JOURNAL OF VIROLOGY,0022-538X/00/$04.0010

May 2000, p. 4860–4867 Vol. 74, No. 10

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Lymphoid Organs as a Major Reservoir for Human T-Cell LeukemiaVirus Type 1 in Experimentally Infected Squirrel Monkeys

(Saimiri sciureus): Provirus Expression, Persistence, andHumoral and Cellular Immune Responses

MIRDAD KAZANJI,1,2* ABEL URETA-VIDAL,3 SIMONA OZDEN,4 FREDERIC TANGY,4 BENOIT DE THOISY,5

LAURENCE FIETTE,6 ANTOINE TALARMIN,2 ANTOINE GESSAIN,1 AND GUY DE THE1

Unite d’Oncologie Virale1 and Unite des Virus Lents,4 CNRS-URA D1930, Unite d’Immunite Cellulaire Antivirale,3

and Unite d’Histopathologie,6 Institut Pasteur, Paris, France, and Laboratoire de Retrovirologie2 andCentre de Primatologie,5 Institut Pasteur de la Guyane, Cayenne, French Guiana

Received 10 August 1999/Accepted 17 February 2000

The aim of this study was to investigate the distribution of human T-cell leukemia virus type 1 (HTLV-1) invarious organs of serially sacrificed squirrel monkeys (Saimiri sciureus) in order to localize the reservoir of thevirus and to evaluate the relationship between viral expression and the humoral or cellular immune responseduring infection. Six squirrel monkeys infected with HTLV-1 were sacrificed 6, 12, and 35 days and 3, 6, and26 months after inoculation, and 20 organs and tissues were collected from each animal. PCR and reversetranscription-PCR (RT-PCR) were performed with gag and tax primers. Proviral DNA was detected by PCR inperipheral blood mononuclear cells (PBMCs) of monkeys sacrificed 6 days after inoculation and in PBMCs,spleens, and lymph nodes of monkeys sacrificed 12 and 35 days and 3, 6, and 26 months after inoculation.Furthermore, tax/rex mRNA was detected by RT-PCR in the PBMCs of two monkeys 8 to 12 days afterinoculation and in the spleens and lymph nodes of the monkey sacrificed on day 12. In this animal, scatteredHTLV-1 tax/rex mRNA-positive lymphocytes were detected by in situ hybridization in frozen sections of thespleen, around the germinal centers and close to the arterial capillaries. Anti-HTLV-1 cell-mediated immunitywas evaluated at various times after inoculation. Anti-p40Tax and anti-Env cytolytic T-cell responses weredetected 2 months after infection and remained detectable thereafter. When Tax peptides were used, thisresponse appeared to be directed against various Tax epitopes. Our results indicate that squirrel monkeysrepresent a promising animal model for studying the early events of HTLV-1 infection and for evaluatingcandidate vaccines against HTLV-1.

Human T-cell leukemia/lymphoma virus type 1 (HTLV-1),the causative agent of adult T-cell leukemia (36) and tropicalspastic paraparesis/HTLV-1-associated myelopathy (TSP/HAM) (10), has also been associated with pediatric infectiousdermatitis (22), uveitis (24), and some cases of arthropathy(13) and polymyositis (25).

Owing to the inherent difficulty of obtaining human speci-mens in early HTLV-1 infection, a relevant animal model isessential for better understanding of the seeding of HTLV-1 invarious organs. We showed recently that the squirrel monkeySaimiri sciureus, a South American nonhuman primate which isfree of simian T-cell leukemia virus, is susceptible to experi-mental infection with syngeneic or allogeneic HTLV-1-immor-talized cells (19). As in humans, such experimental inoculationleads to chronic infection, HTLV-1 provirus being detectablein peripheral blood mononuclear cells (PBMCs) by PCR up to36 months after inoculation. Chronically infected monkeys,like HTLV-1-infected humans, develop high titers of antibod-ies against the structural proteins of the virus (19).

In infections with human immunodeficiency virus type 1(HIV-1) and simian immunodeficiency virus (SIV), the lymphnodes are reservoirs that contain a large viral load during theasymptomatic stage (8, 29). A significant percentage of latently

infected lymphocytes are found in the lymph nodes and con-stitute a target for later viral reactivation (7). Indeed, duringclinical latency in HIV or SIV infection, productively infectedcells are detected at higher frequency in lymph nodes than inperipheral blood, indicating the progressive involvement of thelymphoid organs in HIV infection (2, 21, 27). These findingsshow that HIV is widely disseminated in lymphoid tissue rel-atively early in infection. In contrast, little is known about therole of the lymphoid tissues in the early phases of HTLV-1infection.

The aim of the present study was to investigate the earlyevents in HTLV-1 infection and specifically the distribution ofthe HTLV-1 provirus in various organs of serially sacrificedsquirrel monkeys, to localize the reservoir of the latent virus,and to evaluate the humoral and cellular immune responses toinfection.

MATERIALS AND METHODS

Animals and HTLV-1 infection. Three 6-year-old male, two 9-year-old male,and two 7-year-old female squirrel monkeys from the primate breeding center ofthe Pasteur Institute of French Guiana were used in this study. The experimentsperformed complied with French laws relative to animal experimentation. Fiveanimals were inoculated intravenously with 5 3 107 EVO/798 monkey HTLV-1-transformed cells, and one monkey (1491) had been infected previously with107 of these cells; the seventh animal (1657) had been infected previously byintravenous inoculation with 107 monkey HTLV-1-transformed EVO/1540 cells(19). The monkeys were bled at various times after inoculation, and their PBMCswere separated by Ficoll-Paque. The sera were diluted 1/100, and antibodiesagainst HTLV-1 were measured by enzyme-linked immunosorbent assay(ELISA; Diagnostic Biotechnology, Singapore) at various times after infection

* Corresponding author. Mailing address: Laboratoire de Retrovi-rologie, Institut Pasteur de la Guyane, B.P. 6010, 23, Av. Pasteur,97300 Cayenne, French Guiana. Phone: 594 29 68 44. Fax: 594 30 9416. E-mail: mkazanji@pasteur-cayenne.fr.

4860

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 14

Jan

uary

202

2 by

121

.171

.149

.10.

and then confirmed by Western blotting (HTLV blot 2.3; Diagnostic Biotech-nology).

Six monkeys were sacrificed at 6, 12, and 35 days and 3, 6, and 26 months afterinoculation of the cells (Table 1). Before necropsy, the blood was removed byperfusion with 1 liter of physiological saline. Fragments of dissected organs werethen snap-frozen for in situ hybridization or fixed in 4% paraformaldehyde forhistological examination. Specimens from all organs, including lymphatic tissuesand various regions of the brain and spinal cord, were examined histologicallyand tested by PCR for HTLV-1 provirus. The tissue sections were stained withhematoxylin-eosin and blood; bone marrow smears were stained with May-Grunwald-Giemsa.

Detection of the HTLV-1 provirus by PCR and quantitative PCR. GenomicDNA was extracted from PBMCs and various organs by the method described byIbrahim et al. (11). PCR (35 cycles) was performed, as previously described, withprimers Rmtax1 and Rmtax2 (antisense) for the tax region (202 nucleotides) (23)and with primers gag1 and gag2 for the gag region (17). One microgram ofgenomic DNA from the PBMCs or organs was used for each PCR amplification.The amplified products were submitted to electrophoresis on a 1.4% agarose gel,transferred to nylon membranes, and hybridized with 32P-labeled specific inter-nal oligonucleotide probes for tax (59 GGGGCCCTAATAATTCTACCCGAAGACT 39) and gag (59 GCAAAGGTACTGCAGGAGGT 39). The membraneswere washed and exposed to Hyperfilm MP (Amersham, Little Chalfont, UnitedKingdom) at 280°C for 24 h and 1 week. The sensitivity of the PCR wasevaluated with HTLV-1 plasmid p4.39, cloned from HTLV-1 cell line 2060 (26).Plasmid p4.39 DNA was diluted at various concentrations in 1 mg (150,000 cellequivalents) of DNA from uninfected PBMCs and analyzed by PCR.

Copies of proviral HTLV-1 in PBMCs from infected monkeys were quantifiedby the method described by Cimarelli et al. (5). Briefly, competitive PCRs wereperformed with genomic DNA purified from PBMCs of infected monkeys ob-tained at various times after inoculation. The number of HTLV-1 copies wasdetermined in 0.7 mg of DNA, corresponding to the amount of genomic DNAextracted from 105 PBMCs.

Detection of tax/rex mRNA by RT-PCR. Total cellular RNA was extracted fromPBMCs and tissues with Trizol reagent (Gibco BRL, Grand Island, N.Y.). TheRNA was suspended in water and diluted to a final concentration of 0.1 mg/ml.It was then mixed with 15 pmol of the random hexamer primers in a final volumeof 12.7 ml. Reverse transcription (RT) and cDNA synthesis were performed asdescribed previously (30). Immediately after cDNA synthesis, a seminested PCRwas carried out on the pX region, with RPX3 and RPX5 as the outer primers andRPX3 and RPX4 as the inner primers (20). The sequence of the RPX5 primerwas 59 AGGCGGGCCGAACATAGTCCC 39 (antisense). To confirm the pres-ence of amplifiable cDNA in the samples, primers 18SL (59 CCATGGAGAAGGCTGGGG 39; sense) and 20SL (59 CAAAGTTGTCATGGATGACC 39;antisense) were used to detect a portion of glyceraldehyde-3-phosphate dehy-drogenase (GAPDH) mRNA.

Fate of inoculated cells. To confirm that the expression of tax/rex mRNA ofHTLV-1 and HTLV-1 provirus that was detected was not that of surviving cellsfrom the inoculum, we evaluated the fate of the inoculum by inoculating twofemales with the HTLV-1-transformed cell line EVO/798, derived from a male,and sacrificing the two females 6 and 35 days after inoculation. By PCR withprimers VIB and SRY Omega (35), a portion of the Saimiri Y chromosome geneSRY was amplified and identified by hybridization with the SRY probe (59 TATACCTTCTCATACAGAGATAACTGTACAAAATCC 39). This probe was de-fined after cloning and sequencing of the amplified Saimiri SRY product.

In situ hybridization. In situ hybridization was performed on serial sections ofvarious frozen tissues as described by Vazeux et al. (33) and Boche et al. (3).Briefly, 33P- or 35S-labeled antisense riboprobes corresponding to the completetax mRNA sequence were used. These riboprobes were derived from the T3promoter of a Bluescript vector. The sections were exposed for 10 to 20 days to106 cpm/slide. The monkey HTLV-1-transformed cell line EVO/798 was used asa positive control, and negative controls were performed with PBMCs from anHTLV-1-seronegative monkey and frozen monkey tissues in which tax expressionwas not detected by RT-PCR.

Detection of anti-HTLV-1 cell-mediated immunity. Autologous Epstein-Barrvirus-transformed B-lymphoblastoid cell lines were obtained as described previ-ously (4) and used as target cells in the assay for cytolytic activity after infectionwith vaccinia virus–HTLV-1 constructs or loading with exogenous HTLV-1p40Tax peptides. The recombinant vaccinia viruses were kindly provided by H.Shida, Kyoto University, Kyoto, Japan. The overlapping p40Tax peptides de-scribed by Parker et al. (28) were kindly provided by C. Pique, Institut Cochin deGenetique Moleculaire, Paris, France.

Effector cells were prepared as follows. Frozen PBMCs or splenocytes werethawed and cultured for 3 days at 37°C in a CO2 incubator in RPMI 1640 culturemedium containing 10% fetal calf serum, glutamine, penicillin-streptomycin, andsodium pyruvate. The cultured cells were depleted of CD41 T lymphocytes bymagnetic microbeads coupled with monoclonal antibody Leu-3a (miniMACSsystem; Miltenyi Biotec, Auburn, Calif.), which is a mouse anti-human CD4chain that cross-reacts with the squirrel monkey CD4 chain. Autologous irradi-ated CD41 T cells were used as feeder cells for expansion of the CD41-depletedCD81-enriched lymphocytes in vitro in the presence of phytohemagglutinin (5mg/ml; Difco, Detroit, Mich.) and human recombinant interleukin 2 (40 U/ml;Boehringer Mannheim, Mannheim, Germany). The medium was changed every3 to 4 days. After 2 weeks, the expanded T cells were used in a cytolyticchromium release assay. Briefly, 3 3 103 51Cr-loaded target cells were distributedat 100 ml per well in a round-bottom 96-well microtiter plate (Costar, OSI), and100 ml of effector cells at various ratios of effector/target was added to each wellin triplicate or duplicate. The plates were incubated for 4 h at 37°C, 100-mlaliquots of supernatant were collected, and the release of chromium was countedin a gamma counter (LKB, Les Ulis, France). Maximal release was counted intarget cells lysed with aqueous sodium hypochlorite, and spontaneous releasewas counted in target cells incubated alone. The percentage of specific lysis wascalculated as [(cpm experimental release 2 cpm spontaneous release)/(cpmmaximal release 2 cpm spontaneous release)] 3 100. When background lysisdue to vaccinia virus or Epstein-Barr virus antigens was considerable, a 25- to50-fold excess of cold autologous vaccinia virus-infected B-lymphoblastoid celllines was added to reduce it.

Nucleotide sequence accession number. The GenBank accession number ofthe Saimiri SRY sequence reported (359 nucleotides) is AF151695.

RESULTS

Detection of the HTLV-1 provirus and its distribution inorgans of squirrel monkeys. The distribution of the HTLV-1provirus was evaluated by PCR with gag and tax primers in 20organs from the six experimentally infected squirrel monkeyssacrificed at various times after infection (Table 1). Thismethod has been shown to detect five copies of plasmid p4.39diluted in 1 mg of carrier DNA.

In the animal sacrificed 6 days after inoculation, HTLV-1provirus was detected only in PBMCs, liver, and bone marrow.In the animal sacrificed 12 days after inoculation, the proviruswas detected in PBMCs, spleen, and mesenteric and submax-illary lymph nodes. In the four animals sacrificed at 35 days and3, 6, and 26 months after inoculation of the cells, the mostcommon sites of detection of HTLV-1 provirus were PBMCs,spleen, bone marrow, and all tested lymph nodes. In these fouranimals, positive signals were recorded sporadically in salivarygland, thyroid gland, lung, pancreas, intestine, and spinal cord(Table 1).

Fate of the inoculum. The fate of the inoculum was evalu-ated in two females (90047 and 90083) sacrificed 6 and 35 days

TABLE 1. Distribution of HTLV-1 provirus by PCR in PBMCs andvarious organs of serially sacrificed squirrel monkeys

Samplea

Distributionb

900476 D

9203812 D

9008335 D

921063 M

920396 M

165726 M

PBMC 1 1 1 1 1 1Spleen 2 1 1 1 1 1Mesenteric LN 2 1 1 1 1 1Submaxillary LN 2 1 1 1 1 1Axillary LN 2 2 1 1 1 1Inguinal LN 2 2 1 1 1 1Bone marrow 1 2 1 1 1 1Salivary gland 2 2 1 2 1 1Thyroid gland 2 2 1 2 1 2Lung 2 2 1 2 2 1Liver 1 2 2 2 2 2Pancreas 2 2 2 1 2 1Intestine 2 2 2 1 2 1Stomach 2 2 2 2 2 2Heart 2 2 2 2 2 2Muscle 2 2 1 2 2 2Brain 2 2 2 2 2 2TSC 2 2 1 2 2 2CSC 2 2 2 2 2 1LSC 2 2 1 2 2 1

a LN, lymph node; TSC, thoracic spinal cord; CSC, cervical spinal cord; LSC,lumbar spinal cord.

b Monkey number, time of necropsy. D, day; M, month.

VOL. 74, 2000 LYMPHOID ORGANS AS RESERVOIR FOR HTLV-1 IN MONKEYS 4861

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 14

Jan

uary

202

2 by

121

.171

.149

.10.

after inoculation. As seen in Fig. 1, PCR with primers thatdetect part of the SRY sequence of the Y chromosome showedthe presence of the inoculum 24 h later but not thereafter. Thepresence of the inoculum correlates with the detection ofHTLV-1 provirus (202 bp of the tax region) by PCR and tax/rexmRNA by RT-PCR at 24 h in the PBMCs of these inoculatedmonkeys (Fig. 1 and 2A). No positive signal for the SRY wasdetected in PBMCs or in any organs at necropsy. The absenceof a positive signal for the SRY in PBMCs and organs showsthat the presence of HTLV-1 provirus was due to infection ofthe PBMCs and not to persistence of the inoculum.

Dynamics of virus infection in PBMCs as detected by PCR.As seen in Fig. 1, no or very low positive signals were detectedby PCR in the PBMCs of three monkeys 3 days after inocula-tion, but the signals increased after 8 days and became stableafter 16 days in the monkey sacrificed at 35 days (Fig. 1).Furthermore, in three other animals (92106, 92039, and 1657)sacrificed at 3, 6, and 26 months after inoculation, the HTLV-1provirus could be detected by PCR at 3 weeks after inoculationand thereafter. Quantitative PCR was performed to determinethe proviral load in 105 PBMCs from two monkeys, 90083 and92039, sacrificed at 35 days and at 6 months. In the monkeysacrificed at 35 days, we detected 167 HTLV-1 proviral copies8 days after infection and 557 copies at 35 days. In the animalsacrificed at 6 months, we detected 354 proviral copies 3 weeksafter infection and 413 copies on the day of necropsy.

Detection of HTLV-1 provirus expression (tax/rex mRNA)and in situ hybridization in various organs of squirrel mon-keys. RT-PCR was used to examine the expression of tax/rexmRNA in fresh PBMCs and in organs obtained from the an-imals at necropsy. tax/rex mRNA was detected by seminestedPCR only in the PBMCs, spleen, and mesenteric and submax-illary lymph nodes of the animal sacrificed 12 days after inoc-ulation and in PBMCs collected at 12 days from the animalsacrificed at 35 days (Fig. 2). In other animals, tax/rex mRNAcould not be detected in PBMCs at 3 weeks or in organs atnecropsy. In the animal sacrificed at 12 days, in situ hybridiza-tion on several frozen sections of the spleen revealed scatteredHTLV-1-positive lymphocytes around the germinal centersand next to arterial capillaries (Fig. 3). Cells with signals fortax/rex mRNA were observed reproducibly in serial sectionshybridized with 33P- and 35S-labeled riboprobes. In contrast,we observed no positive cells in frozen or paraffin-embeddedorgans, including spleen, lymph nodes, and PBMCs, from mon-keys infected longer.

Thus, in circulating blood cells, spleen, and lymph nodes, theHTLV-1 provirus is transcribed only transiently in vivo, at avery low level.

Pathological and histological investigations. Some lesionsand lymphocyte infiltrations were observed in the salivaryglands of two monkeys sacrificed at 12 days and 3 months, andfollicular hyperplasia was observed in the spleen and lymphnodes of four of the six monkeys.

Humoral responses of inoculated monkeys. When the anti-body response to HTLV-1 was evaluated by ELISA, no anti-HTLV-1 antibodies were detected in the two animals sacrificedat 6 and 12 days; however, as seen in Fig. 4, the monkeysacrificed at 35 days had high antibody responses from 16 daysafter infection, and the three monkeys sacrificed at 3, 6, and 26months after inoculation had antibodies 3 to 6 weeks afterinfection. The positive sera reacted on Western blottingagainst Gag proteins p19 and p24 and Env gp46 peptide (ami-no acids 162 to 209) and recombinant gp21. This antibodyresponse remained stable for 3 to 26 months.

Anti-HTLV-1 cell-mediated immunity. In the two monkeyssacrificed 6 and 12 days after inoculation, no significant cyto-lytic activity was detected in splenocytes against target cellsinfected with recombinant vaccinia virus expressing the wholep40Tax protein (VacTax; Fig. 5A and B) or loaded with p40Tax

peptides. The monkey sacrificed 6 months after inoculation

FIG. 1. Detection of HTLV-1 tax sequence (202 bp) (first line) and SRYsequence of Y chromosome (second line) by PCR in PBMCs of monkeys 90047(female), 92038 (male), and 90083 (female) sacrificed 6, 12, and 35 days afterinoculation. C2 and C1 represent negative and positive controls, respectively.

FIG. 2. Detection of HTLV-1 provirus expression (tax/rex mRNA) by RT-PCR. (A) Detection of tax/rex mRNA (first line) and GAPDH sequence (secondline) in PBMCs of monkeys 90047, 92038, and 90083 sacrificed 6, 12, and 35 daysafter inoculation. (B) Detection of tax/rex mRNA (first line) and GAPDH se-quence (second line) in spleens of different monkeys sacrificed at various timesafter inoculation. C2 and C1 represent negative and positive controls; respec-tively.

4862 KAZANJI ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 14

Jan

uary

202

2 by

121

.171

.149

.10.

showed cytolytic activity in PBMCs against VacTax-infectedtarget cells at 2 months (Fig. 5C) but not at 2 or 6 weeks (datanot shown). This response against p40Tax seemed to be di-rected against various Tax epitopes, as we detected cell-medi-ated immune responses against Tax peptides 151-165, 171-185,261-275, 265-279, and 271-285 (Fig. 5D). Furthermore, at nec-ropsy at 6 months, we observed strong cytolytic activity insplenocytes against p40Tax but only a weak response againstEnv and no specific cytolytic activity against Gag (Fig. 5E).

A cell-mediated immune response in PBMCs againstHTLV-1 proteins was observed in one monkey with long-terminfection at both 20 and 30 months (Fig. 5F) with a very strongresponse against p40Tax and a weaker response against the Envprotein; no response was observed against the Gag product. Inthis animal, the anti-Tax cytolytic response seemed to be di-rected against a unique epitope contained in the Tax 251-265peptide (Fig. 5G). In the second monkey, the cell-mediatedimmune response was weaker than in the first animal, and theonly cytolytic response, detectable in PBMCs at 20 months andin splenocytes at 26 months, was directed against the Envprotein (Fig. 5H and I).

DISCUSSION

We show here that during early HTLV-1 infection of anonhuman primate (S. sciureus), PBMCs, the spleen, andlymph nodes serve as major reservoirs for HTLV-1.

FIG. 3. In situ hybridization with HTLV-1 tax riboprobe on frozen spleen sections from an infected squirrel monkey sacrificed 12 days after inoculation. (A andB) Positive signals in the spleen observed with antisense 33P-labeled riboprobe; arrows indicate positive spleen cells after 10 days of in situ hybridization. (C) Negativecontrol (PBMCs from squirrel monkey not infected with HTLV-1). (D) Positive control (EVO/798 HTLV-1 monkey-transformed cell line).

FIG. 4. Antibody responses of monkeys against HTLV-1, tested by ELISAafter inoculation with homologous HTLV-1 monkey-transformed cell lines.Monkey 90083 was sacrificed at 35 days, monkey 92106 was sacrificed at 3months, monkey 92039 was sacrificed at 6 months, and monkey 1657 was sacri-ficed at 26 months. O.D., optical density.

VOL. 74, 2000 LYMPHOID ORGANS AS RESERVOIR FOR HTLV-1 IN MONKEYS 4863

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 14

Jan

uary

202

2 by

121

.171

.149

.10.

4864 KAZANJI ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 14

Jan

uary

202

2 by

121

.171

.149

.10.

In our previous studies (11, 18), in which adult rats wereused as the experimental model to examine the distribution ofthe HTLV-1 provirus in serially sacrificed animals, the mostfrequent locations of the provirus 12 weeks after infection werePBMCs and the spinal cord; however, 22 weeks after inocula-tion, when the provirus could no longer be detected in theseorgans, it was present in sympathetic nodes. In a study re-ported by Ishiguro et al. (14) in which rats were infected asneonates, the HTLV-1 provirus was widely disseminated in the

lymphoid system, central nervous system, heart, liver, lung, andkidney. The difference from our results could be linked to theage at which the animals were infected, as neonates rather thanas adults, and to the fact that the rats and monkeys in ourstudies were thoroughly perfused before necropsy. PBMCs andmesenteric lymph nodes were also found to be major reservoirsin HTLV-1-infected rabbits (6). Ibuki et al. (12) showed, how-ever, the presence of HTLV-1 provirus in PBMCs, spleens, andlymph nodes of cynomolgus monkeys 51 weeks after inocula-

FIG. 5. Cultured CD41-depleted CD81-enriched cells obtained from PBMCs or splenocytes, used as effectors in cytolytic chromium release assays. Target cellswere autologous B-lymphoblastoid cell lines either uninfected (n.i.), vaccinia virus infected, or Tax peptide loaded. In some cases, a 25- or 50-fold excess of coldautologous vaccinia virus-infected B-lymphoblastoid target cells was added to reduce background. (A) Monkey 90047 sacrificed day 6 after inoculation; CD4-depletedsplenocytes by day 12 of culture. (B) Monkey 92038 sacrificed day 12 after inoculation; CD4-depleted splenocytes by day 18 of culture. (C) Blood from monkey 92039sampled at 2 months; CD4-depleted PBMCs by day 18 of culture. (D) Blood from monkey 92039 sampled at 2 months; CD4-depleted PBMCs by day 16 of culture.(E) Monkey 92039 sacrificed at 6 months; CD4-depleted splenocytes by day 24 of culture. (F) Blood from monkey 1491 sampled 20 and 30 months after inoculation;CD4-depleted PBMCs by days 23 and 15 of culture, respectively. (G) Blood from monkey 1491 sampled 20 and 30 months after inoculation; CD4-depleted PBMCsobtained from blood sample at 30 months after inoculation, by day 19 of culture. (H) Blood from monkey 1657 sampled 20 months after inoculation; CD4-depletedPBMCs by day 26 of culture. (I) Monkey 1657 sacrificed 26 months after inoculation; CD4-depleted splenocytes by day 21 of culture.

VOL. 74, 2000 LYMPHOID ORGANS AS RESERVOIR FOR HTLV-1 IN MONKEYS 4865

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 14

Jan

uary

202

2 by

121

.171

.149

.10.

tion of an HTLV-1-producing T-cell line derived from a ma-caque monkey.

No data are available on the reservoirs of HTLV-1 in hu-mans during the asymptomatic period. In HIV or SIV infec-tion, it is now accepted that the major viral reservoir during theasymptomatic period is lymphoid tissue (2, 8, 21, 27). In thecase of lentiretroviruses, the lymphoid tissue harbors numer-ous virus-producing cells and virions trapped as immune com-plexes in the follicular dendritic cell network of the germinalcenters. These trapped virions could act as a source of infec-tious virus (2). Infected cells can migrate into and throughlymphoid tissue, and naive CD41 cells, in particular, can beinfected within the germinal centers of the lymphoid tissue.

In the present study, HTLV-1 provirus could be detected byPCR 6 days after infection, and we showed by competitivePCR that the proviral load increases in PBMCs of infectedanimals shortly after infection and remains stable thereafter.RT-PCR and in situ hybridization indicated, however, thatHTLV-1 tax/rex mRNA is transcribed transiently during theearly stage of infection (12 days). We cannot conclude thattax/rex expression is not maintained in PBMCs, but it is tooweak to be detected by our method. Nevertheless, it is likelythat tax/rex mRNA expression does not last long and that thelatency occurs very early after infection of squirrel monkeyswith HTLV-1. HTLV-1 expression is rarely detected in asymp-tomatic human chronic carriers of HTLV-1, despite a highproviral load, suggesting that HTLV-1 replication in vivo re-sults predominantly from mitosis of latently infected cellsrather than from RT (34). The genetic stability of HTLV-1, itsweak expression, and the high proviral load cited above favorsuch a hypothesis. Wattel et al. (34) further suggested thatprimary infection with HTLV-1 must involve infected alloge-neic cells, followed by RT and viral replication. Once a fewrounds of RT have taken place, clonal expansion of the in-fected cells should predominate. Our results in the squirrelmonkey model seem to confirm this observation, as we foundexpression of tax/rex mRNA in PBMCs and lymphoid organsonly during the early stage of infection and found only latentHTLV-1 proviral sequences at these sites thereafter. Thiscould reflect clonal expansion of infected cells lacking detect-able viral RNA. Since only a small proportion of HTLV-1carriers develop malignant disease after 30 to 50 years of in-fection, such clonal expansion must be actively controlled byspecific humoral or cell-mediated immunity.

As a first step to addressing the role of the cell-mediatedimmune response in controlling HTLV-1 infection in the squir-rel monkey model, we analyzed its presence at various timesafter infection in serially sacrificed animals. No clear pheno-typing of the cytolytic effectors or of major histocompatibilitycomplex (MHC) restriction could be done, as there are norelevant monoclonal antibodies and MHC class I molecules inthe squirrel monkey have not been well characterized. Work isin progress to better characterize this response. Nevertheless,two observations support the hypothesis that the cytolytic ef-fectors responsible for the responses we observed are CD8 Tlymphocytes. (i) PBMCs were CD4 depleted before addition ofT mitogen, which would favor expansion of CD8 T lympho-cytes in the culture medium. (ii) NK activity is unlikely, as theB cells used as targets express large amounts of class I mole-cules, which are known to inhibit NK activity; furthermore, NKactivity against unloaded viral peptide or wild vaccinia virus-infected B cells was not observed. We therefore conclude thatthe cell-mediated immune responses observed in our study aredue to cytotoxic T-lymphocyte (CTL) activity.

While there was no detectable CTL response during theearly stage of infection (6 and 12 days and 2 or 6 weeks after

inoculation), activity was detected after 2 months and waspresent during chronic infection (up to 20 months). The CTLactivity was directed mainly against HTLV-1 p40Tax protein. Inrats infected with HTLV-1, CTL responses can be detectedagainst Gag, Env, and Tax, with a stronger reaction againstEnv protein (31). In asymptomatic human carriers of HTLV-1and in patients with TSP/HAM, the CTL response is alsodirected mainly against p40Tax protein (15). Bangham et al. (1)suggested that this response could play a major role in con-trolling HTLV-1 replication, but others consider that it couldbe detrimental in some genetically susceptible individuals,leading them to develop TSP/HAM (15). In our squirrel mon-key model, the CTL response seem to be comparable to thatobserved in asymptomatic human HTLV-1 carriers but withdifferent epitopic targets, probably because of differences inantigen presentation by MHC class I molecules.

It was of interest that virus expression in squirrel monkeyswas detected only in the absence of humoral and CTL re-sponses. In SIV infection, both neutralizing antibodies and theCTL response play important roles in limiting viral replicationand in clearance of the agent (9, 16). The CTL response in ournonhuman primate model, which is probably mediated byCD81-enriched lymphocytes, could be of interest for evaluat-ing the role of cytotoxic CD81 T-cell responses duringHTLV-1 infection; however, immunological tools such asmonoclonal antibodies against squirrel monkey CD4 and CD8molecules will be necessary. Although one monoclonal anti-body cross-reactive between human and Saimiri CD4 mole-cules has been identified (Leu-3a), none of the anti-humanCD8 monoclonal antibodies tested has similar cross-reactivity.In an attempt to derive anti-squirrel monkey CD8 monoclonalantibodies, we cloned and sequenced the cDNAs encodingsquirrel monkey CD8 a and b chains (32). The expression ofthese chains in appropriate mouse cells should enable us toderive the monoclonal antibodies needed to evaluate the roleof the antiviral CTL response in chronic HTLV-1 infection andin HTLV-1-induced neurological disease.

ACKNOWLEDGMENTS

We thank E. Wattel for helpful discussion, C. Nicot for the p4.39plasmid, and J. F. Pouliquen and V. Trouplin for technical assistance.We acknowledge the financial support of the Association pour laRecherche contre la Cancer (ARC), Fondation pour la RechercheMedicale (FRM/SIDACTION) and Association Virus Cancer Preven-tion (VCP).

REFERENCES1. Bangham, C., A. G. Kermode, S. E. Hall, and S. Daenke. 1996. The cytotoxic

T-lymphocyte response to HTLV-I: the main determinant of disease. Semin.Virol. 7:41–48.

2. Blacklaws, B. 1997. Quantification of the reservoir of HIV-I. Trends Micro-biol. 5:215–216.

3. Boche, D., E. Khatissian, F. Gray, P. Falanga, L. Montagnier, and B.Hurtrel. 1999. Viral load and neuropathology in the SIV model. J. Neuro-virol. 5:232–240.

4. Chizzolini, C., A. J. Sulzer, M. A. Olsen-Rasmussen, and W. E. Collins. 1991.Epstein-Barr virus transformation of Saimiri sciureus (squirrel monkey) Bcells and generation of a Plasmodium brasilianum-specific monoclonal anti-body in P. brasilianum-infected monkeys. Infect. Immun. 59:2285–2290.

5. Cimarelli, A., C. A. Duclos, A. Gessain, E. Cattaneo, C. Casoli, M. Biglione,P. Mauclere, and U. Bertazzoni. 1995. Quantification of HTLV-II proviralcopies by competitive polymerase chain reaction in peripheral blood mono-nuclear cells of Italian injecting drug users, central Africans, and Amerindi-ans. J. Acquired Immune Defic. Syndr. Hum. Retrovirol. 10:198–204.

6. Cockerell, G. L., M. Lairmore, B. De, J. Rovnak, T. M. Hartley, and I.Miyoshi. 1990. Persistent infection of rabbits with HTLV-I: patterns ofanti-viral antibody reactivity and detection of virus by gene amplification. Int.J. Cancer 45:127–130.

7. Embretson, J., M. Zupancic, J. L. Ribas, A. Burke, P. Racz, K. Tenner-Racz,and A. T. Haase. 1993. Massive covert infection of helper T lymphocytes andmacrophages by HIV during the incubation period of AIDS. Nature 362:359–362.

4866 KAZANJI ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 14

Jan

uary

202

2 by

121

.171

.149

.10.

8. Fox, C. H., and M. Cottler-Fox. 1992. The pathobiology of HIV infection.Immunol. Today 13:353–356.

9. Gallimore, A., M. Cranage, N. Cook, N. Almond, J. Bootman, E. Rud, P.Silvera, M. Dennis, T. Corcoran, and J. Stott. 1995. Early suppression of SIVreplication by CD81 nef-specific cytotoxic T cells in vaccinated macaques.Nat. Med. 1:1167–1173.

10. Gessain, A., F. Barin, J. C. Vernant, O. Gout, L. Maurs, A. Calender, and G.de The. 1985. Antibodies to human T-lymphotropic virus type-I in patientswith tropical spastic paraparesis. Lancet ii:407–410.

11. Ibrahim, F., L. Fiette, A. Gessain, N. Buisson, G. de The, and R. Bomford.1994. Infection of rats with human T-cell leukemia virus type-I: susceptibilityof inbred strains, antibody response and provirus location. Int. J. Cancer58:446–451.

12. Ibuki, K., S. I. Funahashi, H. Yamamoto, M. Nakamura, T. Igarashi, T.Miura, E. Ido, M. Hayami, and H. Shida. 1997. Long-term persistence ofprotective immunity in cynomolgus monkeys immunized with a recombinantvaccinia virus expressing the human T cell leukaemia virus type I envelopegene. J. Gen. Virol. 78:147–152.

13. Ijichi, S., T. Matsuda, I. Maruyama, T. Izumihara, K. Kojima, T. Niimura,Y. Maruyama, S. Sonoda, A. Yoshida, and M. Osame. 1990. Arthritis in ahuman T-lymphotropic virus type-I (HTLV-I) carrier. Ann. Rheum. Dis.49:718–721.

14. Ishiguro, N., M. Abe, K. Seto, H. Sakurai, H. Ikeda, A. Wakisaka, T. To-gashi, M. Tateno, and T. Yoshiki. 1992. A rat model of human T lymphocytevirus type I (HTLV-I) infection. 1. Humoral antibody response, provirusintegration, and HTLV-I-associated myelopathy/tropical spastic paraparesis-like myelopathy in seronegative HTLV-I carrier rats. J. Exp. Med. 176:981–989.

15. Jacobson, S., H. Shida, D. E. McFarlin, A. S. Fauci, and S. Koenig. 1990.Circulating CD81 cytotoxic T lymphocytes specific for HTLV-I pX in pa-tients with HTLV-I associated neurological disease. Nature 348:245–248.

16. Jin, X., D. E. Bauer, S. E. Tuttleton, S. Lewin, A. Gettie, J. Blanchard, C. E.Irwin, J. T. Safrit, J. Mittler, L. Weinberger, L. G. Kostrikis, L. Zhang, A. S.Perelson, and D. D. Ho. 1999. Dramatic rise in plasma viremia after CD8(1)T cell depletion in simian immunodeficiency virus-infected macaques. J. Exp.Med. 189:991–998.

17. Kawase, K., S. Katamine, R. Moriuchi, T. Miyamoto, K. Kubota, H. Iga-rashi, H. Doi, Y. Tsuji, T. Yamabe, and S. Hino. 1992. Maternal transmissionof HTLV-I other than through breast milk: discrepancy between the poly-merase chain reaction positivity of cord blood samples for HTLV-I and thesubsequent seropositivity of individuals. Jpn. J. Cancer Res. 83:968–977.

18. Kazanji, M., F. Ibrahim, L. Fiette, R. Bomford, and G. de The. 1997. Role ofthe genetic background of rats in infection by HTLV-I and HTLV-II and inthe development of associated diseases. Int. J. Cancer 73:131–136.

19. Kazanji, M., J. P. Moreau, R. Mahieux, B. Bonnemains, R. Bomford, A.Gessain, and G. de The. 1997. HTLV-I infection in squirrel monkey (Saımirisciureus) using autologous, homologous or heterologous HTLV-I-trans-formed cell lines. Virology 231:258–266.

20. Kinoshita, T., M. Shimoyama, K. Tobinai, M. Ito, S. Ito, S. Ikeda, K. Tajima,K. Shimotohno, and T. Sugimura. 1989. Detection of mRNA for the tax1/rex1 gene of human T-cell leukemia virus type I in fresh peripheral bloodmononuclear cells of adult T-cell leukemia patients and viral carriers byusing the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86:5620–5624.

21. Lafeuillade, A., C. Poggi, C. Tamalet, and N. Profizi. 1997. Human immu-

nodeficiency virus type 1 dynamics in different lymphoid tissue compart-ments. J. Infect. Dis. 176:804–806.

22. Lagrenade, L., B. Hanchard, V. Fletcher, B. Cranston, and W. Blattner.1990. Infective dermatitis of Jamaican children—a marker for HTLV-I in-fection. Lancet 336:1345–1347.

23. Mahieux, R., G. de The, and A. Gessain. 1995. The tax mutation at nucleo-tide 7959 of human T-cell leukemia virus type 1 (HTLV-1) is not associatedwith tropical spastic paraparesis/HTLV-1-associated myelopathy but islinked to the cosmopolitan molecular genotype. J. Virol. 69:5925–5927.

24. Mochizuki, M., K. Yamaguchi, K. Takatsuki, T. Watanabe, S. Mori, and K.Tajima. 1992. HTLV-I and uveitis. Lancet 339:1110.

25. Morgan, O., P. Rodgers-Johnson, C. Mora, and G. Char. 1989. HTLV-I andpolymyositis in Jamaica. Lancet ii:1184–1186.

26. Nicot, C., T. Astier-Gin, E. Edouard, E. Legrand, D. Moynet, A. Vital, D.Londos-Gagliardi, J. P. Moreau, and B. Guillemain. 1993. Establishment ofHTLV-I-infected cell lines from French, Guianese and West Indian patientsand isolation of a proviral clone producing viral particles. Virus Res. 30:317–334.

27. Pantaleo, G., C. Graziosi, J. F. Demarest, L. Butini, M. Montroni, C. H. Fox,J. M. Orenstein, D. P. Kotler, and A. S. Fauci. 1993. HIV infection is activeand progressive in lymphoid tissue during the clinically latent stage of dis-ease. Nature 362:355–358.

28. Parker, C. E., S. Nightingale, G. P. Taylor, J. Weber, and C. R. Bangham.1994. Circulating anti-Tax cytotoxic T lymphocytes from human T-cell leu-kemia virus type I-infected people, with and without tropical spastic para-paresis, recognize multiple epitopes simultaneously. J. Virol. 68:2860–2868.

29. Schuurman, H. J., W. J. Krone, R. Broekhuizen, and J. Goudsmit. 1988.Expression of RNA and antigens of human immunodeficiency virus type-1(HIV-1) in lymph nodes from HIV-1 infected individuals. Am. J. Pathol.133:516–524.

30. Talarmin, A., L. J. Chandler, M. Kazanji, B. de Thoisy, P. Debon, J. Lelarge,B. Labeau, E. Bourreau, J. C. Vie, R. E. Shope, and J. L. Sarthou. 1998.Mayaro virus fever in French Guiana: isolation, identification, and sero-prevalence. Am. J. Trop. Med. Hyg. 159:452–456.

31. Tanaka, Y., H. Tozawa, Y. Koyanagi, and H. Shida. 1990. Recognition ofhuman T cell leukemia virus type I (HTLV-I) gag and pX gene products byMHC-restricted cytotoxic T lymphocytes induced in rats against syngeneicHTLV-I-infected cells. J. Immunol. 144:4202–4211.

32. Ureta-Vidal, A., Z. Garcia, F. Lemonier, and M. Kazanji. 1999. Molecularcharacterization of cDNAs encoding squirrel monkeys (Saımiri sciureus)CD8 a and b chains. Immunogenetics 49:718–721.

33. Vazeux, R., N. Brousse, A. Jarry, D. Henin, C. Marche, C. Vedrenne, J.Mikol, M. Wolff, C. Michon, W. Rozenbaum, J. F. Bureau, L. Montagnier,and M. Brahic. 1987. AIDS subacute encephalitis: identification of HIVinfected cells. Am. J. Pathol. 126:403–410.

34. Wattel, E., J. P. Vartanian, C. Pannetier, and S. Wain-Hobson. 1995. Clonalexpansion of human T-cell leukemia virus type I-infected cells in asymptom-atic and symptomatic carriers without malignancy. J. Virol. 69:2863–2868.

35. Whitfield, L. S., R. Lovell-Badge, and P. N. Goodfellow. 1993. Rapid se-quence evolution of the mammalian sex-determining gene SRY. Nature364:713–715.

36. Yoshida, M., M. Seiki, K. Yamaguchi, and K. Takatsuki. 1984. Monoclonalintegration of human T-cell leukemia provirus in all primary tumors of adultT-cell leukemia suggests causative role of human T-cell leukemia virus in thedisease. Proc. Natl. Acad. Sci. USA 81:2534–2537.

VOL. 74, 2000 LYMPHOID ORGANS AS RESERVOIR FOR HTLV-1 IN MONKEYS 4867

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 14

Jan

uary

202

2 by

121

.171

.149

.10.