Long Island Tennis Magazine - September/October 2012

65 Long Island Tennis Magazine • September/October 2012 • LITennisMag.com


"ALPS" is a program for High Aptitude Learners.

The Early Hit Training Center is pleased to an-nounce it's 7th season of group training.This comprehensive program will provide

your child with all the resources necessary toreach his/her maximum tennis potential.

The Early Hit Training Center incorporates all aspects of the gameinto our complete program. After a thorough warm-up, the studentwill work through the core components of tennis, including strokeproduction and drilling. We then moveonto playing dynamics and strategy,and reinforce these lessons with fo-cused match play. A session starts orfinishes with an hour of conditioning.

Come experience our team of renowned tennis teaching pro-fessionals, conditioning trainers and movement experts.

Junior Alps ProgramFALL 2012

TUESDAY6:00 pm - 8:30 pm • 7:30 pm - 10:00 pm

SATURDAY8:00 am - 10:30 am

SUNDAY8:00 am - 10:30 am • 3:30 pm - 6:00 pm

Early HitWINTER 2012/SPRING 2013

LIM

ITE

D A

VA

ILA

BIL

ITY

•LIM

ITE

D A

VA

ILA

BIL

ITY

•LIM

ITE

D A

VA

ILA

BIL

ITY

•LIM

ITE

D A

VA

ILA

BIL

ITY

•LIM

ITE

D A

VA

ILA

BIL

ITY

•LIM

ITE

D A

VA

ILA

BIL

ITY

•LIM

ITE

D A

VA

ILA

BIL

ITY

DAILY6:00 am - 8:00 am365 Days a Year

Late HitWEDNESDAY

9:00 pm - 11:00 pm

FRIDAY8:00 pm - 10:30 pm

SATURDAY7:00 pm - 9:30 pm

SUNDAY7:00 pm - 9:30 pm

Drills, coaching, and match play.Singles & Doubles

at

1LITennisMag.com • September/October 2012 • Long Island Tennis Magazine

By Alan Fleishman

Since I was 21, tennis hasbeen a central part of mylife. This year, I turned 65,and a lot has happened in

the intervening years: Marriages, divorces,children, wooden racquets, metal racquets,short shorts, long shorts, white balls, yel-low balls, watching, learning, coaching andfinally, appreciating all of these things.

Living in Florida and turning 65 (theequivalent of having a Bar Mitzvah, sincethey treat you like a “boy” until then) andwatching Wimbledon since Arthur Ashebrilliantly crafted an underdog victoryagainst the sensational Jimmy Connors,champions and runner ups have taken toCenter Court to compete for the tennisequivalent of the Holy Grail.

Occasionally, personal experiences co-incide with chronology. Sitting watching thescores of the Gentlemen’s Doubles, Iwatched my friend Scott Lipsky reach thequarterfinals, losing to Bob & Mike Bryanin five sets. I watched one of my formerstudent’s son, Noah Rubin, struggle in thejuniors, and I watched a titanic struggle be-tween my hero, and perhaps one of thesport’s greatest players and ambassadors,Roger Federer, and a man who carried anation on his shoulders, Andy Murray ... theveteran against the challenger.

It has been a tough year. Normally, Iwould have been on the phone with mymom, who loved to watch, but neverplayed. Sadly, this year she’s not here toshare the recap; such is the circle of life. Iam trying to balance skills diminished bytime with the untarnished joy of hitting aball within the lines.

Unlike New York, in Florida, the sunshines most of the time, but some of thepeople I compete against, are more con-

cerned with the lines on their faces than thelines on the court. It is not overly important,since none of us will be invited to competeat the All England Club anytime in the nearfuture. That’s okay, the beer is just as re-freshing after the match.

What a match. Racquets sound like riflesand the pace sounds like a racing pulse.HDTV makes it even more impressive. Tohit one forehand, one pass or one dropshot like that would be tennis heaven.The only shot that I have in common withFederer is the shank/frame that goes outby five yards. I hit that shot with more reg-ularity than he does. Both certainly broughtit all to Center Court. We all speak of NovakDjokovic’s coverage, but it seems every-thing Roger hit in the first set came backwith an answer.

For those of you too young to remember,Murray’s coach, Ivan Lendl, previously livedthrough the same crucifixion that the Britishpress leveled against Tim Henman and, be-fore today, Andy Murray. It is possible to bea half-step slower when you are carryingthe dreams of the Commonwealth onyour back. Of course, Federer had his owndemons. How do you rise to the occasionagainst the calendar? Established, com-fortable and a happily married father, howdo you find the desire to dig into the cor-ners, leap up for the millionth overhead ofyour career? As I settled down to watch, Ithought of Johnny Mac, Bjorn Borg, StephanEdberg, Jim Courier, Pete Sampras and allof the other greats who walked out toplay on the equivalent of Lourdes for atennis fan.

I also thought of all the high school play-ers who came out and played on a far lessfamous venue, whether it be courts withcracks that qualify as fault zones againstopponents who missed as many shots asthey made, but still proved more than a

challenge after a full day at school.I think we witnessed two different

matches in the 2012 Wimbledon Men’sSingles Finals—one with the roof open andone with the roof closed. My players didn’tconcern themselves with roofs. Theyplayed in freezing cold (the outdoor seasonbegan in early March), howling winds,courts divided by metal fences rather thantennis nets, and opponents who wanted towin as badly as Murray and Federer. Be-lieve me, I think that the last competitorwho walked away a winner was a Federerin his own right, and his opponent was ascrushed and deflated as Murray.

Hope springs eternal in the humanbreast, and to see the true sportsmanshipand compassion expressed by both men;their understanding of the human conditionthat says one will win, one will lose. Whateffort, exertion, athleticism exhibited andthe ultimate handshake at the net, the paton the back and the precious words ex-changed at the end really say that therewas no loser. Someone came in second. Tome, this is why sports holds the promise ofa metaphor for a life well lived.

Sorry I can’t call, mom.

Alan Fleishman has been a devoted fan oftennis since 1969. He won the Town ofHempstead tennis tournament at New-bridge Road Park in 1972 and was runner-up in 1974. He worked as an assistant tothe tennis professional in the summer pro-gram at Lutheran High School in the early1970s. While teaching social studies atJohn F. Kennedy High School in Bellmore,N.Y., he was fortunate to have coachedsome talented players, but more impor-tantly, some wonderful young men andwomen during his last seven years at theschool. He may be reached by e-mail [email protected].

Witnessing

Wimbledon

Feature Stories6 The Pros Shine on the Grandest Stage in London

at 2012 Olympic Games

14 A Look Back at the 2012 New York Sportimes Season

49 2012 Girls High School Preview

Additional Features1 Witnessing Wimbledon By Alan Fleishman

3 BOLT Releases New Light-Head Models9 Tryouts Set for 2013 USA Maccabiah Tennis Team35 Introducing Love Tennis by hazel36 McEnroe, Agassi, Sampras and Rafter to Compete in NASDAQ Indexes Cup at MSG37 John McEnroe Tennis Academy Honors Eight With Fall Scholarships41 College Recruiting Videos: How Are They Made? By Jeff Fenton

45 Creating Emotion With Strings by Racquet Art50 Football Season is Coming Again By Lonnie Mitchel

52 The Yellow Movement: The 3 R’s of Tennis By Daniel Kresh

53 Practicing Success By Miguel Cervantes III

54 My French Open Experience By Dr. Aaron Freilich

Columns4 Winning Within: The Tennis Player is a Person First and Performer Second

By Rob Polishook, MA, CPC10 Adult League Wrap-Up: Where Has Sportsmanship Gone? By Kathy Miller16 Long Island Tennis Magazine’s Literary Corner: Winning Tennis Strokes By Bill

Longua By Brent Shearer30 Dr. Tom on the Secret to Making a Prodigy By Dr. Tom Ferraro31 College Tennis Spotlight By Ricky Becker34 Long Island Tennis Magazine’s Charitable Initiatives By Teri Mariani 38 Court Six: Long Island Tennis Magazine’s Gossip Column By Emilie Katz42 Fitness and Nutrition By Frank Dolan, BS, CSCS & By Irina Belfer-Lehat44 Tips From the Tennis Pro: Three Secrets to a Better Serve Today By Lisa Dodson46 USTA Eastern Long Island Region Update57 Off-the-Court Directory59 Long Island Rankings62 USTA/Long Island Region 2012 Tournament Schedule

Cover photo credit: Getty Images/USTA

18 2012 U.S. Open PreviewPreviewing the stars as they set to take over New York at the 2012 U.S. Open,with a closer look at the contenders, pretenders, the state of American tennis,what you can learn from the pros at the U.S. Open … the sights, the sounds, theattractions and the pageantry that is the 2012 U.S. Open.

Cover storyTABLE OF CONTENTS

2

2

Long Island Tennis Magazine1220 Wantagh Avenue • Wantagh, NY 11793-2202

Phone: (516) 409-4444 • Fax: (516) 409-4600Web site: www.litennismag.com

StaffDavid Sickmen

Publisher(516) 409-4444, ext. 309 • [email protected]

Joel M. BermanPresident

(516) 409-4444, ext. 310 • [email protected]

Eric C. PeckEditor-in-Chief


Joey ArendtManaging Art Director

Jon BlakeAdvertising Coordinator


Adam WolfthalDirector of Business Development


Anthony PastecchiEditorial Coordinator/Reporter


Emilie KatzMarketing Coordinator

Tara CookBilling Coordinator

(516) 409-4444, ext. 324

Beverly KoondelOffice Administrator

(516) 409-4444, ext. 316

AdvertisingTo receive any information regarding advertising rates, dead-lines, and requirements, call (516) 409-4444 or [email protected].

Article Submissions/Press ReleasesTo submit any material, including articles and press releases, pleasecall (516) 409-4444 or e-mail [email protected]. The deadlinefor submissions is the first of the month preceding the target issue.

SubscriptionsTo receive subscription information, contact (516) 409-4444 ore-mail [email protected] or check out our Web site: www.liten-nismag.com. Fax subscription changes to (516) 409-1600.

Statements of fact and opinion in Long Island Tennis Magazine are theresponsibility of the authors alone and do not imply an opinion on the partof United Sports Publications Ltd. Long Island Tennis Magazinereserves the right to edit, reject and/or postpone the publication of anyarticles, information or data.

September/October 2012Volume 4, Number 5

Long Island Tennis Magazineis published bi-monthly by

United Sports Publications Ltd.Copyright © 2012 United Sports Publications Ltd.

Brent ShearerEditorial Contributor

Kenneth B. GoldbergPhotographer

Kristen KelleherIntern

Kristen MaggioIntern

Jenna PoczikIntern

Jessica StilesIntern


BOLT Sports LLC, NY will introduce twonew tennis racquet models, a 12-pack rac-quet bag and related apparel into its prod-uct line to coincide with the U.S. Open. Thenew racquet models, the B98.light and theB100.light, feature ZipStrip, BOLT’s spring-suspension design. According to BOLT, thehead-light balance of the new racquetsmakes them easy to swing and makesfaster racquet head speeds easier to attainas compared to previous even-balancemodels.

“The combination of faster racquet headspeed with stiff BOLT frames and the extradwell time afforded by our ZipStrips, is aferocious recipe for extreme-velocity spin,particularly when coupled with polyestertype strings,” said BOLT Director BrettBothwell.

The B98.light is for tournament-caliberplayers seeking a head-light, yet powerfuland solid racquet with good feel.

B100.light: 100 square inches, 10.5ounces (strung), three points head-light, 27 inches longThe B100.light is suited to a wide range ofrecreational players, from beginner tosemi-pro. The 100.light is easy-to-swing,forgiving and super comfortable.

B98.light: 98 square inches, 11.1ounces (strung), five points head-light, 27 inches long“The 98.light gets us into the mix with tour-nament juniors, a critical market for our fu-ture growth, and the 100.light has appeal for3.0 and 3.5 players who are, of course, alsocritical to our future,” said Bothwell. “Theplayer response to our ZipStrip design hasbeen off the charts, but one certainly can’t

BOLT Releases New Head-Light Models

appeal to the entire market from pros to be-ginners with just a few frames. This intro-duction is the first of many more ahead aswe expand the product line to include awider range of sizes, weights, and balances,and to cover the full range of player typesand playing levels in the future.”

For more information, visit www.boltad-vance.com or e-mail [email protected].

SPORTIME’S TENNIS& EXCEL TENNIS CAMPSSERIOUS TENNIS, SERIOUS FITNESS, SERIOUS FUN!

THERE’S A SPORTIME TENNIS CAMP NEAR YOU!SPORTIME AMAGANSETT - 631/267-3460 | SPORTIME BETHPAGE - 516/933-8500SPORTIME KINGS PARK - 631/269-6300 | SPORTIME LYNBROOK - 516/887-1330 SPORTIME MASSAPEQUA - 516/799-3550 | SPORTIME QUOGUE - 631/653-6767SPORTIME RANDALL’S ISLAND- 212/427-6150 | SPORTIME ROSLYN - 516/484-9222SPORTIME SYOSSET - 516/364-2727

FIND OUT MORE AT WWW.SPORTIMENY.COM AND CLICK ON ‘CAMPS’.SPORTIMESM... Fitness for Real Life

888/NY TENNIS | www.SportimeNY.comEXCITING NEWS!

The John McEnroe Tennis Academycomes to SPORTIME Bethpage Tennis

September 2012!www.JohnMcEnroeTennisAcademy.com


The tennis player is a personfirst and a performer second.This idea may seem obvious,since we are all born without aracket in our hands, and whenwe first walked onto the court

to play, we didn’t miraculously change identi-ties—we were the same person. Rafael Nadal,in his book Rafa, says, “Tennis is what I do; itis not who I am.” Yet years later, when we holdthat racket in our hands and demonstrate abil-ity in the sport, the way others view us oftenbegins to change the identity from person toplayer. Simply put, when you walk onto thecourt, the insecurities, experiences and trau-mas which you hold as a person do not goaway. You carry them onto the court whereveryou go. For this reason, it’s imperative to getyour personal life in order whenever you hopeto play peak performance tennis.

It can be helpful to think of your develop-ment in sports and life as a tree. A tree startsfrom a seed where the roots create a founda-tion, an anchor of sorts. The roots can be

thought of as the person’s values, belief sys-tem, cultural orientation, work ethic and soul.Influential people in our lives, like our parents,coaches, friends and extended family, play arole in how our roots grow. For example, byencouraging such traits as moral values, per-sonal confidence, self-belief, personal re-siliency and self-empowerment, a person willbe better suited to face obstacles, setbacks,and life’s challenges. Jose Higueras stated, inthe USTA High Performance Newsletter (Vol.10, No. 1), “I’m a big fan of trying to make theplayer as independent as possible.” So re-member, junior players … the stronger the rootsystem, the stronger the physical trunk andbranches become.

The fruits are always a result of the roots.However, these fruits (outcome) often garnermore attention than the roots (process). Theallure of the fruits often shift the focus awayfrom development and the process. They shiftthe focus to the outcome and away from howand what needs to happen to achieve the out-come. Yet make no mistake, development all

starts from the seed and the root system. Dr.David Grand, a psychologist and co-author ofThis is Your Brain on Sports, noted for his workin the field of sports and performance, says,“The foundation is the person—how you playis often a manifestation of yourself, includingyour weakest and strongest points.”

Now, think back to the time you were hav-ing a bad practice or match, exhibiting badbody language, or were just not yourself. Howmuch of this could have been a result of arough day at school, an argument with a friend,parental expectations, or even anxiety aboutan upcoming tournament? Oftentimes, it is off-court issues or unrelated stresses that affectperformance on the court. Awareness of thecomplexity of the person-player relationshipwill help you realize that you’re not a robot! Andthose off-the-court stresses, experiences, andemotional and physical traumas oftentimes getsuppressed in the mind, but the body remem-bers at the conscious or unconscious level.

Another scenario is walking off the courtafter a heartbreaking loss, dejected and rat-

Winning Within-The Tennis Player is a Person

First and Performer SecondBy Rob Polishook, Mental Training Coach, MA, CPC

ross@TENNIS

18 GOODFRIEND DRIVE EAST HAMPTON, NY

JUNIOR + ADULT PROGRAMSHIGH PERFORMANCE ACADEMYROSS SCHOOL TENNIS ACADEMYPRIVATE INSTRUCTION + COURT RENTALS

WWW.ROSS.ORG/TENNIS631-907-5162


tled. A match where you really felt you shouldhave won, but lost your focus and missed ahuge overhead in the third set tie-breaker. Youcould hear the crowd gasp, as your stomachclutched with embarrassment. Certainly, thenext time a big overhead comes up in amatch, it’s likely the missed overhead will flashbefore you like a shooting star. The mind andbody remember trauma.

Lastly, imagine this: The serve is a huge partof your game; in competition, you tear your ro-tator cuff, undergo surgery, and have to besidelined from the game for four months. Whenyou return, people ask how the shoulder is. Youreply like a warrior, “It feels great. Never felt bet-ter.” However, in practice, you’re afraid to go allout and hit your bombs due to some lingeringpain. Then, you change your motion to alleviatethe pain. After that you go through a period ofexcessive double faults. What’s important tounderstand is that the body remembers anykind of physical trauma, especially injuries andsurgeries. The body will try to protect itself fromfurther injury recurrence. Most athletes recoverfrom injuries on a physical level, however heal-ing the mental scars is much more difficult.

Carlos Rodriguez, coach of Justine Henin,said it best in The New York Times, “The ten-nis player is still first a human being. If thehuman being is going good, feeling good, sowill the tennis player.”

James Blake, in his book Breaking Back,said, “My greatest professional successes oc-curred after I faced my most personal chal-lenges … I used to think that was ironic; nowI realize that success flows directly from hav-ing cleared those hurdles.”

In summary, when an athlete crosses thelines, they are still the person and carry is-sues, experiences and traumas with them.The fruits are a result of the roots.

Rob Polishook, MA, CPC is the founder and di-rector of Inside the Zone Sports PerformanceGroup. As a mental training coach he workswith athletes and teams of all levels. His workfocuses on helping athletes gain the mentaledge and letting go of blocks which get in theway of peak performance. He is a USTA ZonalCoach and has spoken and been published forthe USTA, USPTA and ITA. Additionally, he hasconducted workshops nationally and interna-tionally in India and Israel. He may be reachedby phone at (973) 723-0314, e-mail rob@insid-ethezone or visit www.insidethezone.com.

214 COMMACK ROAD • COMMACK(1/2 MILE SOUTH OF JERICHO TPKE)

631-499-6444

GIRL’S TENNIS TEAM SPECIALSRed Tag Sneaker

Clearance

$29.98 to $89.98 Wilson - BLX Series -

New Juice and Steam Racquet

Head - Youtek, IG Radical

& Prestige

Dunlop - Biomimetics

Babolat - New Pure Drive GT

(Women’s, Men’s & Boy’s)

Special Team PricingFor Racquet Re-Stringing

& Re-Grip (Check in store for details)

Be the first to Demo the new 2012

Racquets from

Dress Up The Family For Less!10%

30%40%

50%...AND MORE!

ag Snea

eam Pric

Red TTaClearance

$29.98 to $89.9

s & BoMen’s,omen’(W

Special TTe

aker

Wilson

cing

e

98

s)

- BL

New Juice and

Head oute - YYo

& P

Be the

oy’

Demo the Racque

LX Series -

Steam Racquet

IG Radicalek,

ti

first to new 2012

ets from

For Racquet Re-Stri& Re-Grip

(Check in store for deta

& PrengingDunlop - Bi

Babolat - New ails)

estige

iomimetics

Pure Drive GT


Just three short weeks beforethe Olympics, history wasmade by Roger Federer, takinghis record-tying seventh title atWimbledon. At the age of 31,Roger won his 17th GrandSlam title, giving him therecord for most Men’s Singles

Grand Slam Championships and vaultinghim back to the number one ranking. Ap-proximately 470 hours after that finalended, the first Olympic tennis match wasplayed on the grounds of the All EnglandLawn Tennis and Croquet Club, kicking offthe 2012 London Olympic Games. Thegrounds looked different, the standard darkgreen color was covered by the magentabanners of the Olympics. The standard“All-Whites” rule was not in effect, andplayers were free to wear what they

pleased, be it for national pride or to pro-mote their newest line of clothing, for exam-ple Eleven by Venus Williams. It was to bethe first time that Olympic Gold was con-tested on grass since 1920, and it seemedthat Federer would finally fill in the one spoton his resume with any room for improve-ment, an Olympic Singles Gold Medal.

Men’s Singles

Photo credit: Kenneth B. Goldberg

Andy Murray defeated top-seed R o g e rF e d e r e r o f Switzerland, 6-2, 6-1, 6-4 to

capture the Gold Medal. It was a rematch ofthe 2012 Wimbledon finals, and this time,the outcome was in favor of the hometownMurray who became the first British man towin a singles gold medal in 104 years.

“It’s definitely different,” said Murray.“I’ve won an Olympic Gold Medal. Ihaven’t won a Grand Slam. I know howthis feels and it feels great. I’ve lostsome tough matches in some tough fi-nals and that’s hurt me a lot. I think ten-nis in the Olympics is getting better eachtime it’s played, because all the topplayers are playing now. For me, it’s thebiggest win of my life.”

Murray follows in the footsteps of JohnPius Boland (1900), Laurence Doherty(1904), Josiah Ritchie (1908 outdoors) andArthur Gore (1908 indoors) as maleOlympic singles Gold Medalists represent-ing Great Britain.

“This week has been absolutely incredi-ble, I’ve had a lot of fun,” said Murray. “I feltso fresh on the court today. I didn’t feelnervous really at all, apart from at the be-ginning of the match. The support’s beenunbelievable.

Argentina’s Juan Martin del Potro de-feated second-seeded Novak Djokovicof Serbia 7-5, 6-4 to win the BronzeMedal, capturing his nation’s first medalat the Games. del Potro has a 45-11record this year, having won two ATPWorld Tour titles in 2012, at the Open 13in Marseille and at the Estoril Open. Hecame into the match with a 1-4 lifetimerecord against Djokovic.

“[It is a] disappointing end, but I en-joyed it,” said Djokovic after the loss. “It

The Pros Shine on the Grandest Stagein London at 2012 Olympic Games


PROFESSIONALISM • QUALITY • NO MEMBERSHIP FEES

KARL SOMMER• Long Island tennis icon• 1998 USTA teaching professional of the year• Renowned for development of ten-and-under

talent• Influenced thousands of players at every level

RICKY BECKER• #4 Nationally ranked junior• Stanford University MVP• 4-Time Roslyn High School MVP• Developed Numerous USTA Champions

GAME ON!

[email protected] • GLENHEADRACQUETCLUB.COM

TWO TOP COACHES UNITE TO CREATE THE ULTIMATETENNIS EXPERIENCE THAT LONG ISLAND HAS BEEN WAITING FOR!

was a pleasure playing for my country.”Djokovic has a 45-7 match record to

date in 2012, with two titles under his belt,the Australian Open and the Sony EricssonOpen in Miami.

“It’s our [Argentina’s] first medal atthis Olympic Games,” said del Potro.“It’s the first time in men’s singles. I thinkit means a lot for us. I wish a fantasticday for [Argentineans] to celebrate thiswith me … it’s amazing. It’s history, Ithink. It’s time to celebrate all together.”

Women’s Singles

hoto credit: Kenneth B. Goldberg

Fourteen-time Grand Slam winner SerenaWilliams of the United States defeatedRussia’s Maria Sharapova 6-0, 6-1 to winthe Gold Medal in the Women’s SinglesTennis Final. Serena joins elite company, asshe has won a career singles GoldenGrand Slam, in addition to the two doublesGold Medals that she won with sisterVenus. Serena is currently on a 17-matchwinning streak and has won the last sevenmatches she played against Sharapova,who took home the Silver Medal.

Serena lost just 13 games in the fourOlympic finals she has won: 2000 Syd-ney doubles, 2008 Beijing doubles, 2012London singles and doubles.

Olympic Bronze went to VictoriaAzarenka of Belarus, a 6-1, 6-0 winner overRussia’s Maria Kirilenko. Azarenka’s winensured that the three women’s GrandSlam winners to date collected three of thewomen’s singles medals up for grabs atLondon 2012, as Azarenka added a BronzeMedal to her 2012 Australian Open title,Sharapova added a Silver Medal to her2012 French Open title, and Serena addedher Gold Medal to her 2012 WimbledonChampionship.

Men’s Doubles

Americans Bob & Mike Bryan won theGold Medal in Men’s Doubles, defeatingFrance’s Michael Llodra & Jo-WilfriedTsonga 6-4, 7-6(2). The Bryans capital-ized on a slow start by their French op-ponents to break Tsonga in the firstgame, after they forced them into severalvolley errors. At 4-3, Mike Bryan cameunder tremendous pressure on serve. Butfought back from 15/40 and saved fivebreak points in total.

“This is the biggest win of our careerright here,” said Bob Bryan. “It’s unbe-lievable.” At the 2008 Beijing Olympics,the Bryans won the Bronze Medal.

“To play on Centre Court at Wimbledonand win the gold medal is a dream cometrue,” said Mike Bryan. “We could stoptomorrow and we got a big smile on ourface for the rest of our lives.”

The Bryans join Australians ToddWoodbridge & Mark Woodforde as theonly pairs to win multiple medals in the

men’s doubles event since tennis re-turned to the Olympic Games in 1988.

Frenchmen Richard Gasquet & JulienBenneteau defeat David Ferrer & FelicianoLopez of Spain 7-6(4), 6-2 to win theBronze Medal in men’s doubles.

Women’s Doubles

The overpowering American pair of Serena& Venus Williams won the 2012 OlympicWomen’s Doubles Gold Medal. TheWilliams Sisters beat Andrea Hlavackova &Lucie Hradecka of the Czech Republic, 6-4, 6-4 under the roof on a rainy afternoon atthe All England Club.

“We all talk about this. We have so manymedals, but to be able to add to that, it’slike an unbelievable feeling,” Venus said.“You know that in that count, there you are.It feels amazing.”

The Americans in the crowd at CentreCourt broke into a chant of “U-S-A! U-S-A!”

continued on page 8


as the players left the court, the sisters pumpedtheir fists, turned to wave, then slapped a high-five. This was another commanding perform-ance, as the Sisters did not drop a set throughtheir five matches in London.

Third-seeded Maria Kirilenko & NadiaPetrova of Russia took the Bronze Medal bybeating the top-seeded U.S. pair of LiezelHuber & Lisa Raymond, 4-6, 6-4, 6-1.

Mixed-Doubles

Andy Murray didn’t have long to celebratehis Singles Championship, as he wasslated to head back onto the courts just 45

The Pros Shine continued from page 7

minutes later in the mixed-doubles finals,as he and partner Laura Robson faced MaxMirnyi & Victoria Azarenka of Belarus.Murray had to settle for silver however, asthe pair fell to the Belarussians who pre-vailed in a close match tie-break to winOlympic Gold, 2-6, 6-3, 10-8.

Mike Bryan won his second medal of theweekend when he and U.S. teammate LisaRaymond took the Bronze Medal in mixed-doubles, which returned to the Olympicsfor the first time since 1924.

The Americans performed extremelywell in London, taking home three of fiveavailable Gold Medals in Olympic Tennis.More history was made at the All EnglandLawn Tennis Club with Murray becomingthe first Brit to win Olympic gold in Men’s

Singles Tennis in104 years andSerena becomingthe first woman toever complete theGolden Slam inboth Singles andDoubles. With onlythree weeks be-tween the Olympicfinals and the startof the 2012 U.S.Open, many players have decided totake some time off. Serena said thatnow she has won everything and will goto Disney World, while Federer has re-portedly decided to spend the time withhis family. With the shortened warm upfor the hard court season this year, itwill be intriguing to see how playerscontend with the conditions in FlushingMeadows.

www.LoveTennisByHazel.com

Tennis InspiredFine Jewelry

A game-changing new jewelry line that celebrates a passion fortennis with an appreciation for classic and elegant jewelry.

View the entire collection at:


Rob Delman, Gil Koppel and PeterSimel, Masters Tennis Co-Chairmen,of the 19th Maccabiah USA Organ-

izing Committee, and Head Coach RoyKozupsky are actively seeking the bestJewish tennis players from across thecountry to try out for the Maccabiahteam. The Masters Tennis team will bepart of the 1000+ USA Maccabiah Teamcompeting at the 19th World MaccabiahGames in Israel next July. Masters Tennisathletes must be 35 years of age and upas of July 2013 and age divisions for theteam are: 35-39; 40-44; 45-49; 50-54; 55-59 and 60-64. All interested Jewish ath-letes must fill out an application for theteam, prior to the tryouts which can befound at www.maccabiusa.com. The EastCoast tryout will take place Saturday-Monday, Oct. 27-29 at the Boca RatonResort and Club in Boca Raton, Fla.

The World Maccabiah Games has amagical quality about it which awakensfeelings that touch the hearts and reach the

souls of the Maccabiah participants. Theathletes readily explain that these feelingsremain long past the conclusion of the

competition—they last a lifetime. The Mac-cabiah is more than an international athleticcompetition; it is a celebration of Jewishculture, unity and pride, and support for theState of Israel.

Coach Kozupsky of New York City hasmore than 30 years of coaching experiencein both Israel and the United States. He hasan extensive history with the Israel TennisCenters and was a coach at RamatHasharon from 1978-1980, where he hadthe opportunity to coach and work withmany young elite Israeli Tennis players.Most recently, in 2010-11, Kozupsky wasthe volunteer coach for the men’s andwomen’s club tennis teams at Northeast-ern University in Boston, Mass.

For additional information or for ques-tions regarding the tryouts, please con-tact either: Rob Delman [email protected]; Gil Koppel [email protected]; Peter Simel [email protected] or Roy Kozupskyat [email protected].

Tryouts Set for 2013 USA Maccabiah Tennis Team


BY KATHY MILLER

Ihave been coordinating the USTALeagues on Long Island for 26 years.When I started, there were about 400

players in the league and this numberhas grown to over 4,000. As anotherseason comes to an end, I was thinkingabout some of the good experiencesI’ve had or heard about from the leagueover the years.

I remember when the Long Island 2.5team went to the Nationals in 2001. Itwas just a couple of weeks after 9/11and a few of the women didn’t want tofly and opted not to go. The others wentwithout a full team and were so touchedby the reception they got from the staffand the other teams. At the Saturdaynight banquet, they received thunderousapplause and a standing ovation whenintroduced as the New York team. Theplayers were truly touched and its some-

thing they’ll always remember.I also thought about an Annual Long

Island Tennis Awards Dinner from about15 years ago. I was asked by the LongIsland board if I knew of anyone thatcould speak at the dinner. I suggesteda league player by the name of PattyMcDonald. Patty’s husband is OfficerSteven McDonald who was shot andparalyzed in the line of duty as a NewYork City Police Officer 26 years ago.She told her story about how tennis andthe friendships she made helped get herthrough the harder times in life. Shetalked about how she could go play amatch and leave her real challenges offthe court for a couple of hours. I re-member her being a wonderful speakerand you could hear a pin drop in theroom. I also remember her husbandbeing there with the biggest smile on

his face and being so proud of his wife.She was truly an inspiration.

I think about the friendships I’vewatched develop from the league. Alongwith the many that have bloomed, one ofthem is a friendship from 20 years ago.One of my teammates and I developeda close friendship where we have beenthere for each other for not only the lossof a parent, but the loss of a child, di-vorce, our children growing, gettingmarried and us both becoming grand-mothers in the last year. It’s a very spe-cial friendship to me that may not havebeen, had it not been for the USTALeague.

There was a Long Island seniorwomen’s team that went to Sectionals acouple of years ago where one of theplayers got quite a surprise. As theywere waiting to go out to the courts, one

Where Has Sportsmanship Gone?


of the women from the Long Island teamrecognized one of the opponents fromthe Southern Region as one of herbridesmaids from 40 years ago. Theyhad lost touch, but now e-mail regularly.

My most recent favorite story involvesmy own daughter. She played on a Tri-Level team that won and went to Albany,N.Y. for the Sectionals. The men’s teamthat won from Long Island was there thesame weekend. My daughter lived inLong Beach at the time and a guy shemet there lived in Hewlett. It took thetwo of them going to Albany for the Tri-Level Sectionals to meet and they werejust married in March of this year.

These are just a few stories that re-mind me of what this league is sup-posed to be. Stories that have broughtpeople together and stories that haveshown what team camaraderie andsportsmanship are all about. It’s sad thatthese stories get overshadowed with thenegative side of what people can bringto this game.

From the very first week of this sea-son, nasty and unsportsmanlike behav-

ior started. By the third week, it was sobad that, for the very first time, I sent ane-mail to all captains reminding themthat this is supposed to be fun. No one isplaying for a cash prize, a car, or a tripto Hawaii!

I had complaints of matches almostgetting physical (not just men’smatches), players being verbally abusiveto desk staff, the usual “stalling,” badline calls, spectators getting involved inmatches and my personal favorite—aplayer (not a USTA league member) play-ing as someone else whose name ap-peared on the roster and not once didthe people involved take responsibilityfor their actions. Instead, there were fin-gers being pointed and false accusa-tions made against innocent people. Thestories go on and on and the job of co-ordinating the USTA League this yearbecame a 24/7, on-call responsibility.The three members of the Long IslandGrievance Committee, who volunteertheir time, also spent endless hours withall these grievances. Things were so badthis year, that they were left with no

choice but to suspend multiple players. I remember when all matches were

friendly competition, where people werenice to each other and were graciouswinners and gracious losers. I would getsuch a good feeling when I saw twoteams play and saw tennis friendshipsbudding between the teams. Now, Imostly hear about the never endinggrievances, I get phone calls and e-mails constantly from captains needingto vent and I’ve been called on my cell at10:45 p.m. while two teams are fightingasking for me to settle it. I hear hownasty people can be, the lengths peoplewill go to manipulate schedules, playoffmatches, etc. all just to win, and itmakes me ask: “Where did sportsman-ship go?” It makes me wonder why peo-ple are so willing to toss aside commoncourtesy in exchange for being the vic-tor. Are they really the victor when theyhave to cheat, manipulate and be abu-sive to get there?

I am hoping this article isn’t pointless

Wimbledon attracts a worldwide audience of millions but only a tiny percentage of tennis fans are privileged enough to actually be there. The Wimbledon Experience is the only company

in North America officially appointed by the All England Lawn Tennis Club to provide tour programs to The Championships.

A wide selection of tours for 2013 are available featuring top category reserved seats, accommodation at a choice of London hotels and admission to The Experience Club, where

you will enjoy a buffet lunch and a Wimbledon tradition - strawberries and cream!

Please mention Long Island Tennis Magazine when making a reservation to receive a free Wimbledon towel.

New York Office: 914-481-8594 Toll Free: 1-888-552-5632

www.wimbledon-experience.com

THE EXPERIENCE OF A LIFETIME THE CHAMPIONSHIPS, WIMBLEDON

continued on page 12


and players can take an honest look atthemselves and ask if any of this per-tains to them instead of just assumingit’s the other guy. I hope you all see thepositive this League can bring like thestories above instead of so much of thenegative from this past season. Don’tget me wrong, there were positives thisseason as well, but they get so over-shadowed by the growing negatives andthese situations need to be addressed.

The USTA League is a great program

that has grown every year. I want to seethat growth continue, and all I heard thisyear was the opposite. I said it in the e-mail I sent in June: This league is only asgood as the attitude of the people play-ing in it. Please think about that state-ment: Who wants to rush home fromwork, get to a tennis match and becheated or berated? People start to feellike, it’s just not worth it.

I write this because I love the sportand think the League is a tool to bring

people together on the court for a greatmatch and a couple of hours of funwhere all the REAL difficulties in life canbe put aside for a while. I am asking allof you to help me make this League all itcan be!

We start with a new format next sea-son; let’s call it a new beginning. Therewill be the 18-and-Over League playedon two courts of singles and threecourts of doubles. The 40-and-OverLeague will follow the same format, andthe 55-and-Over which will be threecourts of doubles and will be combinedratings of 6.0 (two 3.0 players or a 2.5and 3.5), 7.0, 8.0 and 9.0. There will alsobe a 65-and-Over League following thesame format of the 55-and-Over. All thedetails will be sent to everyone nextFebruary when the organizing for the up-coming season starts.

Until then, let’s really look at it as anew beginning, not only with the ageand level changes, but new attitudes aswell. Let’s get things back into perspec-tive and remember how lucky we all are.This is how we get to spend our freetime! We get to play this great sport,meet new people, sit and have a slice ofpizza afterwards in what should be anenjoyable day/night.

Club pros have to help get this attitudeout there. Your students listen to you.They follow by the example you set.Please teach and show good sportsman-ship and tennis etiquette. As the USTALeague grows, courts get filled at clubs,students want to take more lessons, andplayers look for club leagues to join. It’sin everyone’s best interest to want thisleague to be a success. Please remem-ber, like I said earlier: THIS LEAGUE ISONLY AS GOOD AS THE ATTITUDE OFTHE PEOPLE PLAYING IN IT!

Good Luck to all of the Long Islandteams at Sectionals!

Next up is the Tri-Level League. If youare interested in having a team or findingone, please e-mail me. Mixed-doubleswill start later in the fall.

Kathy Miller is the manager at CarefreeRacquet Club and is also the AdultLeague Coordinator for USTA/Long Is-land. She may be reached [email protected].

www.catsny.com

Butch Seewagen is a former varsity coach at Columbia University.

He holds over 15 nationaland international titles andis the owner/program director of the Children’s Athletic Training Schools.

For Boys and Girls 5 – 9 years old.

188 Maple Avenue Rockville Center

Phone: 516-753-1299

LI’s first Tennis Academydevoted to the USTA’s 10 & under Initiative.

Private, Semi-Privateand Small Group Lessons

for Boys and GirlsAges 5-9.

Adult teams advancing to the SectionalChampionship in Albany� Women’s 2.5–Carefree Racquet Club (Captain: Donna Hallas)

� Women’s 3.0–Point Set (Captain: Nadine Letts)

� Women’s 3.5–Eastern Athletic Blue Point (Captain: Tricia Livingston)

� Women’s 4.0–Eastern Athletic Blue Point (Captain: Jamie Stickney)

� Women’s 4.5–Rockville Racquet (Captain: Jackie Gaines)

� Women’s 5.0–Sportime Lynbrook (Captain: Tina Buschi)

� Men’s 3.0–Long Beach Tennis (Captain: Joe Esposito)

� Men’s 3.5–Rockville Racquet (Captain: Don Rodgers)

� Men’s 4.0–Rockville Racquet (Captain: Ian Shapiro/Mike Pavlides)

� Men’s 4.5–Sportime Roslyn (Captain: Art Kornblit)

� Men’s 5.0–Carefree Racquet (Captain: Scott Chesney/Andy Schwartz)

Adult League Wrap-up continued from page 11

PUT MORE PLAYIN YOUR DAY

For more information visit

September is National Childhood Obesity Awareness Month

and tennis is the perfect sport to get your kids active.

Attend a USTA Free Tennis Play Day in celebration of

Nickelodeon’s Worldwide Day of Play.

The USTA is hosting Free Tennis Play Days across the country from

September 1 through October 6

© 2012 USTA. All rights reserved.

THERE IS AN EVENT HAPPENING NEAR YOU!

Nickelodeon, Worldwide Day of Play, and all related titles, logos and characters are trademarks of Viacom International Inc.



A L O O K B A C K AT T H E2 0 1 2 N E W Y O R KS P O RT I M E S S E A S O N

NY Sportimes Advanceto the Eastern Conference Finals and Look to Cap OffSuccessful CampaignThe New York Sportimes completed an-other successful season of WorldTeamTennis (WTT) action this summer.Home matches were played at bothSportime Stadium at Randall’s Island (fivematches) and the SEFCU Arena in Albany,N.Y. (two matches). Attendance was up thisyear, as fans have started to realize howmuch fun these matches can be. A noisyatmosphere between points is encour-aged, and WTT is a great chance to seesome of the stars of the game up close andpersonal in an intimate atmosphere.

Playoffs await the SportimesThe New York Sportimes were the secondbest team in the 2012 WorldTeamTennisseason, and with a 9-5 record, theSportimes qualified for the 2012 WTT Play-offs. On Saturday, Sept. 15, the Sportimeswill face off against the defending cham-

pion Washington Kastles for the EasternConference Championship. The Sportimeswill look to end the Kastles unprecedented30-match winning streak and advance tothe 2012 WTT Finals, and a shot at the WTTChampionship for the first time since 2010.The Newport Beach Breakers will face theSacramento Capitals on Friday, Sept. 14 at6:30 p.m. in the Western ConferenceChampionship match. The two ConferenceChampions face off for the King Trophy onSunday, Sept. 16 at 3:30 p.m. EDT.

Legends collide in the Big Apple


Featuring two hall-of-famers, one particu-lar Sportimes homematchup created quitethe buzz with thelargest turnout of theseason. Actor andcomedian JohnLeguizamo, a long

with former New York Mayor DavidDinkins, were two of the celebrities whowere courtside to watch two legends,John McEnroe (Sportimes) and Andre

Agassi (Boston Lobsters) compete inthe night’s men singles and mixed-dou-bles events.

First up was singles and as a spectatorat the event, it was apparent that bothplayers had not lost the competitive na-ture that made them world champions.Famous for his incredible return of serve,Agassi was able to jump on the openinggame and break Johnny Mac’s serve.Both players continued to hold serve,giving Agassi a chance to serve for theset at 4-3. However, McEnroe turned thetables around with some great returns ofserve and one incredible slice backhandup the line. With the set knotted at 4, itwas time (per WTT rules) for a nine-pointtiebreaker. McEnroe couldn’t help himselffrom throwing his racquet and arguingwith the linesperson as tensions began tobuild in the breaker. Agassi was able tokeep the cool hand though and prevailed5-4 (5-3 in the breaker).

In the next match, McEnroe was able toredeem himself in the mixed-doublesevent. The Sportimes team of McEnroe &Martina Hingis paired up against Agassi &Carly Gullickson-Eagle. McEnroe & Hingiswere able to secure an early break andserve for the match, taking it 5-3 over theLobsters.

Hingis wins WTT MVP

Photo credit: Adam Wolfthal

Former world number one-ranked MartinaHingis of the Sportimes was named WTTMost Valuable Player (Female) for theWorld TeamTennis Pro League presentedby GEICO. Bobby Reynolds of the Wash-ington Kastles was named Male MVP.Hingis finished first in women’s singles

SPORT PSYCHOLOGY

Dr. Tom Ferraro is an international noted Sport Psychologistwho has worked with professional and Olympic level athletes in many fields. He publishes internationally andappears both on television and radio.

Learn how to manage your emotions with a credentialed Ph.D. level Sport Psychologist.

• Control anger • Cope with anxiety • Re-establish confidence• Learn how to focus • Get proper diagnosis and treatment for your emotions

1-1 consultations, phone consults, family counseling, on site visits

Dr. Tom Ferraro(516) 248-7189 • 2 Hillside Avenue, Ste. E • Williston Pk, NY 11596

Drtomferraro.com • [email protected]

A L O O K B A C K AT T H E2 0 1 2 N E W Y O R KS P O RT I M E S S E A S O N


this season with a .593 winning percent-age. Hingis teamed with AshleyHarkleroad to finish as the top-rankedteam in women’s doubles with a .571winning percentage. This is the fifth sea-son of WTT play for Hingis, who led theSportimes to the 2005 WTT title.

“I’m proud to win the WTT MVPaward,” said Hingis. “The 2012 seasonwas both challenging and rewarding. Iwas part of a great team and much of mysuccess was thanks to my teammates,coach, team owner and great New YorkSportimes fans.”

Other Sportimes players were recog-nized by WorldTeamTennis for theirstrong showings in 2012 as well, asJesse Witten was named fourth BestMen’s Singles Player, Harkleroad wonthe award for Second Best Women’sDoubles Player and Robert Kendrickwas named Third Best Mixed-DoublesPlayer.

Growing the sportThe WTT season offers the opportunityfor Long Island Tennis Magazine to helpcontinue the growth of grassroots tennisthroughout New York. With Sportime’ssupport, a free copy of our July/Augustedition was distributed to all fans in at-tendance at all home matches. A boothwas setup across from USTA Eastern inthe outdoor food area. Also our profes-sional photographer was on hand for allhome matches to capture the matchesand we had writers to do interviews andrecaps post match.

Season overviewAll in all, this WTT season was a greatprelude to the sport’s stars coming in forthe 2012 U.S. Open, and with New Yorkcurrently not a host site of either an ATPor WTA tournament, the chance to seethe stars of WTT in action should be em-braced and appreciated by tennis fansthroughout the area.

Scenes From the 2012 New York SportimesWorld TeamTennis SeasonCredit all photos to Kenneth B. Goldberg

The New York Sportimes gather after a successfulnight against the Philadelphia Freedoms

RobertKendrick &

Jesse Witten ofthe Sportimes

were 5-3winners over

Luka Gregorc& Jordan Kerr

of thePhiladelphia

Freedoms

John McEnroe of the Sportimes in hismatch against Andre Agassi

Ashley Harkelroad in women’s doubles action forthe Sportimes at Sportime Stadium


Long Island Tennis Magazine’s

Literary CornerBy Brent Shearer

Winning Tennis Strokes By Bill Longua

Winning Tennis Strokes is a short guide-book to tennis techniques and a splen-did general introduction to tennisstrokes. With this book, Bill Longua, aveteran tennis instructor and USPTApro, has produced a concise guide tolearning the fundamentals of the game.

As Longua explains in his foreword,this book is intended for players whorange from beginners to NTRP 4.0. Un-like some other tennis books reviewed in

this space, there are no admissions ofdrug use or high-level strategic con-cerns in Winning Tennis Strokes.

What you get instead is basic instructionwith a non-bossy tilt. Loop backswing ongroundstrokes or straight-back? Eastern,Western or Continental Grips? One-handed backhand volleys or two-handed backhand volleys for playerswith a two-handed backhand ground-stroke? Longua says players learningthe game can take their pick from theseoptions. Fair enough.

The book also includes some practicetips for players just learning the gamewhich, while basic, will be useful. Hesays beginners should bring as manyballs as possible to the court so theydon’t have to spend so much time pick-ing them up. This is a good point.

You could also use this concern as areason as to why beginners should takelessons, because with a pro and a hop-per in use across the net, the studentcan make the most of their court time.Longua does caution readers of his

book that before they show up at thecourts with a shopping cart full of prac-tice balls, they should make sure thereare not many players on adjacentcourts.

At the East River Park courts in Man-hattan where I play, there is a sign thatsays you can only bring six balls on thecourt. Most people interpret this tomean you can only have six balls percourt, but it could just as well meanthere can only be six balls in use at anyone time on all 12 courts. This wouldmake Longua’s advice hard to put intopractice.

Longua is an advocate of the “watchthe ball onto the strings” theory of ten-nis. There are other theories about this,even if nobody says to not watch theball. Some pros say that watching theball is overrated advice. In any case,Longua is a traditionalist on this topic.

A topic that Longua does tackle, is theopen stance/closed stance debate. Hetakes a compromise position on this.Players should start off with what he


calls the traditional forehand, turn, step,hit (closed stance) and when they grad-uate to an intermediate level, may switchto The Modern forehand, load, explode,land (open stance).

The author says, “I recommend thatplayers using the closed stance learn tohit in an open stance when pulled to thecorner for a forehand.”

He doesn’t define closed versus open,so let me say that a closed stance for arighty’s forehand means the left (front)foot is out in front and further to the rightthan the back foot. Open stance meanshitting off the left or back foot withoutthe body having fully turned sideways tothe net. Because I learned the game inthe era of white balls, wood racquetsand long pants, I believe the closedstance is the morally superior way to ad-dress the ball. But I do agree withLongua’s general approach, which is thatplayers should have some flexibility asthey learn the strokes.

In his section on serving, Longua iden-tifies three kinds of serves: Flat, spin andslice. This is a little weird since a slice

serve is a spin serve. What he calls a“spin” serve must be what many call a“kick” or an “American Twist.” But noharm, no foul.

In the section on lobs, Longua says,“Many players feel the lob is a cowardlyshot and an easy way out of a difficultpredicament.”

This may be true of inexperiencedplayers, but I recently attended an exhi-

bition match in which three of the fourplayers had ATP points on their resumesand the one player who didn’t used thelob volley to great effect. But for beginnersand intermediates, this compact book willbe a great companion to take to the courtswith you.

Brent Shearer may be reached by e-mail [email protected].

USTA/Long Island Region 2012

TOURNAMENTSCHEDULE

For detailed information on these and allUSTA tournaments, see pages 62-64 or visit

tennislink.usta.com/tournaments.

For Juniors:• Tournament Training, Team Tennis• 10 & Under Tennis, Mommy & Me• Private and Group Lessons• Parties and Events, including Birth-

day Parties, In-House Tournamentsand Sports Nights

For Adults:• Drill Programs for every level, in-

cluding High Intensity, Flex Drillsand Games Based

• Leagues for all levels• Tournaments, Mixers and Parties

FREE on-court evaluation...Call Today!

PLAY TENNIS AT POINT SET THIS FALL!OUR 2012-2013 INDOOR SEASON FEATURES:

…and MUCH MORE!


Fourth and FinalGrand Slam of 2012Set to Invade NewYorkBy Jessica Stiles

Beginning immediately after the conclu-sion of Wimbledon, the U.S. Open Se-

ries links together WTA and ATPtournaments which take place on hardcourts across America throughout thesummer. This year’s summer calendar wasunique in the sense that it was interruptedwith the 2012 Summer Olympic gamesheld at the All-England Club. Here, playersreturned to the grass courts a few weeksafter Wimbledon play. As the summercomes to a close, fans are gearing up forthe fourth and final Grand Slam event ofthe season, the 2012 U.S. Open.

With the 2012 U.S. Open beginning Aug.27, the big names in tennis will have justenough time to play a warm-up event onthe American hard courts before the startof the tournament. Since 1978, the tourna-ment has been held at the USTA Billie JeanKing National Tennis Center in FlushingMeadows, N.Y. and has been a highlight tothe summers of New York tennis fans. Thisyear’s championships will undoubtedlyprovide a high level of drama, action, andexcitement as the world’s best playerscompete for the final Grand Slam title ofthe year.

Some players go into the tournamentlooking to finish a disappointing season offon a more positive note, and some seek tobuild on the solid season they’ve had thusfar. No matter what the player’s individualgoals are for the tournament, we can fore-

cast the true contenders, pretenders andAmerican hopefuls for this year’s U.S. Open.

ContendersPhoto credit: Kenneth B. Goldberg

On the women’s side,no one can argueSerena Williams as amajor contender for

this year’s title. After her shocking loss inthe opening round at the 2012 FrenchOpen, Serena Williams has yet to lose amatch. In June, Serena was crowned2012 Wimbledon champ. With two U.S.Open titles under her belt, Serena’sgame matches up impeccably well onthe American hard courts.

In addition to Serena, Maria Sharapovahas proven to be another strong con-tender for this year’s U.S. Open title. Al-though she didn’t follow up her FrenchOpen victory with a strong showing atWimbledon, Sharapova certainly played astrong string of tennis at the 2012 Lon-don Olympic games, taking home the Sil-ver Medal for her nation of Russia. Withthe experience of winning the U.S. Open,Sharapova will take that knowledge andconfidence with her from the start of theevent.

Although she has never before won aGrand Slam event, Agnieszka Radwanskahas really proven herself this 2012 sea-son. Currently ranked number three inthe world, Radwanska reached the fi-nals of this year’s Wimbledon champi-onships, falling to eventual winnerSerena Williams. Even though her gamestyle doesn’t have the power of Shara-pova and Williams, Radwanska makesup for it in her high level of “tennis IQ.”


Of course one wouldexpect Roger Federerand Novak Djokovic tobe the strong con-

tenders going into the 2012 U.S. Open.Rafael Nadal has been struck with a seem-ingly reoccurring knee injury, forcing him to pullout of the Open. On the other hand, Djokoviccertainly hasn’t had the same 2012 season ashe had last year going into the Open. Obvi-ously you cannot count Djokovic out of theequation, but going into this year’s event, itseems that the upper hand should go to AndyMurray, Juan Martin del Potro, and reclaimedworld number one Federer. With Murrayreaching the finals of Wimbledon and defeat-ing Djokovic at the Olympic Games to earnGold for his nation of Great Britain, he shouldapproach the U.S. Open with confidence toclinch his first Grand Slam title.

Former U.S. Open champion, Juan Martindel Potro of Argentina has also been play-ing a very high-level tennis of late. DelPotro is one of those players who canstrike when you’re least expecting it and hehas proven to have the ability to do just thatat the U.S. Open.

With Federer there is not much to say, he’sRoger Federer. He is a strong contender forevery Grand Slam event he takes part in andit certainly helps that he is once again num-ber one in the world, and just claimed theWimbledon title.

PretendersJust as there arestrong contenders forthis years’ U.S. Open,there are also a fewplayers who have been

2 0 1 2 U . S . O P E N P R E V I E W


2 0 1 2 U . S . O P E N P R E V I E W

struggling of late, falling somewhat off theradar. Svetlana Kuznetsova and Li Nahave yet to display sparks of their formerglory in the 2012 season. Both go into theU.S. Open with Grand Slam titles on theirresumes, however of late, they haven’t pro-duced results that would indicate a shot atU.S. Open glory. Both have been on thetour for a while now and some might con-clude their careers are winding down.


On the men’s side, former U.S. Openchampion Andy Roddick will not enter thisyear’s U.S. Open with much in the way ofconfidence. There was a point in time whenRoddick’s serve was consistently thebiggest in the game. Today, the level of thegame has increased just enough to whereplayers don’t seem to be as intimidated tostand on the returning end of Roddick’sserve. Over a decade ago, Roddick wonhis one and only Grand Slam title in Flush-ing Meadows, however it will be hard atthis point in his career to hold the trophyonce more.

AmericansPhoto credit: Kenneth B. Goldberg

There is nothing moreexhilarating to the NewYork crowd than gettinga chance to cheer forone of their own. Com-peting in this year’s U.S.Open are a handful ofAmerican hopefuls, on

both the men’s and women’s collective sidesof the event. On the women’s side, young upand comers Christina McHale and SloaneStephens. The New Jersey native McHalehas had a remarkable year, reaching a careerhigh WTA singles ranking of 26th. She’ll be infront of her home crowd, which will hopefullygive her some extra motivation to make it anOpen to remember. In addition to McHale,

Stephens has also had a strong 2012 seasonthus far. She has made great strides, espe-cially at Wimbledon this year. Hard courts areby far her best surface, suiting her powerfulgame style.


On the men’s side, Ameri-cans Mardy Fish, RyanHarrison and big JohnIsner are the top Americanhopefuls for this year’sevent. Although Fish was

sidelined due to injury earlier this year, hechose to bypass the Olympics and get backto proper hard court form. He hasn’t pro-duced the same level of results in this year’sU.S. Open Series; however, Fish will still re-main an American favorite. Harrison has hada very up and down year with a lot of racquetthrowing and frustration. Among all of the tur-moil, he has reached a career-high ATP sin-gles ranking of 60th. If Harrison can channelhis mental fortitude, hopefully he can relishthe kind of U.S. Open event he had in 2011.In addition to Harrison and Fish, Isner has thepotential to have a very strong U.S. Openshowing. Isner has proven this year that hecan hang with the best of them. Admitting tohomesickness during the clay court season,hopefully Isner can channel his energy play-ing in front of an American crowd.

Jessica Stiles is an intern for Long IslandTennis Magazine and plays for the Univer-sity of Kentucky Women’s Tennis Team.

The State of American TennisBy Steven Kaplan

The United Stateswas the dominantforce on the worldtennis scene forthe first 30 years ofthe Open Era, but

in the last decade, has experienced limited

international success. Now, with the cur-rent generation of U.S. champions all over30, American tennis is at a crossroads andthe future is uncertain at best.

Here is a brief look of the U.S. tennisscene at the 2012 U.S. Open ...

The golden girlsSerena Williams did a break dance on cen-ter court at The All England Club to cele-brate a beat down on the rest of the worldto win Olympic Gold. With this win, Serenajoins Stefanie Graf as only the secondwoman to win all four Grand Slams andOlympic Women’s Singles Gold. Serenahas her mojo back and she is a force of na-ture. She is the clear favorite at this year’sU.S. Open after a magical summer run inLondon that included a Wimbledon title.

Venus Williams has played the WTA Tourfor over half her life and her body is showingsigns of wear and tear. Venus can be proudof her seven Grand Slam Singles Titles andwhen she partners with sister Serena, she isstill a favorite to capture the doubles crown.

The good old boysTwins Mike & Bob Bryan are the most suc-cessful doubles team in men’s tennis his-tory and are still going strong at acombined age of 68. They now have anOlympic Gold Medal to add to their im-pressive resume.

Mardy Fish has jumped tremendously inthe ATP World Rankings over the past twoyears. Even if he can stay away from thedevastating effects of glutton that had pre-viously limited his court renaissance, he isover 30 years of age and is facing serioushealth concerns.

Andy Roddick has been one of the mostconsistent performers on the men’s tour inthe last 10 years and is the last American towin a Grand Slam in 2003 at the U.S. Open.While Roddick continues to grind on thetour, it looks as though the tour has been agrind on him.

The current cropJohn Isner is the highest ranked Americanman, hovering at around number 10 in the


2 0 1 2 U . S . O P E N P R E V I E W

world rankings. He has the size andpower to dominate, but questions remainconcerning his mobility and all-aroundgame. I see his near term chances ofwinning a Slam as a long shot.

Local favorite, 20-year-old ChristinaMcHale from Englewood Cliffs, N.J., hasbroken into the top 30 in the WTA rank-ings. Christina has heart, tenacity, youthand an all-around game. Expect her tobattle for a top 10 world ranking if shecan add a weapon to her game.

Sam Querrey from San Francisco hasa huge game and is ranked just insidethe top 40 where he is likely to remain fora while.

Melanie Oudin thrilled U.S. Open crowdsin 2009 by beating Elena Dementieva,Maria Sharapova and Nadia Petrova to be-come the youngest Grand Slam quarter-finalist since Serena Williams in 1999.Unfortunately, her career has stalledsince and she is currently ranked outsidethe top 100.

Ryan Harrison is ranked 60th in theworld at the tender age of 20. After hisfirst round loss to Santiago Giraldo ofColumbia in the 2012 Olympics, TheNew York Times wrote, “Though thematch was considered winnable forHarrison, the loss itself will be less re-membered than Harrison’s petulant be-

havior as the match slipped away.” Stillmany expect great things from Harrisonas he matures.

Coco Vandeweghe is ranked 73rd onthe WTA Tour and is the daughter of for-mer New York Knick Kiki Vandeweghe.She has the size, power and potential tobe a top 20 player in the world.

Donald Young was once the top-ranked junior in the world, but has notlived up to his great potential. Young iscurrently ranked outside the top 50, hav-ing reached a career high of 38th. He hasall the talent in the world, and at 23-years-old, he is young enough to re-shape his game.

Irina Falconi, currently ranked 104thand grew up playing on The City ParksFoundation Courts at the National TennisCenter, and Julia Cohen, ranked 97th,are top young Americans who followedthe unusual path of playing college ten-nis at Georgia Tech and The University ofMiami (Florida). Bravo to these players.

Last and not least by a long shot areSloane Stephens and Taylor Townsend.

Sloane is currently ranked 50th in theworld, and at the age of 19, has thespeed and power to be perhaps the mostpromising young American player inmany years. Taylor Townsend is just 16and the Australian Open Junior Cham-

pion. She could just be the top Americanof the future.

The local crewScott Lipsky who grew up in Merrick,N.Y. and played for Stanford University,is a doubles specialist ranked 34th in theworld. In 2011, Scott teamed with CaseyDellacqua of Australia to win the FrenchOpen Mixed-Doubles title. Not too badan accomplishment for a local kid andStanford Graduate.

Julia Elbaba of Oyster Bay, N.Y., JamieLoeb of Ossining, N.Y. and Noah Rubinof Rockville Centre, N.Y. are local juniorswho will be competing in this year’s Jun-ior U.S. Open. All three of these risingstars have experienced great successagainst the best young players in theworld in junior Grand Slams. Expect tobe seeing their names in the main drawsof women’s and men’s Grand Slamssoon.

What’s the problem?In 2011, Daniel Riley of GQ interviewedAndre Agassi, John McEnroe and PeteSampras for his article “Why Does Amer-ica Suck at Tennis?” All three championsagreed that success runs in a cycle and weare clearly on a downturn.

Agassi advocates that the USTA 10 &Under tennis initiative will be a greatboost to “get the racquet in more kidshands.” He is optimistic that “We’ll makethe adjustment and have our time in thesun again.”

McEnroe explained that the evolution ofequipment and the development of guyswho are “Getting bigger, stronger and moreathletic” has made the game “more of atrack meet instead of a tennis match.”McEnroe thinks that convincing youngAmerican athletes to jump into tennis is“one of the big factors.”

Sampras believes that the recent suc-cess of countries like Spain is “Just testa-ment to how international the game is nowthat we’re not dominating anymore.” I thinkit’s also a testament to the miracles ofmodern science.© 2012 USTA. All rights reserved.

Our facility features 18 outdoor courts, including 4 stadium courts, 12 indoor courts and 4 bubbled clay courts in our state of the art, 245,000 square foot indoor tennis facility.

We are open 11 months of the year and offer the following:

For more information call718.760.6200 (ext. 0) or visit ntc.usta.com


2 0 1 2 U . S . O P E N P R E V I E W

Looking aheadSuccess in tennis is similar to achievementin almost any endeavor, in that it requiresboth opportunity and motivation.

Tennis is still a relatively expensive andexclusive sport in the United States formost families. Other countries are simplydoing a better job of attracting the mostpromising athletes at a young age, espe-cially since tennis has become an Olympicsport.

U.S. athletes love to succeed and tennisplayers are no exception, but the risk toachieving reward as a singular “all or noth-ing” goal is less in this country than whatexists elsewhere in many other parts of theworld. Maybe it’s not such a bad thing forthis country to have some parents who donot have their child drop out of school toroll the dice on pro tennis success.

Many Americans see tennis as a meansto achieving a healthier lifestyle and as animportant part of a well-rounded educationrather than as an escape from poverty oranonymity.

Reuters reports that between the years2000-2010, participation in tennis has out-paced growth in all other traditional sportsin the U.S. by an astounding 46 percent.

Tennis as a participatory sport is grow-ing and thriving in the United States, andwe are healthier and better educated be-cause of this trend.

Therefore, rather than ask why we “Suckat Tennis,” perhaps we should ask, “Whydoes it matter to us that we don’t dominatethe tennis world?”

Steve Kaplan is the owner of BethpagePark Tennis Center, as well as the directorof Reebok Academy for New York CityParks Foundation. Over the last 33 years,Steve has been the longtime coach of morethan 500 nationally-ranked junior players,15 state high school champions, two NCAADivision 1 Singles Champions, and numer-ous touring professionals and prominentcoaches. Steve’s students have beenawarded in excess of $7 million in collegescholarship money. He may be reached bye-mail at [email protected].

2012 U.S. Open Prize Money to Exceed $25 MillionThe USTA has announced that the 2012U.S. Open prize purse has been increasedby more than $2 million to reach a record$25.5 million. Additionally, the top threemen’s and top three women’s finishers inthe Emirates Airline U.S. Open Series mayearn up to an additional $2.6 million inbonus prize money at the U.S. Open, de-pending on their performance over thecourse of the Summer Series. With thisbonus money, the total U.S. Open prizemoney could potentially reach $28.1 mil-lion. To support the majority of players, for2012, prize money has been increased by aminimum of 18 percent for the first threerounds of the main singles draw.

Both the men’s and women’s U.S. Opensingles champions will earn a record $1.9million with the ability to earn an additional$1 million in bonus prize money (for a total$2.9 million potential payout) based on theirperformances in the Emirates Airline U.S.Open Series.

The 2012 U.S. Open purse includes an11 percent overall increase in men’s andwomen’s main draw singles prize moneyover last year’s total. First round maindraw singles prize money has been in-

creased by 21 percent, and second roundmain draw singles prize money has beenincreased by 19 percent. In all, 224 of the256 main draw singles players (87 percentof the main draw singles players) will re-ceive an increase in prize money of atleast 18 percent.

For the 40th consecutive year, the USTAwill offer equal prize money to both menand women—a Grand Slam first and U.S.Open tradition dating back to 1973. Allplayers also receive per diem payments tohelp offset the cost of accommodationsand other expenses.

The Emirates Airline U.S. Open SeriesBonus Challenge rewards the top threemen’s and top three women’s finisherseach year with bonus prize money at theU.S. Open and has resulted in the largestpaychecks in tennis history for men (2007–Roger Federer, $2.4 million) and women(2005, 2010–Kim Clijsters, $2.2 million).The USTA will offer up to an additional $2.6million in bonus prize money at the U.S.Open to the top three men’s and top threewomen’s singles finishers in the EmiratesAirline U.S. Open Series. Players must earnpoints in at least two Series events in orderto be eligible for bonus prize money at theU.S. Open. More than $7.7 million in bonusprize money has been awarded since theSeries began in 2004.


2 0 1 2 U . S . O P E N P R E V I E W

Agassi to be InductedInto U.S. Open Courtof Champions

Photo credit: Adam Wolfthal

The USTA hasannounced thatAndre Agassi, atwo-time U.S.Open Cham-pion, has beennamed the 2012inductee into the

U.S. Open Court of Champions, a U.S.Open and USTA Billie Jean King NationalTennis Center attraction honoring thegreatest singles champions in the historyof the U.S. Championships/U.S. Open.Agassi will be inducted during an on-courtceremony in Arthur Ashe Stadium prior tothe Men’s Singles Championship on Sun-day, Sept. 9. Patrick McEnroe will host theceremony.

The U.S. Open Court of Championssalutes the tournament’s all-time greatestchampions with an individual permanentmonument that serves as a lasting tribute.Agassi will join prior inductees Arthur Ashe,Don Budge, Maureen Connolly, JimmyConnors, Margaret Court, Chris Evert,Althea Gibson, Richard “Pancho”Gonzalez, Steffi Graf, Billie Jean King, Jack

Kramer, Rod Laver, Ivan Lendl, MollaBjurstedt Mallory, John McEnroe, MartinaNavratilova, Margaret Osborne duPont,Ken Rosewall, Pete Sampras, Bill Tildenand Helen Wills. A panel of internationalprint and broadcast journalists selected the2012 inductee from the roster of U.S.champions based on their performances atthe tournament and their impact on thegrowth of the event.

“Few tennis players have impacted thesport of tennis more than Andre Agassi,”said Jon Vegosen, chairman of the boardand president of USTA. “He is a championboth on and off the court, elevating thepopularity of our sport while playing, andnow helping to enhance the lives of chil-dren off the court with his generosity anddedication to providing young people withthe opportunity for a quality education. Hetruly deserves this honor.”

Agassi, the son of a former Olympicboxer, grew up in Las Vegas with a ball ma-chine in his backyard, developing extraor-dinary hand-eye coordination that hasseldom been matched in the history of ten-nis. Turning pro at the age of 16, he quicklyestablished himself as one of the sport’stop talents and a definitive fan favorite.Bold, brash and bigger-than-life, Agassiwon the U.S. Open Men’s Singles Title in1994 (the first unseeded player in the Open

era to capture the U.S. Open) and again in1999. His punishing baseline game, unpar-alleled return-of-serve and superior athleti-cism allowed him to win a career GrandSlam and a total of eight career GrandSlam titles, as well as a Gold Medal in sin-gles at the 1996 Atlanta Olympic Games.He also was a member of two U.S. DavisCup-winning teams. Agassi competed in amen’s Open-era record 21 consecutiveU.S. Opens. He was elected to the Interna-tional Tennis Hall of Fame in 2011.

Currently, he focuses a good deal of histime and efforts on the Andre Agassi Foun-dation for Education and the Andre AgassiCollege Preparatory Academy, a tuition-free public charter school for at-risk youthin Las Vegas.

Lineup Announced forArthur Ashe Kids Day

The USTA has an-nounced that popband The Wanted,chart-topping singerCarly Rae Jepsen,

special guest performer Owl City, and fromNickelodeon’s “How to Rock,” CymphoniqueMiller and Max Schneider, will team up withreigning U.S. Open Champion NovakDjokovic, U.S. number one men’s singlesplayer John Isner, three-time U.S. OpenChamp Kim Clijsters and Mardy Fish at the17th Annual Arthur Ashe Kids Day Presentedby Hess, set for Saturday, Aug. 25 at theUSTA Billie Jean King National Tennis Centerin Flushing, N.Y. from 9:30 a.m.-4:00 p.m.Hosted by AAKD alumnus Jordin Sparks andTV personality Quddus, the full-day tennisand music festival will feature interactivegames, musical entertainment and tennis ac-tivities. Arthur Ashe Kids Day Presented byHess will kick off the 2012 U.S. Open, whichruns from Aug. 27-Sept. 9.

From 9:30 a.m.-12:30 p.m., kids andtheir families can enjoy an exciting sched-ule of free tennis games, live music and at-tractions taking place throughout the

A proud sponsor of

LONG BEACH TENNIS CENTER WWW.LONGBEACHTENNISCENTER.COM

Adult Programs Learn & Play Workshops & Zone Advanced Training Fall Mixed Doubles Team Tennis 6.0-9.0

Adult Leagues 2.5-4.5 LEAGUES AS LOW AS $10 PER WEEK

Junior Programs Beginner/Intermediate Lessons

Tournament Training USTA Tournaments

Play Days & Carnivals

LBTC 899 Monroe Blvd Long Beach NY (516) 432-6060


2 0 1 2 U . S . O P E N P R E V I E W

grounds of the USTA Billie Jean King Na-tional Tennis Center. Inside Arthur AsheStadium from 1:00 p.m.-3:00 p.m., the livetennis and music show will feature fun exhi-bition matches and skills competitions withDjokovic, Isner, Clijsters, Fish and other topplayers and celebrities with musical perform-ances by The Wanted, Carly Rae Jepsen,Owl City, Cymphonique Miller, Max Schneiderand other talent to be announced.

Over the years, Arthur Ashe Kids’ Dayhas featured many of music’s biggest actsincluding Justin Bieber, Rihanna, JonasBrothers, Demi Lovato, Sean Kingston,Britney Spears, Ne-Yo, Gavin DeGraw,Jessica Simpson, Backstreet Boys, CodySimpson, Bow Wow and Hanson.

The Grounds Festival offers a wide rangeof interactive activities as well as a chance forchildren of all ages to test their skills, hit withtop tennis pros, win prizes and enjoy music:

� Hess Express Stage: The Grounds Fes-tival’s free concert featuring a line-up of up-and-coming musical talent including urbansuper group Love Jones Girlz, InterscopeRecords prodigy Ahsan, and from DisneyChannel’s “Shake It Up!” Caroline Sun-shine! More acts to be confirmed.

� 10 & Under Tennis: A chance for kids tolearn real tennis and have real fun doing it.10 & Under Tennis follows almost everyother youth sport and uses racquets, ballsand courts that are sized right for kids sothat they enjoy the game right from the start.

� Hess Express Obstacle Course: Kidscan test agility, balance, running and ten-nis skills.

� Hess Target Time: Intermediate and ad-vanced-level kids have a chance to testtheir skills hitting targets on this court.

� Nike Tennis: Tennis and skill activitieson two courts featuring Nike sponsoredathletes.

� IBM Speedzone: Two radar guns oncourt test the speed of kids’ serves.

� Xerox Beat the Pro: Kids will have thechance to challenge the pros on this fast-paced court.

� Mario Tennis Open for Nintendo 3DS:Players of all ages and skill levels can

enjoy friendly competition and fast-pacedtennis action with Mario Tennis Open, avideo game for the Nintendo 3DS hand-held system. Join Mario and Luigi in theSouth Plaza for some fun photo opps andcheck out this new attraction.

� USTA Serves/Aetna Tennis Skills: Thiscourt will have six to eight various sta-tions for very young kids or special pop-ulations. Stations may include thingslike rolling the ball with a racquet andbouncing a koush ball.

� PTR Speed Tennis: Children can hitwith PTR certified professionals onmini-courts at full speed and with com-plete strokes using a special restrictedflight foam ball.

� USPTA Little Tennis: Ideal for youngerparticipants to hit and learn, USPTAcertified teaching professionals hostthis court consisting of 30 colorful hit-ting stations using a variety of teachingaids.

� USRSA Pro Racquet Round-Up: Kidscan see what it feels like to hit with a toppro’s personal racquet such as Venusand Serena Williams using actual rac-quets weighted and balanced to eachplayer’ s specifications.

� World TeamTennis: Co-ed relay races,targeting beginner players, particularlythe youngest children attending AAKD.

Activities tailored to the age, size,strength and experience level of par-ticipants.

� Also: Watch the Pros Practice, PlayerAutographs, Juggling Workshop, Face-Painting, Hair Braiding, Storytelling, andmore.

Kids comment on theU.S. Open experienceDuring our travels this summer visitingmany of the area tennis camps, Long IslandTennis Magazine asked participants the fol-lowing question: “If you had the chance toplay in the U.S. Open, how would you feeland what do you think it would be like?”

“I don’t really know. I would be really nerv-ous.”—Emily Bacchi, 8, Rockville Racquet

“Nervous, but maybe excited to win a lot ofmoney!”—Michael Baranowski, 10, East-ern Athletic Camp

“Playing Roger Federer at the U.S. Openwould help me gain learning experienceand help boost my career.”—EthanBradford, 13, Glen Head Early Hit Sum-mer Camps


2 0 1 2 U . S . O P E N P R E V I E W

“I would feel really good. I used to play atUSTA near the U.S. Open, so it would begreat to get the chance to play there duringthe championships.”—Katie Choe, 9,Sportime Roslyn

“Pretty excited and I would dominate.”—Joshua Cohen, 8, Sportime Kings Park

“I would want to play Serena Williams. Iwould feel very motivated and successfulfor reaching my goal. I’d be taking a stepup and would be proud representing mycountry.”—Isabella Discipio, 13, SportimeLynbrook

“I would be amazed that I got so far. I wouldbe very proud of myself. I would want to playJelena Jankovic because I think her gruntsare hysterical.”—Laura Fabiea, 15,Sportime Lynbrook

“I would feel honored to play in the U.S.Open because all of my hard work wouldhave paid off. I would want to play CarolineWozniacki because she inspires me. Sheworks hard. I heard a story that she was oneof the worst on her tennis team and sheworked very hard to get where she istoday.”—Alexa Goetz, 11, Bethpage ParkSummer Camp

“I’d be so overjoyed that I was able to getinto the U.S. Open as a young teenagegirl. I would have a great future with ten-nis and hopefully make a lot of money.”—Vivien Huang, 11, Sportime Syosset

“It would be exciting and a great experi-ence. It would promote my tennis ca-reer.”—Matt Kolkhorst, 14, Glen HeadEarly Hit Camp

“I would be excited, and also nervous, buthappy that I may get a trophy.”—MayaKopacz, 7, Sportime Syosset

“I would want to play in the U.S. Openbecause I would be playing someonebetter than me and it could help mygame.”—Jordan Ma, 12, Sportime Roslyn

“I would want to play Nadal. It would be reallyexciting and I would be very happy”—LeaMa, 11, Maurice Trail’s Tennis Camp

“It would be pretty awesome because Iwould be one of the best players in the world.I would want to play Federer because he isone of the classiest players and I would wantto beat one of the best in the world.”—NickMoehringeo, 15, Carefree

“Amazing and super cool.”—SameerNaeem, 16, Sportime Kings Park (SuffolkCounty Community College Site)

“I would feel very proud of myself and wouldfeel very popular. All of my fans would besupporting me. I would want to play againstRoger Federer.”—Jacob Nessim, 8, LongBeach Tennis Center Summer Camps

“I would be very proud of myself and my fam-ily would be supporting me. Even if I didn’twin, I would know that I tried my hardest.”—Alexandra Orbusch, 10, Long Beach Ten-nis Center Summer Camps

“Excited, happy and I could not wait to havefun. I would also be very aggressive in theU.S. Open!”—Aaron Paknoush, 12, ShelterRock Camp

“Very pressured, but excited. I would be nerv-ous because everyone would see me. I wouldhave no privacy!”—Eden Schneck, 10,Eastern Athletic Camp

“I would be really excited and happy. I wouldprobably want to play one of the top rankedplayers because it would be an honor to beon the court with them.”—Olivia Scordo, 12,Bethpage Park Summer Camp

“I would feel really happy if I was in the U.S.Open. I would want to play against SerenaWilliams.”—Katy Segall, 13, Future StarsTennis Camp

“I would want to play Novak Djokovic atthe U.S. Open because it would be agreat learning experience and it would

help my game.”—Mercer Shavelson, 12,Glen Head Early Hit Camp

“It would feel great and it would be a great ex-perience. I would want to play Rafa.”—StevenSun, 11, Maurice Trail’s Tennis Camp

“It would be breathtaking.”—Justin Weissberg,14, Rockville Racquet

“Talented, proud and accomplished.”—DanaWinthrop, 14, Sportime Kings Park (Suf-folk County Community College Site)

“It would be amazing and a big honor.”—Christina Yun, 14, Adidas Camp@ StonyBrook University!

“I would feel really good, proud, and excited.I’d like to play against the best in the world toget better.”—Lauren Zola, 9, Point Set

You heard from the kids, now what do thepros have to say about playing at the U.S.Open?“I enjoy the camaraderie that you can getfrom the fans for the American players—it’sdefinitely the most favorite Slam on theAmericans as far as being able to play onthose big courts and having the crowd be-hind you. We go to so many places, in Spainand in Italy and in England, where you canplay a guy from that country, and those fansare just going crazy for their player. But weknow for a fact that we have that one big eventwhere everyone wants to do well, and we’regoing to have the fans behind us and rootingas loud as they can for us. So that makes it somuch fun and exciting and one of the besttimes of the whole year for us.”—Mardy Fish

“Well, you know, New York, I feel like it’s agreat fan base. They’re going to give youwhatever you give them. They certainly ap-preciate hustle. They like a bit of a show. Yougive them some energy, they’re going to giveit right back to you. I feel like it’s a pretty clear-cut understood relationship, at least from myperspective. It doesn’t get a whole lot betteras far as atmosphere goes than a night ses-sion up there.”—Andy Roddick


2 0 1 2 U . S . O P E N P R E V I E W

More Than 400 Vie for 80 Spots at 2012 U.S. OpenBallperson TryoutsBy Kristen Kelleher


On June 21, the 2012 U.S. Open Ballper-son Tryouts were held at the USTA BillieJean King National Tennis Center. Morethan 400 people were on hand to show offtheir skills in running, throwing and catch-ing for a shot at one of the 80 availablespots. The extreme heat did not stop com-petitors ranging in age from 14 on up fromimpressing the U.S. Open officials for theirshot at the big stage in late August.

“I feel like it went well. It was nervewracking at first since you’re around abunch of people you’ve never met before,”said 15-year-old Gabrielle Williams. “Youjust have to move quickly and rememberwhat you’re doing it for.”

Those who are chosen to become aballperson work during both the qualifyingand main draw of the U.S. Open.

“I think this tryout is pretty hard. It showshow much effort needs to be put in. Theheat was also really tough,” said LawrenceChih, 17.

With the temperature in the 90s and the sunblaring down on the courts, potential ballper-sons had to not only flex their skills but battlethe elements thrown their way by Mother Na-ture, but as the officials continually stressed tothe competitors, “This is U.S. Open weather.”

Richard DeGregoris, a current ballboy,helped at this year’s tryout.

“I’ve been a ballboy for four yearsnow,” said DeGregoris. “I really like it notjust because it’s great money, but it is theexperience of a lifetime being on courtwith the pros. You also meet a lot of newfriends.”

With the applicant pool being so large,the selection for spots is extremely com-petitive. Those selected will have theunique opportunity to be on-court at theUSTA Billie Jean King National Tennis Cen-ter with some of the sport’s biggest stars atthe Open.

Kristen Kelleher is an intern with Long Is-land Tennis Magazine. She is currently at-tending Loyola University Maryland andmay be reached by e-mail at [email protected].

Five Ways to Improve Your Gameby Watching theWorld’s Best TennisPlayers at the OpenBy Steven Kaplan

Walk around the grounds of the USTA BillieJean King National Tennis Center duringthis year’s U.S. Open and you will see play-ers from every part of the globe. Evenmulti-generations are represented in thejunior and senior events. While the assort-ment of differing playing styles is vast, thefundamentals displayed by the world’s toptennis players are similar. Learn what thepros know about tennis success by study-ing their tactics, attributes and skills.

1. Ramp up your playEven the pros are nervous at the start of amatch. They handle these jitters by aimingconservatively, but striking the ball aggres-sively when beginning a match. After hittingtheir way into a personal comfort zone and

only after having successfully made someshots, do the pros confidently go for more.Chris Evert once explained that her goal inthe first game was to “hit her way into thematch” and “ready herself to win.”

2. Seize the opportunityWhile the Girls 12 & Under players oftenchoose to attack only when they feel com-fortable and ready, this strategy is notgoing to work at the highest levels becausehere, aggressive play is opportunity driven.If a U.S Open competitor passes up achance to go for it in the point, they knowvery well that they might not get anotherchance. Most elite players will play theopen court in combination with their servesalmost every time, because the best timeto attack is the first opportunity.

3. Mix it up with a purposeThe specific purpose of variety is to exposeweaknesses and increase uncertaintywhich limits reaction time. Therefore, shotvariety is a means to an end, not just a goalin itself. Variety makes your play more of-fensive, because it delays an opponent’sdecision-making process. Serena Williamswill serve wide to an opponent to forcethem to return from a more forward andwider return position. Once she sees heropponent has adjusted, she will go withpace to middle and keep pounding awayuntil the returner repositions again.

4. Be decisiveHow do the best players in the world knowwhen to come to net? They don’t, they takean educated guess, but they do so with de-cisive commitment. The pros believe thatdecisive decisions are often more impor-tant than making the right tactic or shotchoice because by the time they know thatit’s the right choice, it’s too late to start. Po-sition and hit with no hesitation and makeyour willingness to commitment yourstrength.

5. Compete like a proHere is some bad news that you probablyalready know. Few people who ever pick


2 0 1 2 U . S . O P E N P R E V I E W

up a racket will ever play as well as MariaSharapova or Roger Federer. Here’s somebetter news however, almost anyone canperform every bit as confidently and pro-fessionally as these great champions over80 percent of the time because that’s theamount of time spent in between points.The ratio of play to in between play is 7:1,which is just about 17 minutes of actualplay in a two-hour match. The organiza-tional court habits of every player at theU.S. Open in between points is remarkablyuniform. You still won’t play like Roger evenif you act like him, but you will play better.

The U.S. Open can be an exciting andeye-opening learning experience for tennisplayers at every level, if you know where tofocus your attention.

Steve Kaplan is the owner of BethpagePark Tennis Center, as well as the directorof Reebok Academy for New York CityParks Foundation. Over the last 33 years,Steve has been the longtime coach of morethan 500 nationally-ranked junior players,15 state high school champions, two NCAADivision 1 Singles Champions, and numer-ous touring professionals and prominentcoaches. Steve’s students have beenawarded in excess of $7 million in collegescholarship money. He may be reached bye-mail at [email protected].

USTA Announces New Stadiums to beBuilt at National Tennis Center

Photo credit: Anthony Pastecchi

The USTA hasjoined with NewYork City MayorMichael R. Bloomberg

and Queens officials to release details of aproposed strategic vision for future de-velopment at the USTA Billie Jean King

National Tennis Center in Flushing Mead-ows Corona Park, site of the U.S. Open.The strategic vision—a series of intercon-nected construction projects that includebuilding developments, infrastructure up-grades and improvements to site circula-tion—aims to enhance the currentconditions at the NTC and preserve itsstature as a world-class venue. The projectwill positively impact the facility’s ability tohost its flagship event, the U.S. Open, whilesimultaneously providing a superior experi-ence for both visiting fans and players, al-lowing the City of New York to continue toreap substantial economic benefits.

“The U.S. Open is one of the city’s greatestsporting events, and it generates more than$750 million a year in economic activity,” saidMayor Bloomberg. “The City recognizes thecrucial need to improve the USTA facility andsupports this vision, so that the center re-mains a top-ranked tennis venue capable ofhosting the U.S. Open, and thereby, allowingthe tournament to remain in New York City formany decades.”

The project, expected to developthroughout a multi-year period and costhundreds of millions of dollars, will be un-dertaken by the USTA, which will investi-gate a multitude of potential financingoptions. The project will primarily entail thereplacement and renovation of aging facil-ities and infrastructures. Since 1978, theUSTA has invested more than $500 millionof its own funds into the NTC, and this proj-ect will continue that investment.

“Our goal remains to ensure that theUSTA Billie Jean King National Tennis Cen-ter remains a world-class facility for the topprofessional tennis players, for the hun-dreds of thousands of fans who annuallyattend the U.S. Open, and, as importantly,the near hundred thousand recreationaltennis players who use this facility all year-round,” said Jon Vegosen, chairman of theboard and president of the USTA. “TheStrategic Vision will enable us to achievethis goal.”

Currently, the U.S. Open is New YorkCity’s largest and most valued annual pub-lic sporting event, and generates $756 mil-

lion in economic impact. Attendance nowregularly tops 700,000, making the U.S.Open the highest-attended annual sportingevent in the world. On television andthrough various media, the U.S. Openreaches a global audience, attracting 85million TV viewers in the United States andis broadcast to 188 countries, with morethan 41,000 hours of coverage.

Most notably, the project calls for the con-struction of two new stadiums, one to re-place the aging Louis Armstrong Stadium inits current location at the northeast corner ofthe site, and the other a brand new Grand-stand Stadium, built in a different location atthe southwest corner of the property. Seventournament courts on the southern sectionof the site will be relocated between 30-50feet, and a new walkway will be built to allowfor easy access through the southern part ofthe site. Two parking garages will be con-structed over existing parking lots to ac-commodate additional spaces, and sevencourts on the northwest section–five prac-tice and two tournament- will be replacedand linked by a new, elevated viewing plat-form that will provide better seating andviewing options for fans.

As a direct result of the collective en-hancements, the project will enable thefacility to accommodate an extra 10,000people each day during the U.S. Open,increasing attendance by approximately100,000 new visitors, and amounting to asignificant economic boost to Queens,New York City and the entire metropoli-tan region. The U.S. Open creates 6,000seasonal jobs–with 85 percent of all em-ployees coming from New York City and41 percent from Queens. These 6,000seasonal jobs yield the equivalent of 585(direct and indirect) full- and part-timejobs for Queens residents, earning$40.33 million in direct and indirect em-ployee compensation.

Situated on approximately 42-acres in thepark, the NTC is one of the world’s largestpublic recreational tennis facilities, with in-door and outdoor amenities open for publicuse throughout most of the calendar year,hosting approximately 100,000 patrons.


2 0 1 2 U . S . O P E N P R E V I E W

U.S. Open restaurantsAlong with the best tennis and entertain-ment in the world, the U.S. Open offerspremium-dining experiences—from Mojito,a Cuban-inspired restaurant and bar, toChampions Bar & Grill, a classic Americansteakhouse. Whether you are in the moodfor a light snack, lunch, dinner, meetingfriends for cocktails or satisfying a sweettooth, the restaurants on the grounds of theUSTA Billie Jean King National Tennis Cen-ter can cure any craving. Come experienceall the U.S. Open has to offer.

AcesVaulted ceilings, vi-brant colors and acasual but elegantwine and sushi barcombined with su-

perlative seafood offerings, makes Acesthe ultimate dining experience. You canalso enjoy Aces’ flavorful and sumptuouscuisine in your suite with the Aces PlatinumPackage Series. Join us for lunch, dinneror after the matches.

Champions Bar & GrillA contemporarysetting with classicleather and woodaccents, Champi-ons Bar & Grill is a

modern take on the traditional clubhouse at-mosphere. The Grill offers premium steaks,hearty chops, fresh seafood, salads and awide variety of wines. Join us for fun, deli-cious menu items and the finest cuts of meatand more. Bring your friends for lunch, din-ner or after the matches, and you won’t missa minute of the action with live matches andother sporting events on our many TVs.

U.S. Open Club Presented by Emirates Airline

The U.S. Open ClubPresented by Emi-rates Airline is lo-cated on the groundfloor of Arthur Ashe

Stadium. The U.S. Open Club Presented

by Emirates Airline is available to all Sub-scription Series ticket holders for the dura-tion of the tournament for a nominalentrance fee, and is included for SilverLoge Box seat holders. The U.S. OpenClub Presented by Emirates Airline, with itsstriking contemporary décor, is famous forits Chef’s Table and seasonal selections ofeclectic American cuisine.

Patio Café & BarSoak up the beauti-ful surroundings ofthe U.S. Opengrounds at our ex-panded charming

outdoor café and bar located outside theU.S. Open Club Presented by Emirates Air-line. Enjoy fresh selections of seasonalsandwiches and salads paired with sum-mer specialty cocktails. The Patio Café &Bar is available for all ticket holders. Joinus for lunch, dinner or after the matches.

Mojito Restaurant & BarMojito, a Cuban-in-spired restaurant,transports you to adramatic setting in atropical oasis remi-niscent of 1950sHavana. ExperienceMojito’s lusciousflavors with Latin

specialties and cool cocktails either insideor outdoors in our whimsical outdoor gar-den. Mojito is available for all ticket hold-ers. Join us for lunch, dinner or after thematches. Mojito is located on the groundfloor of Arthur Ashe Stadium near the PatioCafé & Bar.

Heineken Red Star CaféThe new HeinekenRed Star Café is lo-cated next to theSouth Plaza Foun-tains. The re-

designed café will be on the top level of anew two-story building providing guestswith a unique view of the grounds. Guests

can enjoy a spacious, ideal setting to un-wind and keep track of the matches whileenjoying the café’s laid-back atmosphereand enhanced menus. The new U.S. OpenCollection Store, located on the groundlevel, will feature a complete assortment of2012 U.S. Open merchandise and memen-tos alongside a limited selection ofHeineken-branded offerings. Join us forlunch, dinner of after the matches.

Moët & Chandon TerraceThe new Moët &Chandon Terracelocated next to thePatio Café & Barfeatures Moët &

Chandon Imperial Champagne along withfull-service bar options. Guests can relaxand enjoy a glass of champagne in an out-door lounge setting.

Rejuvenate by the FountainsVisit our refreshing food destinations by thefountains, including the South Plaza Café,Cuppa Spotta, Carnegie Deli and Ben &Jerry’s.

Baseline CocktailsCome quench your thirst with a full-servicebar that includes premium wine upgrades.

Wine Bar FoodSample Mediterranean flavors with winesto match.

Grey Goose BarLocated in the Food Village, the GreyGoose Bar features the Grey Goose HoneyDeuce, the U.S. Open signature cocktail,along with Grey Goose specialty cocktailsand a full-service bar.

Food VillageEnjoy regional cuisine and specialty itemsat the U.S. Open Food Village:

� Ben & Jerry’s Ice Cream Shop� Carnegie Deli� Classic Burger� Cuppa Spotta


2 0 1 2 U . S . O P E N P R E V I E W

� Farm to Fork� Franks and Fries� Fresca Mexicana� Fulton Seafood� Glatt Kosher Cart� Grey Goose Bar� New Delhi Spice� Pizza, Pasta� Southern Barbeque� Stonyfield Café� Sweet & Savory Crepes� Grounds rules

The following items are prohibited andMAY NOT be brought onto the premisesand grounds of the U.S. Open:

� Backpacks� Hard coolers or like containers� Sealed packages of any kind� Bottles or cans (glass or metal)� Aerosol cans or noisemaking devices� Alcohol� Video cameras or recording devices� Computers or laptops� Food (except in limited quantities, or for

medical, dietary or infant purposes)� Weapons� Animals (unless a service animal)� Flags, banners or signs� Any materials constituting unauthorized

advertising or promotion� Laser pointing devices

� Tennis racquets� Any other items deemed inappropriate or

dangerous by the U.S. Open personnel

U.S. Open attractions� U.S. Open American Express Fan Ex-

perience: The U.S. Open American Ex-press Fan Experience that premieredduring the 2011 U.S. Open is moving in-side and will be located in the spacepreviously occupied by SmashZone(within the Chase Center). Open to thepublic, the U.S. Open American Ex-press Fan Experience will feature swinganalysis hitting bays allowing fans to getinstant feedback on their swing alongwith other activities. Also new for 2012,the Fan Experience will include a full-size tennis court with daily program-ming and special offers and assistancefor American Express Cardmembers.

� Mobile Shopping: The 2012 U.S. Openfeatures an enhanced mobile experiencethat includes merchandise-ordering ca-pabilities in addition to the ability tocheck live scores, daily schedules, thelatest news and watch live matches. Withthis dynamic shopping feature, you’ll beable to purchase merchandise while onthe grounds for pick-up or delivery to se-lect locations at your convenience.

� Fountain/Plaza Desk: ESPN and CBSwill broadcast live during select ses-sions. You won’t want to miss inter-views with today’s tennis stars!

� Where to See the Stars: The prac-tice courts located by the West Gateare a great place to get an up-closelook at some of the world’s bestplayers.

� Membership: Here’s your chance tomake tennis, make a difference incommunities across the country. Jointhe USTA today and help us changelives through tennis Stop by the USTAMembership Booth next to the U.S.Open American Express Fan Experi-ence under the overhang of the ChaseCenter. A vast array of tournamentsouvenirs and mementos are availableto commemorate your U.S. Open ex-perience.

� Merchandise: A vast array of tourna-ment souvenirs and mementos areavailable to commemorate your U.S.Open experience.

� International Tennis Hall of Fame& Museum Gallery at the U.S.Open: Be sure to visit the U.S. OpenGallery, located inside the ChaseCenter.

Does your schedule make it difficultto play on a USTA League team?Are you looking for people to play

with, but don’t know where to go? Do youwant to work on your singles game, with-out affecting your USTA rating?

USTA’s Flex League may be for you.Flex Leagues allows you to play when

it’s convenient for you. You arrange a mu-

tually agreeable match day, time and loca-tion with your opponent. The home playercovers the court costs, if any.

Registration is completed online atwww.ustaflex.com. Once registration isclosed, a schedule will be generated. Youwill receive a list of opponents and sug-gested “play by” dates. Once the match isplayed, the scores are recorded online.

Additionally, all players registered for theUSTA Flex League are entered into theUSTA Flex League Sweepstakes where thegrand prize is a trip for two to the U.S.Open.

Fall registration dates for the USTA FlexLeague run from June 15 through Sept. 20.

For more information, e-mail [email protected].

USTA Flex League


2 0 1 2 U . S . O P E N P R E V I E W

2012 U.S. OPEN MATCH SCHEDULESubject to change

Date/Session Day/Evening Time Featured Matches

Monday, August 27 1 Day 11:00 a.m. Men’s/Women’s 1st Round2 Evening 7:00 p.m. Men’s/Women’s 1st Round

Tuesday, August 283 Day 11:00 a.m. Men’s/Women’s 1st Round4 Evening 7:00 p.m. Men’s/Women’s 1st Round

Wednesday, August 295 Day 11:00 a.m. Men’s 1st Round/Women’s 2nd Round6 Evening 7:00 p.m. Men’s/Women’s 2nd Round

Thursday, August 307 Day 11:00 a.m. Men’s/Women’s 2nd Round8 Evening 7:00 p.m. Men’s/Women’s 2nd Round

Friday, August 319 Day 11:00 a.m. Men’s 2nd Round/Women’s 3rd Round10 Evening 7:00 p.m. Men’s 2nd Round/Women’s 3rd Round

Saturday, September 111 Day 11:00 a.m. Men’s/Women’s 3rd Round12 Evening 7:00 p.m. Men’s/Women’s 3rd Round

Sunday, September 213 Day 11:00 a.m. Men’s 3rd Round/Women’s Round of 1614 Evening 7:00 p.m. Men’s 3rd Round/Women’s Round of 16

Monday, September 315 Day 11:00 a.m. Men’s/Women’s Round of 1616 Evening 7:00 p.m. Men’s/Women’s Round of 16

Tuesday, September 417 Day 11:00 a.m. Men’s Round of 16/Women’s Quarterfinals18 Evening 7:00 p.m. Men’s Round of 16/Women’s Quarterfinals

Wednesday, September 519 Day 11:00 a.m. Men’s and/or Women’s Quarterfinals20 Evening 7:00 p.m. Men’s and/or Women’s Quarterfinals

Thursday, September 621 Day 11:00 a.m. Men’s Quarterfinals/Mixed-Doubles Final22 Evening 7:00 p.m. Men’s Quarterfinals

Friday, September 723 Day 11:00 a.m. Men’s Doubles Final/Women’s Semifinals

Saturday, September 824 Day 11:00 a.m. Men’s Semifinals25 Evening 7:00 p.m. Women’s Final/Pre-Match Ceremony

Sunday, September 926 Day 12:00 p.m. Women’s Doubles Final/Men’s Final


By Tom Ferraro, Ph.D.

Ijust got back from a book tour of Korea,and I was there to discover the secretto how such a little country like Korea

can produce a wave of female golfers thatdominate the LPGA. I traveled to The OneGolf Academy run by Dr. Won Park. They

are located next to a giant Samsung fac-tory and underneath a highway bridge.The Academy is really just a driving rangewith a par three course next door. Fromthis humble place comes a long list of Ko-rean of golf stars.

I asked Dr. Park how he does it. “Sim-ple. You start the girls at a young age and

expect to see a total commitment to golfby the age of 12. We assume they willwork extremely hard, seven days a week.The parents are devoted to the child’s ca-reer and give their last penny to them.This kind of support lasts for about 10years. They typically turn pro by the ageof 18 and are expected to win or suffergreat shame and guilt. It helps that wehave a national superstar in Se Ri Pak forthe kids to look up to.”

What’s good for golf is good for tennis.If you want to develop a young prodigy,do what they do in Korea. Start themyoung, expect them to fully commit totennis to the exclusion of all else by theage of 12, provide unlimited support for10 years, give them good coaching, andin return, expect both respect, gratitudeand many trophies. Some say this is tooharsh to do to American children, but itsure does work in Korea.

For consultations, treatment or on-site vis-its, contact Dr. Tom Ferraro Ph.D., sportpsychologist, by phone at (516) 248-7189,e-mail [email protected] or visit www.dr-tomferraro.com.

Dr. Tom on the Secret to Making a Prodigy


By Ricky Becker

It’s late in the summer andyou want to play collegetennis and use your tennisgame to help your college

prospects, but you haven’t done anythingyet to prepare for your college search. Thisis what you should do first …

If you graduated high school in2012 …Know what you want to get out of aschool first and foremost (scholarship,education, tennis, geography), and thengo on the Internet or hire a college con-sulting company and contact thecoaches at these schools. Realistically, itwill be tough to set anything up for Sep-tember, but there should be some schol-arship opportunities starting in January ifyou try hard enough. Scholarship moneysometimes opens up last minute at someschools as people transfer or de-commit.Play tournaments, and if you are rankedoutside the top-100, make a collegevideo ASAP. Make visiting schools thatyou are interested in a very high priorityas well.

If you finished your junior yearof high school in 2012 …Make your college video, know what youwant to get out of a school, make a list of10-15 schools and contact the coaches atthese schools. Parents, if your kids are shyor not being proactive, this is probably not

the time to teach them proactivity, send acoach an e-mail on your child’s behalf. Or(and I am not saying to do this of course)some parents I have spoken to have sente-mails from their child’s e-mail saying itwas the child. I’m just saying it has beendone many, many times.

If you finished your sophomoreyear of high school in 2012 …Educate yourself with the process sothat there are no surprises for the up-coming school year. Make a target list ofno more than 20 schools. Educate your-self on what rankings and grades you willneed to be of interest to the schools onyour list. Statistically, any college that islooking for recruits two stars higher thanwhat you are on TennisRecruiting.net aremajor long shots at this point as well.Casually reach out to schools that will beinterested in your current credentials. Ifany of these correspondences go well,try and set up an unofficial visit to aschool.

If you finished your freshmanyear of high school in 2012 …Educate yourself on what the tennisand academic thresholds are for col-leges and try to imagine if you canreach your target schools by hitting theathletic or academic threshold. A stu-dent who is slightly below a school’sacademic and athletic target has a lotless of a chance for admittance/schol-arship money than a person who sur-

Mythbusters: It’s August … I Haven’t Done Anything in My College Search … What Now?

passes one target and clearly misses theother target. Parents should make a pre-liminary list of colleges with their kids.There is no need to limit the amount ofcolleges on the list. Send a casual letterto a coach if your ranking and/or gradesfit their profile. This is a great time to sitback and try to realistically figure out iftennis will open doors or if all the focusshould be on academics.

If you are now entering highschool …Start looking at tennis practice as anotherfun way of doing homework. Test scoresmatter for college but so does a ranking.Train on-and-off the court with similar re-spect and dedication that you give yourhomework. Parents should start under-standing what is important to them andtheir child in a college. Parents should startto get an idea what ranking would garnerthe interest of particular tennis teams. Kidsand parents should get acquainted withTennisRecruiting.net which is the rankingthat most college coaches look at.

Ricky Becker is founder of JuniorTennis-Consulting LLC, which offers off-court col-lege guidance services to junior tennisplayers. He is now director of tennis at PineHollow Country Club and will be runningtennis programs at Glen Head RacquetClub in the winter. He can be reached by e-mail at [email protected], by phone at(516) 605-0420 or via JuniorTennisConsult-ing.com.


SPORTIME IS THE ONLY PLACE TO PLAY TENNIS ON LONG ISLAND� 110 tennis courts at 8 locations across Long Island, in

soft and hard surfaces, indoors and outdoors

� Convenient online court booking from home

� Lowest hourly and seasonal court rates for members

� World-Class tennis professionals offering the finesttennis instruction for kids and adults

� League programs for adults and juniors of all agesand levels

� Complimentary court time for members

� Complimentary game arranging

� High Performance Elite Junior training and ExcelTennis Camps

888/NY TENNISwww.SportimeNY.com/Tennis

New members/particpants only. Offer not valid at Randall’s Island. Not tobe combined with any other offer or discount. 3310-LITM-QS

FREE QUICKSTART CLASSGet your kids playing tennis fast with SPORTIME’s

QuickStart Program for children ages 5 - 10! Booka free class by September 2012 at any SPORTIME

Tennis location.

SPECIAL OFFERSTake advantage of our offers

below and become a member ofthe SPORTIME family of clubs!

FALL PROGRAM REGISTRATION GOING ON NOW!CALL TODAY!

Visit us online to find aSPORTIME location nearest you!

New members/particpants only. Offer not valid at Randall’s Island. Not tobe combined with any other offer or discount. Not applicable to a Quick-Start Program. 3310-LITM-PD

$50 OFF ANY 17-WEEK PROGRAMJoin any SPORTIME Tennis location by September2012 and get $50 off the cost of a 17-Week Tennis

program.

THE ACADEMY

SPORTIMET E N N I S

BE PART OF SOMETHING BIGGER !


THEE ACADEMY

516.933.8500www.JohnMcEnroeTennisAcademy.com

COURT TEST REQUIRED - CALL TODAY!

THE JOHN McENROE TENNIS ACADEMYComing to SPORTIME Bethpage Tennis September 2012


You don’t need muscles to change theworld … you just need a heart. And a12-year-old Syosset, N.Y. girl is prov-

ing what a heart she has. Gabrielle Sklarwas sitting at the dinner table when hermother mentioned the life and deathbattle of her Sportime tennis coach TJHarvey, 58, was facing against bladdercancer. In addition to fighting a cancer thathas the worst recurrence rate, Harvey’spart-time status at work did not qualify himfor health insurance, putting him in thesame void as one out of six Americans.

“When I described what TJ was goingthrough, right away Gabby asked howshe could help,” her mother, Sandra, re-called.

Gabby is a giggly, chatty seventhgrader at Southwoods Middle School inSyosset. And while her days are packedwith after-school activities, including ten-nis, piano and singing lessons, Gabrielle’smission was clear: Help Harvey.

“It’s the best it could get,” she says ofcombining a feeling of accomplishmentwith helping someone in need.

Susan Stix, a clinical social worker inRoslyn, N.Y., says it’s important that chil-dren learn the gift of charity.

“It makes them have a deeper sense ofconnection, and they learn that such a lit-tle gesture can make a big difference,”said Stix.Gabby created a plan. She would beginby asking her friends to donate. The best

way to entice them to give? Give them agood time! Have a pool party!

The weather was as warm as the heartsshe attracted. Gabby set out a bucket of“love,” and into it, friends poured in $1s,$5s, $10s even $20s. At the end of the

party, Gabrielle had raised $300 for thebeloved tennis coach.

“We made a party with a purpose, in-stead of just a party,” mother SandraSklar said.

But Gabby wasn’t done yet. Fueled byher success, she summoned the courageto approach a local pizza parlor, Zio’s Ital-ian Grill and Pizzeria on Cold SpringRoad in Syosset. Owner Marcello Cac-cialino was touched by Gabby’s act ofkindness and supplied his own in theform of zeppolis—300 of them—that en-terprising Gabby could sell to the public.

“Sometimes you have to give back. Ilost a father-in-law to cancer, and thoughtwas a nice thing that the kids were get-ting involved,” said Caccialino.

But where to sell them? The savvyyoung businesswoman knew she neededa place with lots of foot traffic. She askedthe management at Stop & Shop in Oys-ter Bay if she could set up a table in frontof the supermarket, and got the go-ahead.

So while the other kids were messingaround at the mall, Gabrielle and two re-cruits were turning dough into donations.They came home with another $500.

“It made me feel really proud that Icould do something,” said Gabby.

“She had a lot of compassion, and shefelt good about doing good,” SandraSklar recalled.

The next step was to present Harvey

Twelve-Year Old Helps Raise Money for Coach With CancerB Y T E R I M A R I A N I

L O N G I S L A N D T E N N I S M A G A Z I N E

charitable initiatives

Gabrielle Sklar


with the money. Gabby was off to sleep-away camp, leaving her mother to springthe surprise. Carrying a tray full of brown-ies, Sandra Sklar met TJ for lunch atMim’s. But the real treat was in the lovebucket—all the money her daughter hadcollected for him. Harvey was over-whelmed.

“It’s humanitarian, it’s empathic, andit’s generous. It lifted me above theclouds and made me want to fightharder,” TJ said.

Harvey has made it a point to live hisown life generously. There is no clockwhen he gives his “hour-long” lessons.

They’re done when the student “gets it.”And students routinely say they learnmore in one hour from him than from ayear of lessons with other teachers.

“TJ treats everyone like an advancedplayer, so you become one,” said KarenSchoenbart, president and chief operat-ing officer of NPD Group and a long-timestudent of Harvey’s.

Harvey readily accepts players into hispractice group that other tennis coachesmay be reluctant to take on. They includestudents with birth defects, hearing dis-abilities and Parkinson’s disease.

“Those players inspire other players to

How many times have you searchedfor jewelry that truly reflects yourpassion for tennis only to find a

pair of $20 fuzzy yellow tennis ball ear-rings? That was the problem Designerand Owner Hazel Nussbaum experi-enced in 2010 when trying to find a pieceof tennis-inspired jewelry to celebrate abig win. Although consumers are over-whelmed with jewelry choices, the ten-nis player has been left out of the game.

“I’m not the only woman out thereseeking elegant, classic and approach-able pieces celebrating her love of ten-nis” said Hazel. “Can’t you hear the‘racquet?’ These fans want it and theycan’t find it … anywhere.”

Yes, we hear it and we’re happy totell you that you don’t have to look anyfurther. Introducing Love Tennis byhazel, a game-changing new jewelryline that celebrates passion for thegame with elegantly hand-craftednecklaces, bracelets and earrings. Oh,and they even have cuff links for him!

The line includes a total of four collec-tions based on the Grand Slam tournamenthost cities. New York and Paris are avail-able now, while Melbourne and London willdebut in 2013. These classic and timelesspieces express the passion points of thegame—winning, motivation and teamspirit. Some pieces are whimsical, othersmore bold, but all are simply beautiful.

The New York collection lariat necklace(see center image) features a sterling silvertennis ball gently slipped through a simple,yet subtle, silver racket with tiny gold-plated handle. The tennis ball stud earrings(see left image) are a clever take on a time-less classic. And, the Racquet and BallHook Bracelet (see right image) is brilliant—a sterling silver racquet with gold-platedhandle gently hooks onto a sterling silvertennis ball; all seamlessly linked on a ster-ling silver bangle.

And, the icing on the cake—all piecesare proudly made in the USA.

For more information and to view the entirecollection, visit www.lovetennisbyhazel.com.

Introducing Love Tennis by hazel

do their best,” Harvey said.The giving experience turned out to be

as important to Gabrielle as it was forHarvey. One heart helping another heart.And as we all know, two hearts are betterthan one.

“I’m not going to stop,” said Gabby.To make a donation to TJ Harvey‘s fight

against cancer, visit http://www.givefor-ward.com/tjharvey

Teri Mariani is a TV newswriter in New York.She may be reached by phone at (917)562-5708 or e-mail [email protected].


InsideOut Sports + Entertainment hasannounced that tennis legends JohnMcEnroe, Andre Agassi, Pete Sampras

and Patrick Rafter will be competing inthe NASDAQ Indexes Cup as part of thePowerShares Series Tour at MadisonSquare Garden in New York, N.Y. onMonday, Nov. 5. Formerly known as theChampions Series, the PowerShares Se-ries will visit a total of 12 U.S. cities dur-ing its seven-week season.

In addition to McEnroe, Agassi,Sampras and Rafter, the tour, producedby Larry Magid, will feature fellow GrandSlam champions Jimmy Connors, JimCourier, Michael Chang and Mats

Wilander, as well as Davis Cup ChampionTodd Martin. The athletes will becompeting for a prize pool totaling $1million to be shared by the top threefinishers at the conclusion of the season.Each PowerShares Series tournament willshowcase four of the legendary playerscompeting for ranking points playing intwo, one-set semifinals followed by aone-set championship match.

Pete Sampras finished the 2011 sea-son as the number one-ranked player, fol-lowed by Jim Courier and Andre Agassi.

“We are thrilled to be coming to Madi-son Square Garden with the Power-Shares Series,” said Jon Venison, partner

at InsideOut Sports + Entertainment.“New York audiences expect to see thebest and this event will showcase fourformer world number ones and U.S.Open Champions competing againsteach other in a one-night shootout tour-nament. It will be a fantastic night of ten-nis at The Garden.”

The PowerShares Series is a tennis cir-cuit for champion tennis players over theage of 30, created in 2005 by InsideOutSports + Entertainment, the New Yorkbased firm which is co-owned and op-erated by former SFX executive JonVenison and former world number oneJim Courier.

McEnroe, Agassi, Sampras and Rafter to Compete in NASDAQ Indexes Cup at MSG in November


Eight boys and girls, ranging in age fromseven to 16, were introduced this week aswinners of full or partial scholarships to theJohn McEnroe Tennis Academy (JMTA). Eachwere among approximately 170 participantsages six through 17 in an open tryout on July21, and the eight were honored on-court dur-ing the World TeamTennis matchup betweenthe New York Sportimes and WashingtonKastles at Sportime Randall’s Island.

The eight winners were:

� Palmer Clare, North Bellmore, N.Y. (16)� Diane McCready, Brooklyn, N.Y. (11)� Natalie Eordekian, Woodside, N.Y. (7)� Cameron Daniels, Oakland Gardens,

N.Y. (15)� Leonte Wilder, Plainfield, N.J. (11)� Sean Wei, Yorktown Heights, N.Y. (12)� Tomas Kopczynski, Sleepy Hollow, N.Y.

(12)� Amber O’Dell, Chesterfield, Mich. (11)

In all, 23 semifinalists advanced to an af-ternoon session at the tryout, from whichthe winners were selected.

“These eight boys and girls showed agreat deal of potential and positive, winningattitude,” said McEnroe. “I was pleasedwith how much talent and competitivespirit we saw at the tryout, and my Acad-

emy staff and I are looking forward to work-ing with these exceptional young athletesto maximize their abilities.”

The JMTA, expanding with annexes onLong Island and in Westchester to open inSeptember 2012, continues to draw a widerange of talented young people from all walksof life who are interested in learning tennisfrom its Hall of Fame namesake and from theelite team of JMTA coaches that have beenassembled. The third annual session of theAcademy will begin in September.

John McEnroe Tennis AcademyHonors Eight With Fall Scholarships

The day-long tryout was held at theJMTA Flagship location, Sportime Randall’sIsland, with young players between theages of six and 17 having worked out forJMTA coaches. McEnroe observed andevaluated the players in the second oppor-tunity for young players to participate inopen tryouts for spots in the JMTA. In July2010, over 300 young people participatedin tryouts, with five boys and seven girlsawarded full or partial scholarships to theJMTA.

John McEnroe congratulates the recipients of Fall Scholarships to his John McEnroe Tennis AcademyPhoto credit: Adam Wolfthal


B Y E M I L I E K A T Z

Tweets from the prosDaniela Hantuchova(@dhantuchova): Heyguys, I had so much funlast night at the ESPYs! Itwas fun seeing so manygreat athletes under oneroof. It’s always great tobe in LA!

C a s e y D e l l a c q u a(@caseydel lacqua) :Justin Bieber seems likea lovely young lad witha good head on hisshoulders.

Mardy Fish (@Mardy-Fish): I’m not an Angelsfan at all but obviously Ihave to root for a guynamed Mike Troutright???

Novak Djokovic (@djok-ernole): I’m officially backin the office! I hit a coupleof balls with Maria, trustme … she didn’t take iteasy on me :)

Sabine Lisicki (@sabine-lisicki): Done for the day.It feels so good to gethome after a good day ofpractice. I’ll sleep like ababy tonight!

Shahar Peer (@sha-harpeer): After a reallygood day of tennis andfitness I had a massage,and now I’m going tohave dinner! Really happyabout today :-)

Carol ine Wozniacki( @ c a r o w o z n i a c k i ) :Evening on the couch forme! 6 hours of training in30 degrees should do it.

Serena Williams (@sere-nawilliams): I’m at ChefChu’s restaurant in PaloAlto Ca. This place is in-sanely good! ThanksChef! I love it!!!

R o b i n S o d e r l i n g(@RSoderling): Acupunc-ture time!

Andy Roddick (@andy-roddick): It’s awesomewhen you’re behindsomeone at the grocerystore and as they are get-ting wrung up they run toget five more things.

Tweets from the 2012London Olympics

Bob Bryan (@Bryanbros):Trying on some snazzygear at USA team pro-cessing.

Sabine Lisicki (@sabine-lisicki): Woohoo on myway to London!!! So ex-cited!

Ryan Harrison (@ryan-harrison92): Made it toLondon! Awesome newNike gear for theOlympics! Can’t wait toget going.

Serena Williams (@sere-nawilliams): OLYMPICS!!!!!

Carol ine Wozniacki(@carowozniacki): Backin London and can’t waitfor the Olympics! I am soexcited to represent Den-mark!!


Body IssueDaniela Hantuchova hasfollowed Serena Williamsand Vera Zvonareva in ap-pearing before the camerasfor ESPN The Magazine’sannual Body Issue.

There’s precedent forHantuchova’s (lack of)coverage: She featured

prominently in Sports Illustrated’s 2009Swimsuit Issue, alongside fellow prosMaria Kirilenko and Tatiana Golovin.

Basketball Meets TennisScottie Pippen, part ofthe six-time World Cham-pion Chicago Bulls andthe original Dream Team,watched Serena Williamsadvance to the next round

at Wimbledon and Dallas Mavericks starDirk Nowitzki watched his Germancompatriot Sabine Lisicki upset MariaSharapova at Wimbledon as well.

And the ESPY goes to …Maria Sharapova made acameo on the red carpetat the ESPY Awards heldat Los Angeles’ NokiaTheatre. She then won theBest Female Tennis Player

honor, but was beaten for Best Female Ath-lete by Baylor University basketball champBrittney Griner, and for Best Comeback byDetroit Lions quarterback MatthewStafford. Novak Djokovic also won at theESPYs, as Best Male Tennis Player.

Back to schoolVenus Williams is takingonline classes throughIndiana University. Shewore her school colorsand letters while watch-

ing sister Serena play at Wimbledon

Love and marriageMarcos Baghdatis andKarolina Sprem marriedin Trakoscan castle in herhomeland of Croatia inJuly. Sprem is also preg-

nant with the couple’s first child. Both play-ers are 27 and have been dating for twoyears. On his way to tying the knot isJames Blake. Blake is set to be married onNov. 9 in San Diego. Blake and his fianceeEmily just recently had their first child, ababy girl named Riley. María JoséMartínez Sánchez has been enjoyingsome of the best years of her career re-cently and the Spaniard got married inBarcelona on July 14 to her boyfriend ofnine years, Juan Domingo Pérez.

Serena hopes not toargue at U.S. Open

Serena Williams jokesthat her goal at this sum-mer’s U.S. Open is to“maybe not get into anargument.” In her last twoappearances at FlushingMeadows, Williams threat-

ened a linesperson after being called for afoot fault (in the 2009 semis), and then ar-gued with chair umpire Eva Asderaki overa hindrance call, calling her “not a very niceperson inside” (in the 2011 final).

“If someone makes me really angry Imight have to get into a little bit of an argu-ment, but my goal is to try to stay calm if Ican,” Serena said with a smile. “If not I’mgoing out with a bang as I did the past twoyears.”

Last call at Open for Clijsters

This year’s U.S. Open willbe the last for formerworld number one-rankedKim Clijsters of Belgium.Clijsters has announcedthat she plans on retiringafter the event. She ini-

tially retired in 2007 due to a hip injury, butreturned in 2009 to win her second U.S.Open title that year. Earlier this year, Cli-jsters had already announced this would beher last season.

“As it stands, I will end my career at theU.S Open,” said Clijsters. “That is where Ienjoyed my greatest triumphs and it is a veryspecial place for me.” She is a three-timechampion in Flushing Meadows, winning thetournament in 2005, 2009 and 2010.

McHale and Stephenson the USS Midway

Two of America’s most promising youngstars, Christina McHale and SloaneStephens, had a very special experienceon Day 1 of the Mercury Insurance Open,playing tennis on and then touring the USSMidway, the longest-serving U.S. Navy car-rier of the 20th Century and the most vis-ited floating ship museum, with more thanfive million visitors since 2004.

Tube stations

In celebration of the Olympic Games inLondon 2012, the names of 361 tube sta-tions will be changed to carry the names ofOlympic athletes. Roger Federer now hashis own stop near the city centre. “RogerFederer” will be one of the stops on theblack line, the so-called Northern Line andwill replace the normal stop “Old Street.”Athletes like Lionel Messi, Samuel Eto’o,Usain Bolt, Fabian Cancellara, CarlLewis, Michael Jordan and MuhammadAli were also honored with their own tubestation stops during the Olympics thissummer.

40 Long Island Tennis Magazine • September/October 2012 • LITennisMag.com 40LITennisMag.com • July/August 2012 • Long Island Tennis Magazine Submissions for both advertising and editorial are due by October 1, 2012.

For more information, please call 516-409-4444 or e-mail [email protected]

Distribution scheduled for 11/01/12This edition will feature:• Top Coaches Roundtable Discussion• U.S. Open Recap• Year In Review• Summer Camp Photo Recap

Distributionacross Long Island at300+ locations:• Country clubs• Tennis camps• Retail stores• Gyms• Indoor tennis

clubs• Supermarkets, and• Many more!• Bonus Distribution at Girls HS StateChampionships

Don’t miss the advertising opportunities in the nextedition of Long Island Tennis MagazineNovember/December 2012!


By Jeff Fenton

Representing your collegeas a participant on its ten-nis team is a thrill of a life-time. I try to open the door

for as many high school hopefuls as I can.When a college coach requests a videofrom a high school prospect, they might beasking, “Who are you and why should I beconsidering you?”

When I make a video for a high schoolplayer, I want to portray the player as hon-estly as I can. I look at each player as a spe-cial athlete. Through my videos, I try to showthe true athletic skills, as well as the innerdrive from each player. Everyone has some-thing special. I was a Division I scholarshipathlete myself, so I have a personal under-standing of what it takes to be a contributorto a team sport. Tennis players are no differ-ent from other athletes who will be repre-senting their college in their sport of choice.In these videos, a person’s body languagespeaks: Players must exude positive energy,confidence, strength and intelligence. I alsolike to include some audio bytes from eachprospect because there is no substitute forspeaking from the heart.

All-in-all, these “highlight reels” are animportant vehicle for broadcasting yourselfto a college coach. Most coaches receivehundreds of these videos, so if yours doesnot stand out, you’ve lost an opportunity:An unforced error, if you will. Thehighlight reel needs to get tothe point, make a state-ment and be informative.It needs to exhibit real-istic challenging tennisand some actualcompetitive play.

During the actualvideotaping session, Iuse my 16 years as aUSPTA teaching pro toidentify goals and commu-nicate them to the player andthe player’s coach. We design certaindrills to bring out the best from the player.

Editing is a long and sometimes compli-cated procedure that is an often overlookedprocess of the highlight reel. I must choosethe best segments of the video to use, putthem in the most logical order, use the ap-propriate dissolves, include the audio bytesstrategically, include information about theplayer, such as awards and recognition,

rankings, etc., add energetic music whenappropriate, even take out unwanted audiolike humming from fans or buzzing from flo-rescent bulbs. Sometimes I use slow-motionwhen I feel an athletic movement needs to

be highlighted.The finished DVD that I pro-duce has a photograph of

the player printed on thedisc. Also popular andeasily accommodatedis the service of pro-ducing a video file forthe player to upload

to the Web to sites likeYouTube. The coaches

seem to find this a practi-cal venue for receiving a

video.Each player that truly has the ambi-

tion to play for their college team canachieve it. If you put in the work, you canbe rewarded. There is a school out therefor you.

Jeff Fenton is a USPTA-certified teachingpro working out of Clay Time Indoor Tennisin Island Park, N.Y. He may be reached bye-mail at [email protected].

College Recruiting Videos:

How Are They Made?

“Through my videos, I try to

show the true athleticskills, as well as the

inner drive from each player.”

RACQUETCLUB

1414 Jerusalem Avenue, North Merrick, NY 11566 • 516-489-9005

JUNIOR DEVELOPMENT PROGRAMAND ADULT LEARN & PLAYSSeptember 13th - January 20th

Testing Dates:August 20th-24th & August 27th-30th—5:00 p.m. - 6:00 p.m.

August 25th—9:30 a.m. - 10:30 a.m.


cutting, as well as allow the athlete totransfer adequate force into the ground tobe fast and explosive.

With a minimal shoe, most of the energyis dissipated through the natural absorp-tion of the foot musculature. This creates agreat “training” situation because you canfeel your connection to the ground throughthe proprioceptors. These proprioceptorsdictate balance, stability and motor control.In a strength and movement training envi-ronment, this could be very beneficial tothe long-term development of athleticism.

By Frank Dolan, BS, CSCS

If you are in any way con-nected to the fitness or run-ning world, you know thatthere is quite a bit of hype

around the idea of using a minimal shoe fortraining and running. From Vibram Five Fin-gers to the New Balance Minimus, you cansee athletes everywhere utilizing theseshoes to strengthen their feet, as well ascreate a more natural feel in athletic move-ments. But, the question still remains: Arethese shoes good for playing tennis?

If a minimal shoe can help improve func-tional movement, wouldn’t it make sensethat it could improve your movements onthe court? In this case, the answer is no.Tennis is a sport in which the shoe be-comes part of the equipment. The lateralsupport, wide base and hard bottom of thetennis shoe will support multi-directional

But, with that being said, when you hit thecourt, you want to be in a proper tennisshoe to minimize the risk of injury, as wellas express your game optimally.

Frank Dolan, BS, CSCS is a strength andconditioning specialist, and the owner ofSports and Fitness Performance in Islip,N.Y. In addition to studying directly undersuch industry luminaries as Gray Cook,Mark Verstegen and Mike Boyle, Frankconsults for organizations such as Equi-nox Fitness Clubs, Major LeagueStrength, The Baseball Factory, and sev-eral local colleges, high schools andsports organizations. He is an expansionteam presenter for Functional MovementSystems (FMS), and in 2008, worked asconsultant to the New York Yankees dur-ing spring training. He may be reached byphone at (631) 650-7140 or [email protected].

Minimal Shoes for Tennis?“With a minimal shoe,

most of the energy is dissipated through the

natural absorption of the foot musculature.”

ROCKVILLE RACQUET CLUB

80 N. CENTRE AVENUE, ROCKVILLE CENTRE • [email protected]

Men’s & Women’sLeagues2.5-4.5Call for

Placement

JUNIOR DEVELOPMENT PROGRAM15 WEEK SESSION

Starting September 10TH • Age 4 Yrs – 18 YrsGROUPS, PRIVATES, SEMI-PRIVATE

Call For Screening AppointmentNew Members Only

DIRECTOR, PAT MOSQUERA

NEVER A MEMBERSHIP FEE

Women’s& Men’s

Learning LeaguesCall ForTry-Outs

ROCmen’s

’’’nnnnnneneneeeeememememmmmmmomomomomomoWoWoWoWoWoWWWWWWWWWW ssssssss’s’’’nnnnnnnen s’MMMMMMMMM&&&&&&&&

CKVILNIO

E RACQUEPROGRAM

srY

ET CLUB

Men’s & Women’sMen’s & Women’sooooooWoWoWWWWWWWWWWW& W& & & & &&&&& &s &s &s s Men’s Men’s Men’sMen’sMen’sMen’sen’sen’en’en’enen ssss’’n’nnnnneneneeeeemememmmmmmmmmomomooooooWoWWWWWWWo ’smenM ’sLLLLL

M

ss

80 N. CENTR

LL

ssts

esesesesesesueueueueueueguguguguguaguaguagagageageageageaLeaLeasssss’s’s’sn’sn’n’n’nnenenenenenMeMeMeMeMeMeMMM& M& M& M& M& M&&&&&&&

yyyTryTryTrTrTrTTTTT

sL e

TryTr

LeaLeaLeaLeLeg Leg Leg Leg Lng Lng Ling LLearning LLearning Learning Learning LearningLearningLearningLearningLearninLearninLearninLearninLearniL

Try-OutsutsutsOutsOutsOutsOutsOuts-OutrrrrororororForForForForFol Fol Foll Foall Foall FCall FCall F

-OutsCall FCallCallCallCalCalCaCaCaCC

-Out-Outy-Ouy-Ouy-Ouy-Ouy-Oy-Ory-OryryryTTT

OCKVILLE C6-76

RockvilleR

sssssssssss

MEMA

CENTRE • Ro64-53Racquet.net

SOM

HSREBM

@optonline.net

Place tttntntententententmenmenmenmenmeemeemerrrororororforforforfor for55555ssssesesesesesesueueueueuegueguguguguaguaguagagageageageagLeaLeaLeaLeaLeaLeaLeLeLeLeLLL

alaPlaPlaPlaPlPlPlPPPPP cementacPla

.5.54.54.54.54.54.5-4.-4.-45-45-45-45-4.5-42.5-2.5-2.5-2.52.52.52 52 522222l foll foll foall foall fCall fCall fCall CallCallCallCalCalCaCaCaCCemecemecemcemcemcemacemaceaceaceacaclll


know why. That is why it is equally impor-tant to include protein and fat.

Fat is the body’s most concentratedsource of energy, providing more thantwice as much potential energy ascarbohydrates or protein (nine calo-ries per gram, versus four caloriesper gram). During exercise, stored fatin the body (in the form of triglyc-erides in adipose or fat tissue) is bro-ken down into fatty acids. These fattyacids are transformed through theblood to muscle for fuel.

Protein is not being maintained in thebody for use of energy. Protein is needed tobuild and repair body tissues, as well as syn-thesize important enzymes and hormones.Protein, however; provides energy in latestages of prolonged exercise.

Elite tennis players require different typesand amounts of fuel than most recreationalplayers, a registered dietitian can help you ac-curately estimate your daily caloric needs andhelp you with a meal plan that will enhanceyour athletic achievements.

By Irina Belfer-Lehat

The foods that we eat providethe energy or fuel that our bodyneeds. Athlete’s bodies have

different needs and requirements in order tooptimize their athletic performance. Manypeople have misconceptions about differentfood groups, as some try to avoid carbohy-drates, while others avoid fats. This type of di-eting is called “fad diets” and are never a goodidea, especially for an athlete. An athlete,needs all six food groups, specifically: Grains,vegetables, fruits, oils, milk, meat and beans.

Carbohydrates, such as sugar and starch,are readily broken down into glucose, the prin-cipal energy source of the body. Glucose canbe used immediately or it can be stored in theliver and muscles as glycogen. Blood glucoseserves as the most significant source of en-ergy for the brain at rest and during exercise.The capacity of your body to store muscle andliver glycogen is limited to about 90 to 120minutes of continuous, vigorous activity. If youever hit the wall while exercising, now you

Irina Belfer-Lehat is a New York State-li-censed dietitian and certified dietitian-nutritionist. She may be reached byphone at (917) 769-8031 or e-mail [email protected].

Meeting Energy Needs

ENENTT

EEYYLALAAAYYS PS PIINNNNGGNNIISEEKSEEK

33ESESGGAASSERERSHSHIIEWEWJJGG

646435-35-

11ererbbememttepepSS::ttasasoo C CttWesWesTRTRSSIINNNNTETESSRRTETESSAAMM

bb))FFM,M,((::SSRROOIINNUUJJ::rrooffggitinitinrurucceerroolslsAA44--39, 4039, 40--: 35: 35ssnnooiissiivviiDDeeggAA

MM((EL:EL:LEVLEVSSERERTTSSAAMMLLRROOWWTTARARPP++5533

WWthth1919

ttaaGGinintatannuuooMMe e hhttatat2012 2012 10,10,::TSTSUUYOYORR

gg,,esesggaallllaa))FF,,MM((::NNEEPPOO1998,1998,--19951995nnrroobb6660-60-59, 59, --54, 5554, 55--49, 5049, 50--44, 4544, 45

)) F F,,MMNANARREENTNTIITTSSEEGGRRAALLRDRD33SS’’DDLL

7000+7000+SSTTRROOSPSPGGNNIIATATPPIICCIITT

amam G GahahiiababccacacMMddrlrlooWWWWoont nt eesseerrppeerrtoto

ggnn A Assoo L Lininbblulu C CyytrtrnnuuooCCtete

))(M(M::RSRSEETTSSAAMMDDNNRARAGG&&++8811yyllllaaenerenergg2013201331/31/12/12/ffffooooffssaassgegeAAAAgg4. 4.

PPMMOOCCNGNGIITTRRPOPOSSLLNANAOOIITTAA60+ C60+ CSSEETTEELLHHTTAAHHSSIIWWEE+ J+ J

20120130,30,--1717yyululJJ,,esesmmt thet theaaAASSUUthethe

AACC,,ssleleeegg

80+80+oo65 t65 tsseeagag

NNOOIITTIITTEESSEEIIRRTTNNUUOOCC

raelrael Is Is3,3,

i iti itVVttssuummssttnnaaliclicppppaaddeettsseerreettnnII

2929--7722rreeobobttOcOc::ttasasoo C CttasasEEpp

bibiiittaaliclicppppaalliaiaicicffffoonnaaininddnneesstteeRRnnooatata Ra RccooBBe e hhttatat201220129,9,

,,

ff

ttmmrrooffttuuooyyrrttaassaalllleewwssaannioiobbuullCC&&ttrrooeses

ggyy

illillt ft fddlliittdd

AASSUUiibbaaccccaaMMoott

,,gg

titililitt


Three Secrets to a Better Serve TodayBy Lisa Dodson

In today’s game, there aremany schools of thought asto how to create the bestserve. The information is

often unclear, the terminology is difficultand the execution is near impossible. I’dlike to give you three clear and simple con-cepts to think about that will change yourserve for the better in a relatively short pe-riod of time.

I. Relax already!It is truly rare to find a player who under-stands what “relaxed” means in the gameof tennis. Often when searching for a re-laxed state, a player becomes so loose thatstrokes and technique are slow and sloppy.They simply haven’t hit enough technicallysound serves to be confident in letting theracket head do the work for them. Espe-cially problematic for the serve is the un-comfortable Continental Grip. Playerssqueeze the grip so as not to lose the grip.

At the same time, they are killing the fluidand rhythmic technique they are trying toachieve.

A relaxed mind, hand and body have adirect effect on the speed your serve willtravel. Here are a few practical things youcan do to physically understand what a re-laxed grip means. Gently put your hand inthe correct grip position on the racket.Slide your hand down so that only your firstfinger and your thumb are on the flaredbutt-end of the racket. Your other three fin-gers will be curled under the butt of theracket. Now go through your service mo-tion without hitting a ball. The racket shouldfeel heavy and uncontrollable. You can feelall of the “links” in your arm contributing toyour service motion. Now try hitting a ballwith this grip. You’ll be surprised that thisseemingly impossible task is really effec-

tive. As you put more fingers on the grip,strive to maintain the whippy feeling that al-lows all of the “links” in your arm to con-tribute to the serve.

II. Look up before you toss!Most tennis players think that they arelooking up to their ball toss when they areactually looking out. To test what you do,stand up, relax your neck and let your headgo back as far as it can against the top ofyour back. If you are inside, you should belooking at a spot on the ceiling almost di-rectly above your head. Your tossing armlifts and the fingers of your tossing hand goto the sky. A high tossing hand will set thetossing shoulder higher than the hittingshoulder, making this head position feelmore natural.

Clear vision is essential for great contacton a ball. A little-known fact is that the bestservers look up before the ball is tossed.Looking up in anticipation of the arrival ofthe ball is a much more efficient method ofserving. If your head goes up in advance of

“Clear vision is essential forgreat contact on a ball.”


the toss, your eyes will be still. Now youwill be fully able to focus on the target. Tryenvisioning a small picture frame hangingin the air at optimum contact point. Lookup to that picture frame and work onbeing able to place the toss in that area.Focus and intent to strike the ball will befar greater.

III. Toss with a flat handThe position of the toss hand and arm areneglected areas when dealing with theserve. The toss arm has several criticalfunctions. How the ball is propelled up isimportant not only for the result of the tossbut also for the next phase of the serve.Ball tosses should travel straight up and

down, without spin or arc (except when in-tended). Fingers bent or curled around theball assure failure.

For a successful toss, flatten your fingersand place the ball on the creases of the lastjoint segment. Place your thumb gentlyover the top of the ball, making sure tokeep the hand flat by laying your wristdown. Straighten your elbow, bring yourtoss arm down and up in the direction ofthe right net post (for a right-handedserver). The toss comes from the shoulderand gentle body action, and the hand fin-ishes up in the “picture frame” describedabove. Gently popping the hand open atthe release point eliminates “flipping” theball off the fingers. The toss hand contin-

ues to the sky to set the tossing shoulderhigher than the hitting shoulder and allow-ing an upward hit.

The three secrets to a great serve aren’tflashy, but are so critically fundamental tothe serve that you simply cannot be as suc-cessful without them. Make masteringthese principles a priority and you will soonhave the stress free, dominant and power-ful serve that you have been wanting.

Lisa Dodson is owner of The Total Serve, aUSPTA Pro 1, and a formerly WTA world-ranked player. She may be reached by e-mail at [email protected] or visitwww.thetotalserve.com.

Creating Emotion With Strings by Racquet Art

We’ve all purchased racquets thathave had the manufacturer’s logopainted on the strings. Does this

add any excitement or fun to your game?The answer is no. It won’t make you playlike Roger Federer or Serena Williams. So,why do we leave it there. There is an op-tion that adds excitement to your game,unity to you team which may strike fear inyour opponent, depending on the optionyou choose. I am talking about a creativestencil from Racquet Art. Through theirWeb site, RacquetArt.com, you can choosefrom more than 50 different pictures tostencil on the strings of your racquet. Addsome fun with a smiley face or some fearand distraction with a skull and cross-bones. If you don’t see what you are look-ing for, Racquet Art can design an imagefrom your artwork. They are inexpensiveand bring a smile to your face each timeyou take out your racquet.

For leagues and school teams, in additionto fun, why not use a common stencil toshow team unity to your opponent. Thestencils are made from high-quality, stencilplastic and can be used over and over. Onestencil can be used for the entire team.

“Many teams have ordered customlogos for their team racquets,” saidMichael Waroff, owner of Racquet Art. “Itbrings a special sense of unity and pridewhen everyone takes out their racquets

and the entire team raises the same flag, soto speak.”

In addition to the stencils, Racquet Artsells premium stencil ink in 10 exciting col-ors. Some colors are better on light strings,some are better on dark strings. They havean ink color for everyone. The inks are soldin one and eight ounce containers with afelt tipped applicator pre-installed in thebottle. To paint the image on the strings, all

that is necessary is to give the bottle aslight squeeze and run the applicator overthe opening in the stencil on the strings.Racquet Art includes full instructions withthe stencils and on their Web site.

Next time you go to your stringer to haveyour racquets restrung, make sure you tellthem that you want a fun stencil from Rac-quet Art. Show some fun and excitementwith your racquet.


Local children spent a fun day on thecourts at Malverne High School atLong Island Kids Rally Day, pre-sented by the USTA Eastern Long Is-land Region and benefitting theUSTA National Junior Tennis &Learning (NJTL) Program. More than250 kids from across Nassau andSuffolk Counties represented Com-munity Tennis Associations (CTAs),NJTLs, day camps and other groups.They enjoyed a day of games andmatches, as well as 10 & Under les-sons for newcomers. The day’s spe-cial guest clinician, former worldnumber six-ranked pro Chanda

Rubin, spent the day on court with the juniors giving them tips andinstruction that can only come from a true champion. Specialthanks to the Malverne School District, the Village of Malverne andthe many volunteers who helped make Rally Day a success.

USTA EASTERN LONG ISLAND REGION

Kids’ Rally Day Shines

Chandra_Rubin-Formerworld number six proChandra Rubin was the starof Long Island Kids RallyDay, giving lessons andsharing her on-court wisdom

The 5th Annual Ten-nis Blitz in the Parkswas held at eightNassau County Parksin mid-July, withnearly 1,100 Nas-sau County adultsand children beingtreated to 2.5 hours

of free tennis lessons by USTA staffers, USPTA and PTR pros, andother volunteers.

Tennis Blitz in the Parks was conceived and organized by BillMecca, the USTA Eastern Long Island Region Tennis Service Rep-resentative who worked with Karen Beckhard Ravener from the Nas-sau County Department of Parks to ensure that all 1,100 participantshad an outstanding tennis experience.

The event was held at seven Nassau County Parks: EisenhowerPark, Christopher Morley Park, Nickerson Beach, North Wood-mere, Cantiague Park, Cow Meadow Park and Centennial Park.

Tennis Blitz in the Parks is open to all players, Nassau County

Tennis Blitz in the Park: A New Nassau County Tradition

campers of all ages and skills. It features the latest 10 & Underteaching techniques and methodology, and where appropriate,uses modified racquets, balls and courts. According to Mecca, thisevent is arguably the largest of such events in the country, and todate, nearly 5,000 children and adults have benefitted from themany benefits of playing tennis.

The success of the Blitz in the Parks program is the due to thegenerosity of many people and organizations, including the USTA,USPTA, USTA Eastern and many Long Island volunteers.

The non-profit Baldwin TennisClub, a new USTA Long Islandmember organization, has beenoffering low-cost kids’ lessons allsummer and held its first-everKid’s PLAY DAY at Baldwin High School. The USTA Eastern LongIsland Region congratulates the Baldwin Tennis Club on its suc-cessful inaugural season and looks forward to working with thegroup in the months and years ahead.

New Member Organization Offers Lessons



Junior Fun at LI Rally DayChanda Rubin Takes Part in the 2012 Long Island Kids Rally Day

It’s that time of year again—fair and fes-tival season—and the USTA EasternLong Island Region volunteer Board ofDirectors is looking forward to meetingmany local tennis fans on the streets thisyear. The Long Island Region will be outin force at the Merrick Fair on Saturday,Sept. 8, and the Bellmore Family Festi-val on Saturday, Sept. 22. Both eventstake place near the train stations in eachrespective town. Tennis courts speciallysized for those ages 10 & Under will beset up at the fairs, and USTA pros will begiving lessons all day. There will also be

games and prizes, and we’ll be selling special “I Love LI Tennis” t-shirts for only $5 each. Member organizations and tennis instruc-tors who want to volunteer their time to help at the fairs can [email protected]. We can also use high school ten-nis player volunteers as well as any USTA members who want tohelp. Stop by and support your Long Island Region at the fairs!!

Street Fair Season ArrivesThe USTA Eastern Long Is-land Region has been astrong local presence onFacebook, but we want tosee more of you. We’re tryingto reach 1,000 Likes and youcan help. Just go to USTALong Island on Facebookand Like our page. Then,you’ll have immediate ac-cess to important tennis in-

formation in the Region, including details of all our events,programs and activities and links to local clubs and details aboutwhat your fellow Long Island tennis players, instructors, facilitiesand supporters are doing. We’re also happy to post your newsabout tournaments, fundraisers, tennis fundraisers, tournamentwins or results, school tennis results, 10 & Under tournaments andresults, Long Island juniors and Long Island rankings, among otherthings. Just forward all of your news to us by e-mail at [email protected].

Do You Like Us?

Join the fun with theUSTA Eastern Long Island Region at the Merrick and BellmoreStreet Fairs in September

USTA Eastern LongIsland RegionPresident DanielBurgess with volunteerJay Fagin

CarlSummerlin,president ofthe USTAEastern MetroRegion,providedmusic duringKids RallyDay Members of the Alliance Junior Tennis Camp of Roosevelt

enjoyed the day of tennis fun

Chanda Rubin with USTAEastern Long Islandvolunteer Ross Binder

Participants from Wee Friends DayCamp in Wantagh enjoy a cooling sweettreat from Merrick’s Swirlz Worlddessert emporium

Chanda Rubinwith Terry

Fontana, USTAEastern Long

Island RegionRally Day

Chair, duringthe 2012 Long

Island KidsRally Day event



Nassau Tennis in the Parks


2012 Long Island Tennis MagazineGIRLS HIGH SCHOOL PREVIEWIn 2011, the Girls High School Tennis Sea-son ended on a sour note as Syosset HighSchool defeated Half Hollow Hills East forthe Long Island Championship via acoaches forfeit by HHHE over a lineup dis-pute. While this was deeply concerning onmany levels, it shouldn’t overshadow whatwas one of the best seasons on-court byLong Island high school girls in recentmemory.

The 2011 New York State Finals fea-tured two Long Island girls (HannahCamhi of Syosset and Morgan Herrmannof Garden City), and Syosset High Schoolwon their third consecutive Long IslandChampionship.

This season Syosset will have to moveon without State Champion and first sin-gles player Hannah Camhi, but Syossetstill returns a strong lineup looking towin their fourth consecutive High SchoolChampionship. They will be challengedthis year by Port Washington, Roslynand Manhasset amongst others. In Suf-folk, Half Hollow Hills East is the de-fending Champion, but will be withouttop player Ludmilla Yamus who hasgraduated. They will be challenged byrival Half Hollow Hills West and North-port, who finished last season 9-1 and10-0 respectively during the regular sea-son.

The Nassau County Girls High SchoolChampionship Tournament will be heldOct. 20-21 at Eisenhower Park in EastMeadow, N.Y., with the 2012 New YorkState Girls High School Championship setfor Nov. 2-5 in Albany, N.Y.

Top returningplayers to watch� Morgan Herrmann of Garden City

(Freshman): Last year as an 8thgrader, Herrmann was the runner-upat both the New York State and Nas-sau County Champiosnhips. WithCamhi off to Brown, Herrmann will

look to win both championships in herfreshman year.

� Nicholle Torres of Great Neck South(Senior): In 2011, Torres won the Sin-gles Consolation Draw at the New YorkState Tournament. With this being hersenior season, she will look to go outwith a bang.

� Zenat Roshizada of Half Hollow HillsWest (Senior): In 2011, Roshizada lostto Nicole Daniggelis in the SuffolkCounty Singles Final. This year, shewill try to finish her senior season witha County title and with Daniggelis hav-ing graduated, Roshizada may be thefavorite.

� Bridget Harding of Northport (Junior):Last year, Bridget along with her sisterMickey won the Suffolk County Dou-bles Championship before losing inthe New York State Quarterfinals. Thisyear, while her sister has graduated,Bridget returns to Northport for herjunior season, and another run at astate championship.

� Brittany Burke of Garden City (Senior):Finished third in the Nassau Doubles Cham-pionship playing with Marissa Cameronwho has since graduated. But Burke returnsfor her senior season and will play secondsingles behind Morgan Hermann.

� Paulina Tafler of Oceanside (Sopho-more): Finished fourth in NassauCounty as a freshman but will only getbetter in her Sophomore season and isa threat for the Nassau Championship.

� Lauren Livingston (Junior) & EmmaBrezel (Senior) of Port Washington: In2011, the duo of Livingston & Brezel fin-ished second in the Nassau County Dou-bles draw. This year, they both returnlooking to go one step further in 2012.

� Gabriella Leon (Senior) & VeronikaPaikin (Senior) of Hewlett: They playfirst and second singles throughout theseason and they teamed up to win theNassau County Doubles Championshipas juniors. This year, they return toHewlett High School as seniors seekinga second consecutive title.

For more information or questions,please call Maurice Trail at 516-302-5613

AnnouncingMaurice Trail’s Elite WorkshopEvery Monday during indoor season from 7pm - 9pm at

Jericho-Westbury Indoor Tennis44 Jericho Turnpike • Jericho, NY 11753


atives are the ones who are getting hurt.Recently, several prominent football

players publicly came out on the dan-gers of the game as it relates to con-cussions. We have seen severalnoteworthy former players who actuallycommitted suicide as a result of braindamage/depression brought on by theeffects of one or more concussions theyhad suffered. Kurt Warner, a famous re-tired NFL quarterback, and others havesaid that they would prefer their ownchildren not play football and find an-other sport. This is a very controversialsubject, so much so that there havebeen many rule changes to protect theNFL, collegiate and high school footballplayers. Even Pop Warner Leagues, oneof the first national youth sport organi-zations to implement concussion rules,are changing their rules regarding foot-ball practices.

When I hear of those things happen-ing, although unfortunate for the playerswho play the sport and even those whowatch like myself, I see an opportunityfor tennis.

Come on; let’s think out of the box fora moment … can you see more football

Specializing in:

• Sports nutrition • General nutrition • Pediatric nutrition

• Weight management • Heart disease • Diabetes

Call for appointment today!Phone: 917-769-8031

Email: [email protected]

Registered Dietitian. Certified Dietitian-Nutritionist.Improve Your Game With the Right Nutrition!

Irina Belfer-Lehat RD., CDN

Find out where good nutrition can take you....Private,

group lessonsand tennis clubsin services are

available.

By Lonnie Mitchel

The audience who readsthis magazine has anaffinity for the game.However, we are ap-

proaching football season, and a signif-icant amount of sports media turns theirattention to NFL training camps as wellas NCAA Division I football. Aside fromthe U.S. Open, tennis finds itself fightingfor its place in the sports media pie. I un-derstand this is because the NFL is themost popular spectator sport in Amer-ica, that is where the ratings are and thatis what sells advertising. It is simplygood business. It is because many foot-ball fans love the action, the strategy,their favorite teams and the violence ofthe game. We love it except if it is ourown children, husbands, friends and rel-

“Here is my idealistic wish, I need just one prominent high

school or college player in everycommunity across America

to stand up and say ‘I am going to play tennis.’”

Guys who play … I know you’re out there … tell yourfriends about us!

Football Season isComingAgain


players playing tennis? I can and I knowit’s possible; we just have to convincethem. My son just graduated high schoolthis year, and his experience in highschool included competing on the tennisteam. What surprised me is that many ofhis friends who do play on the footballteam signed his yearbook with good-na-tured comments about football being themasculine sport and tennis being thecowardly sport. Well, behind the good-natured teasing comes some truth in thatthere is still a culture that believes tennisplayers are just not worthy of the respectfrom the football community. Well if con-cussions, broken ankles, dislocatedshoulders and a plethora of other injuriesare prevalent in that community, then Iguess I am glad I was exposed to tennisfrom a young age. Coming from a mid-dle-class neighborhood, I can assureyou I was the minority as were my chil-dren because we chose the sport oftennis.

I have not been to a football game,whether it be pro, collegiate or highschool, where I not have seen at least

one injured player sitting out the gameand at least a couple of play stoppagesfor a player who suffered an injury. Yes,of course tennis players can suffer in-juries. We are not immune to knee prob-lems, tennis elbow and more. However,I never saw a tennis player carted offthe court because of a concussion.

Here is my idealistic wish, I need justone prominent high school or collegeplayer in every community across Amer-ica to stand up and say “I am going toplay tennis.” If one person on a footballteam does it, then our game will havemore of a chance to get out of thecountry clubs and out into the main-stream. Like it or not, our game still res-onates within the sports community asa country club game and not for themasses. I know the USTA tries to getout into under privileged communitiesand other neighborhoods to promoteour sport, but when the high schoolfootball team attracts 60 or more kidsto tryout and many middle-Americahigh schools and communities canbarely attract a dozen tennis players to

try out, something is just not right. Idon’t know whose fault that is or why,but I do know we have a long way togo.

The U.S. Open will probably drawrecord crowds again this year so thingscannot be too bad. However, I won’t seetoo many people from my old middle-class neighborhood there. That is toobad, they are missing something great.If you are a football player who has hadone too many injuries, call your buddiesand say, “Tennis anyone?”

Lonnie Mitchel is head men’s andwomen’s tennis coach at SUNY Oneonta.He has produced many high school andcollegiate level tennis players, includinghis own children, Wayne (who plays atMuhlenberg College) and Trevor (whocompetes regularly on the USTA LongIsland Junior Circuit, gaining the numberone ranking in the 14s). His wife, Harriet,is a club level tennis player and canoften be found on the court. Lonnie maybe reached by phone at (516) 414-7202or e-mail [email protected].


By Daniel Kresh

We live in a world where re-sources are limited and peo-ple are increasingly trying tofind ways to squeeze more

out of less. In a tennis match, there are amultitude of opportunities to extend rallies,points, games and sets to get as much asyou can out of your time on court. Just likethe “green movement,” the “yellow move-ment” has three R’s: “React, Respond, Re-cover” by concentrating on these actionsyour tennis game will reach its maximumefficiency.

ReactTennis is almost entirely a reactionarysport. The only shot that is not a responseto your opponent’s action is the serve.Everything else requires you to anticipate,place yourself as best as you can, and thenmove to attempt to position yourself for thebest possible “Response.” Despite theracket in your hand, tennis is a lower bodysport and footwork could never … I repeat… never, be overemphasized. The key to a

good reaction is the spilt step, a short hopinto a neutral-ready position that equally al-lows you to react to any shot. Now, I couldgo on for pages and pages about position-ing, but to put it simply: (1) a split stepshould occur so you land at the time youropponent makes contact every time youropponent strikes the ball, and (2) as soonas you hit a shot, you should try to moveback toward the center of the baseline,stopping to split step as your opponent re-sponds to you.

RespondBased on how well you “React,” you havedifferent options on how to “Respond.” Thebetter position you get into (ball in an idealstrike zone, opponent off the court, closingin to take the ball early) the safer it is to playmore aggressively (faster flatter ball, quickcourt penetration, lower net clearance,down the line or short/extreme angle). Youhave gained the upper hand and it lessrisky to play to win. When you are in a moreworse off position (ball outside of strikezone, behind the baseline/uncomfortablyon the run, opponent closing in to take the

ball early), you should play more defensivesafe shots (more spin, higher net clearance,deeper bounce, more cross-court, slowermovement through the court). It is very dif-ficult to win a point from these scenarios,and it’s a low percentage play, so these de-fensive shots allow you to stop the bleed-ing and improve your court positioning tofight your way back into the rally. Eachpoint in tennis, when played well, should bea tug of war where a point is earned andnot given away.

RecoverA tennis match is not just about one shot.In fact most points in tennis are not aboutone shot. Unless the serve is unreturned orthe return is a winner, a tennis point is acarefully-constructed attempt to be the lastperson to hit the ball in. Many playersstruggle with positioning which causesthem to “go for broke” (try to compensatefor poor position by attempting a winnerthat is nearly impossible). If you want to getthe most out of your tennis, you need toplay the ball smart when you are out of po-sition and work hard to get back to whereyou are comfortable on the court.

It may not be possible to win everymatch, but that doesn’t mean you everhave to lose. Use the three R’s and get themost out of your points, and in the end, vic-tory will be sweeter and even in defeat, youshould have a sense of pride knowing thatyour opponent has earned the win.

Daniel Kresh is a USPTA-certified tennisprofessional who recently accepted the po-sitions of director of junior tennis and as-sistant tennis professional at the ThreeVillage Tennis Club in Setauket, N.Y. He isalso the assistant professional at The PortJefferson Country Club at Harbor Hills. Hemay be reached by e-mail at [email protected].

The Yellow Movement:The 3 R’s of Tennis

“Each point in tennis, when played well, should be a tug of war where a point is earned and not given away.”


By Miguel Cervantes III

With the playoffs of the adultUSTA Leagues approaching,it seems an appropriate timeto ask ourselves, how we

practice to maximize success. The peoplewho play in the leagues are folks with jobs,families and other responsibilities. If time al-lows, they will practice and work on theirgame, but how can that small amount oftime be maximized?

One way to use the small amount of timeyou find to work on your game is to simplyplay tennis. By playing tennis, I mean thatyou go out there and just play sets as youwould a regular match. The benefit of thisis that it puts you in a similar situation youwill be in your league matches. When youpractice the way you expect to play, you’llfind you are far less nervous during amatch and can perform the way you ex-pect. The downfall of this method thoughis that you are not working on any onething specifically. If there is a large defi-ciency in your game, that deficiency will notreally be remedied and will continue tohaunt you, costing you point after point.Another negative aspect of this method isthat it’s fairly hard on your body, all thingsconsidered. A match is already toughenough on your body, but to add practicetime that doubles the amount of stress onyour muscles and joints can be rough.You’ll soon find your need for tennis full,but your Ibuprofen bottle empty.

Another way to use your borrowed time isto just hit with a friend. This method provideslittle stress on your body and can be ex-tremely relaxing. You can work on yourstrokes in general or focus on one or a fewaspects of your game. If you want to focuson your volleys and serve, you can do that.The major negative impact of this methodthough is that it does not prepare you to playpoints. You may find yourself practicing welland full of confidence, that is, until you get toyour match and then feel the pressure. If younever practice under pressure, then you willtake much longer to adjust to it in a realmatch scenario.

I have foundthat the bestway to ut i l izeyour pract icetime is threefold:

� One, choose thebiggest deficiencyin your game andpractice it with a part-ner. For example, if youwanted to improve yourvolleys because they havebeen terrible as of late, plant your-self at the net while your partner hit ballsto you over and over.

� Two, integrate this practice with the situa-tion you would use it. It is rarely the case intennis that you are already in the situationsyou practice, and so, it’s important to prac-tice the associated variables that come withwhat you practiced. For example, after youpracticed your volleys you would practicehitting an approach shot and then finishwith a volley. If you were practicing yourserve, you could practice your serve, fol-lowed by a recovery to the middle (for sin-gles) or an approach to the net (for doubles).

� Finally, you would do some point play pay-ing close attention to the things youworked on. Here is where you see if you’vereally made any improvement.

Practicing SuccessA match is already tough

enough on your body, but to addpractice time that doubles the

amount of stress on your musclesand joints can be rough ...

“

”With so many things in our lives vying for our

time, it is important to make the best of whatwe allow for tennis practice. Maximize yoursuccess by practicing smarter. Improve thebest and worst aspects of your game to winmore points and limit your liabilities respectively.Write to me and tell me how it is you’ve goneabout practicing for success in your league.

Formerly with Daniel Burgess at FreeportTennis, Miguel Cervantes III now teaches atCarefree Racquet Club and privately out-doors. Miguel specializes in teaching be-ginners, training juniors and coachingdoubles. He may be reached by e-mail [email protected].


By Dr. Aaron Freilich

My family and I have beengoing to the U.S. Open forthe past 30 years. My love oftennis was passed on to my

son Michael, who became an accomplishedjunior player in the USTA circuit. After hegraduated high school in 2011, I decided togive him, as a graduation present, a trip tothe 2012 French Open. I had always wantedto visit a second Grand Slam venue andParis seemed the right locale for us. Australiawas too far away and Wimbledon too rainyfor us to plan a trip there. The trip soon in-volved my brothers Joshua and Neil, andcousins Arnie and Jonathan. We decided togo to the first week of tournament as youwould have more access to players andmore matches than we would see during thesecond week.

There are many ticket brokerages that ad-vertise sales for the French Open. It becameobvious that their starting prices of $350 perticket was not in our budget. I began researchhow to buy tickets at face value and discov-ered that the French Open put their tickets onsale Feb. 15 at 7:00 a.m. in the morningFrench time on a first-come, first-served basis.

All that was required that you register onlinewith a User Name and Password. So it was1:00 a.m. EST on Feb. 15 that all six of us wentonline to buy our tickets. The wait was up totwo hours, but in the end, we were all able topurchase tickets at face value for four sessionsfrom Monday to Thursday. The French Openpolicy is to permit only four tickets purchased

per user the entire tournament, and the in-dividual cost of the tickets were approxi-mately $75 per session. We were now setto make our flights and hotel reservationsto finalize our plans.

Roland Garros has two main courts, Char-trier, which seats approximately 15,000 peo-ple and Lenglen, which seats approximately

My French Open Experience

Neil, Michael, Aaron and Joshua Freilich at Lenglen


9,000. After researching the previous fewyears, we realized that the top players alter-nate on both courts in the early rounds.Since we wanted to experience both courts,we bought Chartrier tickets for Monday andWednesday and Lenglen tickets for Tuesdayand Thursday. This was to ensure we saw allthe top players at least once over the fourdays that we were there. Our strategy wasvalidated in that we were able to see NovakDjokovic on Monday in Chartrier, Andy MurrayTuesday in Lenglen, Roger Federer in Char-trier on Wednesday and Rafael Nadal inLenglen on Thursday. There was also aCourt #1, which seated around 3,000 and re-quired a special ticket for admission. It wasnot possible to enter any of these threecourts without a specific ticket for that court.If you had a ticket for one of these showcourts and left a match early, you were givena voucher, which you needed to present inorder to return into that stadium. Without the

original ticket and voucher, it was not possi-ble to return to your seat.

The grounds at Roland Garros are ex-tremely small and roughly one-third the sizeof the U.S. Open grounds. The outer courtsare extremely cramped and small, and holdonly a few hundred seats. On day one, wediscovered Court #2, which on one of itssides had a small dugout with roof over it toprotect you from the sun. This court becameour second home, and we would arrive atRonald Garros at 9.30 a.m. in order to getearly entrance to the grounds. Althoughmatches would start at 11:00 a.m., by 10:15a.m. the dugout was full to capacity. Fromour first row seats in the dugout, we watchedon successive days John Isner, David Ferrer,Juan Martín del Potro and Milos Raonic. Wegot completely into all of these matches andthe players acknowledged our cheers andexhortations. We were able to take someamazing pictures of the players at the con-

clusion of their matches and the atmosphereon the small grand courts was electric.

The amenities at all of the courts were ex-tremely sparse. None of the show courts hadbathroom facilities or concessions stands. Infact, it was impossible even to obtain a glassof water in the stadium. The small courtswere exactly the same, and once you exitedone of these courts, it was impossible to re-turn. The lines to get into an outer courtwould last hours. The trade-off was that wehad a guaranteed seats in one of the mainstadiums, where there was no wait or linesto get in. There was no general food courtlike there is at the U.S. Open, but there aresmall stands that would sell ice cream,pizza and various other foods. Two scoopsof Häagen-Dazs ice cream would cost $8and a soda $6. Souvenirs were just as ex-pensive with t-shirts running $40-plus and

Dr. Aaron Freilich (right) and his son Michael (left) atChartrier during the 2012 French Open in Paris

Michael Freilich and John Isner on the grounds ofRoland Garros

Dr. Aaron Freilich (right) and Milos Raonic (left)after practice

continued on page 56

The JTC Recruiting Pages – Make the most comprehensive college list anywhere for anincredible value! Visit www.juniortennisconsulting.com.

Personal Consultation – Get answers to a myriad of questions that you have aboutwalk-ons, timelines, videos, and items you didn’t consider!

Full-Service College Guidance Program – Get the benefit of our 200+ college coachcontacts, as well as, step-by-step guidance through the process.

Ricky Becker’s

Still Available:

Contact former Stanford University and Roslyn High School MVP Ricky Becker today at 516-605-0420 or [email protected].

www.juniortennisconsulting.com

JuniorTennisConsulting LLC Programs

At Some Level, We Can Assist Anyone!Guaranteed!

Visit www.JuniorTennisConsulting.com

NOW ATGLEN HEADRACQUET

CLUB!


a hat was $35. My favorite souvenir pur-chased this year was a French Open towel,which was $20.

Our access to the top players was unreal.On day one, we watched Novak Djokovicpractice on Court #9 and then we were ableto take photos with him. Roger Federerstrolled past us after the conclusion of hismatch and a bit later, Rafael Nadal did thesame. We spent time with Ryan Harrisonafter his practice session and he could nothave any nicer to us. We stumbled into amatch on Court #17 at the extreme outskirtsof the grounds between Florian Mayer ofGermany and Eduardo Schwank from Ar-gentina and found ourselves singing the na-tional anthems of both individual countrieswith the 100 fans that sat on the court. Wewere able to participate in Brian Baker’samazing miracle comeback as we watchedhim defeat Xavier Malisse while wavingAmerican flags.

The quality of play that we witnessed thatwas exceptional. We primarily focused onthe men’s tournament and had the privilegeof watching from the 10th row of Lenglen asNadal destroyed a feisty Denis Istomin.Federer was not sharp in his four-set winover Adrian Ungur and his erratic play car-ried over to all the subsequent matches inthe tournament. We got to marvel atDjokovic’s athleticism in his win over PotitoStarace. We saw Andy Murray’s listlessnessand lethargy in his match as well against Tat-suma Ito of Japan. The two highlightmatches of the week that we witnessed wereGrigor Dimitrov versus Richard Gasquet,which was filled with acrobatic shot-makingand an incredible 46-shot rally that left Dimitrovin cramps on the ground in agony andGasquet vomiting on the court. We were for-tunate to see the conclusion of the match be-tween John Isner and Paul-Henry Mathieu onCenter Court as we begged an usher to let

some crazed Americans to see the conclu-sion of the match. The French crowd wasraucous, loud, and partisan, and as Isner gotmore and more fatigued, he stood no chanceand eventually lost 18-16 in the fifth set. I canstill hear the French singing and chanting andMathieu’s name in French even now.

We are in a golden era in men’s tennisnow. There is superlative play and amazingpersonalities at the top of the game. I feelfortunate that I got to experience one weekclose up at the French Open witnessing thegreat players of today with access that Icould never even begin to dream of atFlushing Meadows. This venue is a mustfor any tennis fan, who is looking for thatmemorable tennis vacation experience inone of the world’s prettiest cities.

Dr. Aaron Freilich is a board certified cardi-ologist and avid tennis enthusiast. He re-sides in Lawrence, N.Y. with his wife Saraand their four children. He may be reachedby e-mail at [email protected].

My French Open Experience continued from page 55

• Experts in elimination of termites, carpenter ants and other wood boring insects • Residential and commercial pest control maintenance programs

• Experienced pest control professionals for over 25 years• Nassau, Suffolk, Queens County and Brooklyn

• References available• Certified Pesticide Applicator NYS #C1-625256


ACUPUNCTUREMETROPOLITAN

Metropolitan Acupuncture & Herbal Medicine, LLC

Acupuncture for Pain Management

Acupuncture can stimulate the body’s own natural pain-relieving endorphins to alleviate pain and can effectively suppress the body’s

inflammatory mediators to reduce inflammation and swelling.

For more information, or to schedule an appointment, please contact:Dr. Michael Bennett L.Ac., Dip. O.M.

347-565-4255 • www.metropolitanacupuncture.com

� Air conditioning service and repairs � Heating service and repairs� New or replacement of heating & air conditioning systems

Maintenance & Service Contracts available

For Service or a Quote for New or Replacement Units Call 516-717-8006 or 516-300-0909

“Save Money With Save Air”

OUR EMERGENCY SERVICE CALLS ARE STILL PRICED AT $90.00!

Save Air has developed a comprehensive residential central air conditioning21-point tune-up program…and we are offering it at an unbeatable price of

only $99 (regularly $199.00) until October 31, 2012! Call for your appointment today.

Serving Nassau County - Lic. #H3603290000

Save Air Heating & Air Conditioning Service & Repair

Servicing all brands for residential and commercial applications for:

Heating and Air ConditioningSAVE AIRSAVE AIR

A

Savee Airr iss givingg awayy Residentiall Centrall Airr Conditioningg Tune-Upss forr Onlyy $99!(Regularlyy $199.00)

With over 15 years of heating and air conditioning experience, Save Air Heating and Air Conditioningwill deliver quality workmanship at competitive pricing for all your repairs, service,

and new and replacement heating & air conditioning systems.

Catering for any occasion. Choose from our wide display ofcrudites, platters, salads, heroes and desserts. You'll love how

easy it is to create your own menu . . . and how great Town Bagel Catering tastes!

TOWN BAGEL1133 Old Country Road

Plainview, NY516-931-7698

SPORT PSYCHOLOGYLearn how to manage your emotions

with a credentialed Ph.D. level Sport Psychologist.

Dr.Tom Ferraro (516) 248-71892 Hillside Avenue, Ste. E • Williston Pk, NY 11596

Drtomferraro.com • [email protected]

• Control anger • Cope with anxiety • Re-establish confidence• Learn how to focus • Get proper diagnosis and treatment for your emotions

1-1 consultations, phone consults, family counseling, on site visits

ACUPUNCTURIST SPORTS PERFORMANCE

CATERER PSYCHOLOGIST

For more details, contact [email protected] or 516-409-4444.


Bethpage Park Tennis CenterAndrea Pappas—Manager

99 Quaker Meeting House Road #1Farmingdale, NY 11735

516-777-1358 • [email protected]

Butch Seewagen Tennis Academy @ Rockville Centre CATS

Jami Madison—Director188 Maple Avenue • Rockville Centre, NY 11570

516-763-1299, ext. 10 • [email protected]

Carefree Racquet ClubKathy Miller—Manager

1414 Jerusalem Avenue • Merrick, NY 11566516-489-9005 • [email protected]

Eastern Athletic ClubCira Jones—Manager

9 Montauk Highway #A • Blue Point, NY 11715631-363-2882 • easternathleticclubs.com

Eastern Athletic ClubBetsy Johnson—Manager

854 Jericho Turnpike • Huntington Station, NY 11746631-271-6616 • easternathleticclubs.com

Eastern Athletic ClubGary Jones—Manager

100 Ruland Road • Melville, NY 11747631-753-3696 • easternathleticclubs.com

Glen Head Racquet ClubKarl Sommer: 516-676-9849

Home of Early Hit Training [email protected]

Carl Barnett: 516-455-122595 Glen Head Road • Glen Head, NY 11545

[email protected]

Long Beach Tennis CenterChuck Russell—Director of Tennis

899 Monroe Boulevard • Long Beach, NY 11561516-432-6060 • www.longbeachtenniscenter.com

[email protected]

New York Tennis Academy at Great Neck EstatesHowie Arons—Director of Junior Tennis Program

12 Shore Drive • Great Neck, NY 11021516-233-2790 • [email protected]

Point Set Indoor TennisTonny vandePieterman—Director of Tennis3065 New Street • Oceanside, NY 11572

516-536-2323www.pointsettennis.com • [email protected]

Port Washington Tennis AcademyManny Iqbal—Director of Tennis

100 Harbor Road • Port Washington, NY 11050516-883-6425 • www.pwta.com • [email protected]

Robbie Wagner’s Tournament Training Center@ Glen Cove

Stephen Alcala—Managing Partner60 Sea Cliff Avenue • Glen Cove, NY 11542

516-759-0505 • www.rwtt.com

Robbie Wagner’s Tournament Training Center@ Glenwood Landing

Adrian Chirici—Director of Tennis142 Glenwood Landing RoadGlenwood Landing, NY 11547516-676-9107 • www.rwtt.com

Rockville Racquet ClubSusan Alvy—Manager

80 North Centre Avenue • Rockville Center, NY 11570516-764-5350 • [email protected]

Ross SchoolHolly Li—Manager

18 Goodfriend Drive • East Hampton, NY 11937631-907-5162

www.ross.org/tennis • [email protected]

SPORTIME AmagansettSue De Lara—Co-General Manager

Hana Sromova—Director of Tennis/Co-General Manager320 Abrahams Path • Amagansett, NY 11930

631-267-3460www.SportimeNY.com/Amagansett

[email protected]

SPORTIME Bethpage TennisMike Kossoff—Director of Tennis

101 Norcross Avenue • Bethpage, NY 11714516-933-8500

www.SportimeNY.com/[email protected]

SPORTIME Bethpage Multi-SportRandy Louie—General Manager

4105 Hempstead TurnpikeBethpage, NY 11714

516-731-4432www.SportimeNY.com/Bethpage-Multi-Sport

[email protected]

SPORTIME QuogueWill Van Rensburg—Director of Tennis2571 Quogue-Riverhead, Route 104

East Quogue, NY 11959631-653-6767


SPORTIME at Harbor IslandCesar Andre—Director of Tennis

In Harbor Island Park • Mamaroneck, NY 10543914-777-5050


SPORTIME Kings ParkJason Wass—Director of Tennis

275 Old Indian Head RoadKings Park, NY 11754

631-269-6300www.SportimeNY.com/Kings-Park

[email protected]

SPORTIME LynbrookJeff Morys—Director of Tennis

175 Merrick Road Lynbrook, NY 11563

516-887-1330www.SportimeNY.com/Lynbrook

[email protected]

SPORTIME MassapequaJordie Dolberg—Director of Tennis

5600 Old Sunrise HighwayMassapequa, NY 11758

516-799-3550www.SportimeNY.com/Massapequa

[email protected]

SPORTIME Randall’s IslandFelix Alvarado—Assistant Director of Tennis

1 Randall’s IslandNew York, NY 10035

212-427-6150www.SportimeNY.com/Manhattan

[email protected]

SPORTIME RoslynAdam Mandell—Director of Tennis

Landing Road, PO Box 1Roslyn, NY 11576

516-484-9222www.SportimeNY.com/[email protected]

SPORTIME SchenectadyPhilippe Ceas—Director of Tennis

2699 Curry RoadSchenectady, NY 12303

518-356-0100www.SportimeNY.com/Schenectady

[email protected]

SPORTIME Syosset Tennis & Multi-SportKarl Sommer—Director of Tennis

75 Haskett DriveSyosset, NY 11791

516-364-2727www.SportimeNY.com/Syosset-Tennis

[email protected]

USTA National Tennis CenterWhitney Kraft—Director of TennisFlushing Meadows Corona Park

Flushing, NY 11568718-760-6200 • www.usta.com


L O N G I S L A N D R A N K I N G S

Boys & Girls Long Island Rankings(as of 07/30/12)

BOYSLong Island Boys 12 SinglesRank Name..................................City1........Abhinav Raj Srivastava ....Melville, N.Y.2........Zachary Khazzam..............Roslyn Heights, N.Y.3........Jackson Weisbrot..............Dix Hills, N.Y.4........Daniel Meinster..................South Setauket, N.Y.5........Cameron Klepper ..............Dix Hills, N.Y.6........Austin Pomerantz..............Old Westbury, N.Y.7........Tommy George Srisuro ....Garden City, N.Y.8........George Kaslow..................Port Washington, N.Y.9........Connor Leaf ......................Dix Hills, N.Y.10......Aman Sharma....................Glen Head, N.Y.11......Alexander Roti ..................Locust Valley, N.Y.12......Arjun Sharma ....................Glen Head, N.Y.13......Daniel Chikvashvili ............Melville, N.Y.14......Logan Paik Chang ............Old Westbury, N.Y.15......Karan Amin ........................Roslyn, N.Y.16......Jack Flores ........................Huntington, N.Y.17......Matthew Roberts ..............Setauket, N.Y.18......William Sepanski ..............Huntington, N.Y.19......Preet Rajpal........................Syosset, N.Y.20......Evan Kirsh..........................Roslyn, N.Y.21......Adam Wilck........................Dix Hills, N.Y.22......Daniel Chang ....................Manhasset, N.Y.23......Matthew Catton ................Woodbury, N.Y.24......Drew Ingall ........................Melville, N.Y.25......Bradford Lin ......................Kings Point, N.Y.26......Maxwell Moadel ................Brookville, N.Y.27......Timothy Serignese ............Port Washington, N.Y.28......Zachary Berlin....................Dix Hills, N.Y.29......Kabir Rajpal........................Syosset, N.Y.30......Eric Li..................................Old Westbury, N.Y.31......Benjamin Reichbach ........Syosset, N.Y.32......Matthew Terlovsky ............Merrick, N.Y.33......Evan Hirsch........................Old Westbury, N.Y.34......Sujay Sharma ....................New Hyde Park, N.Y.35......Niles Ghaffar ......................Massapequa, N.Y.36......Christopher Grisham ........Huntington, N.Y.37......Luke Karniewich................Glen Head, N.Y.38......Louie Kotler........................Roslyn, N.Y.39......Ethan Ertel..........................Dix Hills, N.Y.40......Sam Reichbach ................Syosset, N.Y.

Long Island Boys 14 SinglesRank Name..................................City1........Arnav Raj Srivastava ........Melville, N.Y.2........Zachary Mollo....................Dix Hills, N.Y.3........Zachary Khazzam..............Roslyn Heights, N.Y.4........Harris Durkovic ..................Dix Hills, N.Y.5........Jordan Diamond................Mount Sinai, N.Y.6........Pete Siozios ......................New Hyde Park, N.Y.7........Kenneth Chiu ....................Holtsville, N.Y.8........Jake Cohen........................Oceanside, N.Y.9........Spencer Lowitt ..................Syosset, N.Y.10......Mitchell Berger ..................Lake Grove, N.Y.11......Christian Esposito ............Port Washington, N.Y.12......JohnThomas Sepanski ....Huntington, N.Y.13......Jake Grossman ................Sands Point, N.Y.14......Ben Snow ..........................Water Mill, N.Y.15......Marco Ammirati ................Halesite, N.Y.16......Daniel Marzagalli ..............Patchogue, N.Y.17......Austin Egna........................Port Washington, N.Y.18......Joonho Ko ........................Huntington, N.Y.19......Aaron Askowitz..................Great Neck, N.Y.20......Lucas Larese DeSanto......Southampton, N.Y.21......Simar Sawhney..................New Hyde Park, N.Y.

22......Max Egna ..........................Port Washington, N.Y.23......Connor Leaf ......................Dix Hills, N.Y.24......Jake Sandler......................Lynbrook, N.Y.25......Jay Burkett ........................Syosset, N.Y.26......George Kaslow..................Port Washington, N.Y.27......Jackson Weisbrot..............Dix Hills, N.Y.28......Jason Gerber ....................Commack, N.Y.29......Derek Menker ....................Great Neck, N.Y.30......Vincent Tozzi ......................North Babylon, N.Y.31......Hunter Pomerantz ............Old Westbury, N.Y.32......Vincent Chen ....................Hauppauge, N.Y.33......Vincent Tozzi ......................North Babylon, N.Y.34......Daniel Meinster..................South Setauket, N.Y.35......Landon Phillips ..................Great Neck, N.Y.36......Eric Handelman ................Melville, N.Y.37......Alex Joseph Amadio ........Smithtown, N.Y.38......Serge Ushkevich ..............Sands Point, N.Y.39......Connor Dove......................Baldwin, N.Y.40......Curran Varma ....................Manhasset, N.Y.

Long Island Boys 16 SinglesRank Name..................................City1........Cole Laffitte........................East Setauket, N.Y.2........Matthew Bahar ..................Woodbury, N.Y.3........Dylan Granat......................Woodbury, N.Y.4........Nick John Stamatos..........Cold Spring Harbor, N.Y.5........Arnav Srivastava................Melville, N.Y.6........Chirag Doshi ......................Sands Point, N.Y.7........Zachary Chang..................Massapequa, N.Y.8........Joshua Fried ......................Plainview, N.Y.9........Milan Gunasekera ............Mount Sinai, N.Y.10......Harris Durkovic ..................Dix Hills, N.Y.11......Zane Siddiqui ....................Long Beach, N.Y.12......Raizada Vaid ......................Old Westbury, N.Y.13......Evan Kober ........................Wantagh, N.Y.14......Ankur Kejriwal....................Hewlett, N.Y.15......Austin Ash..........................Syosset, N.Y.16......Troy Haas ..........................Huntington Station, N.Y.17......Jeremy Grossman ............Woodbury, N.Y.18......Gregory Rosenthal ............Syosset, N.Y.19......Ryan Diaz ..........................Jericho, N.Y.20......Benjamin Goldrich ............Syosset, N.Y.21......Joshua Sydney..................East Northport, N.Y.22......Jesse Richeimer ................Merrick, N.Y.23......George Carmi ....................Lloyd Harbor, N.Y.24......Joseph D’orazio ................Saint James, N.Y.25......Craig Cusano ....................Bellmore, N.Y.26......Samuel Johnson................Huntington, N.Y.27......Eric Ravens........................Merrick, N.Y.28......Palmer Clare ......................North Bellmore, N.Y.29......Ronald Spinelli ..................Dix Hills, N.Y.30......Jason Gerber ....................Commack, N.Y.31......Cory Seltman ....................Dix Hills, N.Y.32......Jake Sandler......................Lynbrook, N.Y.33......Jack Vissicchio ..................Port Washington, N.Y.34......Jarrett Levine ....................Island Park, N.Y.35......Mitchell Berger ..................Lake Grove, N.Y.36......Duane Davis ......................Dix Hills, N.Y.37......Richard Spinelli..................Sands Point, N.Y.38......Sam Kramer ......................Westhampton, N.Y.39......Dylan Davis ........................Dix Hills, N.Y.40......Steven Marzagalli ..............Patchogue, N.Y.

Long Island Boys 18 SinglesRank Name..................................City1........Richard Liell ......................Nesconset, N.Y.2........Samuel Hajibai ..................Kings Point, N.Y.3........Sander Brenner ................Port Washington, N.Y.4........Brett Titcomb ....................Lloyd Harbor, N.Y.5........Anton Averin ......................South Setauket, N.Y.6........Michael Vera ......................Bethpage, N.Y.

7........Brian Heinze ......................Garden City, N.Y.8........Marco Betito ......................Floral Park, N.Y.9........Ian Baranowski ..................Syosset, N.Y.10......Chris Casamassima ..........Franklin Square, N.Y.11......Connor Gehrke..................Miller Place, N.Y.12......Jonathan Smucker............Lido Beach, N.Y.13......Milan Gunasekera ............Mount Sinai, N.Y.14......Craig Cusano ....................Bellmore, N.Y.15......James Heaney ..................Locust Valley, N.Y.16......Alex Philip Rosenfield........Holtsville, N.Y.17......Zane Siddiqui ....................Long Beach, N.Y.18......Julian Adler ........................Roslyn, N.Y.19......Christopher Schwab ........Seaford, N.Y.20......Brett Edelblum ..................Roslyn, N.Y.21......Richard Mitchell ................Franklin Square, N.Y.22......Ronald Spinelli ..................Dix Hills, N.Y.23......Roger Young......................Brookhaven, N.Y.24......Kush Dave..........................Syosset, N.Y.25......Daniel Baruch ....................East Meadow, N.Y.26......Dylan Ander ......................Hewlett, N.Y.27......Jonathan Ochoa................Hicksville, N.Y.28......John Reilly..........................Mount Sinai, N.Y.29......Jacob Rothstein ................Port Jefferson, N.Y.30......Benjamin Mermelstein ......Northport, N.Y.31......Zachary Romanzi ..............Brightwaters, N.Y.32......Matthew Kantor ................Westhampton Beach, N.Y.33......Eric Ross............................Roslyn, N.Y.34......Donald Wunder..................West Islip, N.Y.

GIRLSLong Island Girls 12 SinglesRank Name..................................City1........Kaitlyn Byrnes....................Massapequa, N.Y.2........Ivanna Nikolic ....................Glen Head, N.Y.3........Christina Jud......................Glen Head, N.Y.4........Denise Lai ..........................Setauket, N.Y.5........Lucia Hu ............................Roslyn, N.Y.6........Evangelia Frankis ..............Manhasset, N.Y.7........Madeline Clinton................Manhasset, N.Y.8........Lauren Bishop....................Woodbury, N.Y.9........Morgan Voulo ....................East Setauket, N.Y.10......Samantha Galu..................Jericho, N.Y.11......Marina Hilbert ....................Locust Valley, N.Y.12......Madison Williams ..............Glen Cove, N.Y.13......Alexa Bracco ....................Freeport, N.Y.14......Katelyn Walker ..................Sands Point, N.Y.15......Kerri Goldfuss....................Westbury, N.Y.16......Sofia Anzalone ..................Center Moriches, N.Y.17......Calista Sha ........................Roslyn Heights, N.Y.18......Madison Li ........................Old Westbury, N.Y.19......Mina Sarcevic ....................Dix Hills, N.Y.20......Allison Cooney ..................Locust Valley, N.Y.21......Lauren Cherkin ..................Melville, N.Y.22......Giuliana Gibson ................Westbury, N.Y.23......Elena Vlamakis ..................Garden City, N.Y.24......Brittany Polevikov..............Port Washington, N.Y.25......Ariana Malik ......................Melville, N.Y.26......Claire Weis ........................Glen Cove, N.Y.27......Merri Kelly ..........................Oyster Bay, N.Y.28......Kaitlyn Schwarz ................Oceanside, N.Y.29......Amy Delman ......................Great Neck, N.Y.30......Rachel Arbitman................Hewlett, N.Y.31......Maryam Ahmad ................Albertson, N.Y.32......Dasha Dlin..........................Glen Head, N.Y.33......Marisa Menist ....................Great Neck, N.Y.34......Angela Chi..........................Great Neck, N.Y.35......Grace Riviezzo ..................Syosset, N.Y.36......Julia Kepczynska ..............Southampton, N.Y.37......Morena DeVito ..................Syosset, N.Y.

38......Hannah Abraham ..............Syosset, N.Y.39......Alexis Kotsailidis................Manorville, N.Y.40......Julieta Eulau ......................Long Beach, N.Y.

Long Island Girls 14 SinglesRank Name..................................City1........Sabrina Ferretti ..................Setauket, N.Y.2........Michelle N. Carnovale ......Massapequa, N.Y.3........Adele Sukhov ....................Westbury, N.Y.4........Rebecca Stern ..................Dix Hills, N.Y.5........Danielle Mirabella ..............Wantagh, N.Y.6........Juliana Shenker ................Rockville Centre, N.Y.7........Rosa LaCorte ....................Merrick, N.Y.8........Jennifer Wang....................Dix Hills, N.Y.9........Sarah Seeman ..................Port Washington, N.Y.10......Katherine Changtroraleke Greenvale, N.Y.11......Matilda Bros ......................Lloyd Harbor, N.Y.12......Emma Rosenberg ............Port Washington, N.Y.13......Nikaylah Williams ..............Wheatley Heights, N.Y.14......Gabrielle Raziel ..................Melville, N.Y.15......Jennifer Berman ................Jericho, N.Y.16......Elizabeth Sossan ..............Valley Stream, N.Y.17......Emily Feingold ..................Roslyn, N.Y.18......Ellen Huhulea ....................Rockville Centre, N.Y.19......Devika Kedia......................East Norwich, N.Y.20......Stephanie Cole ..................Manhasset, N.Y.21......Morgan Voulo ....................East Setauket, N.Y.22......Mara Stewart ....................Oceanside, N.Y.23......Rachel Weiss ....................Great Neck, N.Y.24......Rachel Collins....................Port Jefferson, N.Y.25......Brooke Digia ......................Manhasset, N.Y.26......Nicole Vassalle ..................Port Washington, N.Y.27......Grace Graham ..................Rockville Centre, N.Y.28......Danah Han ........................Dix Hills, N.Y.29......Emily Shutman ..................Huntington, N.Y.30......Emily Fernandez................Shirley, N.Y.31......Ariana Fixon-Owoo ..........Lynbrook, N.Y.32......Katelyn Walker ..................Sands Point, N.Y.33......Amanda Foo ......................Manhasset, N.Y.34......Olivia Scordo ....................Glen Head, N.Y.35......Laura Halsey......................Westhampton, N.Y.36......Theodora Brebenel............Glen Head, N.Y.37......Trinity Chow ......................Glen Cove, N.Y.38......Lexee Shapiro....................Syosset, N.Y.39......Emily Marge ......................Medford, N.Y.40......Christina Jud......................Glen Head, N.Y.

Long Island Girls 16 SinglesRank Name..................................City1........Olivia Marie Ammirati ........Halesite, N.Y.2........Allison Gabrielle Huber......Melville, N.Y.3........Elena Nastasi ....................Bayville, N.Y.4........Emily Rees ........................Rockville Centre, N.Y.5........Alexandra Linder ..............Sands Point, N.Y.6........Sabrina Ferretti ..................Setauket, N.Y.7........Lauren Difazio....................Greenlawn, N.Y.8........Julia Khan ..........................Port Washington, N.Y.9........Rebecca Stern ..................Dix Hills, N.Y.10......Laura Torsiello....................Bayport, N.Y.11......Sarah Seeman ..................Port Washington, N.Y.12......Michelle Haykin ................Great Neck, N.Y.13......Taylor Sim ..........................Plainview, N.Y.14......Stacy Denbaum ................Syosset, N.Y.15......Elizabeth Kallenberg..........Port Washington, N.Y.16......Alexandra Lipps ................Roslyn, N.Y.17......Danielle Mirabella ..............Wantagh, N.Y.18......Katherine Changtroraleke ..Greenvale, N.y.19......Gina Ciliberti ......................West Islip, N.Y.20......Angelika Rothberg ............Centerport, N.Y.21......Alexandra Dananberg ......Massapequa, N.Y.22......Alanna Kane ......................Sea Cliff, N.Y.


L O N G I S L A N D R A N K I N G S23......Bridget Connors ................East Quogue, N.Y.24......Rini Halder..........................Huntington, N.Y.25......Taylor Cosme ....................New Hyde Park, N.Y.26......Matilda Bros ......................Lloyd Harbor, N.Y.27......Amanda Luper ..................Melville, N.Y.28......Lindsay Haley ....................Hicksville, N.Y.29......Alana Weitz ........................Roslyn, N.Y.30......Grace Graham ..................Rockville Centre, N.Y.31......Gina Paprella......................Saint James, N.Y.32......Marianne Naleski ..............Southold, N.Y.33......Jamie Brown......................Huntington, N.Y.34......Rhianna Fitzpatrick............Saint James, N.Y.35......Elizabeth Gee ....................Garden City, N.Y.36......Campbell Howe ................Locust Valley, N.Y.37......Kathryn Sinicropi ..............Cold Spring Harbor, N.Y.38......Sarah McGurren................Floral Park, N.Y.

Long Island Girls 18 SinglesRank Name..................................City1........Olivia Ammirati ..................Halesite, N.Y.2........Jennifer A. Carnovale........Massapequa, N.Y.3........Emma Brezel......................Port Washington, N.Y.4........Kerrin Toner........................West Babylon, N.Y.5........Lara Fishbane....................Commack, N.Y.6........Laura Torsiello....................Bayport, N.Y.7........Elena Nastasi ....................Bayville, N.Y.8........Bianca Posa ......................Valley Stream, N.Y.9........Rithika Reddy ....................Syosset, N.Y.10......Veronika Paikin ..................Valley Stream, N.Y.11......Sara Finger ........................Saint James, N.Y.12......Jennifer Glukhman ............Syosset, N.Y.13......Amanda Gaimaro ..............Lynbrook, N.Y.

Boys & Girls Sectional Rankings(as of 07/31/12)

BOYSSectional Boys 12 Singles—Long Island RegionRank Name ............................City2........Brian Shi ............................Jericho, N.Y.4........Daniel Eric Pellerito............Syosset, N.Y.5........Alan Delman ......................Great Neck, N.Y.6........Ryan Goetz ........................Greenlawn, N.Y.8........Cannon Kingsley ..............Northport, N.Y.9........Steven Well Sun ................Glen Cove, N.Y.13......Patrick F. Maloney ............Oyster Bay, N.Y.19......Ronald P. Hohmann ..........Oyster Bay, N.Y.20......Michael Medvedev............Oceanside, N.Y.24......Pete Siozios ......................New Hyde Park, N.Y.33......Neel Raj..............................Oyster Bay, N.Y.37......Gardner Howe ..................Locust Valley, N.Y.42......Benjamin Grossman..........Sands Point, N.Y.44......Abhinav Raj Srivastava ....Melville, N.Y.45......Billy G. Suarez....................Huntington, N.Y.63......Sujay Sharma ....................New Hyde Park, N.Y.67......Spencer Brachman ..........Commack, N.Y.68......Matthew Franklin Porges..Sands Point, N.Y.70......Niles Ghaffar ......................Massapequa, N.Y.80......Oliver Worth ......................Locust Valley, N.Y.81......Jeffrey McDonnell..............Glen Cove, N.Y.86......Preet Rajpal........................Syosset, N.Y.87......Eli Grossman......................Woodbury, N.Y.89......Karan Amin ........................Roslyn Heights, N.Y.94......Maxwell Moadel ................Brookville, N.Y.102 ..Eric Li..................................Old Westbury, N.Y.109 ..Logan Paik Chang ............Old Westbury, N.Y.110 ..Cameron Klepper ..............Dix Hills, N.Y.

118 ..Kabir Rajpal........................Syosset, N.Y.124 ..Jack Louchheim................Sagaponack, N.Y.125 ..Zachary Berlin....................Dix Hills, N.Y.126 ..Matthew Roberts ..............Setauket, N.Y.139 ..Zachary Khazzam..............Roslyn Heights, N.Y.

Sectional Boys 14 Singles—Long Island RegionRank Name ............................City6........Brenden Andrew Volk........Dix Hills, N.Y.19......Athell Bennett ....................Valley Stream, N.Y.20......Keegan Morris ..................Franklin Square, N.Y.21......Chris Kuhnle ......................Shoreham, N.Y.24......Sean Patrick ......................Oyster Bay, N.Y.27......Sean Mullins ......................Lloyd Harbor, N.Y.30......Finbar Talcott ....................Sea Cliff, N.Y.41......Colin Francis Sacco ..........Brightwaters, N.Y.44......Nasser Ghaffar ..................Massapequa Park, N.Y.49......Daniel Shleimovich............Merrick, N.Y.50......Trippie Franz ......................Bridgehampton, N.Y.51......Alex Grossman ..................Sands Point, N.Y.52......Rajan Vohra........................Glen Head, N.Y.64......Nicolas Demaria ................New Hyde Park, N.Y.71......Pete Siozios ......................New Hyde Park, N.Y.74......Alan Delman ......................Great Neck, N.Y.75......Del Schunk ........................Westhampton Beach, N.Y.80......Yuval Solomon ..................Plainview, N.Y.82......Andy Zhou ........................Commack, N.Y.86......Dylan Granat......................Woodbury, N.Y.92......Mark Julian Baker..............North Baldwin, N.Y.96......Ben Snow ..........................Water Mill, N.Y.98......Matthew Holweger............Manhasset, N.Y.100 ..Aziz Rashidzada ................Dix Hills, N.Y.103 ..Daniel Weitz ......................Roslyn, N.Y.114 ..Lucas Larese DeSanto......Southampton, N.Y.119 ..Austin Egna........................Port Washington, N.Y.121 ..Joonho Ko ........................Huntington, N.Y.124 ..Garrett Malave ..................Laurel, N.Y.126 ..Timothy Serignese ............Port Washington, N.Y.133 ..Max Egna ..........................Port Washington, N.Y.137 ..Benjamin Tenner................Roslyn, N.Y.142 ..Ronald Hohmann ..............Oyster Bay, N.Y.144 ..James Kyrkanides ............Stony Brook, N.Y.149 ..Stephen Gruppuso............Bayport, N.Y.

Sectional Boys 16 Singles—Long Island RegionRank Name ............................City3........Josh Silverstein..................Great Neck, N.Y.4........Daniel Grunberger ............Great Neck, N.Y.5........Noah Rubin........................Rockville Centre, N.Y.10......Philip Daniel Antohi ..........Glen Head, N.Y.12......Alexander Lebedev ..........Island Park, N.Y.22......Brandon T. Stone ..............Melville, N.Y.23......Douglas Notaris ................Wantagh, N.Y.27......Zain Ali................................Dix Hills, N.Y.35......Jared R. Halstrom..............Bellmore, N.Y.37......Bryant Born........................Manhasset, N.Y.39......Lubomir Cuba....................Massapequa Park, N.Y.44......Eric Wagner........................Roslyn Heights, N.Y.50......Jonathan Paris ..................Cold Spring Harbor, N.Y.60......Kyle Alper ..........................Dix Hills, N.Y.63......Conor Mullins ....................Lloyd Harbor, N.Y.64......John P. D’Alessandro ........Northport, N.Y.63......Lamar Remy ......................Roslyn, N.Y.64......John D’Alessandro............Northport, N.Y.73......Lamar Remy ......................Roslyn, N.Y.75......Fernando Filho ..................East Hampton, N.Y.78......Dylan Appel........................Locust Valley, N.Y.80......Benjamin Rosen ................Port Washington, N.Y.82......Justin Park ........................Huntington, N.Y.

89......Julian Zlobinsky ................Greenvale, N.Y.96......Cole Laffitte........................East Setauket, N.Y.103 ..Alex Brebenel ....................Glen Head, N.Y.106 ..James Heaney ..................Locust Valley, N.Y.108 ..Cory Seltman ....................Dix Hills, N.Y.109 ..Brenden Volk......................Dix Hills, N.Y.119 ..Michael DeNigris ..............Islip, N.Y.125 ..Joseph D’orazio ................Saint James, N.Y.128 ..Palmer Clare ......................North Bellmore, N.Y.136 ..Dylan Granat......................Woodbury, N.Y.139 ..Dennis Uspensky ..............Atlantic Beach, N.Y.140 ..Zacarias Imperial ..............Garden City Park, N.Y.142 ..Henry Tell............................Woodbury, N.Y.149 ..Brian Hoffarth ....................Fort Salonga, N.Y.

Sectional Boys 18 Singles—Long Island RegionRank Name ............................City2........Josh Levine........................Syosset, N.Y.5........Andrew Yaraghi ................Mill Neck, N.Y.8........Noah Rubin........................Rockville Centre, N.Y.11......Vihar Shah..........................New Hyde Park, N.Y.13......Samuel Lam ......................Old Westbury, N.Y.15......Eric Rubin ..........................Lido Beach, N.Y.16......Brendan Henry ..................Massapequa, N.Y.25......Aidan Talcott ......................Sea Cliff, N.Y.26......Josh Silverstein..................Great Neck, N.Y.27......Ofir Solomon......................Plainview, N.Y.30......Matthew O. Barry ..............Lido Beach, N.Y.32......Ethan Bogard ....................Lido Beach, N.Y.34......Howard J. Weiss................Great Neck, N.Y.40......Conor Dauer ......................Lloyd Harbor, N.Y.52......Austin Davidow..................Glen Head, N.Y.54......Kevin Katz..........................Woodbury, N.Y.55......Tyler J. Hoffman ................Sayville, N.Y.62......Zachary Lessen ................Roslyn Heights, N.Y.71......Matthew Demichiel............Hewlett, N.Y.73......Alexander Schidlovsky......Sea Cliff, N.Y.75......Clark Ruiz ..........................Glen Head, N.Y.82......John D’Alessandro............Northport, N.Y.89......Sean Chhugani..................Roslyn, N.Y.95......Sander Brenner ................Port Washington, N.Y.98......Philip Antohi ......................Glen Head, N.Y.100 ..Richard Mitchell ................Franklin Square, N.Y.101 ..Alex Sacher........................Glen Head, N.Y.102 ..Jeffrey Cherkin ..................Melville, N.Y.110 ..Douglas Notaris ................Wantagh, N.Y.114 ..Brian Slivonik ....................Oyster Bay, N.Y.115 ..Lamar Remy ......................Roslyn, N.Y.119 ..Eric Wagner........................Roslyn Heights, N.Y.121 ..Ian Baranowski ..................Syosset, N.Y.133 ..Dylan Appel........................Locust Valley, N.Y.136 ..Jeremy Dubin ....................Southampton, N.Y.144 ..Brandon Stone ..................Melville, N.Y.147 ..Roger Young......................Brookhaven, N.Y.

GIRLSSectional Girls 12 Singles—Long Island RegionRank Name ............................City2........Hannah Zhao ....................Syosset, N.Y.10......Lea Ma ..............................Dix Hills, N.Y.20......Jasmine Olivia Abidi ..........Glen Head, N.Y.21......Alexa Susan Goetz............Greenlawn, N.Y.29......Olivia Rose Scordo............Glen Head, N.Y.36......Stephanie Anne Petras ....Manhasset, N.Y.39......Katelyn Walker ..................Sands Point, N.Y.43......Francesca Karman............Port Washington, N.Y.47......Merri Kelly ..........................Oyster Bay, N.Y.48......Rachel Arbitman................Hewlett, N.Y.

57......Maryam Beshir Ahmad ....Albertson, N.Y.64......Julia Kielan ........................Valley Stream, N.Y.69......Celeste Wang Traub..........Jericho, N.Y.74......Trinity Chow ......................Glen Cove, N.Y.93......Kimberly Liao ....................Commack, N.Y.97......Jacqueline Rae Bukzin......Manorville, N.Y.102 ..Lucia Hu ............................Roslyn, N.Y.108 ..Kaitlyn Byrnes....................Massapequa, N.Y.112 ..Gabriela Sciarrotta ............Woodmere, N.Y.115 ..Denise Lai ..........................Setauket, N.Y.120 ..Amy Delman ......................Great Neck, N.Y.123 ..Rory Gallaher ....................East Hampton, N.Y.125 ..Madison Williams ..............Glen Cove, N.Y.126 ..Evangelia Frankis ..............Manhasset, N.Y.127 ..Morgan Voulo ....................East Setauket, N.Y.130 ..Ivanna Nikolic ....................Glen Head, N.Y.131 ..Marisa Menist ....................Great Neck, N.Y.133 ..Madeline Clinton................Manhasset, N.Y.146 ..Alexa Bracco ....................Freeport, N.Y.

Sectional Girls 14 Singles—Long Island RegionRank Name ............................City5........Madison Battaglia..............Cold Spring Harbor, N.Y9........Amber Nicole Policare ......East Atlantic Beach, N.Y.12......Alexa Graham....................Garden City, N.Y.14......Claire Handa ......................Rockville Centre, N.Y.17......Taylor S. Cosme ................New Hyde Park, N.Y.43......Dominique Woinarowski ..Syosset, N.Y.48......Esther Chikvashvili ............Syosset, N.Y.49......Stephanie Chikvashvili ......Melville, N.Y.52......Courtney Kowalsky ..........Oyster Bay, N.Y.54......Ashley Lessen....................Roslyn Heights, N.Y.57......Celeste Rose Matute ........Oyster Bay, N.Y.66......Josephine Winters ............Elmont, N.Y.71......Amanda Allison Foo..........Manhasset, N.Y.88......Brynn Maris April ..............Dix Hills, N.Y.94......Danielle Mirabella ..............Wantagh, N.Y.98......Emily Shutman ..................Huntington, N.Y.101 ..Sarah Seeman ..................Port Washington, N.Y.108 ..Nicole Kielan......................Valley Stream, N.Y.110 ..Dasha Dlin..........................Glen Head, N.Y.111 ..Ellen Huhulea ....................Rockville Centre, N.Y.115 ..Lea Ma ..............................Dix Hills, N.Y.125 ..Adele Sukhov ....................Westbury, N.Y.132 ..Morgan Herrmann ............Garden City, N.Y.133 ..Michelle Carnovale............Massapequa, N.Y.140 ..Emma Rosenberg ............Port Washington, N.Y.141 ..Olivia Scordo ....................Glen Head, N.Y.147 ..Lexee Shapiro....................Syosset, N.Y.150 ..Hannah Zhao ....................Melville, N.Y.

Sectional Girls 16 Singles—Long Island RegionRank Name ............................City21......Madison Battaglia..............Cold Spring Harbor, N.Y.22......Bridget Elaine Harding ......Northport, N.Y.27......Mia M. Vecchio..................Manhasset Hills, N.Y.28......Sunaina Vohra....................Glen Head, N.Y.32......Aimee N. Manfredo ..........Shoreham, N.Y.34......Amber Policare ..................East Atlantic Beach, N.Y.38......Aleksandra Mally ..............Franklin Square, N.Y.46......Paulina Tafler......................Oceanside, N.Y.50......Danielle Giannetti ..............Oyster Bay, N.Y.56......Lauren Ann Livingston ......Sands Point, N.Y.58......Claudia M. Ruiz ................Glen Head, N.Y.67......Alexa Graham....................Garden City, N.Y.68......Michele Lehat ....................Great Neck, N.Y.73......Esther Chikvashvili ............Melville, N.Y.94......Claire Handa ......................Point Lookout, N.Y.100 ..Olivia Funk ........................Hicksville, N.Y.


United Sports Publications, Ltd. • United Sports Public

atio

ns, L

td. •

USP

L O N G I S L A N D R A N K I N G S102 ..Alexandra Linder ..............Sands Point, N.Y.103 ..Rhea Malhotra ..................Syosset, N.Y.105 ..Rithika Reddy ....................Syosset, N.Y.107 ..Allison Huber......................Melville, N.Y.113 ..Julia Khan ..........................Port Washington, N.Y.117 ..Nicole Koskovolis ..............Manhasset, N.Y.120 ..Lauren Difazio....................Greenlawn, N.Y.128 ..Elena Nastasi ....................Bayville, N.Y.130 ..Taylor Cosme ....................New Hyde Park, N.Y.140 ..Bridget Connors ................East Quogue, N.Y.142 ..Katharine Brandow ..........East Northport, N.Y.150 ..Emily Rees ........................Rockville Centre, N.Y.

Sectional Girls 18 Singles—Long Island RegionRank Name ............................City6........Hannah L. Camhi ..............Woodbury, N.Y.8........Katherine Yau ....................Manhasset, N.Y.9........Vivian Cheng......................Woodbury, N.Y.11......Sophie Barnard..................Mill Neck, N.Y.20......Nicholle Torres ..................North Hills, N.Y.32......Julia Elbaba........................Oyster Bay, N.Y. 34......Stephanie Loutsenko ........Bellmore, N.Y.38......Morgan Feldman ..............Glen Head, N.Y.47......Mia Vecchio ......................Manhasset Hills, N.Y.51......Aleksandra Mally ..............Franklin Square, N.Y.52......Sunaina Vohra....................Glen Head, N.Y.56......Melissa Carlay ..................New Hyde Park, N.Y.57......Claudia Ruiz ......................Glen Head, N.Y.60......Taylor Diffley ......................Hampton Bays, N.Y.62......Ashley A. Masanto ............Baldwin, N.Y.67......Sara Finger ........................Saint James, N.Y.69......Aimee Manfredo................Shoreham, N.Y.74......Alison Wang ......................Great Neck, N.Y.81......Bianca Posa ......................Valley Stream, N.Y.84......Yuliya Astapova ................Port Washington, N.Y.99......Laura Torsiello....................Bayport, N.Y.102 ..Gabrielle Leon....................Woodmere, N.Y.103 ..Erica Bundrick ..................Mattituck, N.Y.107 ..Rithika Reddy ....................Syosset, N.Y.110 ..Emma Brezel......................Port Washington, N.Y.113 ..Olivia Ammirati ..................Halesite, N.Y.114 ..Zenat Rashidzada ............Dix Hills, N.Y.118 ..Paulina Tafler......................Oceanside, N.Y.123 ..Lisa Petruzillo ....................Syosset, N.Y.127 ..Esther Chikvashvili ............Melville, N.Y.129 ..Alexa Graham....................Garden City, N.Y.

Boys & Girls National Rankings(as of 08/09/12)

BOYSNational Boys 12 Singles—Long Island PlayersRank Name ............................City13......Brian Shi ............................Jericho, N.Y.22......Ryan Goetz ........................Greenlawn, N.Y.34......Alan Delman ......................Great Neck, N.Y.44......Steven Well Sun ................Glen Cove, N.Y.84......Patrick Maloney ................Oyster Bay, N.Y.91......Daniel Eric Pellerito............Syosset, N.Y.97......Ronald P.Hohmann ..........Oyster Bay, N.Y.138 ..Cannon Kingsley ..............Northport, N.Y.290 ..Michael Medvedev............Oceanside, N.Y.305 ..Billy Suarez ........................Huntington, N.Y.396 ..Gardner Howe ..................Locust Valley, N.Y.420 ..Pete Siozios ......................New Hyde Park, N.Y.427 ..Neel Raj..............................Oyster Bay, N.Y.

447 ..Benjamin Grossman..........Sands Point, N.Y.485 ..Abhinav Srivastava............Melville, N.Y.

684 ..Matthew Porges ................Sands Point, N.Y.

National Boys 14 Singles—Long Island PlayersRank Name ............................City41......Brenden Andrew Volk........Dix Hills, N.Y.182 ..Chris Kuhnle ......................Shoreham, N.Y.202 ..Sean Patrick ......................Oyster Bay, N.Y.258 ..Athell Patrick Bennett........Valley Stream, N.Y.273 ..Sean Mullins ......................Lloyd Harbor, N.Y.304 ..Colin Sacco........................Brightwaters, N.Y.330 ..Finbar Talcott ....................Sea Cliff, N.Y.583 ..Keegan Morris ..................Franklin Square, N.Y.634 ..Trippie Franz ......................Bridgehampton, N.Y.701 ..Nasser Abdel Ghaffar........Massapequa, N.Y.762 ..Stephen Gruppuso............Bayport, N.Y.

National Boys 16 Singles—Long Island PlayersRank Name ............................City23......Josh Silverstein..................Great Neck, N.Y.69......Daniel Grunberger ............Great Neck, N.Y.115 ..Philip Daniel Antohi ..........Glen Head, N.Y.127 ..Alexander Lebedev ..........Island Park, N.Y.153 ..Douglas Notaris ................Wantagh, N.Y.199 ..Brandon T. Stone ..............Melville, N.Y.261 ..Julian Alexi Zlobinsky........Greenvale, N.Y.280 ..Lamar Remy ......................Roslyn, N.Y. 376 ..Dennis Uspensky ..............Atlantic Beach, N.Y.435 ..Jonathan Paris ..................Cold Spring Harbor, N.Y.452 ..John P. D’Allesandro ........Northport, N.Y.494 ..Zain Ali................................Dix Hills, N.Y.538 ..Jared Halstrom ..................Bellmore, N.Y.579 ..Conor Mullins ....................Lloyd Harbor, N.Y.675 ..Eric Wagner........................Roslyn Heights, N.Y.839 ..Bryant Born........................Manhasset, N.Y.840 ..Lubomir Cuba....................Massapequa Park, N.Y.

National Boys 18 Singles—Long Island PlayersRank Name ............................City7........Noah B. Rubin ..................Merrick, N.Y.22......Josh M. Levine ..................Syosset, N.Y.211 ..Howard J. Weiss................Great Neck, N.Y.

217 ..Samuel Lam ......................Old Westbury, N.Y.258 ..Brendan Henry ..................Massapequa, N.Y.260 ..Andrew S. Yaraghi ............Mill Neck, N.Y.316 ..Aidan Talcott ......................Sea Cliff, N.Y.334 ..Matthew O. Barry ..............Lido Beach, N.Y.359 ..Eric Rubin ..........................Lido Beach, N.Y.364 ..Vihar Shah..........................New Hyde Park, N.Y.441 ..Ofir Solomon......................Plainview, N.Y.480 ..Dennis Uspensky ..............Atlantic Beach, N.Y.520 ..Josh Silverstein..................Great Neck, N.Y.529 ..Alexander Schidlovsky......Sea Cliff, N.Y.544 ..Lamar Remy ......................Roslyn, N.Y.629 ..Kevin Katz..........................Woodbury, N.Y.631 ..Conor Dauer ......................Lloyd Harbor, N.Y.676 ..Julian Alexi Zlobinsky........Greenvale, N.Y.797 ..Ethan Bogard ....................Lido Beach, N.Y.893 ..Austin Davidow..................Glen Head, N.Y.

GIRLSNational Girls 12 Singles—Long Island PlayersRank Name ............................City12......Hannah Zhao ....................Syosset, N.Y.108 ..Lea Ma ..............................Dix Hills, N.Y.130 ..Jasmine Olivia Abidi ..........Glen Head, N.Y.240 ..Alexa Goetz........................Greenlawn, N.Y.385 ..Merri Kelly ..........................Oyster Bay, N.Y.440 ..Olivia Scordo ....................Glen Head, N.Y.468 ..Francesca Karman............Port Washington, N.Y.494 ..Jacqueline Rae Bukzin......Manorville, N.Y.763 ..Katelyn Walker ..................Sands Point, N.Y.866 ..Celeste Traub ....................Jericho, N.Y.

National Girls 14 Singles—Long Island PlayersRank Name ............................City43......Madison Battaglia..............Cold Spring Harbor, N.Y.168 ..Alexa Graham....................Garden City, N.Y.206 ..Taylor Cosme ....................New Hyde Park, N.Y.237 ..Amber Nicole Policare ......East Atlantic Beach, N.Y.247 ..Claire Handa ......................Point Lookout, N.Y.456 ..Celeste Rose Matute ........Oyster Bay, N.Y.536 ..Esther Chikvashvili ............Melville, N.Y.657 ..Morgan Herrmann ............Garden City, N.Y.680 ..Dominique Woinarowski ..Syosset, N.Y.760 ..Courtney Kowalsky ..........Oyster Bay, N.Y.

763 ..Josephine Winters ............Elmont, N.Y.909 ..Hannah Zhao ....................Melville, N.Y.

National Girls 16 Singles—Long Island PlayersRank Name ............................City324 ..Madison Battaglia..............Cold Spring Harbor, N.Y.345 ..Bridget Harding ................Northport, N.Y.452 ..Sunaina Vohra....................Glen Head, N.Y.497 ..Aimee Manfredo................Shoreham, N.Y.515 ..Paulina Tafler......................Oceanside, N.Y.590 ..Danielle Giannetti ..............Oyster Bay, N.Y.678 ..Mia Vecchio ......................Manhasset Hills, N.Y.731 ..Claudia Ruiz ......................Glen Head, N.Y.738 ..Aleksandra Mally ..............Franklin Square, N.Y.777 ..Amber Policare ..................East Atlantic Beach, N.Y.

National Girls 18 Singles—Long Island PlayersRank Name ............................City44......Julia Elbaba........................Oyster Bay, N.Y.56......Hannah L. Camhi ..............Woodbury, N.Y. 123 ..Sophie Barnard..................Mill Neck, N.Y.151 ..Katherine Yau ....................Manhasset, N.Y.156 ..Vivan Cheng ......................Woodbury, N.Y.474 ..Morgan Feldman ..............Glen Head, N.Y.558 ..Stephanie Loutsenko ........Bellmore, N.Y. 717 ..Melissa G. Carlay ..............New Hyde Park, N.Y.719 ..Taylor Diffley ......................Hampton Bays, N.Y.827 ..Ashley Masanto ................Baldwin, N.Y.861 ..Claudia Ruiz ......................Glen Head, N.Y.882 ..Nicholle Torres ..................North Hills, N.Y.

Visit us at: www.dennyschildrenswear.com

Bellmore, NYCedarhurst, NYCommack, NYLittle Neck, NY

Oceanside, NYPlainview, NYWoodbury, NY

Locations

Main OfficePlainview Centre • 516-681-4490


USTA/Long Island Region 2012TOURNAMENT SCHEDULE

For detailed information on these and all USTA tournaments, visit tennislink.usta.com/tournaments.

SEPTEMBER 2012Saturday-Monday, September 1-3USTA Regional Tournament Segment—September (Glen Cove)Robbie Wagner Tournament Training at Glen Cove60 Sea Cliff AvenueGlen Cove, N.Y.Divisions: B (14-12)s, FIC, B (14-12)d, SESurface Type: Clay IndoorEntry Fee: $102.63 per player (deadline for entries is Thursday, Aug. 2) For more information, call (516) 759-0505.

Friday-Sunday, September 7-9LBTC September ClassicLong Beach Tennis Center899 Monroe BoulevardLong Beach, N.Y.Divisions: Ranked MW (Op)s, SE, M (Op)d, SE; X (Op)d, SE;NM (3.5-4.0)s, SE; NW (3.0-4.0)s, SE; NM (4.0)d, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Sunday,Aug. 12)For more information, call (516) 432-6060.

Friday-Sunday, September 7-9L2O Sportime Kings Park September OpenSportime Kings Park275 Old Indianhead Road • Kings Park, N.Y.Divisions: Intermediate B (14-12)s, SE; QuickStart BG (10[78’ Court/Green Ball])s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Aug. 31 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, September 7-9L2O Sportime Lynbrook September ChallengerSportime Lynbrook175 Merrick Road • Lynbrook, N.Y.Divisions: Intermediate G (14-12)s, SE; QuickStart BG (10[78’Court/Green Ball])s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Aug. 31 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, September 7-9L2R Sportime Syosset September RegionalSportime Syosset75 Haskett Drive • Syosset, N.Y.Divisions: Intermediate BG (14-12)s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Tuesday, Aug. 28 at 1:00 p.m.)For more information, call (516) 933-8500.

Friday-Sunday, September 7-9Huntington Men’s Open & M25 Singles ChampionshipsHuntington Indoor Tennis100 Broadway StreetHuntington Station, N.Y.Divisions: Ranked M (Op, 25)sSurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Aug. 31 at 1:00 p.m.)For more information, call (631) 421-0040.

Friday-Sunday, September 14-16L1B Sportime King’s Park September ChallengerSportime Kings Park275 Old Indianhead Road • Kings Park, N.Y.Divisions: Challenger BG (14)s, SE; QuickStart BG (10[78’Court/Green Ball])s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,September 7 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, September 14-16L2O Sportime Lynbrook September OpenSportime Tennis Lynbrook175 Merrick RoadLynbrook, N.Y.Divisions: Intermediate BG (14)s, FMLCSurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Sept. 7 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, September 14-16L3 Sportime Lynbrook Eastern UPSSportime Tennis Lynbrook175 Merrick RoadLynbrook, N.Y.Divisions: Novice G (14-12)s, RR; QuickStart G(10 [60’Court/Orange Ball])s, RRSurface Type: UnknownEntry Fee: $43.50 per player (deadline for entries is Monday, Sept. 10 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, September 14-16L1B Sportime Syosset Fall ChallengerSportime Syosset75 Haskett Drive • Syosset, N.Y.Divisions: Challenger BG (12)s, SE; QuickStart BG (10[78’Court/Green Ball])s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Tuesday, Sept. 4 at 1:00 p.m.)For more information, call (516) 933-8500.

Friday-Sunday, September 14-16L3 Huntington Eastern UPSHuntington Indoor Tennis100 Broadway Street • Huntington Station, N.Y.Divisions: Novice BG (18-12)s, RR; QuickStart BG (10[60’Court/Orange Ball])s, RRSurface Type: UnknownEntry Fee: $43.50 per player (deadline for entries is Monday, Sept. 10 at 4:00 p.m.)For more information, call (631) 421-0040.

Friday-Sunday, September 21-23L3 Sportime Kings Park Eastern UPSSportime Kings Park275 Old Indianhead Road • Kings Park, N.Y.Divisions: Novice BG (14-12)s, RR; QuickStart BG (10[60’Court/Orange Ball])s, RRSurface Type: UnknownEntry Fee: $43.50 per player (deadline for entries is Monday, Sept. 17 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, September 28-30L2O Kings Park Sportime September OpenSportime Kings Park275 Old Indianhead Road • Kings Park, N.Y.Divisions: Intermediate BG (18-16)s, SE; Novice BG(10 [78’Court/Green Ball])s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Sept. 21 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, September 28-30 & Friday-Monday,October 5-8+L1 Sportime Lynbrook Eastern Designated Closed Champi-onships Level 4 FICSportime Tennis Lynbrook175 Merrick Road • Lynbrook, N.Y.Divisions: Grand Prix G (12)s, FIC; G (12)d, SESurface Type: UnknownEntry Fee: $50 per player singles (deadline for entries isMonday, Sept. 17 at 1:00 p.m.)For more information, call (646) 852-2283.

Friday-Sunday, September 28-30 & Friday-Monday,October 5-8+L1 Sportime Bethpage Eastern Designated Closed Championships, Level 4 FICSportime Tennis Bethpage101 Norcross Avenue • Bethpage, N.Y.Divisions: Grand Prix B (12)s, FIC; B (12)d, SESurface Type: UnknownEntry Fee: $50 per player singles (deadline for entries isMonday, Sept. 17 at 1:00 p.m.)For more information, call (516) 933-8500.




Friday-Sunday, September 28-30 & Friday-Monday,October 5-8+L1 RWTTC Eastern Designated Closed ChampionshipsLevel 4 FICRobbie Wagner Tournament Training Center60 Sea Cliff Avenue • Glen Cove, N.Y.Divisions: Grand Prix G (18)s, FIC; G (18)d, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Monday,Sept. 17 at 1:00 p.m.)For more information call (516) 759-0505.

Friday-Sunday, September 28-30 & Friday-Monday,October 5-8+L1 Point Set Eastern Designated Closed Championships Level4 FICPoint Set Indoor Racquet3065 New Street • Oceanside, N.Y.Divisions: Grand Prix B (16)s, FIC; B (16)d, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Monday,Sept. 17 at 1:00 p.m.)For more information, call (516) 536-8246.

Friday-Sunday, September 28-30 & Friday-Monday,October 5-8+L1 PWTA Eastern Designated Closed ChampionshipsLevel 4 FICPort Washington Tennis Academy100 Harbor Road • Port Washington, N.Y.Divisions: Grand Prix G (16)s, FIC; G (16)d, SESurface Type: UnknownEntry Fee: $54.25 per player singles (deadline for entries isMonday, Sept. 17 at 1:00 p.m.)For more information, call (516) 883-6425.

Saturday-Sunday, September 29-30Sportime Syosset75 Haskett Drive • Syosset, N.Y.Divisions: Novice BG (16-12)s, RRSurface Type: UnknownEntry Fee: $43.50 per player (deadline for entries is Monday,Sept. 24 at 1:00 p.m.)For more information, call (516) 364-2727.

OCTOBER 2012Friday-Sunday, October 5-7Long Beach Tennis Center Fall ChampionshipsLong Beach Tennis Center899 Monroe Boulevard • Long Beach, N.Y.Divisions: Ranked M (Op)sd, SE; NMW (3.0-4.0)sd, SE; NX(Op)d, SESurface Type: UnknownEntry Fee: $54.25 per player singles (deadline for entries isWednesday, Oct. 3 at 1:00 p.m.)For more information, call (516) 432-6060.

Friday-Sunday, October 5-14L1B Sportime Kings Park October ChallengerSportime Kings Park275 Old Indianhead RoadKings Park, N.Y.Divisions: Challenger BG (12)s, SE QuickStart BG (10 [78’Court/Green Ball])s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Sept. 28 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, October 5-7L2R Sportime Lynbrook October ChallengerSportime Tennis Lynbrook175 Merrick Road Lynbrook, N.Y.Divisions: Intermediate B (16-12)s, SE; G (18-16)s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Sept. 28 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, October 5-7 & 12-14L2O The Tennis King September Open @ Roslyn EstatesThe Tennis King25 The TulipsRoslyn, N.Y.Divisions: Intermediate G (14)s, SESurface Type: ClayEntry Fee: $54.25 per player (deadline for entries is Satur-day, Sept. 1)For more information, call (516) 621-2009.

Friday-Sunday, October 5-7 & 12-14L1 Huntington Indoor Fall ChampionshipsHuntington Indoor Tennis100 BroadwayHuntington Station, N.Y.Divisions: Championships BG (10 [78’ Court/Green Ball])s, SESurface Type: UnknownEntry Fee: $48.88 per player (deadline for entries is Tues-day, Sept. 25 at 6:00 p.m.)For more information, call (631) 421-0040.

Friday-Monday, October 5-8L2R Deer Park Tennis October RegionalDeer Park Tennis Center30 Burt DriveDeer Park, N.Y.Divisions: Intermediate B (18-12)sSurface Type: UnknownEntry Fee: $48.88 per player (deadline for entries is Friday,Sept. 28 at 1:00 p.m.)For more information, call (631) 243-0363.

Friday-Sunday, October 12-14L2O Sportime Kings Park October OpenSportime Kings Park275 Old Indianhead RoadKings Park, N.Y.Divisions: Intermediate B (14-12)s, SE; QuickStart B (10 [78’Court/Green Ball])s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Oct. 5 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, October 12-14L2R Sportime Lynbrook October ChallengerSportime Tennis Lynbrook175 Merrick Road • Lynbrook, N.Y.Divisions: Intermediate G (14-12)s, SE; QuickStart G (10[78’Court/Green Ball])s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Oct. 5 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, October 12-14L2R Long Beach Tennis Center October RegionalLong Beach Tennis Center899 Monroe BoulevardLong Beach, N.Y.Divisions: Intermediate BG (18-16)s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Tues-day, Oct. 9 at 1:00 p.m.)For more information, call (516) 432-6060.

Friday-Sunday, October 19-21L2R Sportime Lynbrook October OpenSportime Tennis Lynbrook175 Merrick Road • Lynbrook, N.Y.Divisions: Intermediate B (14) s, FMLC; QuickStart BG (10[78’ Court/Green Ball])s, FRLCSurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Oct. 12 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, October 19-21L3 Sportime Kings Park Eastern UPSSportime Kings Park275 Old Indianhead Road • Kings Park, N.Y.Divisions: Novice BG (14-12)s, RR; QuickStart BG (10 [60’Court/Orange Ball])s, RRSurface Type: UnknownEntry Fee: $43.50 per player (deadline for entries is Monday,Oct. 15 at 1:00 p.m.)For more information, call (516) 484-9222.




Friday-Sunday, October 19-21L1B Long Beach October ChallengerLong Beach Tennis Center899 Monroe BoulevardLong Beach, N.Y.Divisions: Challenger BG (18-16)sd, SESurface Type: UnknownEntry Fee: $54.25 per player singles (deadline for entries isTuesday, Oct. 16 at 1:00 p.m.)For more information, call (516) 432-6060.

Friday-Sunday, October 19-21L3 RWTT @ Glenwood Landing Eastern UPSRobbie Wagner Tournament Training Center81 Round Hill RoadRoslyn Heights, N.Y.Divisions: Novice BG (14-12)s, RRSurface Type: Hard IndoorEntry Fee: $43.50 per player (deadline for entries is Friday,Oct. 12 at 1:00 p.m.)For more information, call (516) 759-0505.

Saturday, October 20L3 Sportime Bethpage 10U & 8U October UPSSportime Tennis Bethpage101 Norcross AvenueBethpage, N.Y.Divisions: QuickStart BG (10 [60’ Court/Orange Ball] 8 [36’Court/Red Ball])s, RRSurface Type: UnknownEntry Fee: $38.13 per player (deadline for entries is Monday,September 24 at 1:00 p.m.)For more information, call (516) 933-8500.

Friday-Sunday, October 26-28L2O Sportime Kings Park Fall ChallengerSportime Kings Park275 Old Indianhead Road • Kings Park, N.Y.Divisions: Intermediate BG (12)s, FRLC; QuickStart BG (10[78’ Court/Green Ball])s, FRLCSurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Oct. 19 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, October 26-28L2O Sportime Lynbrook October OpenSportime Tennis Lynbrook175 Merrick Road • Lynbrook, N.Y.Divisions: Intermediate BG (14)s, SE; QuickStart BG (10 [78’Court/Green Ball])s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Friday,Oct. 19 at 1:00 p.m.)For more information, call (516) 484-9222.

Friday-Sunday, October 26-28L2O Sportime Syosset October OpenSportime Syosset 75 Haskett DriveSyosset, N.Y.Divisions: Intermediate BG (18-16)s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Tuesday,Oct. 16 at 1:00 p.m.)For more information, call (516) 933-8500.

Friday-Sunday, October 26-28 & Friday-Sunday, November 2-4L1 Sportime Bethpage Ron Smyth Memorial ChampionshipsSportime Bethpage101 Norcross AvenueBethpage, N.Y.Divisions: Championships BG (16)s, SESurface Type: UnknownEntry Fee: $54.25 per player (deadline for entries is Monday,Aug. 27 at 1:00 p.m.)For more information, call (516) 933-8500.

Friday-Sunday, October 26-28L1B Long Beach Fall ChallengerLong Beach Tennis Center899 Monroe BoulevardLong Beach, N.Y.Divisions: Challenger BG (14-12)sd, SESurface Type: UnknownEntry Fee: $54.25 per player singles (deadline for entries isMonday, Oct. 22 at 1:00 p.m.)For more information, call (516) 432-6060.

Find out why we were voted BEST hair Salon & Day Spa

Total Beauty.

www.CactusSalon.com

Valid Sun-Thurs w/ selected stylists

Long Island Tennis Magazine - September/October 2012

Documents

Transcript of Long Island Tennis Magazine - September/October 2012