011.07.012

http://dx.doi.org/10.1016/j.nano.2013.06.004

http://dx.doi.org/10.1016/j.nano.2013.06.004

http://jvi.asm.org

http://jvi.asm.org/

Maintenance of Dimer Conformation by the Dengue Virus …jvi.asm.org/content/88/14/7998.full.pdf ·...

Documents

Transcript of Maintenance of Dimer Conformation by the Dengue Virus …jvi.asm.org/content/88/14/7998.full.pdf ·...