M1:02082 — REVISED Design and Production of Active ... · Production and purification of...
Transcript of M1:02082 — REVISED Design and Production of Active ... · Production and purification of...
![Page 1: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/1.jpg)
1
M1:02082 — REVISED
Design and Production of Active Cellulosome Chimeras:
SELECTIVE INCORPORATION OF DOCKERIN-CONTAINING ENZYMES INTO
DEFINED FUNCTIONAL COMPLEXES*
Henri-Pierre Fierobe‡, Adva Mechaly§, Chantal Tardif‡¶, Anne Belaich‡,
Raphael Lamed||, Yuval Shoham**, Jean-Pierre Belaich‡¶ and Edward A. Bayer§‡‡
From the ‡Bioénergétique et Ingéniérie des Protéines, Centre National de la Recherche
Scientifique, IBSM-IFR1, 13402 Marseille, France; the §Department of Biological Chemistry,
The Weizmann Institute of Science, Rehovot 76100 Israel; the ¶Université de Provence, 13331
Marseille, France; the ||Department of Molecular Microbiology and Biotechnology, Tel Aviv
University, Ramat Aviv 69978 Israel; and the **Department of Food Engineering and
Biotechnology, and Institute of Catalysis Science and Technology, Technion — Israel Institute of
Technology, Haifa 32000 Israel
‡‡Correspondence to: Edward A. BayerDepartment of Biological ChemistryThe Weizmann Institute of ScienceRehovot 76100 Israel
Tel: (+972) 8-934-2373Fax: (+972) 8-946-8256E-mail: [email protected]
Running title: Chimeric cellulosomes
Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on April 4, 2001 as Manuscript M102082200 by guest on A
ugust 21, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 2: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/2.jpg)
2
Acknowledgments
*The authors are grateful to S. Champ and O. Valette for expert technical assistance. This
work was supported by a contract from the European Commission (Fourth Framework,
Biotechnology Programme, BIO4-97-2303). Grants from the Israel Science Foundation
(administered by the Israel Academy of Sciences and Humanities, Jerusalem) are gratefully
acknowledged. Additional support was provided by the Otto Meyerhof Center for
Biotechnology, established by the Minerva Foundation, (Munich, Germany), and funds from the
Technion-Niedersachsen Cooperation (Hannover, Germany).
1 The abbreviations used are: CBD, cellulose-binding domain; CBM, carbohydrate-binding
module; HPLC, high-performance liquid chromatography; nondenaturing PAGE, polyacrylamide
gel electrophoresis (in the absence of detergent); Rmax, maximum binding capacity of analyte in
RU; RU, resonance units; SPR, surface plasmon resonance
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 3: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/3.jpg)
3
SUMMARY
Defined chimeric cellulosomes were produced, in which selected enzymes were incorporated in
specific locations within a multi-component complex. The molecular building blocks of this
approach are based on complementary protein modules from the cellulosomes of two clostridia
— Clostridium thermocellum and Clostridium cellulolyticum — wherein cellulolytic enzymes are
incorporated into the complexes by means of high-affinity species-specific cohesin-dockerin
interactions. To construct the desired complexes, a series of chimeric scaffoldins was prepared by
recombinant means. The scaffoldin chimeras were designed to include two cohesin modules from
the different species, optionally connected to a cellulose-binding domain. The two divergent
cohesins exhibited distinct specificities, such that each recognized selectively and bound strongly
to its dockerin counterpart. Using this strategy, appropriate dockerin-containing enzymes could
be assembled, precisely and by design, into a desired complex. Compared to the mixture of free
cellulases, the resultant cellulosome chimeras exhibited enhanced synergistic action on crystalline
cellulose.
Key words: Cellulosome; cellulases; multi-enzyme complex; cohesin domain, scaffoldin
subunit; protein-protein interaction; Clostridium thermocellum; Clostridium cellulolyticum
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 4: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/4.jpg)
4
INTRODUCTION
Cellulosomes are macromolecular complexes, produced in cellulolytic microorganisms,
designed for efficient degradation of cellulose and associated plant cell wall polysaccharides (1-5).
Cellulosomes are composed of a collection of subunits, each of which comprises a set of
interacting functional modules or domains. A typical cellulosome contains a cellulose-binding
scaffoldin subunit that organizes the other enzymatic components into the complex by virtue of a
high-affinity interaction among complementary domains. Thus, scaffoldin contains a cellulose-
binding domain (CBD) and multiple copies of cohesin domains. Each cohesin interacts
tenaciously with a dockerin domain on an enzyme subunit, thereby incorporating the enzymes
into the complex.
Various reports have indicated that the cohesins of a given cellulosome appear to recognize
all of the dockerin-containing enzymes within the same species (6,7), suggesting that the intra-
species cohesin-dockerin interaction is relatively non-specific. On the other hand, at least for two
clostridial species, C. thermocellum and C. cellulolyticum, the recognition between their cohesins
and dockerins was shown to be species specific (8).
In an earlier review (9), we suggested the use of hybrid forms of cellulosomal components
for improved hydrolysis of cellulosic substrates. We now provide experimental evidence
demonstrating that increased synergistic action among cellulolytic enzymes can be achieved by
selective incorporation into cellulosome-like complexes. To this end, several chimeric scaffoldins
and hybrid enzymes were designed. The chimeric scaffoldins comprised an optional CBD and
two cohesin domains of unlike specificity, one from each clostridial species. Recombinant
enzyme constructs contained a catalytic module together in the same polypeptide chain with a
dockerin domain from either species. The cellulosome chimeras were assembled in vitro, simply
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 5: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/5.jpg)
5
by combining, in equimolar amounts, three desired components, i.e., the chimeric scaffoldin and
two enzymes. The resultant cellulosome chimeras exhibited enhanced synergy on a
microcrystalline cellulose substrate. This approach is appropriate for incorporating other types
of enzyme and non-enzyme components into complexes for biotechnological application.
EXPERIMENTAL PROCEDURES
Plasmids—Plasmids and encoded proteins are summarized in Figure 1. Positive clones were
verified by DNA sequencing. BL21(DE3) (Novagen, Madison, WI) was used as production host
for pET derivatives.
pJFAc, encoding for a His-tag-containing construct of the native, dockerin-bearing CelA of
C. cellulolyticum, was obtained by inserting the primer 5’-
AGCTAGAACACCACCACCACCACCACTAATA-3’ into a HindIII site (His-tag underlined
in all sequences), located at the 3’ extremity of the coding region of pA2 (10).
To exchange the native C. cellulolyticum CelA dockerin, the dockerin-encoding region of C.
thermocellum CelS was amplified from pQE30-docS (11), using the primers 5’-
GCCGCCTTAGAAGCCAAGACAAGCCCTAGCCCATCTACTAAATTATAC-3’ (AsuII
site in bold) and 5’-
CCCCCCAAGCTTTTAGTGGTGGTGGTGGTGGTGGTTCTTGTACGCCAATGT-3’
(HindIII site, bold). The amplified fragment was ligated into AsuII-HindIII linearized pJFAc
resulting in pJFAt.
pETFt was obtained using the overlap-extension PCR method (12,13). The DNA
encoding the catalytic domain of celF was amplified from pETFc (14,15), using the forward 5'-
GACCTAGGTTGTGCTTCTTCACT-3' (unique AvrII site in bold) and reverse 5'-
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 6: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/6.jpg)
6
TACTTTATATGTCATGCTCGGGAAGAGTATTGCATAAACTC-3' primers. The DNA
encoding a C. thermocellum dockerin-domain was amplified from pQE30-docS, using the forward
5'-
TTCCCGAGCATGACATATAAAGTACCTGGTACTCCTTCTACTAAATTATACGGCGACG
TC-3' and reverse 5'-GTGCTCGAGGTTCTTGTACGGCAATGTATCTAT-3' primers,
introducing a XhoI site (bold) at the 3’-extremity. The two resultant overlapping fragments
(overlapping regions in italics) were mixed, and a combined fragment was synthesised using the
external primers. The fragment was cloned into AvrII-XhoI-linearized pETFc, thereby generating
pETFt.
pETscaf1 was constructed by PCR amplification of two fragments: the Ct-CBDt-
encoding DNA was amplified from p2CBD3(6) using 5’-
GGAATACCATGGTTCCGTCAGACGGTGTG-3’ (NcoI, bold) and 5‘-
GATCCTTAAGAGAATCTGACGGCGGTA-3’ (AflIII, bold). The Cc-encoding region was
amplified from pETCipC1 (16) using primers 5’-GATTCTCTTAAGGTTACAGTAGG-3’
(AflIII, bold) and 5’-CGGGATCCTTATTGAGTACCAGG-3’ (BamHI, bold). The fragments
were ligated into NcoI-BamHI-linearized pET9d.
pETscaf2 was similarly constructed: The DNA coding for Cc was amplified from
pETCipC1 using primers 5‘-CATGCCATGGGCGATTCTCTTAAAG-3’ (NcoI, bold) and 5’-
CCAGGATCGATCGTTACACTACC-3’ (PvuI, bold), and the CBDt-Ct region from p2CBD3
using primers 5‘-TGGCACGATCGATCCGACCAAGGGAGC-3’ (PvuI, bold) and 5‘-
CGCGGATCCTAATCTCCAACATTTAC-3’ (BamHI, bold).
pETscaf3 was constructed from pETCipC1 and pCBD3. The stop codon in the former
plasmid was eliminated using primers 5’-TGCAGGAAGTCTTCCAGCTGGAGG-3’ (located
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 7: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/7.jpg)
7
upstream of a unique BamHI site) and 5’-
CCGCCCCTCGAGTTCCTTTGTAGGTTGAGTACC-3’ (XhoI site in bold, located
immediately downstream of the gene). The amplified fragment was ligated into the original
plasmid using the BamHI-XhoI sites, resulting in pETCip1X. Ct-encoding DNA was amplified
from pCBD3 using primers 5’-GGGCGGCTCGAGCCATCAACACAGCTTGTAACA-3’ and
5’-GGGCGGCTCGAGGA TCCTATCTCCAACATTTAC-3’, thus introducing a XhoI site
(bold) at both extremities. The resulting fragment was then ligated into the XhoI site of
pETCip1X.
pETscaf4 was constructed by amplifying the Ct-encoding region from p2CBD (6), using
NdeI-containing primers 5’-GGGCGGCATATGGTTCCGTCAGACGGT-3’ and 5’-
GGGCGGCATATGCGGTGTGTTTGTCGGTGT-3’, and ligating the PCR product into NdeI-
linearized pETcoh1B (17).
Production and purification of recombinant proteins—E. coli was grown at 37°C to OD600
= 1.5 in Luria-Bertani medium, supplemented with 1.2% glycerol (w/v) and the appropriate
antibiotic. The culture was then cooled to 25°C (Ac, At, all chimeric scaffoldins) or 18°C (Fc and
Ft), and isopropyl thio-β-D-galactoside was added to a final concentration of 400 µM (Ac, At, all
chimeric scaffoldins) or 40 µM (Fc and Ft). After 16 h, the cells were centrifuged (10 min, 3000
g), resuspended in 30 mM Tris-HCl, pH 8, and broken in a French press. The purification of His-
tagged proteins (see Fig. 1) was performed on Ni-NTA resin (18). Scaf1 and Scaf2 were purified
on Avicel as previously described (6). The concentration of purified proteins was estimated by
absorbance (280 nm) in 6 M guanidine hydrochloride, based on the known amino acid
composition of the desired protein (http://expasy.hcuge.ch/sprot/protparam.html).
Nondenaturing PAGE—Samples (7.5 µM final concentration) were mixed at room
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 8: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/8.jpg)
8
temperature in 10 mM Tris-HCl, pH 8, 250 mM NaCl, 10 mM CaCl2, and 4 µl were subjected to
PAGE (gradient 4-15%) using a PhastSystem apparatus (Pharmacia, Uppsala, Sweden).
Gel filtration—Gel filtration was performed by HPLC using a calibrated Zorbax G-250
(Interchim, Montlucon, France) column, equilibrated with 50 mM Tris-HCl pH 8, 0.4 M KCl, 10
mM CaCl2, 0.01% surfactant P20 (Biacore AB, Uppsala, Sweden) at a flow rate of 1 ml min-1.
Samples were diluted in the same buffer (14 µM final concentration), and 10 µL were loaded onto
the column. Chromatographic data were recorded at 280 nm.
Surface plasmon resonance (SPR)—Experiments were performed using a Biacore system
as described earlier (17), using 10 mM Tris-maleate pH 6.5, 2.5 mM CaCl2, 0.005% P20 as
running buffer (flow rate 25µl min-1). Biotinylated chimeric scaffoldins (19), 95-100 RU of Scaf1
and Scaf2, 110-120 RU of Scaf3, and 65-70 RU of Scaf4, were coupled to streptavidin–bearing
sensor chips. The cellulases were diluted to 5 nM in the same buffer and allowed to interact with
the immobilized chimeric scaffoldin by injections of 600 s.
Enzyme activity—Samples (8 µM in 20 mM Tris-maleate pH 6.0, 0.1 M NaCl, 10 mM
CaCl2, 50 µl) were incubated at 37°C with 4 ml of Avicel (8 g liter-1, Fluka, Buchs, Switzerland).
At predetermined time intervals, 1-ml aliquots were centrifuged and examined for reducing sugars
(20). The final protein concentration during the assay was 0.1 µM, and glucose was used as the
standard for reducing sugar analysis.
RESULTS
Design and preparation of recombinant components—Four different chimeric scaffoldins
were engineered (Fig. 1), each containing two different cohesin species that exhibit divergent
specificities (8). Scaf1 and Scaf2 are based on the cellulosomal scaffoldin from C. thermocellum, in
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 9: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/9.jpg)
9
which the two cohesins are separated by an internal CBD (21). Scaf3 is based on the C.
cellulolyticum cellulosome and contains an N-terminal CBD (22). Scaf4, which lacks a CBD, was
designed to determine whether simple complexation of enzymes would also promote synergistic
activity.
The enzyme components were all based on two established cellulosomal enzymes: the
family-5 CelA (10) and the family-48 CelF (15), herein referred to as Ac and Fc, respectively. To
complement the native enzymes, two hybrid constructs (termed At and Ft) were designed, in
which the intrinsic dockerin domain (designated “c”) of the respective C. cellulolyticum enzyme
was replaced by a dockerin domain (designated “t”) of differing specificity from the
corresponding family-48 enzyme, CelS (23), from C. thermocellum (Fig. 1). Thus, four different
enzyme pairs can be incorporated onto each chimeric scaffoldin: Ac + At, Ac + Ft, Fc + At, and
Fc + Ft.
The engineered proteins were produced in E. coli and affinity-purified in one step on either
cellulose or Ni-NTA, according to the presence of a CBD or His-tag, respectively. The chimeric
scaffoldins were found to be very stable upon storage for several days at 4°C, whereas low levels
of spontaneous cleavage between the catalytic and the dockerin modules were detectable for both
wild-type and hybrid enzymes.
Analysis of chimeric cellulosome complexes—Complex formation in the presence of calcium
was verified using three different techniques: nondenaturing PAGE, gel-filtration HPLC and SPR.
Nondenaturing PAGE clearly demonstrated that near-complete complex formation could be
achieved by simply mixing the desired components in vitro (Fig. 2). Binary or ternary mixtures of
the free proteins resulted in a single major band of altered electrophoretic mobility. These results
were confirmed by gel filtration HPLC of stoichiometric mixtures of the same components (Fig.
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 10: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/10.jpg)
10
3). The peaks corresponding to the free components disappeared and were replaced by a major
peak of higher molecular mass. Apparent masses of 150 kDa and 200 kDa were found for binary
and ternary complexes, respectively. The results are in good agreement with the expected sizes of
the desired cellulosome chimeras. A minor peak (~400 kDa) was also observed, which may
suggest that low levels of oligomerization may also occur.
SPR-based estimates of affinity parameters for the interaction of Ac and Fc with the
various chimeric scaffoldins revealed similar Kd values (1-2.5 10-10 M). These results were in
accord with previously determined values for the cohesin-dockerin interaction in C. cellulolyticum
(17). The affinity of At and Ft, however, was too high (>1011 M-1) to be determined using the
Biacore system, suggesting a much stronger interaction in the C. thermocellum cellulosome.
The interaction between the chimeric scaffoldins and different combinations of the enzyme
components is presented in Fig. 4A. In this set of experiments, enzymes bearing C. cellulolyticum
dockerins were introduced prior to those from C. thermocellum. Under saturating or near-
saturating conditions, the amounts of enzyme, Ac or At (85-95 RU) and Fc or Ft (130-140 RU),
that were bound to the immobilized chimeric scaffoldin, were in close agreement with the
calculated Rmax, thus confirming a stoichiometry of 1 :1 :1 for the ternary complexes. The results
indicate that complexation between the enzymes and the C. cellulolyticum cohesin does not
disturb subsequent binding of the second enzyme to the C. thermocellum cohesin.
In another set of experiments, Scaf4 was employed to examine whether assembly of the
chimeric cellulosomes is affected by the mode of interaction among the different components. For
this purpose, the desired enzymes were either introduced simultaneously or in reversed order
(Fig. 4B). The resultant sensograms clearly demonstrated that each type of cohesin binds in an
independent manner to the appropriate dockerin-containing enzyme, irrespective of the order of
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 11: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/11.jpg)
11
incorporation.
Enhanced synergy of cellulosome chimeras—Cellulosome chimeras were generally found to
be more active than simple mixtures of the free enzyme pairs (Fig. 5). Bringing two cellulolytic
modules into close proximity clearly enhances the catalytic efficiency on crystalline cellulose. The
observed enhancement of activity increased with incubation time (data not shown) and reached a
maximum after 24 h. The cellulolytic activity of the enzyme complexes was further improved
when the scaffoldin contained a CBD. When attached to the CBD-containing scaffoldins (Scaf1,
Scaf2 and Scaf3), the heterogeneous enzyme mixtures (Ac + Ft or Fc + At) exhibited an enhanced
synergy of about 2 to 3 fold. In the absence of a CBD (Scaf4), enhanced levels of synergy (~1.5
fold) were also observed. The most effective combinations of components were Scaf1 and Scaf2
together with enzymes Fc and At. Interestingly, the homogeneous mixture of family-5 enzymes
(Ac and At) also displayed levels of enhanced synergy, roughly equivalent to those of the
heterogeneous mixture of Ac and Ft. In contrast, chimeric complexes containing only the family-
48 enzymes (Fc and Ft) showed little if any synergistic action.
DISCUSSION
The results of the present work provide experimental verification of earlier proposals
whereby cellulosome chimeras can be constructed by combining appropriate dockerin-containing
enzymes and recombinant cohesin-containing scaffoldins (9). The concept is shown
schematically in Figure 6. The construction of the desired cellulosome chimeras is generated by
the tenacious binding interaction between complementary modules each located on
complementary interacting components, i.e., cohesins on chimeric scaffoldins and dockerins on
enzyme subunits. The resultant multi-component protein complexes assume some or all of the
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 12: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/12.jpg)
12
functional characteristics of the parent components, such that their proximity within the same
complex leads to enhanced synergistic activity.
In previous works, single enzyme components of the C. thermocellum cellulosome have
been shown individually to exhibit enhanced activity on insoluble cellulose substrates upon
incorporation via a suitable scaffoldin into a cellulosome-like complex. In an early study, Wu et
al. (24) reported that a purified cellulosomal cellulase (CelS) can be combined with the native
scaffoldin, leading to an increase in hydrolytic activity of the complex on crystalline cellulose.
More recently, Kataeva et al. (25) showed that a different cellulosomal enzyme (endoglucanase
CelD) interacts stoichiometrically with scaffoldin constructs, and the resultant complexes were
found to degrade cellulose in a synergistic manner. Yet another cellulosomal enzyme
(endoglucanase CelE) was shown by Ciruela et al. (26) to exhibit enhanced crystalline cellulase
activity upon prior interaction with the full-length recombinant scaffoldin. In each of these latter
studies, only one enzyme type was incorporated into the given complexes, and the observed
enhancement of activity was mainly attributed to targeting of the enzyme to the solid substrate
by the scaffoldin-borne CBD. Finally, Bhat and colleagues (27,28), reconstituted a simplified
cellulosome by combining purified preparations of native cellulosomal components, including the
full-size scaffoldin with selected enzymatic subunits. The resultant reconstituted complex
exhibited enhanced synergy on cellulose compared to the activity of the mixture of free enzymes.
In this communication, we investigated the synergistic interaction of a heterogeneous
system, wherein two different recombinant cellulosomal enzymes were incorporated selectively
into discrete artificial cellulosome complexes by virtue of their vectorial interaction with defined
chimeric scaffoldins. Each of the chimeric scaffoldins contained two cohesins of divergent
specificities. The scaffoldins were designed to examine the contribution of location of the
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 13: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/13.jpg)
13
designated modules therein. Thus, Scaf1 and Scaf2 both contain cohesins from the two species,
but their position vis-à-vis the internal CBD is reversed. The content of Scaf3 is very similar to
that of Scaf2, except its CBD is at an N-terminal rather than internal position. Finally, the
cohesins of Scaf4 are identical to Scaf1, except Scaf4 lacks a CBD. The data indicate that the
activity levels of the chimeric cellulosomes were significantly higher than those of the combined
free enzyme systems, thereby demonstrating that proximity of the different enzymes within the
complex indeed appears critical to the observed enhancement of synergistic action. The presence
of a targeting CBD in the chimeric scaffoldin conferred an additional contribution towards the
final level of enzyme activity displayed by a given complex.
Since the enzymes from C. thermocellum are thermophilic whereas those from C.
cellulolyticum are mesophilic, enzymes from the two bacteria would be incompatible in the same
complex. Thus, the mesophilic C. cellulolyticum cellulases (family-5 CelA and family-48 CelF)
were selected for this work, because their recombinant forms have already been shown to act
synergistically in the free state on crystalline cellulose (Corinne Reverbel-Leroy, Thesis of
Université de Provence, Aix-Marseille France, September 1996). The incorporation of the
enzymes into defined chimeric cellulosomes provided further enhancement of 2- to 3-fold.
It is interesting to note that some enzyme combinations proved better than others. It is
currently unknown why complexes composed of the homogeneous mixture of Ac and At resulted
in enhanced synergy while those of Fc and Ft displayed no synergy. It is also unclear why those
containing the combination of Fc and At consistently showed heightened levels of synergy over
those containing Ac and Ft. A possible stabilizing effect of the cohesin-dockerin interaction on
the Fc and/or At constructs could account for the observed differences. In any case, improved
levels of synergy may eventually be expected by using higher-degree systems that contain
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 14: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/14.jpg)
14
additional or other combinations of enzymes.
Analysis of complex formation by three complementary methods revealed that selectivity
and stoichiometry of the cohesin-dockerin interaction are strictly maintained. In this context, the
individual dockerin-containing enzymes were incorporated into the desired chimeric scaffoldins
via binding to the matching cohesins, in an independent manner, irrespective of the order of
application. The enzymes could be added sequentially or mixed together and applied concurrently
with the same effect: complete and selective incorporation of the desired components.
This work represents an initial demonstration of the approach, and the use of the cohesin-
dockerin interaction as a selective type of molecular adapter for incorporating desired proteins
into multi-component complexes. In doing so, we have used the components of two well-
characterized cellulosome systems, which exhibit divergent cohesin-dockerin specificities. The
present system can be refined and elaborated in several ways. In order to extend the system,
cohesin and dockerin pairs can be used from other cellulosome species (3) to selectively
incorporate additional enzyme components into higher order complexes. Alternatively,
mutagenesis experiments may provide tailor-made specificities for this purpose (8,11,29).
Moreover, the genetic approach can be applied to increase the tenacity of the cohesin-dockerin
interaction thereby reinforcing the stability of the resultant chimeric cellulsomes. In any event,
the capacity to control the specific incorporation of enzymatic and non-enzymatic components
into defined chimeric cellulosome complexes should have considerable biotechnological value for a
broad variety of applications (9).
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 15: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/15.jpg)
15
REFERENCES
1. Felix, C. R., and Ljungdahl, L. G. (1993) Annu. Rev. Microbiol. 47, 791-819
2. Béguin, P., and Lemaire, M. (1996) Crit. Rev. Biochem. Molec. Biol. 31, 201-236
3. Bayer, E. A., Chanzy, H., Lamed, R., and Shoham, Y. (1998) Curr. Opin. Struct. Biol. 8,
548-557
4. Bayer, E. A., Shimon, L. J. W., Lamed, R., and Shoham, Y. (1998) J. Struct. Biol. 124,
221-234
5. Shoham, Y., Lamed, R., and Bayer, E. A. (1999) Trends Microbiol. 7, 275-281
6. Yaron, S., Morag, E., Bayer, E. A., Lamed, R., and Shoham, Y. (1995) FEBS Lett. 360,
121-124
7. Lytle, B., Myers, C., Kruus, K., and Wu, J. H. D. (1996) J. Bacteriol. 178, 1200-1203
8. Pagès, S., Belaich, A., Belaich, J.-P., Morag, E., Lamed, R., Shoham, Y., and Bayer, E. A.
(1997) Proteins 29, 517-527
9. Bayer, E. A., Morag, E., and Lamed, R. (1994) Trends Biotechnol. 12, 378-386
10. Fierobe, H.-P., Gaudin, C., Belaich, A., Loutfi, M., Faure, F., Bagnara, C., Baty, D., and
Belaich, J.-P. (1991) J. Bacteriol. 173, 7956-7962
11. Mechaly, A., Yaron, S., Lamed, R., Fierobe, H.-P., Belaich, A., Belaich, J.-P., Shoham, Y.,
and Bayer, E. A. (2000) Proteins 39, 170-177
12. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene 77, 51-
56
13. Meza, R., Nufiez-Valdez, M.-E., Sanchez, J., and Bravo, A. (1996) FEMS Microbiol. Lett.
145, 333-339
14. Reverbel-Leroy, C., Belaich, A., Bernadac, A., Gaudin, C., Belaich, J.-P., and Tardif, C.
(1996) Microbiology 142, 1013-1023
15. Reverbel-Leroy, C., Pagés, S., Belaich, A., Belaich, J.-P., and Tardif, C. (1997) J.
Bacteriol. 179, 46-52
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 16: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/16.jpg)
16
16. Pagès, S., Belaich, A., Tardif, C., Reverbel-Leroy, C., Gaudin, C., and Belaich, J.-P. (1996)
J. Bacteriol. 178, 2279-2286
17. Fierobe, H.-P., Pagès, S., Belaich, A., Champ, S., Lexa, D., and Belaich, J.-P. (1999)
Biochemistry 38(2), 12822-12832
18. Porath, J., Carlsson, J., Olsson, I., and Belfrage, G. (1975) Nature 258, 598-599
19. Bayer, E. A., and Wilchek, M. (1990) Methods Enzymol. 184, 138-160
20. Park, J. T., and Johnson, M. S. A. (1949) J. Biol. Chem. 181, 149-151
21. Gerngross, U. T., Romaniec, M. P. M., Kobayashi, T., Huskisson, N. S., and Demain, A.
L. (1993) Mol. Microbiol. 8, 325-334
22. Pagès, S., Belaich, A., Fierobe, H.-P., Tardif, C., Gaudin, C., and Belaich, J.-P. (1999) J.
Bacteriol. 181, 1801-1810
23. Wang, W. K., Kruus, K., and Wu, J. H. D. (1993) J. Bacteriol. 175, 1293-1302
24. Wu, J. H. D., Orme-Johnson, W. H., and Demain, A. L. (1988) Biochemistry 27, 1703-
1709
25. Kataeva, I., Guglielmi, G., and Béguin, P. (1997) Biochem. J. 326, 617-624
26. Ciruela, A., Gilbert, H. J., Ali, B. R. S., and Hazlewood, G. P. (1998) FEBS Lett. 422,
221-224
27. Bhat, M. K. (1998) Recent Res. Devel. Biotech. Bioeng. 1, 59-84
28. Bhat, S., Goodenough, P. W., Bhat, M. K., and Owen, E. (1994) Int. J. Biol. Macromol.
16(6), 335-342
29. Mechaly, A., Fierobe, H.-P., Belaich, A., Belaich, J.-P., Lamed, R., Shoham, Y., and
Bayer, E. A. (2001) J. Biol. Chem. 276, 9883-9888
30. Spinelli, S., Fierobe, H. P., Belaich, A., Belaich, J. P., Henrissat, B., and Cambillau, C.
(2000) J Mol Biol 304(2), 189-200
31. Tavares, G. A., Béguin, P., and Alzari, P. M. (1997) J. Mol. Biol. 273, 701-713
32. Shimon, L. J. W., Bayer, E. A., Morag, E., Lamed, R., Yaron, S., Shoham, Y., and Frolow,
F. (1997) Structure 5, 381-390
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 17: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/17.jpg)
17
Figure Legends
FIG. 1. Schematic representation of the recombinant proteins used in this study.
White (C. thermocellum) and gray (C. cellulolyticum) symbols denote the source of the respective
domain (see Key to Symbols). The cohesin domains are numbered according to their original
position in the respective native cellulosomal scaffoldin. A hydrophilic domain (x) of unknown
function is part of the C. cellulolyticum scaffoldin. In the shorthand notation for the enzymes, A
and F represent the catalytic domains from C. cellulolyticum cellulosomal family-5 CelA and
family-48 CelF, respectively; c and t refer to the dockerin domains, derived from C. cellulolyticum
or C. thermocellum, respectively.
FIG. 2. Electrophoretic mobility of components and assembled complexes on
nondenaturing gels. (A) Scaf1-based cellulosome chimeras with Fc and At: lane1, Scaf1 alone;
lane 2, Fc alone; lane 3, At alone; lane 4, binary mixture of Scaf1 and Fc ; lane 5, binary mixture of
Scaf1and At ; lane 6, ternary mixture of Scaf1, Fc and At. (B) Scaf3-based chimeras with the same
enzyme components: Lanes same as (A) with substitution of the designated chimeric scaffoldin.
In each lane, equimolar concentrations (7.5 µM), of the indicated proteins were used, except the
control in lanes 3, where 30 µM of At were applied, due to the characteristic diffuse banding
pattern of the free protein. Similar quality gels were obtained for Scaf2- and Scaf4-based systems.
Note: the minor bands observed in several of the lanes do not reflect significant proteolytic
cleavage of the dockerin domain, as indicated in separate SDS-PAGE experiments (data not
shown).
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 18: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/18.jpg)
18
FIG. 3. Gel filtration HPLC analysis of Scaf3-based components and assembled
chimeric cellulosome complexes. Injected proteins are indicated on each chromatogram.
Vertical lines indicate the positions of molecular mass markers : blue dextran (V0 > 2 MDa), β-
amylase (200 kDa), alcohol dehydrogenase (150 kDa), bovine serum albumin (66 kDa), ovalbumin
(44 kDa) and carbonic anhydrase (29 kDa). Data of similar quality were also obtained for chimeric
cellulosomes based on Scaf1, Scaf2 and Scaf4. Note that the chimeric scaffoldin elutes at a
significantly higher position than its expected molecular mass, an effect possibly related to an
extended arrangement of its modules or the known tendency of uncomplexed cohesins to dimerize
(30-32). On the other hand, the elution of both dockerin-containing enzymes At and Fc is
retarded. This effect appears to reflect the presence of the dockerin domain, since the recombinant
forms of the dockerin-free (truncated) enzymes elute more rapidly, in agreement with the
expected molecular mass (data not shown).
FIG. 4. SPR sensograms showing sequential binding of cellulases onto
immobilized chimeric scaffoldins. (A) Scaf1-, Scaf2- and Scaf3-based systems, in which the
order of injection is the same where the designated C. cellulolyticum enzymes are followed by
those of C. thermocellum, and (B) Scaf4-based systems, in which the order of injection is altered
where c,t = C. cellulolyticum enzymes followed by C. thermocellum, t,c = C. thermocellum
followed by C. cellulolyticum and (c+t) = simultaneous injection of the designated enzymes. In all
graphs, curves 1 = injection of Ac and At (solid lines); 2 = injection of Ac and Ft (dotted lines), 3
= injection of Fc and At (dashed lines) and 4 = injection of Fc and Ft (dot-dashed lines). Black
bars above the figure indicate the duration of the injection of the desired cellulase (5 nM each).
Note the characteristic broad curve of enzymes containing the C. cellulolyticum-derived dockerins
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 19: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/19.jpg)
19
(first injection) compared to the sharp curves of those from C. thermocellum (second injection),
reflecting the remarkably high affinity of the latter cohesin-dockerin interaction.
FIG. 5. Activity of chimeric cellulosomes on microcrystalline cellulose. The
designated pairs of enzymes were mixed in stoichiometric amounts with the indicated chimeric
scaffoldin. The activity on Avicel of the resultant chimeric cellulosome complexes was compared
with that of equimolar concentrations of the free enzymes alone or in the presence of free CBD
from CipC. Microcrystalline cellulase activity represents the amount of soluble sugars released
(µM), measured after 24 h of incubation at 37°C, to a total level of solubilization estimated at
about 2% of the original amount of substrate. Glucose was used as a standard. The data show
the mean and standard deviation of three independent experiments.
FIG. 6. Schematic representation of the approach. A chimeric scaffoldin is produced,
containing an optional carbohydrate-binding module (CBM) and multiple (n) cohesin modules of
different dockerin specificities. The dockerin counterparts comprise distinct modules as part of
the polypeptide chains of the desired protein component (e.g., enzymes A, B, C, and N). The
chimeric cellulosome complex is constructed by simply mixing in solution the chimeric scaffoldin
and dockerin-containing components. The resultant complex exhibits enhanced synergistic
functions, due to the close proximity of the interacting components. (See Figure 1 for key to
symbols).
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 26: M1:02082 — REVISED Design and Production of Active ... · Production and purification of recombinant proteins—E. coli was grown at 37°C to OD 600 = 1.5 in Luria-Bertani medium,](https://reader033.fdocuments.us/reader033/viewer/2022050100/5f3f848a91bac53f2c1cea4a/html5/thumbnails/26.jpg)
Yuval Shoham, Jean-Pierre Belaich and Edward A. BayerHenri-Pierre Fierobe, Adva Mechaly, Chantal Tardif, Anne Belaich, Raphael Lamed,
dockerin-containing enzymes into defined functional complexesDesign and production of active cellulosome chimeras: Selective incorporation of
published online April 4, 2001J. Biol. Chem.
10.1074/jbc.M102082200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on August 21, 2020
http://ww
w.jbc.org/
Dow
nloaded from