m bio m bi ed - Ateneo de Manila University Programs Promotional Brochure.pdfElectives 3 3 6...
A G ATGCCATTGTCCCCCGGC CTCCTGCTGCTGCTGCTCT CC GG GG CC AC GGCCACCGCT GCC CT G C C A C A A G A TG CC ATTG TCC CC C GG CCT C CT G C TG C T G C T G C T A C A A G A T G C C A T T G T A CA A G A T G C C A T T G T C C C C C G G C C TC CT G C T G C TG C T G C TC T CC GG G G CC AC GG CC ACCGCTGC CCT GC C AC AA G AT GC CATTGTC CCCCGGC CTCCTGCTGCTGCTGCTACAAGATGCCATTGTA ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTACAAGATGCCATTGTACAAGATGCCATTGTATENEOGGCCTCCTGCTGCTGCTGCTC Ateneo de Manila University School of Science and Engineering Department of Biology Contact Us Department of Biology Science Education Complex Ateneo de Manila Unversity Katipunan Avenue, Loyola Heights Quezon City, Philippines 1108 Phone: (632) 426 6001 ext. 5610 Telefax: (+632) 426 1034 Email: [email protected] Mission The Department of Biology commits itself to excellence and leadership in undergraduate and graduate programs in the fields of biodiversity, biomedicine, microbiology, molecular biology, and bio-education. It is guided by a dynamic and relevant curriculum that incorporates the strengths of Ateneo tradition and the challenges of the future. As an innovative center of learning, teaching, and research in the life sciences, it is dedicated to serve the University, the country, and all of humanity for the greater glory of God. Vision The Department of Biology envisions itself as the premier provider of excellent education and research in biomedical sciences, biotechnology, conservation biology, microbiology, molecular biology, and bio- education, applying a holistic, rigorous and innovative approach to the biological sciences. Its alumni become prime movers and leaders in medicine, research, industry, and the academe, working toward nation-building from a Filipino, Catholic, and Jesuit perspective. GRADUATE DEPARTMENT ATENEO DE MAN NILA UNIVERSITY PROGRAMS MSc Bio Master of Science in Biology M Bio Master of Biology M Bi Ed Master in Biology Education OFBIOLOGY Insulamon palawanense Freshwater crab from Palawan Dr. Hendrik Freitag The research thrust of the Department of Biology is Biodiversity for Medicine and Environment (BioME). Research activities of graduate students are clustered into three domains: Molecular Biology and Biotechnology; Ecology and Biosystematics; and Biomedicine. Students are trained to acquire a wide range of research techniques that encompass all levels of biological organization—from molecular and cellular to populations and ecosystems. Research Molecular Biology and Biotechnology Ecology and Biosystematics Biomedicine BioME Biodiversity for Medicine and Environment
Transcript of m bio m bi ed - Ateneo de Manila University Programs Promotional Brochure.pdfElectives 3 3 6...
AGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCACAAGATGCCAT
TGTC
CCCC
GGCC
TCCT
GCTG
CTG
CTG
CT A
CAAG
ATG
CCAT
TGT
ACAAGATG
CCATTGTCCCCCG
GCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTACAAGATGCCATTGTA
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTACAAGATGCCATTGTACAAGATGCCATTGTATENEOGGCCTCCTGCTGCTGCTGCTCTC
Ateneo de Manila UniversitySchool of Science and Engineering
Department of Biology
Contact UsDepartment of Biology
Science Education ComplexAteneo de Manila UnversityKatipunan Avenue, Loyola HeightsQuezon City, Philippines 1108
Phone: (632) 426 6001 ext. 5610Telefax: (+632) 426 1034Email: [email protected]
MissionThe Department of Biology commits itself to excellence and leadership in undergraduate and graduate programs in the fields of biodiversity, biomedicine, microbiology, molecular biology, and bio-education. It is guided by a dynamic and relevant curriculum that incorporates the strengths of Ateneo tradition and the challenges of the future. As an innovative center of learning, teaching, and research in the life sciences, it is dedicated to serve the University, the country, and all of humanity for the greater glory of God.
VisionThe Department of Biology envisions itself as the premier provider of excellent education and research in biomedical sciences, biotechnology, conservation biology, microbiology, molecular biology, and bio-education, applying a holistic, rigorous and innovative approach to the biological sciences. Its alumni become prime movers and leaders in medicine, research, industry, and the academe, working toward nation-building from a Filipino, Catholic, and Jesuit perspective.
Graduatedepartment of bioloGyAtEnEo DE MAnilA UniVErSityAtEnEo DE MAnilA UniVErSity
ProgrAMS
mSc bioMaster of Science in Biology
m bioMaster of Biology
m bi edMaster in Biology Education
of bioloGy
Insulamon palawanenseFreshwater crab from PalawanDr. Hendrik Freitag
The research thrust of the Department of Biology is Biodiversity for Medicine and Environment (BioME). Research activities of graduate students are clustered into three domains: Molecular Biology and Biotechnology; Ecology and Biosystematics; and Biomedicine. Students are trained to acquire a wide range of research techniques that encompass all levels of biological organization—from molecular and cellular to populations and ecosystems.
research
Molecular Biology and Biotechnology
Ecology and Biosystematics
Biomedicine
biomeBiodiversity for Medicine
and Environment
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTACAAGATGCCATTGTACAAGATGCCATTGTATENEOGGCCTCCTGCTGCTGCTGCTCTC
Shell shape variation in Conus spp. Mr. Ronald Allan L. Cruz
Phalaenopsis bastianiiDr. Anneke M. Padolina
Pollen grains of Acalypha poiretii and Phyllanthus vacciniifolius.Dr. Vernie G. Sagun
Bioluminescent bacteria isolated from squidDr. Ronie J. Calugay
mSc bioMaster of Science in BiologyThe Master of Science in Biology (M.Sc. Bio) is a research-oriented degree that aims to prepare students for teaching and research, and for work in industry and government agencies that require expertise in the field of biology.
m bioMaster of BiologyThe Master of Biology (M. Bio) program is designed to answer the professional needs of tertiary level biology teachers for upgrading, updating, and retooling. This is a non-thesis, straight coursework program that allows a student to finish the degree within one year and two summers, or within four summers.
m bi edMaster in Biology EducationThe Master in Biology Education (M. Bi Ed) is specifically designed for science teachers of primary and secondary schools. It does not only emphasize content, but also incorporates teaching strategies. The program seeks to address issues on learning and teaching; and current trends in biology education.
Degree ProgramsBi 201 Design and Analysis of ExperimentBi 202 Teaching BiologyBi 203 Special Topics in BiologyBi 220 Advanced Microbiology Bi 221 Advanced VirologyBi 223 Advanced MycologyBi 224 Advanced ParasitologyBi 225 Advanced Medical MicrobiologyBi 226 Advanced Microbial EcologyBi 227 Advanced ImmunologyBi 230 Advanced GeneticsBi 232 Advanced Microbial GeneticsBi 233 Advanced Human GeneticsBi 234 Quantitative GeneticsBi 235 Advanced Population GeneticsBi 236 CytogeneticsBi 237 GenomicsBi 240 Advanced Cell and Molecular BiologyBi 241 Advanced BiotechnologyBi 242 Advanced BioinformaticsBi 251 Advanced Morpho-AnatomyBi 254 Advanced Biology of InvertebratesBi 260 Advanced Developmental BiologyBi 270 Advanced EcologyBi 271 Advanced SystematicsBi 272 Anvanced Freshwater EcologyBi 273 Marine EcologyBi 274 Terrestrial EcologyBi 275 Conservation BiologyBi 276 Advanced Evolutionary Biology Bi 278 Molecular SytematicsBi 279 PhycologyBi 280 Advanced Physiology
Courses
Application can be accomplished through the Office of the Associate Dean for Graduate Programs (http://www.admu.edu.ph/ls/graduate-programs).
50% Tuition Scholarship for Teachers and Academicians. The Loyola Schools offers a 50% tuition scholarship to Filipino Master’s students who are teachers or academicians outside the Ateneo.
Teaching and Graduate Assistantships. Teaching and Graduate Assistants (limited slots) are nominated by the Department Chair and are entitled to full tuition scholarship and allowance.
DOST-ASTHRDP. The DOST Accelerated Science and Technology Human Resource Development Program grants cover tuition and fees, book allowance, stipend, and transportation allowance. (http://www.sei.dost.gov.ph)
CHED. The CHED Faculty Development Program provides full tuition and other fees, a monthly stipend, book allowance, transportation allowance, as well as thesis and dissertation grants. (http://www.ched.gov.ph)
Admission
Scholarships
required Units
Bi 281 Environmental PhysiologyBi 282 Environmental ToxicologyBi 283 EndocrinologyBi 290 Graduate SeminarBi 298 Special Problem (MBio)Bi 299 Graduate Thesis (MSc Bio)BiEd 210 Biology Investigation and InstrumentationBiEd 211 Fundamentals of ResearchBiEd 220 Cell and Molecular Biology for TeachersBiEd 230 Biodiversity and Taxonomy for TeachersBiEd 240 Genetics and Evolution for TeachersBiEd 250 Morphology and Physiology for TeachersBiEd 260 Ecology and Environmental Issues for TeachersBiEd 270 Developmental Biology for TeachersBiEd 280 Physiological Chemistry for TeachersBiEd 290 Practicum (M Bi Ed)Ed 210 Modern Trends and Directions in Curriculum and TeachingEd 234 Educational Materials and MediaEd 254 Psychology of Learning and Teaching
MSc Bio M Bio M Bi Ed
Core Courses 15 15 9
Specialty Courses 6 9 15
Electives 3 3 6
Graduate Seminar 1 1 -
Thesis 6 - -
Special Problem - 3 -
Practicum - - 6
Total no of units 31 31 36
Students are required to pass the comprehensive examinations which will cover all the 5 core courses for MSc Bio and M Bio and the 3 core courses and any 3 specialty courses for M Bi Ed.
Comprehensive Exams
