Macrophages eat cancer cells using their owncalreticulin as a guide: Roles of TLR and BtkMingye Fenga,b,c, James Y. Chena,b,c,1, Rachel Weissman-Tsukamotoa,b,c,1, Jens-Peter Volkmera,b,c,1, Po Yi Hoa,b,c,Kelly M. McKennaa,b,c, Samuel Cheshiera, Michael Zhanga, Nan Guoa,b,c, Phung Gipa,b,c, Siddhartha S. Mitraa,and Irving L. Weissmana,b,c,d,2

aInstitute for Stem Cell Biology and Regenerative Medicine, bLudwig Center for Cancer Stem Cell Research and Medicine, cStanford Cancer Institute, anddDepartment of Pathology, Stanford University School of Medicine, Stanford, CA 94305

Contributed by Irving L. Weissman, December 30, 2014 (sent for review December 15, 2014)

Macrophage-mediated programmed cell removal (PrCR) is animportant mechanism of eliminating diseased and damaged cellsbefore programmed cell death. The induction of PrCR by eat-mesignals on tumor cells is countered by don’t-eat-me signals such asCD47, which binds macrophage signal-regulatory protein α to in-hibit phagocytosis. Blockade of CD47 on tumor cells leads to phago-cytosis by macrophages. Here we demonstrate that the activationof Toll-like receptor (TLR) signaling pathways in macrophages syn-ergizes with blocking CD47 on tumor cells to enhance PrCR. Bru-ton’s tyrosine kinase (Btk) mediates TLR signaling in macrophages.Calreticulin, previously shown to be an eat-me signal on cancercells, is activated in macrophages for secretion and cell-surface ex-posure by TLR and Btk to target cancer cells for phagocytosis, evenif the cancer cells themselves do not express calreticulin.

immunosurveillance | programmed cell removal |Bruton’s tyrosine kinase | “eat me” signal | Toll-like receptor

Programmed cell removal (PrCR) is a process of macrophage-mediated immunosurveillance by which target cells are rec-

ognized and phagocytosed (1). PrCR previously was known to bea key step concurrent with programmed cell death for theclearance of apoptotic cells, but when apoptosis is blocked, PrCRof neutrophils that are living (because of the enforced expressionof bcl2) occurs precisely at the same time that PrCR removesdying wild-type neutrophils (2). Recently a role for PrCR ineliminating living tumor cells has been revealed (1). Several studieshave indicated a crucial function of CD47 as an antiphagocyticdon’t-eat-me signal dominating over PrCR (3–10). During cancerdevelopment, tumor cells up-regulate CD47, which protects themfrom PrCR (1, 3, 4, 6). Blockade of the interaction between CD47on target cells and its receptor, signal-regulatory protein α (SIRPα),on macrophages elicits efficient PrCR of cancer cells but not ofmost normal cells in vitro and in vivo (Fig. 1A) (1, 3). WhenCD47 is blocked, cancer cells, but not normal cells, are phago-cytosed because prophagocytic eat-me signals such as calreticulin(CRT) are commonly expressed on many leukemias, lymphomas,and solid tumors (Fig. 1A) (11). CRT normally is an endoplasmicreticulum (ER) protein possessing ER retention KDEL se-quences but can be released to the cell surface in many instancesof cell damage by cytotoxic drugs or inflammation and is rec-ognized by macrophage LRP1/CD91 during phagocytosis ofapoptotic cells (12, 13). Bruton’s tyrosine kinase (Btk) isa member of the Tec nonreceptor protein tyrosine kinase family,which plays a crucial role in the regulation of the innate immuneresponse (14, 15). A defect of Btk leads to immunodeficienciesincluding X-linked hypo- or agammaglobulinemia (16–18), pre-sumably caused by the blockade of B-cell development andperhaps related to inefficient clearance of defective B-lineagecells as well (19). Thus far, however, little is known about themolecular mechanisms by which macrophages recognize andphagocytose living cancer cells. We show here that macrophagesexpress CRT and that Toll-like receptor (TLR) signaling through

Btk results in its trafficking to the cell surface, where it can beused to mediate PrCR of appropriate tumor cells.

ResultsWe performed phagocytosis assays by coculturing mouse bonemarrow-derived macrophages (BMDMs) and target human can-cer cells to examine the efficacy of PrCR under different con-ditions. To induce phagocytosis, we blocked CD47 on a humancolon cancer cell line (SW620) either by treating tumor cells withCD47-blocking antibodies or by directly knocking out CD47.Phagocytosis was increased significantly by knocking out the self-protective signal CD47 (SW620CD47KO) (Fig. S1) resulting froman imbalance of eat-me over don’t-eat-me pathways (Fig. 1A).Treatment of SW620WT cells with anti-CD47 antibody elicitedstronger phagocytosis which was reversed by Fc-receptor blockersto the same level as that of SW620CD47KO cells, suggesting thatanti-CD47 antibody induced phagocytosis of SW620 cancer cellsby both Fc-independent (blockade of CD47–SIRPα interactions)and Fc-dependent mechanisms (Fig. 1A).To understand the molecular mechanisms of PrCR, we per-

formed screening experiments to identify signaling pathways thatregulate the phagocytic ability of macrophages. TLR signalingplays a crucial role in the innate immune response against

Significance

Macrophage-mediated programmed cell removal (PrCR) playsan essential role in tumor surveillance and elimination.Blockade of the don’t-eat-me signal CD47 on tumor cells allowsalready expressed eat-me signals to induce PrCR to eliminatetumor cells. To date the molecular mechanism by which mac-rophages recognize and phagocytose tumor cells remains un-clear. This paper demonstrates that the activation of Toll-likereceptor (TLR) pathways in macrophages induces the phos-phorylation of Bruton’s tyrosine kinase (Btk), which catalyzescell-surface exposure of calreticulin. Calreticulin on or secretedby macrophages plays a critical role in mediating adjacent tu-mor cell recognition and phagocytosis. These findings reveala strategy to enhance the efficacy of PrCR through a combina-tion of TLR/Btk activation and CD47 blockade, and advance ourunderstanding of the underlying mechanism of macrophage-mediated PrCR of tumor cells.

Author contributions: M.F., J.Y.C., R.W.-T., J.-P.V., P.Y.H., K.M.M., S.C., M.Z., N.G., P.G., S.S.M.,and I.L.W. designed research; M.F., J.Y.C., R.W.-T., J.-P.V., P.Y.H., K.M.M., M.Z., N.G., P.G.,and S.S.M. performed research; M.F., J.Y.C., P.Y.H., K.M.M., M.Z., and N.G. contributednew reagents/analytic tools; M.F., J.Y.C., R.W.-T., J.-P.V., P.Y.H., K.M.M., S.C., M.Z., N.G.,P.G., S.S.M., and I.L.W. analyzed data; and M.F., J.-P.V., and I.L.W. wrote the paper.

The authors declare no conflict of interest.

Freely available online through the PNAS open access option.1J.Y.C., R.W.-T., and J.-P.V. contributed equally to this work.2To whom correspondence should be addressed. Email: irv@stanford.edu.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1424907112/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1424907112 PNAS | February 17, 2015 | vol. 112 | no. 7 | 2145–2150

IMMUNOLO

GYAND

INFLAMMATION

pathogens (20, 21), and TLR agonists are listed as immunother-apeutic agents with anticancer potential (22). However, the role ofTLR signaling in PrCR of living cancer cells remains unexplored.Thus, we pretreated BMDMs with various TLR agonists and thenassayed their phagocytotic ability against cancer cells. We foundthat the activation of multiple TLRs significantly enhancedphagocytosis of cancer cells (Fig. 1B). We next focused on theTLR agonists that were most effective at enhancing phagocyto-sis, assessing their effects on a wider range of macrophages andtumor cells. We showed that treatment of macrophages with TLR3,-4, and -7 agonists, i.e., high-molecular-weight polyinosinic-poly-cytidylic acid [poly (I:C) HMW], LPS, and imiquimod, dramaticallyenhanced their phagocytosis of multiple hematopoietic and solidtumor cells (Figs. S2 and S3). Subsequent assessment in micelacking T, B, and natural killer (NK) cells showed that these TLRagonists significantly improved the efficacy of CD47-blocking anti-body in blocking tumor growth in vivo (Fig. S4).To understand further the mechanism by which the activation

of TLR signaling in macrophages promoted tumor cell phago-cytosis, we treated macrophages by combining TLR agonists withvarious inhibitors targeting key molecules that positively(MAPK, Btk) (23–27) or negatively (PI3K, caspase-1) (28, 29)regulate TLR signaling. Blockers of MAPK, PI3K, and caspase-1showed no effect on phagocytosis of cancer cells. In contrast,ibrutinib, a specific blocker of Btk, a tyrosine kinase expressed inthe hematopoietic system (Fig. S5) (15, 30, 31), significantly at-tenuated phagocytosis induced by TLR agonists (Fig. 2A). Treat-ment of macrophages with poly (I:C) HMW, LPS, or imiquimodstimulated Btk to be phosphorylated, and this effect was coun-teracted by ibrutinib, resulting in basal Btk phosphorylation (Fig.

2B). Notably, basal-level phagocytosis of cancer cells was regu-lated by the Btk pathway, and ibrutinib showed an inhibitoryeffect on both Fc-dependent and -independent phagocytosis(Fig. S6A). In sum, Btk is a crucial effector through which TLRsmediate tumor cell phagocytosis. Interestingly, stimulationand inhibition of Btk showed differential temporal effects onphagocytosis. Maximal phagocytic ability of macrophages wasachieved with 16 h of Btk activation (Fig. 2C); in contrast, blockadeof Btk showed a prompt effect and reached the maximal inhibitionwithin 1 h (Fig. 2D).Upon activation, Btk phosphorylates transcription factors such

as TFII-I and STAT5A (32, 33) in the nucleus and PLCγ2 (34) atthe plasma membrane. Recent studies identified CRT as a sub-strate phosphorylated by Btk when TLR7 was activated in therecognition of apoptotic cells (35). Phosphorylation of CRT byBtk in macrophages was important for CRT trafficking to the cellsurface to function as a bridging molecule in the CRT/CD91/C1qcomplex, which initiates phagocytosis of apoptotic cells (13, 35,36). To investigate whether CRT is the critical downstream ef-fector of the TLR–Btk pathway to mediate PrCR of tumor cells,we then examined the expression and function of CRT in mac-rophages. We found that CRT was expressed on the surface ofmacrophages, and its cell-surface exposure was regulated by theactivation status of Btk (Fig. 3 A and B and Fig. S6B). CRT an-tibody significantly inhibited phagocytosis of SW620 cells bymouse BMDMs or human peripheral blood mononuclear cells(PBMC)-derived macrophages (Fig. 3C and Fig. S6 C and D),whereas overexpression of CRT in a mouse monocyte/macro-phage cell line, J774, led to enhanced phagocytosis (Fig. 3D). Inaddition, we confirmed phosphorylation of CRT upon Btk

Fig. 1. Activation of TLR signaling leads to enhanced PrCR of living cancer cells. (A, Left) Schematic showing PrCR of living tumor cells by macrophages.Blockade of CD47 leads to an imbalance of eat-me over don’t-eat-me pathways, which elicits phagocytosis of tumor cells, either Fc-dependent (elicited by Fc–FcR interaction) or Fc-independent (labeled in red, representing cancer-specific eat-me signals other than Fc). (Right) A phagocytosis assay showing blockadeof CD47-induced phagocytosis, with SW620 cells [control IgG-treated, anti-CD47 antibody (B6H12)–treated, or CD47KO] as target cells and BMDMs fromRAG2−/−, γc−/− mice. Fc receptor blocker (FcRB) reversed phagocytosis of B6H12-treated cells to the same level as inf CD47KO cells. **P < 0.01, t test; ns, notsignificant. (B) A phagocytosis assay showing a screen of TLR agonists, with SW620 cells [PBS-treated, anti-CD47 antibody (Hu5F9-G4)–treated, or CD47KO] astarget cells and BMDMs from BALB/c mice. TLR agonists used in the screen were Pam3CSK4 (Pam, TLR1/2), heat-killed Listeria monocytogenes (HKLM, TLR2),poly (I:C) HMW [poly (I:C), TLR3)], lipopolysaccharide (LPS, TLR4), flagellin from Salmonella typhimurium (FLA-ST, TLR5), Pam2CGDPKHPKSF (FSL-1, TLR6/2),imiquimod (Imi, TLR7), and class B CpG oligonucleotide (ODN 1826, TLR9). Dashed lines indicate twofold phagocytosis of each condition [PBS-treated, anti-CD47 antibody (Hu5F9-G4)-treated, or CD47KO] in the control macrophage group. Error bars represent SD.

2146 | www.pnas.org/cgi/doi/10.1073/pnas.1424907112 Feng et al.

activation, which reached the maximal level after 30 min of imi-quimod treatment of macrophages (Fig. S6E). These results sug-gest that CRT is an essential component regulated by the TLR–Btk pathway to mediate phagocytosis of living cancer cells.

We further dissected the role of CRT in mediating PrCR ofcancer cells. Previous studies demonstrated cell-surface expres-sion of CRT on apoptotic cells and multiple viable human cancercells (Fig. S7 B–D) (11, 12). Thus, we examined whether CRT

Fig. 2. Btk is the key signaling molecule regulating PrCR of cancer cells. (A) A phagocytosis assay showing a screen with combined TLR agonists and variousinhibitors targeting downstream signaling molecules, with SW620 cells (control or CD47KO) as target cells and BMDMs from RAG2−/−, γc−/− mice. Inhibitorsused in the screen were PD98059 (PD, MEK inhibitor), LY294002 (LY, PI3K inhibitor), ibrutinib (Ibr, Btk inhibitor), and YVAD (vaspase-1 inhibitor). **P < 0.01(t test; comparison between samples in control or CD47KO groups, Imi-ctrl vs. other conditions). (B) Immunoblots showing the phosphorylation of Btk inducedby TLR agonists [Poly (I:C) HMW, LPS, imiquimod]. When cells were treated simultaneously with TLR agonists and ibrutinib, the induction of Btk phos-phorylation was attenuated. Total Btk showed no change. (C and D) Temporal effects of Btk activator (imiquimod) (C) and inhibitor (ibrutinib) (D) onphagocytosis, with SW620 cellsCD47KO as target cells and BMDMs from NSG mice. Error bars in A, C, and D represent SD.

Fig. 3. Btk controls cell-surface exposure of CRT on macrophages to regulate PrCR of cancer cells. (A) The expression of CRT on macrophages was examined bya cell-surface biotinylation assay. Immunoblots showed that cell-surface CRT increased upon Btk activation and decreased upon Btk inhibition. Ibr, ibrutinib; Imi,imiquimod. (B) Increased cell-surface exposure of CRT on macrophages induced by TLR agonists [poly (I:C) HMW, LPS, imiquimod], as examined by flowcytometry analyses. (C) A phagocytosis assay showing CRT antibody inhibited phagocytosis of cancer cells, with SW620 cells [PBS-treated, anti-CD47 antibody(Hu5F9-G4)-treated or CD47KO] as target cells and BMDMs from RAG2−/−, γc−/− mice. Enhancement of phagocytosis induced by Poly (I:C) or imiquimod wasreversed by CRT blockade. Dashed lines indicate normalized phagocytosis of each condition [PBS-treated, anti-CD47 antibody (Hu5F9-G4)-treated or CD47KO] inthe control macrophage group. (D) Overexpression of CRT in J774 cells promoted phagocytosis. Expression of CRT was examined by immunoblotting. SW620cells [control IgG- or anti-CD47 antibody (B6H12)–treated] were used as target cells. *P < 0.05, **P < 0.01 (t test). Error bars in C and D represent SD.

Feng et al. PNAS | February 17, 2015 | vol. 112 | no. 7 | 2147

IMMUNOLO

GYAND

INFLAMMATION

plays a critical role in mediating cancer cell phagocytosis on bothmacrophages and target tumor cells (Fig. 4A). Interestingly,blockade of CRT on macrophages diminished phagocytosis, butblocking CRT on cancer cells showed no effect, suggesting thatCRT has a specific role in mediating phagocytosis on macro-phages (Fig. 4A). Importantly, cell-surface expression of CRTwas enhanced by TLR agonists in macrophages but not in targetcancer cells, which lack Btk (Fig. S7), indicating distinct mech-anisms regulating CRT exposure. Next, we examined macro-phage subpopulations with different levels of cell-surface CRTand found that macrophages with a higher surface CRT showeda stronger phagocytic ability (Fig. 4B and Fig. S8 A and B).Quantitative analysis of a panel of macrophages, including sub-populations with differential surface CRT expression and mac-rophages at different time points after imiquimod treatment,revealed a significant correlation between CRT expression onmacrophages and tumor cell phagocytosis (Fig. 4C and Fig. S8 Cand D). Additionally, both M1 and M2 human macrophages (37,38) derived from the peripheral blood expressed CRT on thesurface, and an M1 subset expressed a somewhat higher level ofCRT (Fig. S9). Taken together, these findings indicate that CRTis a key effector for macrophage-mediated surveillance of tumorcells and that enhanced PrCR of cancer cells can be achieved byup-regulating CRT on macrophages.

DiscussionRecent progress in cancer immunology has highlighted theability of cancer cells to evade immunosurveillance as one of theessential hallmarks of cancer (1, 39, 40). Although lymphocytes(T, B, and NK cells) have been thought to mediate the bulk ofanticancer immunosurveillance (41), we have demonstrated thatblockade of CD47 on tumor cells leads to in vivo immune rec-ognition, macrophage phagocytosis of tumor cells, and tumor

elimination in mice deficient in lymphocytes, indicating thatphagocytes are crucial to surveillance against cancer cells (40).Phagocytosis of tumor cells mediated by anti-CD47 blockade canresult in cross-presentation of tumor antigens to CD8 T cells, sothat CD47 blockade can result in both innate immune systemmacrophage surveillance and stimulation of adaptive immunesystem T-cell cytotoxicity (42). Here we show that cell-surfaceexpression of CRT on macrophages is controlled by the TLR–

Btk pathway, which induces the phosphorylation of CRT for itscleavage from the ER retention signals and subsequent secretionand binding to CD91 on the cell surface. We show that thismechanism of secretion is important for mediating PrCR of livecancer cells and also removes apoptotic cells (35). CRT onmacrophages may function in detecting target cells through transinteraction with as yet unidentified specific receptors on targetcancer cells; thus blockade of surface CRT inhibits PrCR.Moreover, CD47 mutant mice do not phagocytose self red cellsor hematopoietic stem cells; however, these cells are phagocy-tosed rapidly when transferred to wild-type congenic normal orirradiated mice (3, 43), even though neither cell type expressesCRT in microarrays, indicating that other eat-me signals may beused or that CRT can decorate target cells that do not expressCRT genes. We show that multiple types of TLR agonists areable to stimulate macrophages and enhance PrCR of solid tumorcells, as is consistent with reports that the TLR4 agonist LPS andIFN-γ receptors are necessary for activating macrophages tophagocytose acute myeloid leukemia cells after the CD47–SIRPα interaction is disrupted (44). These studies suggest thatTLR signaling can synergize with anti-CD47 blockade to en-hance tumor cell phagocytosis and therefore modulating TLRsignaling could be a therapeutic approach to enhance tumor cellelimination. Notably, the impact of modulating TLR signaling innormal cells in the context anti-CD47 blockade must be tested

Fig. 4. CRT is a key effector on macrophages in mediating PrCR of cancer cells. (A) A phagocytosis assay showing the effects of blocking CRT on macrophagesor cancer cells. (Left) A schematic showing the design of the experiments. Macrophages, target cells, or both were pretreated with CRT antibody and thensubjected to the phagocytosis assay. (Right) A phagocytosis assay showing CRT on macrophages is necessary for phagocytosis of cancer cells, with SW620 cells(control or CD47KO) as target cells and BMDMs from RAG2−/−, γc−/− mice. (B) Phagocytic ability of macrophages with differential surface CRT expression levels.Definitions of CRTLow, CRTMedium, and CRTHigh populations are given in Fig. S8 A and B. (C) Normalized tumor cell phagocytosis (y axis) was plotted againstnormalized cell-surface CRT expression (Log2; x axis) on macrophages with SW620 cells (CD47KO) as target cells and BMDMs from RAG2−/−, γc−/− or NSG mice.■, BMDMs from NSG mice treated with imiquimod for 0, 1, 6, 16, or 24 h; ▲, BMDMs from RAG2−/−, γc−/− mice (CRTLow, CRTMedium, CRTHigh, and bulkpopulations); ●, BMDMs from NSG mice (CRTLow, CRTMedium, CRTHigh, and bulk populations). Error bars in A and B represent SD.

2148 | www.pnas.org/cgi/doi/10.1073/pnas.1424907112 Feng et al.

first before the therapeutic potential of such synergy can bejudged. Further investigation of the interaction between mac-rophages and target cancer cells should advance our under-standing of the principles of cancer cell immune evasion.

Materials and MethodsMice. BALB/c, RAG2−/− γc−/− BALB/c and NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG)mice were bred in a pathogen-free facility in the Institute for Stem Cell Bi-ology and Regenerative Medicine at Stanford University. All animal proce-dures were approved by the Administrative Panel on Laboratory AnimalCare at Stanford University.

Cell Culture. The human cancer-derived cell lines SW620 (colon cancer),HL60 (leukemia), Raji (lymphoma), MDA-MB-231 (breast cancer), and PC3(prostate cancer) and the murine macrophage/monocyte cell line J774were obtained from ATCC and were cultured routinely in DMEM supple-mented with 10% (vol/vol) FBS (SW620, MDA-MB-231, and J774 cells),Iscove’s Modified Dulbecco’s Medium (IMDM) supplemented with 20%(vol/vol) FBS (HL60 cells), F-12K medium supplemented with 10% (vol/vol)FBS (PC-3 cells), or RPMI-1640 medium supplemented with 10% (vol/vol)FBS (Raji cells). Tumor cells were transduced with lentiviruses which weregenerated with a pCDH-CMV-MCS-EF1 lentiviral vector expressing a lucif-erase–eGFP fusion protein and were sorted by flow cytometry with BDFACSAria II cell sorters for GFP+ cells, as described previously (6).

CD47 Knockout with Transcription Activator-Like Effector Nucleases. Tran-scription activator-like effector nucleases (TALENs) were designed and as-sembled as described (45). The genomic locus of human CD47 (NC_000003.12)was scanned for putative TALEN-binding pairs. Exon 2 ultimately was selectedfor targeting, and the TALEN pairs TGTCGTCATTCCATGCTTTG and TATA-CTTCAGTAGTGTTTTG were cloned respectively into the pTALEN backbone.SW620 cells were transfected with the CD47-TALEN constructs using Lipo-fectamine 2000. Three days after transfection, cells were stained with anti-CD47 or isotype antibodies. CD47− cells were sorted by flow cytometry withBD FACSAria II cell sorters.

Preparation of Macrophages. BMDMs were generated as previously described(3). Briefly, bone marrow cells were isolated from BALB/c, NSG, or RAG2−/−,γc−/− mice at ∼6–10 wk of age. The cells were treated with ammonium-chloride-potassium (ACK) lysis buffer and then were cultured in IMDM me-dium supplemented with 10% (vol/vol) FBS and 10 ng/mL of macrophagecolony-stimulating factor (M-CSF). The cells were used for flow cytometryanalysis or phagocytosis assay after 6–8 d of differentiation.

Flow Cytometry Analysis. Flow cytometry analyses were performed using a BDLSRFortessa. For staining, 2.5 × 105–106 cells were incubated with indicatedantibodies (1:50–1:200) in FACS buffer [PBS with 2% (vol/vol) FBS] on ice for30 min. Cells then were washed with FACS buffer and subjected to FACSanalyses. For staining of macrophages, cells first were treated with Fc re-ceptor blockers or a high concentration of isotype IgG control (5–10× in-dicated antibodies) to block nonspecific binding of antibodies caused by theinteraction of the Fc domain and Fc receptors on macrophages.

Phagocytosis Assay. FACS-based phagocytosis assays were performed toevaluate the phagocytic abilities of macrophages. Macrophages were har-vested after 6–8 d of differentiation and were divided into FACS tubes orlow-attachment 96-well plates, with 1–5 × 104 cells per well or tube. Targetcells were added and mixed with macrophages and were incubated at 37 °Cfor 2 h with the indicated conditions (antibody or drug treatment).

ACKNOWLEDGMENTS. We thank A. McCarty, S. Karten, T. Storm, L. Jerabek,S. Willingham, D. Corey, J. Seita, K. Loh, N. Fernhoff, R. Lu, A. Newman,H. Contreras-Trujillo, R. Sinha, T. Naik, M. Miyanishi, and S. Liu for scientificdiscussions, technical assistance, and reagents; P. Lovelace and J. Ho forassistance with FACS; and R. Majeti, J. Liu, and the CD47 Disease Team forproviding the anti-CD47 antibody Hu5F9-G4. Anti-Btk antibodies were giftsfrom Dr. Owen Witte (University of California, Los Angeles). This work wassupported by National Cancer Institute of the National Institutes of HealthGrants R01 CA086017 (to I.L.W.) and P01 CA139490 (to I.L.W.) and The Vir-ginia and D. K. Ludwig Fund for Cancer Research. M.F. is a Damon RunyonCancer Research Fellow (DRG-2128-12). S.S.M. is a Seibel Scholar of the SeibelStem Cell Institute.

1. Chao MP, Majeti R, Weissman IL (2012) Programmed cell removal: A new obstacle inthe road to developing cancer. Nat Rev Cancer 12(1):58–67.

2. Lagasse E, Weissman IL (1994) bcl-2 inhibits apoptosis of neutrophils but not theirengulfment by macrophages. J Exp Med 179(3):1047–1052.

3. Jaiswal S, et al. (2009) CD47 is upregulated on circulating hematopoietic stem cellsand leukemia cells to avoid phagocytosis. Cell 138(2):271–285.

4. Majeti R, et al. (2009) CD47 is an adverse prognostic factor and therapeutic antibodytarget on human acute myeloid leukemia stem cells. Cell 138(2):286–299.

5. Chao MP, et al. (2011) Extranodal dissemination of non-Hodgkin lymphoma requiresCD47 and is inhibited by anti-CD47 antibody therapy. Blood 118(18):4890–4901.

6. Willingham SB, et al. (2012) The CD47-signal regulatory protein alpha (SIRPa) in-teraction is a therapeutic target for human solid tumors. Proc Natl Acad Sci USA109(17):6662–6667.

7. Chao MP, et al. (2011) Therapeutic antibody targeting of CD47 eliminates humanacute lymphoblastic leukemia. Cancer Res 71(4):1374–1384.

8. Chao MP, et al. (2010) Anti-CD47 antibody synergizes with rituximab to promotephagocytosis and eradicate non-Hodgkin lymphoma. Cell 142(5):699–713.

9. Edris B, et al. (2012) Antibody therapy targeting the CD47 protein is effective in a modelof aggressive metastatic leiomyosarcoma. Proc Natl Acad Sci USA 109(17):6656–6661.

10. Kim D, et al. (2012) Anti-CD47 antibodies promote phagocytosis and inhibit thegrowth of human myeloma cells. Leukemia 26(12):2538–2545.

11. Chao MP, et al. (2010) Calreticulin is the dominant pro-phagocytic signal on multiplehuman cancers and is counterbalanced by CD47. Sci Transl Med 2(63):63ra94.

12. Gardai SJ, et al. (2005) Cell-surface calreticulin initiates clearance of viable or apo-ptotic cells through trans-activation of LRP on the phagocyte. Cell 123(2):321–334.

13. Ogden CA, et al. (2001) C1q and mannose binding lectin engagement of cell surfacecalreticulin and CD91 initiates macropinocytosis and uptake of apoptotic cells. J ExpMed 194(6):781–795.

14. Rawlings DJ, Witte ON (1994) Bruton’s tyrosine kinase is a key regulator in B-celldevelopment. Immunol Rev 138:105–119.

15. Mohamed AJ, et al. (2009) Bruton’s tyrosine kinase (Btk): Function, regulation, andtransformation with special emphasis on the PH domain. Immunol Rev 228(1):58–73.

16. Bruton OC (1952) Agammaglobulinemia. Pediatrics 9(6):722–728.17. Good RA, Varco RL (1955) A clinical and experimental study of agammaglobulinemia.

J Lancet 75(6):245–271.18. Tsukada S, Witte ON (1994) X-linked agammaglobulinemia and Bruton’s tyrosine

kinase. Adv Exp Med Biol 365:233–238.19. Amoras AL, Kanegane H, Miyawaki T, Vilela MM (2003) Defective Fc-, CR1- and CR3-me-

diatedmonocyte phagocytosis and chemotaxis in common variable immunodeficiency andX-linked agammaglobulinemia patients. J Investig Allergol Clin Immunol 13(3):181–188.

20. O’Neill LA, Golenbock D, Bowie AG (2013) The history of Toll-like receptors - redefininginnate immunity. Nat Rev Immunol 13(6):453–460.

21. Kawai T, Akira S (2006) TLR signaling. Cell Death Differ 13(5):816–825.22. Guha M (2012) Anticancer TLR agonists on the ropes. Nat Rev Drug Discov 11(7):

503–505.23. Ní Gabhann J, Jefferies CA (2011) TLR-induced activation of Btk— role for endosomal

MHC class II molecules revealed. Cell Res 21(7):998–1001.24. Lim KH, Staudt LM (2013) Toll-like receptor signaling. Cold Spring Harb Perspect Biol

5(1):a011247.25. Doyle SL, Jefferies CA, Feighery C, O’Neill LA (2007) Signaling by Toll-like receptors 8

and 9 requires Bruton’s tyrosine kinase. J Biol Chem 282(51):36953–36960.26. Schmidt NW, Thieu VT, Mann BA, Ahyi AN, Kaplan MH (2006) Bruton’s tyrosine kinase

is required for TLR-induced IL-10 production. J Immunol 177(10):7203–7210.27. Lee KG, et al. (2012) Bruton’s tyrosine kinase phosphorylates Toll-like receptor 3 to

initiate antiviral response. Proc Natl Acad Sci USA 109(15):5791–5796.28. Fukao T, Koyasu S (2003) PI3K and negative regulation of TLR signaling. Trends Im-

munol 24(7):358–363.29. Jabir MS, et al. (2014) Caspase-1 cleavage of the TLR adaptor TRIF inhibits autophagy

and β-interferon production during Pseudomonas aeruginosa infection. Cell Host

Microbe 15(2):214–227.30. Burger JA, Buggy JJ (2013) Bruton tyrosine kinase inhibitor ibrutinib (PCI-32765). Leuk

Lymphoma 54(11):2385–2391.31. Brown JR (2013) Ibrutinib (PCI-32765), the first BTK (Bruton’s tyrosine kinase) inhibitor

in clinical trials. Curr Hematol Malig Rep 8(1):1–6.32. Yang W, Desiderio S (1997) BAP-135, a target for Bruton’s tyrosine kinase in response

to B cell receptor engagement. Proc Natl Acad Sci USA 94(2):604–609.33. Mahajan S, et al. (2001) Transcription factor STAT5A is a substrate of Bruton’s tyrosine

kinase in B cells. J Biol Chem 276(33):31216–31228.34. Kurosaki T, et al. (2000) Regulation of the phospholipase C-gamma2 pathway in B

cells. Immunol Rev 176:19–29.35. Byrne JC, et al. (2013) Bruton’s tyrosine kinase is required for apoptotic cell uptake via

regulating the phosphorylation and localization of calreticulin. J Immunol 190(10):

5207–5215.36. Vandivier RW, et al. (2002) Role of surfactant proteins A, D, and C1q in the clearance

of apoptotic cells in vivo and in vitro: Calreticulin and CD91 as a common collectin

receptor complex. J Immunol 169(7):3978–3986.37. Heusinkveld M, van der Burg SH (2011) Identification and manipulation of tumor

associated macrophages in human cancers. J Transl Med 9:216.38. Mori K, Hiroi M, Shimada J, Ohmori Y (2011) Infiltration of m2 tumor-associated

macrophages in oral squamous cell carcinoma correlates with tumor malignancy.

Cancers (Basel) 3(4):3726–3739.39. Hanahan D, Weinberg RA (2011) Hallmarks of cancer: The next generation. Cell

144(5):646–674.

Feng et al. PNAS | February 17, 2015 | vol. 112 | no. 7 | 2149

IMMUNOLO

GYAND

INFLAMMATION

40. Jaiswal S, Chao MP, Majeti R, Weissman IL (2010) Macrophages as mediators of tumorimmunosurveillance. Trends Immunol 31(6):212–219.

41. Vesely MD, Kershaw MH, Schreiber RD, Smyth MJ (2011) Natural innate and adaptiveimmunity to cancer. Annu Rev Immunol 29:235–271.

42. Tseng D, et al. (2013) Anti-CD47 antibody-mediated phagocytosis of cancer bymacrophagesprimes an effective antitumor T-cell response. Proc Natl Acad Sci USA 110(27):11103–11108.

43. Oldenborg PA, et al. (2000) Role of CD47 as a marker of self on red blood cells. Science288(5473):2051–2054.

44. Theocharides AP, et al. (2012) Disruption of SIRPα signaling in macrophages eliminateshuman acute myeloid leukemia stem cells in xenografts. J Exp Med 209(10):1883–1899.

45. Sanjana NE, et al. (2012) A transcription activator-like effector toolbox for genomeengineering. Nat Protoc 7(1):171–192.

2150 | www.pnas.org/cgi/doi/10.1073/pnas.1424907112 Feng et al.