KALLIKREIN GENE REGULATION IN HORMONE-

DEPENDENT CANCER CELL LINES.

Stephen Anthony Myers

Bachelor of Applied Science (Honours, 1A)

PhD Candidate

The Science Research Centre, School of Life Sciences, Queensland University of

Technology (QUT), Brisbane, 4001. Australia.

A thesis submitted for the degree of Doctor of Philosophy of the Queensland

University of Technology.

2003

KEYWORDS Kallikreins (KLKs), Kallikrein 1 and 4 genes (KLK1, KLK4), Human Kallikrein 1 and

4 protein (hK1, hK4), Hormonal Regulation, Estrogen, Progesterone, Progesterone

Receptor (PR), Promoter, Transcription Initiation Site (TIS), Hormone Response

Elements (HREs), Progesterone Response Elements (PREs), Reporter Gene Assays,

Electromobility Shift Assay (EMSA), Chromatin Immunoprecipitation (ChIP) Assay.

ii

ABSTRACT Hormone-dependent cancers (HDCs), such as those of the prostate, ovary, breast and

endometrium, share characteristics that indicate similar underlying mechanisms of

carcinogenesis. Through steroid hormone signalling on “down-stream” target genes,

the growth, development and progression of HDCs are regulated. One such family of

target genes, highly expressed in HDCs and regulated by steroid hormones, are the

tissue kallikreins (KLKs). The KLKs are a multigene family of serine proteases

involved in physiological processes such as blood pressure regulation, inflammation,

and tumour development and progression via the hydrolysis of specific substrates.

Although the KLK gene family is clearly implicated in tumourigenesis, the precise

roles played by these genes are largely unknown. Additionally, except for the

androgen-responsive genes, KLK2 and KLK3, the mechanisms underlying their

hormonal regulation in HDCs are yet to be identified.

The initial focus of this thesis was to examine the regulation of the kallikreins, KLK1

and KLK4, by estradiol and progesterone in endometrial and breast cancer cell lines.

From these studies, progesterone clearly regulated KLK4 expression in T47D cells

and therefore, the focus of the remaining studies was to further examine this

regulation at the transcriptional level. An overview of the results obtained is detailed

below.

Human K1 and hK4 protein levels were increased by 10 nmol/L estradiol benzoate,

progesterone, or a combination of the two, over 48 hours in the endometrial cancer

cell line, KLE. However, these same treatments resulted in no change in KLK1 gene

or hK1 protein levels in the endometrial cancer cell lines, HEC1A or HEC1B (only

hK1 analysed). Progesterone treatment (0-100 nmol/L) over 24 hours resulted in a

clear increase in KLK4 mRNA at the 10 nmol/L dose in the breast cancer cell line,

T47D. Additionally, treatment of T47D cells with 10 nmol/L progesterone over 0-48

hr, resulted in the rapid expression of the hK4 protein at 2 hr which was sustained for

24 hr. Further analysis of this latter progesterone regulation with the anti-

progesterone, RU486, over 24 hours, resulted in an observable decrease in hK4 levels

at 1 µmol/L RU486. Although the estrogen and progesterone regulation of the hK1

protein was not further analysed, the data obtained for hK4 regulation in T47D cell

iii

lines, supported the premise that this gene was progesterone-responsive. The rapid

expression of hK4 protein by progesterone at two hours suggests that KLK4

transcription is directly coupled to progesterone regulation, perhaps through

progesterone receptor (PR) binding to progesterone-responsive regions within the

KLK4 promoter or far “up-stream” regions. Thus, the following further studies were

performed.

To test this hypothesis, the transcription initiation site (TIS) and 5’ flanking regions of

the KLK4 gene in T47D cells were interrogated. Primer extension and 5’ RACE

identified the TIS 78 bp 5’ of the putative ATG site for translation as identified by

Korkmaz et al. (2001). This KLK4 gene transcript consists of only four exons, and

thus excludes the pre/pro signal peptide. Although a TATA-box is not present within

-25 to -30 bp 5’ of the identified TIS, a number of consensus binding motifs for Sp1

and estrogen receptor half-sites were identified. It is possible that the Sp1 sites are

involved in the basal levels of transcription for this gene. Additionally, a putative

progesterone response element (PRE) was identified in the far “up-stream” regions of

the KLK4 gene.

Basal levels of transcription were observed within the KLK4 proximal promoter

region when coupled to a luciferase reporter gene and transfected into T47D cell lines.

Additionally, the KLK4 proximal promoter region did not induce the luciferase

reporter gene expression when progesterone was added to the system, however,

estradiol was inhibitory for luciferase gene expression. This suggests that the

proximal promoter region of the KLK4 gene could contain functional EREs but not

PREs. In keeping with this hypothesis, some ER half-sites were identified, but PR

sites were not obvious within this region.

The identified PRE in the far “up-stream” region of the KLK4 gene assembled the

progesterone receptor in vitro, and in vivo, as assessed by electromobility shift assays

and chromatin immunoprecipitation assays (EMSAs and ChIPs), respectively. The

binding of the PR to the KLK4 PRE was successfully competed out by a PR antibody

and not by an androgen receptor antibody, and thus confirms the specificity of the

KLK4 PRE-PR complex. Additionally, the PR was recruited and assembled onto and

off the progesterone-responsive KLK4 region in a cyclic fashion. Thus, these data

iv

strongly suggest that the PR represents one of the core components of a transcription

complex for the KLK4 gene, and presumably also contributes to the expression of this

gene. Moreover, these data suggest a functional coordination between the PR and the

KLK4 progesterone-responsive region in T47D cells, and thus, provide a model

system to further study these events in vivo.

v

TABLE OF CONTENTS KEYWORDS……………………………………………………………………………………………i

ABSTRACT…………………………………………………………………………………………….ii

TABLE OF CONTENTS………………………………………………………………………………v

LIST OF FIGURES………………………………………………………………………………..…..xi

LIST OF TABLES…………………………………………………………………………………....xiii

LIST OF ABBREVIATIONS………………………………………………………………………..xiv

STATEMENT OF ORIGINAL AUTHORSHIP…………………………………………………...xvi

PUBLISHED PAPERS DURING MY PhD……………………………………………………..…xvii

ACKNOWLEDGEMENTS………………………………………………………………...………xxiii

CHAPTER 1

INTRODUCTION AND LITERATURE REVIEW

1.1 INTRODUCTION………………………………………………………………………….………..2

1.2 HORMONE-DEPENDENT CANCERS AND HORMONE ACTION……………………………..3

1.2.1 Hormone Action in Hormone Dependent Cancers………………………………………………...4

1.3 THE TISSUE KALLIKREINS: GENERAL INFORMATION……………………………………..8

1.4 STRUCTURAL ORGANISATION OF THE TISSUE KALLIKREIN GENE FAMILY.………….9

1.5 KNOWN AND PUTATIVE FUNCTIONS OF KLKS1-15………………………………………...12

1.5.1 Renal/Pancreatic Tissue Kallikrein 1 (KLK1)……………………………………………………12

1.5.2 Glandular Kallikrein 2 (KLK2) and Prostate Specific Antigen (PSA-KLK3)……...………….....14

1.5.3 Kallikrein 4 (KLK4)………………………………………………………………………………………..14

1.5 4 Kallikreins 5-15 (KLK5-KLK15)…………………………………………………………………………15

1.6 KALLIKREIN EXPRESSION AND REGULATION IN HDCS………………………………….16

1.6.1 KLK1 Expression and Hormonal Regulation…………………………………………………………..17

1.6.2 KLK2 and KLK3 Expression and Hormonal Regulation………………………………………….....20 1.6.2.1 Transcriptional Regulation of KLK2……….…………………………………………………………21

1.6.2.2 Transcriptional Regulation of KLK3…………………………………………………………………..24

1.6.3 Expression and Hormonal Regulation of KLK4……………………………………………….…27

1.6.4 Expression and Hormonal Regulation of the Additional Family Members, KLK1-15…………...28

1.7 PREVIOUS HONOURS WORK……………………………………………………………...……31

1.8 CONCLUSIONS AND RELEVANCE TO THE PROJECT……………………………………....32

1.8.1 Specific Aims……………………………………………………………………………………...33

CHAPTER 2

MATERIALS AND METHODS

2.1 INTRODUCTION…………………………………………………………………………….……35

2.2 GENERAL REAGENTS AND CHEMICALS……………………………………………….……35

2.3 TISSUE SAMPLES AND CELL LINES………………………………………………………..…35

2.4 CELL CULTURE……………………………………………………………………………..……36

vi

2.5 CELL COUNTING……………………………………………………………………………...….36

2.6 STEROID TREATMENTS………………………………………………………………………...36

2.7 DNA, RNA, NUCLEAR AND CYTOPLASMIC PROTEIN EXTRACTS…………………….…37

2.7.1 Total RNA Preparation………………………………………………………………………...…37

2.7.2 DNA Extraction……………………………………………………………………………...……38

2.7.3 Isolation of Soluble Protein………………………………………………………………...……..…38

2.8 BICINCHONINIC ACID (BCA) ASSAY………………………………………………………....39

2.9 PURIFICATION OF THE CLONTECH PROSTATE cDNA LIBRARY………………………...39

2.10 PREPARATION OF BACTERIAL ARTIFICIAL CHROMOSOME AND COSMID DNA…...40

2.11 REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION (RT-PCR)…………...…41

2.11.1 Reverse Transcription…………………………………………………………………………...41

2.11.2 The Polymerase Chain Reaction (PCR)……………………………………………………………41

2.12 ELECTROPHORESIS OF PCR AMPLICONS………………………………………………..…41

2.13 SOUTHERN BLOTTING ANALYSIS………………………………………………………...…42

2.13.1 Preparation of PCR Amplicons for Southern Blot Analysis…………………………………….42

2.13.2 3’-Digoxigenin-deoxyuraciltriphosphate Oligonucleotide Probe Labelling……………….……42

2.13.3 DNA Hybridisation…………………………………………………………………………...…43

2.14 ANTIBODY DESIGN FOR K4………………………………………………………………..…44

2.15 SODIUM DODECYL SULPHATE-POLYACRYLAMIDE GEL ELECTROPHORESIS …..…44 2.15.1 Western Blotting Analysis…………………………………………………………………….…44

2.16 TRANSCRIPTION INITIATION START SITE (TIS) MAPPING……………………………....45

2.16.1 Phosphorus 32 [γ32P]-ATP Labelled Primer Extension…………………………………...……45

2.16.2 Primer Extension 8% Sequencing Gel…………………………………………………………..46

2.16.3 5’-Carboxyfluorescein (CF)-Labelled Primer Extension……………………………………….47

2.16.4 5’RNA Ligated Mediated-Random Amplification of Complementary Ends…………………….47

2.16.4.1 Calf-Intestinal (CIP) De-Phosphorylation of Non-Capped RNA and Precipitation….………47

2.16.4.2 Tobacco Acid Pyrophosphatase (TAP) Treatment to Remove the 7-Methyl-Guanosine,

(m7G) 5’ CAP-Site from Capped RNA………………………………………………………...48

2.16.4.3 Ligation of the RNA 5’ RLM-RACE Adapter………………………………………………….48

2.16.4.4 Reverse Transcription of the CIP/TAP, RNA Adapter-Ligated RNA………………………….49

2.16.4.5 Polymerase Chain Reaction (PCR) from 5’ RLM-RACE cDNA……………………..………..49

2.17 CLONING…………………………………………….…………………………………………...49

2.17.1 PCR Amplicon Gel Excision and Purification…………………………………………………..49

2.17.2 Ligation of PCR Amplicons Into gGEM-T Easy Vectors…………………………………...….49

2.17.3 Transformation of gGEM-T Easy Vector Into JM109 High Efficiency E.coli Competent

Cells by Heat-Shock………………………………………………………..…………………….50

2.17.4 Plating of Transformation Culture Onto LB/Ampicillin/IPTG/X-Gal Plates……………...……50

2.17.5 Identification of Positive Colonies……………………………………………………………...50

2.17.6 Extraction of Plasmid DNA Containing Inserts from the Bacterial Cell Pellets……………..…51

vii

2.18 DNA SEQUENCING……………………………………………………….………………...…..51

2.19 GENE ANALYSIS……………………………………………………………………………..…51

2.19.1 Identification of Putative Regulatory Elements in the KLK4 Gene Promoter………………..…51

2.20 REPORTER GENE ASSAYS ON THE KLK4 PROMOTER…………………………………....52

2.20.1 Preparation of the pGL3-Basic Luciferase Reporter Vector for the Ligation of KLK4

Promoter Constructs…………………………………………………………………………………..….52

2.20.2 Ligation of KLK4 PCR Products Into pGL3-Basic Luciferase Reporter Vectors………………52

2.20.3 Transfection of KLK4 pGL3 Promoter Constructs into T47D Breast Cancer Cell Lines………53

2.20.4 Reporter Gene Assays…………………………………………………………………………...53

2.21 ELECTROMOBILITY SHIFT ASSAY (EMSA) AND SUPER SHIFT ASSAYS……………....54

2.21.1 Design of KLK4 DNA Constructs………………………………………………………..……...54

2.21.2 3’-Biotinylation of KLK4 DNA Constructs……………………………………………………...54

2.21.3 Electromobility Shift Assay (EMSA) Preparation………………………………………………….54

2.21.4 Preparation of a 6% EMSA Gel ………………………………………………………………...55

2.21.5 Electrophoresis and Transfer of EMSA Products…………………………………………….…55

2.21.6 Detection of EMSA Products by Chemiluminescence…………………………………………...55

2.21.7 Super Shift Assay……………………………………………………………………….………..56

2.22 CHROMATIN IMMUNOPRECIPITATION (CHIP) ASSAY………………………………..….56

CHAPTER 3.

THE HORMONAL REGULATION OF KALLIKREINS 1-4 (KLK1-4), IN

HORMONE-DEPENDENT CANCER CELL LINES OF THE ENDOMETRIUM AND BREAST

3.1 INTRODUCTION……………………………………………………………………………….…59

3.2 MATERIALS AND METHODS…………………………………………………………………...61

3.2.1 Cell Culture and Steroid Treatments………………………………………………...………...…61

3.2.2 RNA Extractions………………………………………………………………………………..…61

3.2.3 Protein Extractions and Concentrations………………………………………………….……....61

3.2.4 Reverse Transcription-Polymerase Chain Reaction (RT-PCR)………………………...……...…61

3.2.5 Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis (SDS-PAGE) and Western Blot

Analysis…………………………………………………………………………………………...62

3.2.6 Quantitative Image Analysis…………………………………………………………………...…62

3.3 RESULTS…………………………………………………………………………………………..64

3.3.1 KLK1-4 Expression in Endometrial and Other HDCs……………………………………………..64

3.3.2 KLK1/K1 Regulation by Estradiol and Progesterone in the HEC1A and KLE Cell Lines………66

3.3.3 Western Analysis of the hK1 Protein Levels in the HEC1A and KLE Cell Line Treated With

Estrogen, Progesterone, and the Combination of Both Over 24 Hours…………………………68

3.3.4 Western Analysis of hK4 in Endometrial Cancer Cell Lines………………………….……...…..71

3.3.5 Regulation of hK4 by Estradiol and Progesterone in HEC1A/B and KLE Cells………………...71

3.3.6 Up Regulation of KLK4/hK4 at the RT-PCR and Protein Level By Progesterone in the Breast

Cancer Cell Line, T47D……………………………………………..….…………………………74

viii

3.3.7 The hK4 Protein Is Down-Regulated By the Anti-Progesterone Antagonist RU486 In the

Breast Cancer cell Line, T47D……………………………………………………………………....76

3.4 DISCUSSION……………………………………………………………………………………....78

3.5 CONCLUSIONS……………………………………………………………………………………82

CHAPTER 4

MAPPING THE TRANSCRIPTION INITIATION SITE (TIS) AND THE IDENTIFICATION

OF PROMOTER-SPECIFIC REGULATORY MOTIFS IN THE KALLIKREIN 4 (KLK4)

GENE

4.1 INTRODUCTION …………………………………………………………………………………84

4.2 MATERIALS AND METHODS………………………………………………………………...…89

4.2.1 Cell Culture of T47D and LNCaP Cell Lines………………………………………………….…89

4.2.2 RNA Extraction…………………………………………………………………..………….……89

4.2.3 Purification of, and Screening the Prostate Library………………………………….……...……89

4.2.4 Primer Design for Each Assay………………………………………………..……………..……89

4.2.5 Phosphorus 32 [γ32P]-ATP Labelled Primer Extension………………………………………….92

4.2.6 Carboxy Fluorescein (CF)-Labelled Primer Extension…………………………………………..92

4.2.7 Southern Hybridisation……………………………………………………...……………………92

4.2.8 RNA Ligase Mediated-Random Amplification of cDNA Ends (RLM-RACE)…………………….92

4.2.9 Identification of Putative Progesterone Response Elements………………………………………….93

4.3 RESULTS…………………………………………………………………..……………………....95

4.3.1 Prostate Library Screening…………………………………………………………………….…95

4.3.2 Primer Extension Using A [γ32P]-ATP-Labelled KLK4 Oligomer Probe……………………….95

4.3.3 CF-Labelled KLK4 Primer Extension in T47D Cells…………………………………………….95

4.3.4 5’-RLM-RACE for the TIS in T47D and LNCaP RNA…………………………………………....97

4.3.4.1 Optimisation of the 5’-RLM-RACE……………………………………………………………..97

4.3.5 Identification of the KLK4 Promoter Region and Potential Regulatory Motifs………………...103

4.4 DISCUSSION…………………………………………………………………………….…….…109

4.5 CONCLUSIONS…………………………………………………………………………………..115

CHAPTER 5

INTERROGATION OF THE PROXIMAL PROMOTER REGION OF THE KLK4

PROMOTER FOR BASAL ACTIVITY

5.1 INTRODUCTION………………………………………………………………………………...117

5.2 MATERIALS AND METHODS………………………………………………………………….121

5.2.1 Design of Promoter Constructs………………………………………………………………….121

5.2.2 Preparation of Bacterial Artificial Chromosome and COSMID DNA………………………….121

5.2.3 Polymerase Chain Reaction (PCR) of the KLK4 Promoter……………………………………..121 5.2.4 Cloning PCR Amplicons into pGEM-T Easy and pGL3-basic Luciferase Vector……….……...122

ix

5.2.5 Transfection of KLK4 Constructs into T47D Breast Cancer Cell Lines and the Analysis of

Luciferase Activity………………………………….………………………………………....…122

5.3 RESULTS……………………………………………………………………………………...….124

5.3.1 Identification of Restriction Sites for the Cloning of KLK4 Constructs into pGL3-basic

Luciferase Vector………………………………………………………………………...……………124

5.3.2 PCR of KLK4 Constructs from BAC and COSMID DNA……………………………………….124

5.3.3 Cloning of KLK4 Promoter Constructs into pGEM-T Easy Vector and pGL3-Basic

Luciferase Reporter Vector………………………………………………………..……………....124

5.3.4 Sequence Analysis of K4 pGL3 Luciferase Constructs………………………………………….127

5.3.5 Analysis of K4898 and K4446 Promoter Constructs……………………………………………127

5.3.6 Identification of Putative Progesterone Response Elements (PREs)…………………………....133

5.4 DISCUSSION……………………………………………………………………………………..136

5.5 CONCLUSIONS…………………………………………………………………………………..141

CHAPTER 6

THE PROGESTERONE RECEPTOR (PR), COMPLEXES IN VITRO, AND IS RECRUITED

IN “REAL-TIME”, TO A PROGESTERONE-RESPONSIVE REGION IN THE KLK4

PROMOTER IN THE BREAST CANCER CELL LINE, T47D

6.1 INTRODUCTION………………………………………………………………………………...143

6.2 MATERIALS AND METHODS………………………………………………………………….150

6.2.1 T47D Cell Culture……………………………………………………………………………….150

6.2.2 Extraction of Nuclear and Cytosolic Extracts from the Breast Cancer Cell Line, T47D……….150

6.2.3 Design and Biotinylation of the Synthetic Progesterone Response Element (PRE) and

Variant Forms from the KLK4 PRE Identified in Chapter 5……………………………………150

6.2.4 Electromobility Shift Assay (EMSA) to Determine the Binding Capacity of the PRE Element

and the Variant Forms…………………………………………………………………………..152

6.2.5 Super Shift Assay with a Progesterone and Androgen Receptor Antibody to Determine

Specific Binding Receptors………………………………………………………………………151

6.2.6 The Chromatin Immunoprecipitation Assay (ChIP)…………………………………………….151

6.2.7 DNA Extraction from T47D Cell Lines…………………………………………………….……153

6.2.8 Oligonucleotide Primers for the ChIP Assay………………………………………………………….153

6.2.9 Polymerase Chain Reaction (PCR) for the ChIP Assay………………………………………...153

6.3 RESULTS……………………………………………………………………...………………….155

6.3.1 The KLK4 PRE Binds Factors from the T47D Nuclear Extract……………………...…………155

6.3.2 The KLK4 PRE Binds Factors from the T47D Nuclear Extract that Appear to be

Progesterone Regulated……………………………..…………………………………………..160

6.3.3 Factors from the T47D Nuclear Extract Bind Distinct Regions on the KLK4 PRE……..……...160

6.3.4 The Progesterone Receptor (PR) Binds to the KLK4 PRE……………………………….……..164

6.3.5 The Progesterone Receptor (PR) Is Recruited and Assembled In “Real-Time”, In Vivo, to the

KLK4 Progesterone-Responsive Region………………………………………………………....169

x

6.4 DISCUSSION………………………………………………………………………………..……173

6.5 CONCLUSIONS…………………………………………………………………………………..181

CHAPTER 7

GENERAL DISCUSSION AND FINAL CONCLUSIONS

7.1 INTRODUCTION………………………………………………………………………………...183

7.2 EXPRESSION AND REGULATION OF KLK1/KLK4………………………………………….184

7.3 THE SIGNIFICANCE OF KLK4/hK4 EXPRESSION AND REGULATION BY

PROGESTERONE IN THE BREAST CANCER CELL LINE, T47…………………………….185

7.4 MAPPING THE KLK4 TIS AND THE 5’ FLANKING REGULATORY REGIONS………..…187

7.5 BASAL ACTIVITY OF THE KLK4 PROXIMAL PROMOTER……………………………..…190

7.6 THE PROGESTERONE REGULATED RECRUITMENT OF THE PROGESTERONE

RECEPTOR TO A NOVEL PROGESTERONE RESPONSE ELEMENT IN THE 5’

FLANKING REGION OF THE KLK4 GENE………………………………………..…………..191

7.7 FINAL CONCLUSIONS…………………………………………………………………..……...195

7.8 SUMMARY…………………………………………………………………………………...…..197

CHAPTER 8

REFERENCES………………………………………………………………………………..……..199

xi

LIST OF FIGURES Figure 1.1. Steroid Receptor Response Mechanism

Figure 1.2. Schematic Diagram of the KLK Gene Locus

Figure 1.3. Typical Structural Organisation of the Human Kallikrein Gene

Figure 1.4. 5’ Promoter and “up-stream” Regions of KLKs1-3 and Various Regulatory Motifs

Figure 1.5. Schematic Diagram of KLK2 and KLK3 Constructs

Figure 3.1. Expression of KLK1-4 in Endometrial Cancer Cell Lines and other HDCs

Figure 3.2. Semi-Quantitative RT-PCR For KLK1 In the Endometrial Cancer Cell Line, HEC1A

Figure 3.3. Western Blot Analysis of Human K1 in HEC1A and KLE Cell Lines Treated With

Estrogen, Progesterone and a Combination of Both For 24 Hours

Figure 3.4. Western Blot Analysis of hK4 in Endometrial Cancer Cell Lines.

Figure 3.5. Regulation of hK4 By Estrogen, Progesterone, and a Combination of Both, in the

Endometrial Cancer Cell Lines, HEC1A, HEC1B and KLE

Figure 3.6. KLK4/hK4 Regulation By Progesterone in the Breast Cancer Cell Line, T47D

Figure 3.7. Inhibitory Analysis of hK4 by RU486 in the Breast Cancer Cell Line, T47D

Figure 4.1. Schematic Diagram of the General Transcriptional Machinery Complex and Interacting

Promoter and Enhancer Regions

Figure 4.2. Schematic Diagram of the Genomic Structure of the KLK4 Gene Indicating the Two

Transcription Initiation Sites (TIS)

Figure 4.3. Schematic Diagram of the KLK4 Gene Structure and Position of Primers Used to Map the

TIS

Figure 4.4. Schematic Diagram of the 5’ RNA Ligated Mediated-Random Amplification of

Complementary Ends (RLM-RACE)

Figure 4.5. [γ32P]-ATP-Labelled Primer extension for the KLK4 TIS in the Prostate Cancer Cell Line,

LNCaP

Figure 4.6. CF-Labelled Primer Extension for the KLK4 TIS in the Breast Cancer Cell Line, T47D

Figure 4.7. Optimisation of the 5’-RLM-RACE Procedure

Figure 4.8. 5’-RLM-RACE to Identify the KLK4 TIS in the Prostate Cancer Cell Line, LNCaP

Figure 4.9. 5’-RLM-RACE to Identify the KLK4 TIS in the Breast Cancer Cell Line, T47D

Figure 4.10. Sequence Data Representing the TIS from the 5’-RLM-RACE Experiment for the KLK4

Gene in the Prostate (LNCaP) and Breast (T47D) Cancer Cell Lines

Figure 4.11. 5 Kb Sequence Alignment of KLK2-4 5’-“Up-Stream” Regions

Figure 4.12. Sequence of Part of the KLK4 5’-Flanking Genomic DNA Showing Positions of the

Putative SP1 Sites, TIS, and ATG Sites for Translation

Figure 4.13. Cister Scan and Plot of Potential Cis-Acting Motifs in Approximately 3 kb of KLK4 5’-

Flanking Genomic Sequence

Figure 5.1. KLK4 Promoter Sequence Analysed for the Design of KLK4 Promoter Constructs

Figure 5.2. Schematic Diagram of the pGL3-Basic Luciferase Vector

Figure 5.3. PCR, Cloning and Purification of KLK4 Constructs

Figure 5.4. Sequence Analysis of KLK4 Constructs

xii

Figure 5.5. Luciferase Activity of the K41781 Constructs Transfected into T47D Lines

Figure 5.6. Sequence Analysis of KLK4 Promoter and “Up-Stream” Regions for PREs

Figure 6.1. Typical Schematic Diagram of the KLK4 Gene and the Relative Position of the Identified

Progesterone Response Element, PRE

Figure 6.2. Schematic Diagram Representing the Electromobilty Shift Assay (EMSA)

Figure 6.3. Schematic diagram of the Chromatin ImmunoPrecipitation Assay (ChIP)

Figure 6.4. Electromobility Shift Assay (EMSA) for the Identification of Nuclear Extract Protein

Interactions with the PRE0 Element and Variant Forms

Figure 6.5. Titration Assay for Probe Concentration and EMSA With the PRE0 (wild-type) and PRE 9-

11 Variants

Figure 6.6. Progesterone-Regulated Binding on the PRE0 in T47D Nuclear Extracts

Figure 6.7. Electromobility Shift Assay On Variant Forms of PRE0 With Nuclear Extracts From

Progesterone-Treated T47D Cell Lines

Figure 6.8. EMSA and SuperShift Assay for the Binding of the PR to the PRE0

Figure 6.9. Electromobility Shift Assay and SuperShift Assay Using Both Progesterone and Androgen

Receptor (PR and AR, respectively) Antibodies

Figure 6.10. Electromobility Shift Assay (EMSA) and Super Shift Assay With Progesterone and

Androgen Receptor (PR and AR, respectively) Antibodies and PRE Variants 1-4

Figure 6.11. Chromatin Immunoprecipitation Assay (ChIP) for the Recruitment of the Progesterone

Receptor (PR) to the Native KLK4 Chromatin

Figure 6.12. Schematic Representing the Binding of the PR and an Unknown Factor to the PRE0

xiii

LIST OF TABLES Table 1.1. Location, Position and Function of the Regulatory Elements Within the KLK1-3 Promoter

Regions

Table 1.2. Consensus and Non-Consensus Androgen Response Elements (AREs)

Table 3.1 Primers, Annealing Temperatures and Product Sizes for the RT-PCR of KLK1- KLK4 and

B2-Microglobulin

Table 3.2. Expression Patterns of the Kallikrein Gene Family (KLK1-4) in T47D, HEC1A, Ishikawa

and KLE Cell Lines Obtained by RT-PCR analysis

Table 4.1. Assay Type, Primer and Primer Sequence for Mapping the KLK4 TIS

Table 6.1. Nomenclature and Sequence of each Progesterone Response Element Construct (PRE)

Table 6.2. Sequence, Position and Size of Each Primer Pair Designed for the ChIP Analysis

Table 6.3. ARE Sequences Within KLK3 and KLK2 Genes and Homology With KLK4 PRE

xiv

LIST OF ABBREVIATIONS ARE androgen response element

BCA bicinchoninic acid

bp base pairs

°C degrees Celsius

CAPS 3-[Cyclohexylamino]-1-propane-sulfonic acid

cDNA complementary DNA

CE cytoplasmic extracts

ChIP chromatin immunoprecipitation

cm centimetres

DMEM dulbecco’s modified eagle’s medium

DNA deoxyriboucleic acid

EDTA ethylene diamine tetra acetate

EMSA electromobility shift assay

ERE estrogen response element

FCS fetal calf serum

fmol femtomole

HRE hormone response element

K kallikrein protein

Kb kilobase

KDa kilodaltons

KLK kallikrein gene

L litres

LB Luria Bertani

min minute

mg milligrams

ml millilitres

nmol nanomole

mol moles

mol/L moles per litre

mRNA messenger ribonucleic acid

NaCl sodium chloride

NaOH sodium hydroxide

NE nuclear extracts

ng nanograms

OD optical density

PAGE polyacrylamide gel electrophoresis

PBS phosphate buffered saline

PRE progesterone response element

xv

RLM-RACE RNA ligase mediated-random amplification of complementary ends

RNA ribonucleic acid

rpm rotations per minute

RT room temperature

RT-PCR reverse transcription-polymerase chain reaction

sec seconds

SDS sodium dodecyl sulphate

TAP tobacco acid pyrophosphatase

TIS transcription initiation site

U unit

µg micrograms

µl microliters

UTR untranslated region

UV ultra-violet

xvi

STATEMENT OF ORIGINAL AUTHORSHIP

The work contained in this thesis has not been previously submitted for a degree or a

diploma at any other higher education institute. To the best of my knowledge and

belief, the thesis contains no material previously published or written by another

person except where due reference is made.

Signed:

Stephen Anthony Myers

B. App. Sci. (Hons).

xvii

PAPERS PUBLISHED DURING MY PhD OR IN

PREPARATION 1. Outcomes from Honours project and aspects of work presented in Chapter

Three.

Stephen A Myers and Judith A Clements. (2001). Kallikrein 4 (KLK4), A New

Member of the Human Kallikrein Gene Family Is Upregulated By Estrogen and

Progesterone in the Human Endometrial Cancer Cell Line, KLE. The Journal of

Clinical Endocrinology and Metabolism. 86:2323-2326.

2. Work to which I contributed data.

I performed the analysis in Figure 6 of this paper. The KLK1-4 panels from Figure 6

also form part of the data presented in Chapter 3.

Harvey, T.J., Hooper, J.D., Myers, S.A., Stephenson, S., Ashworth, L.K and

Clements, J.A. (2000). Tissue-specific expression patterns and fine mapping of the

human kallikrein (KLK) locus on proximal 19q13.4. The Journal of Biological

Chemistry, 275: 37397-373406.

3. Work to which I contributed data that was unrelated to this PhD thesis.

I performed some of the sequence analysis in Figure 1A of this paper.

John D. Hooper, Loan T. Bui, Fiona K. Rae, Tracey J. Harvey, Stephen A. Myers,

Linda K. Ashworth, and Judith A. Clements. (2000). Identification and

Characterization of KLK14, a Novel Kallikrein Serine Protease Gene Located on

Human Chromosome 19q13.4 and Expressed in Prostate and skeletal Muscle.

Genomics. 73:117-122.

4. Manuscript in preparation.

Work performed in Chapters 3-6.

Myers. S.A., Odorico. D.M., and Clements. J.A. Characterization of the Human

Kallikrein 4 (KLK4) Promoter and the Identification of a Unique Progesterone

Response Element (PRE) that Recruits the Progesterone Receptor in vivo, in the

Breast Cancer Cell Line, T47D. For submission to The Journal of Biological

Chemistry.

xviii

ACKNOWLEDGEMENTS I wish to sincerely thank my supervisors Professor Judith Clements and Dr. Dimitri

Odorico for their ongoing support throughout my PhD. I would also like to extend

my gratitude to current members of the Science Research Centre, Dr. John Hooper

and Dr. Jon Harris, and to past members, Dr. Fiona Rae and Dr. Tracey Harvey for

their support and stimulating conversations.

I would also like to thank the support staff for all their help with general consumables,

ordering of stock and reagents etc. I would also like to extend my thanks to all

members of the Science Research Centre for making my time here at QUT an

enjoyable one.

This project would not have been possible without the “Dora Lush” National Health

and Medical Research Council (NH&MRC) postgraduate scholarship award.

This thesis is dedicated to my life-long partner Sue Read for her continual support and

guidance.

CHAPTER 1

INTRODUCTION AND LITERATURE REVIEW

2

1.1. INTRODUCTION

Hormone-dependent cancers (HDCs), such as those of the prostate, ovary, breast and

endometrium, share characteristics that indicate similar underlying mechanisms of

carcinogenesis. By means of steroid hormone receptor (SHR) signalling, many

“down-stream” target genes are activated and subsequently involved in promoting

effects such as cell division, differentiation, proliferation and invasion (reviewed in

Henderson and Feigelson, 2000). A number of anti-steroid therapies, such as the anti-

estrogen, tamoxifen, or the anti-androgen, biclutamide, have been used successfully to

slow the growth of estrogen and androgen responsive tumours of the breast and

prostate, respectively (Manni, 1987; Blackledge et al., 1997; Berstein et al., 2003;

Crivellari et al., 2003). However, such treatments are not successful when the cancers

become hormone unresponsive (Arnold and Isaacs, 2002; Navarro et al., 2002). Thus,

a clearer understanding is needed of the mechanisms involved in the regulation of

“down-stream” target genes that are implicated in aspects of tumour cell proliferation,

differentiation, migration and invasion in HDCs.

The human KLK family are thought to play a role in tumourigenesis due to their high

expression profiles in HDCs, their regulation by the steroid hormones androgens,

estrogen and progesterone (reviewed in Diamandis et al., 2000a) and their processing

abilities that have been associated with tumour progression (Desrivieres et al., 1993;

Kumar et al., 1997; Clements et al., 2000). Additionally, both hK2* and hK3

(prostate-specific antigen or PSA) are useful diagnostic/prognostic markers for

prostate cancer. PSA is the current serum marker and hK2 is suggested to be a useful

adjunct marker, although not yet in routine clinical use (reviewed in Rittenhouse et

al., 1998; Yu et al., 1999; Magklara et al., 2002; Scoralis et al., 2003). Furthermore,

other studies have suggested that KLKs4-10 are unfavourable prognostic markers for

ovarian cancer (reviewed in Yousef and Diamandis, 2003). For most KLKs, the

precise regulatory events and “down-stream” pathways that lead to KLK involvement

in tumour progression are yet to be established. Furthermore, detailed studies of

steroid hormone action at the transcriptional level for the newer KLKs (KLKs4-15)

have yet to be performed.

* Approved nomenclature for the kallikrein gene family (Diamandis et al., 2000b). KLK will be used for the gene, while hK designates the protein. This nomenclature will be used throughout this thesis.

3

The two most studied KLKs at the transcriptional level are KLK2 and KLK3. Both of

these genes are activated through well-defined androgen response elements (AREs) in

the promoter and far “up-stream” enhancers 5’ of the gene coding regions (Riegman

et al, 1991; Murtha et al, 1993; Luke and Coffey, 1994; Cleutjens et al, 1996, 1997;

Schuur et al, 1996; Pang et al, 1997; Sato et al, 1997; Sun et al, 1997; Zhang et al,

1997; Brookes et al, 1998; Yu et al, 1999; Mitchell et al, 2000; Yeung et al, 2000).

The identification of the precise mechanisms underlying androgen receptor (AR)

recruitment to AREs in the promoter and far “up-stream” enhancer of KLK3, enabled

researchers to study in detail the mechanisms of AR interaction on androgen-

responsive genes, such as PSA (Shang et al., 2002). Anti-androgens block the action

of the AR on AREs in the KLK3 promoter (Kang et al., 2002; Shang et al., 2002).

This has provided a system to study KLK3 gene regulation, consensus AREs, and the

effects of anti-androgens on prostate cancer. Although there have been numerous

studies at the transcriptional level for KLK2 and KLK3, our knowledge of the

mechanisms underlying the transcriptional regulation of the other family members is

limited.

Thus, in the following sections, I will briefly overview some common aspects of

HDCs, introduce the human tissue kallikrein gene family, and review the existing

knowledge of the human kallikrein gene family in terms of their tissue-specific

expression and function. More comprehensively, I will outline the existing

information on KLK regulation by the steroid hormones estrogen, progesterone and

androgens both at the transcriptional and post-transcriptional levels.

1.2. HORMONE-DEPENDENT CANCERS (HDCs) AND HORMONE ACTION

Hormone-dependent cancers (HDCs) represent a class of solid tumours that share

similarities in their responsiveness to hormones. In particular, the steroid hormones,

predominantly androgens, estrogens, and progesterone, regulate the proliferation,

differentiation, and development of cancers of the prostate, ovary, breast and

endometrium (Clark and Sutherland, 1990; Poulin et al., 1991; Arnold and Isaacs,

2002; Liao and Dickson, 2002). It is through specific steroid-responsive target genes

that these processes occur, and therefore, it is important to identify the regulatory

motifs of these target genes as well as understand the actions of the steroid hormone

4

receptor complexes that bind these regions to fully understand the mechanisms of

hormone-dependent tumourigenesis.

In the last 30 years, there has been a dramatic improvement in the treatment of HDCs

of the breast, ovary, uterus and prostate (Green and Furr, 1999). The development of

the anti-estrogen, tamoxifen (Nolvadex) spearheaded an array of drugs that counter-

act the proliferative effects of the male and female steroid hormones. Many recent

studies in the context of steroid receptor/co-activator or co-repressor assembly on the

promoters of these steroid receptor target genes are revealing a number of surprises in

terms of the specificity or selectivity of these anti-steroid drugs (Liu et al., 2001,

2002a; Shang et al., 2000). In one tissue type the drug may act as an antagonist, while

in another tissue, an agonist. Tamoxifen is probably the classic example of this kind

of specificity or selectivity. While, tamoxifen functions as an estrogen receptor (ER)

antagonist in breast cancer cells such as MCF-7, in other tissues, such as bone, and on

certain promoters, tamoxifen act as a partial agonist (Green and Furr, 1999; Shang et

al, 2000). Furthermore, long-term treatment with tamoxifen paradoxically stimulates

breast tumour development in model systems and patients (Ali and Coombes, 2002).

Earlier studies in breast cancer using the anti-progesterone, mifepristone (RU486),

inhibited the growth of breast cancer cell lines in vitro suggesting a direct role for the

progesterone receptor (PR) in the modulation of “down-steam” target genes that are

involved in the development of this cancer (Bardon et al., 1985). Additionally, in

vivo studies with estrogen-primed breast cancer cell (MCF-7) xenografts in nude mice

have established that monotherapy with tamoxifen or RU486 reduces tumour growth

(El Etreby and Liang, 1998). Other studies have successfully used anti-androgen

therapies to reduce the growth and development of prostate cancer in men (Furr,

1996; Schellhammer et al., 1997).

1.2.1. Hormone Action In Hormone-Dependent Cancers (HDCs)

The steroid/thyroid hormone receptors are a family of nuclear ligand activated

transcription factors that include the receptors for progesterone (PR), androgen (AR),

estrogen (ER), glucocorticoids (GR) and mineralocorticoids (MR) and receptors for

thyroid hormone, retinoids and vitamin D (reviewed in Weigel, 1996). There are also

a number of steroid receptor isoforms, such as the progesterone receptor A and B

5

(PRA and PRB), estrogen receptor alpha and beta (ERα and ERβ) and androgen

receptor A and B (ARA and ARB) and although PRA/PRB and ARA/ARB are

alternative spliced forms, ERα and ERβ are two distinct gene products (McGowan

and Clarke, 1999; Oehler et al., 2000; Tilley et al., 2003). Studies have shown that

both PR and ER isoforms are involved in a complex interplay of cross-talk with each

other and other factors that selectively modulate target gene transcription (Kastner et

al., 1990; Vegeto et al., 1993; Graham and Clarke, 1997; Oehler et al., 2000), and are

beyond the scope of this review.

The steroid regulation and expression of a specific target gene(s) is a complex

process. For example, the mechanism by which progesterone manifests biological

activity in target tissues is similar to that of the other members of the steroid hormone

receptor superfamily (McDonnell, 1995). The biological actions of progesterone are

mediated through the gene products of PRA and PRB where both of these receptors

are transcribed from a single gene by alternative promoter usage (Giangrande et al.,

1997). The principal steroid, progesterone, is thought to predominately mediate its

biological effects via binding to PR. Upon binding progesterone, the PR undergoes a

conformational change resulting in its dissociation from heat shock proteins,

translocation to the nucleus, dimerisation, and assembly onto progesterone response

elements (PREs) in progesterone-responsive target genes (Figure 1.1). When bound to

the PRE, the receptor can modulate target gene expression by the recruitment of

specific components of the transcriptional machinery.

The analysis of a large number of naturally occurring hormone response elements

(HREs), such as PREs, as well as synthetic substrates has revealed that a sequence of

six base pairs constitutes the core recognition motif orientated as inverted or direct

sequence repeats and separated by a variable number of spacing nucleotides (Zhou et

al., 1997). However, a number of studies have confirmed the binding of these steroid

receptors (such as PR) to non-classical HREs (Kepa et al., 1996; Nelson et al.,

1999b), and thus, these differences in sequence most likely provide preferential

binding and tissue specific regulation. Previous studies have identified that the

consensus sequence for a number of steroid receptors, such as androgen,

6

Figure 1.1. Steroid Receptor Response Mechanism of the Progesterone Receptor Binding to a

Progesterone Response Element. The steroid hormone progesterone is a lipophilic molecule that can

pass through the cell membrane where it binds to the progesterone receptor (PR) that is associated with

heat shock proteins (HSPs). Upon binding ligand, the PR dissociates from the HSPs and the active PR

dimerises on PR-specific progesterone response elements (PRE) located on progesterone-responsive

genes. This binding event than elicits transcription of progesterone-specific target genes.

7

glucocorticoid and progesterone receptors (AR, GR and PR, respectively)

preferentially recognises this sequence motif AGAACA (Aranda and Pascual, 2001).

Many studies at the transcriptional level are aimed at identifying the presence of cell-

specific proteins capable of interacting with steroid receptors and modulating the

transcriptional response of target genes. Co-activators such as the steroid receptor co-

activator (SRC-1), and others, bind to agonist-bound receptor ligand binding domains

(LBDs) to aid in bridging the receptor and the transcriptional machinery required for

transcription (Liu et al., 2001, 2002a). Co-repressors such as nuclear receptor co-

repressor (NcoR) and co-repressor silencing mediator for retinoid and thyroid

hormone receptor (SMRT) bind to the hinge region of nuclear receptors and prevent

co-activators binding to the LBD regions and thus, repress transcription (McDonnell

et al., 1995; Liu et al., 2002a). These kinds of studies are too numerous to report on,

however, it is clear that a detailed analysis of the transcriptional regulation of steroid-

induced target genes is now providing an insight into the molecular biology of

potential drug targets for their use in cancer-based therapeutics. These studies

emphasise the importance of understanding the intricacies of the subsequent steroid

receptor/DNA binding specificity on “down-stream” target genes that are implicated

in tumour growth and development.

Numerous studies have identified that steroids such as estrogen, progesterone and

androgens are implicated in the “down-stream” expression of genes involved in

tumourigenesis. For example, estrogens were shown to activate cyclin E-cdk2

complexes in the breast cancer cell line, MCF-7 (Planas-Silva and Weinberg, 1997)

and it was suggested that this response plays a major role in driving epithelial cell

proliferation. Studies by Moore et al. (1997) identified increased levels of c-myc

mRNA in T47D cells when exposed to the synthetic progestin, R5020. These authors

suggested that increased levels of c-myc by progestin are implicated in breast cancer

proliferation. Additionally, androgens have been shown to regulate the keratinocyte

growth factor (KGF) that is involved in prostate cancer development (Trapman and

Cleutjens, 1997).

As noted earlier, many of these steroid-specific gene responses are mediated through

sequence-specific motifs called hormone response elements (HREs) that occur in the

8

5’ flanking regions “up-stream” of the transcription initiation site (TIS). A number of

HREs for the steroid receptors such as the androgen, progesterone, estrogen and

glucocorticoid response elements (ARE, PRE, ERE and GRE, respectively) share

similar sequence motifs (Massaad et al., 2000). In vitro transcription studies have

confirmed that these response elements are not receptor-specific. In many target

genes, the binding site of steroid receptor to these HREs can deviate significantly

from the consensus sequence (Cleutjens et al., 1996). This may perhaps explain why

different steroids have diverse effects in different cell types.

In addition to the many genes that are regulated by steroid hormones and implicated

in HDCs, the tissue kallikreins (KLKs) are another family of steroid hormone

regulated genes highly expressed in HDCs and implicated in the progression of

tumourigenesis (reviewed in Yousef and Diamandis, 2003). However, apart from

KLK2 and KLK3 in prostate cancer, little is known of the mechanisms underlying

their hormonal regulation.

1.3. THE TISSUE KALLIKREINS: - GENERAL INTRODUCTION

The tissue kallikreins (KLKs) are a multi-gene family of serine proteases involved in

the post-translational processing of many polypeptide precursors to their biologically

active or inactive forms; a function that underlies, and is central to, a number of

biological events (Bhoola et al., 1992; Clements, 1998; Rittenhouse et al., 1998;

Harvey et al., 2000). The KLKs have been identified in a number of species such as

the rodent, dog, fish, monkey and humans (reviewed in Bhoola, 1992; Clements,

1998) and are highly conserved within the mouse, rat and human families (Clements

et al., 2000; Yousef and Diamandis, 2000a). In rodents, the kallikreins encompass a

large family of genes comprising of thirteen and twenty-four kallikreins in the rat and

mouse respectively (Evans et al., 1987; MacDonald et al., 1996). More recently, the

mouse kallikrein gene locus has been extended to 25 genes (Olsson and Lundwall,

2002). This group of genes are clearly the orthologs of the recently described human

KLK4-15 genes (see below).

At the outset of this PhD thesis, the human KLK gene family consisted of only four

genes (KLK1-4), however, the gene family locus was eventually expanded and now

consists of fifteen genes, KLK1-15 (Yousef et al., 1999a, 2000a; Gan et al., 2000;

9

Harvey et al., 2000). Given that a number of these newer kallikreins (KLK4-15) share

less sequence homology between each other and between the original kallikreins

(KLK1-3), suggests an evolutionary divergence of this gene family (Harvey et al,

2000). As a result, the human KLK gene family may consist of at least two to four

groups, those that have remained closely linked and homologous (KLK1-3), and those

that have diverged during evolution (Murray et al, 1992; Harvey et al, 2000).

Additionally, many of the KLKs share tissue-specific expression. For example,

KLK2-4 are highly expressed in the prostate while KLK6-13 are expressed at high

levels in the pancreas (Harvey et al., 2000). These data may suggest evolutionary

conservation of cis-acting, tissue-specific promoter elements conferring tissue

specificity of expression and possibly other regulatory elements (for an excellent

review on tissue-specific promoters see Harrington et al., 2000). In fact, KLK2 and

KLK3 share high conservation throughout their coding exons and their 5’ genomic

flanking regions (Gan et al., 2000). In addition, both of these genes are similarly

regulated by androgens at the transcriptional level through similarly located androgen

response elements (AREs) in prostate cancer cell lines (Riegman et al, 1991; Murtha

et al., 1993; Luke and Coffey, 1994; Cleutjens et al., 1996, 1997; Schuur et al., 1996;

Pang et al., 1997; Sato et al., 1997; Sun et al., 1997; Zhang et al., 1997; Brookes et al.,

1998; Yu et al., 1999; Mitchell et al., 2000; Yeung et al., 2000). Moreover, the newer

KLKs, which appear to have diverged further in sequence, but still retain some

restricted expression patterns, appear to be similarly regulated. Therefore, perhaps

some of the regulatory regions in the promoters of these newer KLKs are also

conserved.

1.4. THE STRUCTURAL ORGANISATION OF THE TISSUE KALLIKREIN

GENE FAMILY

The human KLK gene family (hKLK1-15) is clustered within 300 kilobases (Kb) on

the long arm of chromosome 19q proximal 13.4 (Figure. 1.2) (Riegman et al., 1992;

Gan et al, 2000; Harvey et al, 2000; Yousef et al, 2000a). Five pseudogenes have

been identified: three between KLK2 and KLK4, and two upstream of KLK2 and

KLK3 (Stephenson et al, 1999; Gan et al., 2000). These pseudogenes lack introns and

include only part of the serine protease coding regions.

10

Figure 1.2. Schematic Diagram of the KLK Locus. Schematic of chromosome 19q proximal 13.3-

13.4 locus showing the positions of the KLK1-15 genes within the KLK gene family. Arrows represent

the direction of transcription of each gene. The boxed panel at the right shows the distance in base pairs

(bp) between each of the KLK genes (below the dotted lines and in bold font), while the size of each

KLK gene (bp) is indicated directly above each KLK gene.

KLK 1 ↑ KLK15 ↑ KLK3 ↓ KLK2 ↓ KLK4 ↑ KLK5 ↑ KLK6 ↑ KLK7 ↑ KLK8 ↑ KLK9 ↑ KLK10 ↑ KLK11 ↑ KLK12 ↑ KLK13 ↑ KLK14 ↑

19q13.3-.4

4640 6206 5846 5790 4405 9470 10483 6509 KLK1----KLK15----KLK3----KLK2----KLK4----KLK5----KLK6----KLK7---- 1501 23299 13319 26730 32568 5860 6333 12127 5674 7122 5427 5310 5801 8905 6349 KLK8----KLK9----KLK10----KLK11----KLK12----KLK13----KLK14 2145 4535 3435 1568 21315 12897 Telomere

11

Information generated by Yousef et al., (2000a) established that the gene telomeric to

KLK14 is an unrelated Siglec gene that encodes a putative leptin-binding protein

(Foussias et al., 2000). At the centromeric end, the next gene after KLK1 is also an

unrelated testicular acid phosphatase (ACPT) gene that denotes the end of the KLK

family (Yousef et al., 2001a). Based on data generated using a degenerate

oligonucleotide probe to the histidine-encoding region of the serine proteases, Harvey

et al. (2000), could show that no other serine proteases existed approximately 400 Kb

centromeric and 220 Kb telomeric of the extended locus and it is therefore likely that

the entire human KLK locus has been mapped.

The human KLK1-15 genes range in size from 4-10 Kb (Figure 1.2). For the most

part, these variations in size are the result of differences in intron size; however, the

intron phases are completely conserved in all KLKs1-15 (Nelson et al., 1999a;

Stephenson et al., 1999; Clements et al., 2000; Hu et al., 2000; Yousef et al., 2000a).

There is also conservation of the KLK genomic organization with five coding exons,

although, some of the recent members have additional exons containing 5’ or

3’untranslated regions (Clements et al., 2000; Yousef et al., 2000a). In addition, the

position of the codons for the three residues crucial for catalytic activity (histidine

(H), aspartate (D) and serine (S) are also conserved in exons 2, 3 and 5 respectively

across all fifteen genes in the human and rodent (Evans et al., 1987; Wines et al.,

1991; Clements et al., 2000) (Figure 1.3).

When compared with the original KLKs1-3, the recently described KLKs4-15 have

significantly reduced levels of homology, with approximately 25-44% similarity at

the protein level (Harvey et al., 2000). Phylogenetic tree analysis within the human

KLK gene family, suggests there are a number of subgroups within this species

(Harvey et al., 2000). In accordance with this data, the more conserved KLKs1-3 may

reflect a recent gene duplication event (Clements et al., 2000).

The KLKs are glycoproteins with a theoretical average molecular weight of

approximately 28.6 KDa, although the range observed experimentally for KLK1-3 is

between 34-43 KDa (Lu et al., 1989; Bei et al., 1995; Hsieh et al., 1997; Rittenhouse

et al., 1998). This size difference is due to the various glycosylated states of these

enzymes (Woodley et al., 1985; Rittenhouse et al., 1998). As noted earlier, the active

12

site of the enzyme includes three amino acid residues histidine, aspartate and serine,

which are crucial for the catalytic activity of the enzyme (Figure 1.3). The KLKs are

first synthesised as a zymogen containing a pre/pro-region typically encoded by exons

1 and 2, respectively. The signal pre-region is involved in directing the secretion of

the enzyme, while the pro-region, when cleaved, generates the mature enzyme (Figure

1.3) (Clements, 1998).

1.5. KNOWN AND PUTATIVE FUNCTIONS OF KLKS 1-15

1.5.1. Renal/Pancreatic Tissue Kallikrein 1 (KLK1)

The kallikreins were conventionally distinguished by their ability to release (lys)-

bradykinin from kininogen (Bhoola et al., 1992). In humans, only hK1 satisfies the

functional description of a “true” kallikrein. Human K1 has strong kininogenase

activity and releases mainly lysine-bradykinin (lys-BK) from both high and low

molecular weight kininogen (Blais et al., 2000). The major effects of hK1 are

mediated via the kallikrein-kinin system, and specific kinin receptors (B1 and B2).

These receptors are coupled to G proteins and predominantly associated with phospholipase C-β activation and intracellular Ca2+ recruitment by inositol 1,4,5-

triphosphate (IP3) (Blais et al., 2000). Kinins, via their receptors, are involved in a

number of processes such as inflammation, blood pressure/flow, vascular

permeability and mitogenesis (Bhoola, 1992). Additionally, they are important in

tumour blood flow and tumour growth (Maeda et al., 1999). Of interest, it has

recently been reported that hK1 will directly activate the human B2 receptor

independent of BK release (Hecquet et al., 2000); however, the significance of this

finding is yet to be established.

Human tissue K1 also processes a number of other in vitro substrates including the

matrix metalloproteases (MMP), procollagenase and progelatinase, prolactin,

proinsulin, prorenin, atrial natriuretic factor, vasoactive intestinal peptide, low density

lipoprotein, insulin-like and epidermal growth factors (reviewed in Clements, 1997),

but, it is not yet clear whether these in vitro substrates truly reflect a multi-functional

role for hK1 in vivo. However, the potential activation of the MMPs by hK1 may be

important in facilitating matrix rearrangement and cancer cell invasion.

13

Figure 1.3. Typical Structural Organisation of the Human Kallikrein Gene Family. The 5 exons

are indicated with blue and red rectangles with each exon numbered within the rectangle. The domains

encoding the pre/pro region (signal and activation peptides, respectively) and the catalytic triad, His,

Asp and Ser (encoded on exons 2, 3 and 5 respectively) are shown. The intervening lines denote

introns and the blue rectangles are the coding regions while the red represents 5’ and 3’ untranslated

regions. The ATG for translation initiation is shown in exon 1. The protein coding region representing

the pre/pro and mature enzyme is shown as a larger blue rectangle directly underneath the genomic

structure.

ATG

His Asp Ser

Pre /ProRegion

Exons (coding)

Untranslated Exons

His Asp SerPre/ProRegion

Protein Coding Region

1 2 3 4 5

Mature Enzyme

14

1.5.2. Glandular Kallikrein 2 (KLK2) and Prostate-Specific Antigen (PSA-KLK3)

Human K2 can activate urokinase or urinary plasminogen activator (uPA) by cleaving

the pro-region of uPA, which in turn converts plasminogen to plasmin (Frenette et al.,

1997). Plasmin is a strong proteolytic enzyme that has a wide substrate specificity

cleaving many proteins, as well as fibrin, in the extracellular matrix and thus creates a

localised microenvironment of matrix degradation through which migration of tumour

cells is facilitated (Mullins and Rohrlich, 1983; Pedersen et al., 2003; Schneider et al.,

2003). Additionally, the activation of mammalian PSA by hK2 has been

demonstrated in a Syrian hamster tumour cell line AV12-664 (Kumar et al, 1997).

The primary role of PSA is to lyse the seminal clot (Lilja, 1985; Takayama, et al,

1997; Deperthes et al., 1997) by degradation or hydrolysis of semenogelin 1 and II

and fibronectin and thus enhance sperm motility (Kumar, et al., 1997). PSA can also

induce apoptosis and negatively regulate tumour cell proliferation in prostatic cell

lines (Balbay et al., 1999); however its exact role in this process remains to be

elucidated. In addition, hK2 and PSA have also been show to cleave insulin-like

growth factor-binding proteins and thus, are hypothesised to be involved in the

increase of free IGF and abnormal prostate cell growth (Okabe et al., 1999; Dube and

Tremblay, 1997; Rehault et al., 2001). PSA can also activate transforming growth

factor-beta (TGF-β) in osteoblast cells and thus, is proposed to induce mitogenic

activity (Killian et al., 1993). Furthermore, the intrinsic ability of hK2 and PSA to

degrade extracellular components such as fibronectin and laminin (Mullins and

Rohrlich, 1983; Webber et al., 1995), may be one of the principal requirements

considered necessary for tumour cells to detach from their primary sites and breach

the numerous structural and cellular boundaries of the ECM.

1.5.3. Kallikrein 4 (KLK4)

The biological function of hK4 is not yet known, although there is some indication of

its biological function from recent biochemical studies. Recombinant K4 was shown

to activate pro-PSA, single-chain urokinase-type plasminogen activator (scUPA) and

prostatic acid phosphatase (PAP) (Takayama et al., 2001a). Both PSA and scUPA

proteins are implicated in cancer invasion and metastasis (Zarghami et al., 1997;

Schneider et al., 2003; Pedersen et al., 2003; Diamandis et al., 2000a), and it has been

suggested that the activation of PAP by K4 may be deleterious to cellular growth

15

regulation and the development of prostate cancer (Takayama et al., 2001a). The

activation of PSA by K4 (as well as hK2) suggests a proteolytic cascade of events

whereby these enzymes may be acting in concert to aid in cell proliferation,

development and invasion of cancer cells.

Human K4 also shares 78% homology at the amino acid level with pig enamel matrix

serine protease 1 (EMSP1) and is likely the human ortholog of this gene. EMSP1 is

involved in the degradation of the enamel protein matrix allowing the maturation of

dental enamel (Overall and Limeback, 1998; Simmer et al., 1998; Hu et al., 2000).

Thus, perhaps hK4, like hK2 and PSA, may also play a role in ECM degradation,

modulating cellular adhesive forces critical for neoplastic growth and metastasis. In

addition, with the striking sequence similarity between hK4 and EMSP1, and the role

that EMSP1 plays in enamel matrix degradation, it is tempting to postulate that hK4

may be expressed in human teeth and also play a role in bone remodelling and

contribute to the patho-physiological processes of bone metastasis.

1.5.4. Kallikreins 5-15 (KLK5-KLK15)

Given their relative recent identification, the functions of the other newer KLKs

(KLK5-15) are less clear than that of the original members (KLK1-3), but will be

summarised briefly below.

KLK5 and KLK7 were first described in skin and both of these enzymes have been

suggested to be involved in catalysing the degradation of intercellular cohesive

structures in the cornified layer of the skin, thus facilitating the continuous shedding

of cells from the skin surface (Lundstrom and Egelrud, 1991; Brattsand and Egelrud,

1999). In addition, the co-localisation of both hK5 and hK7 enzymes in the skin and

the analysis of their pro-peptide cleavage sites and putative substrate specificities, has

led to the suggestion that hK5 may activate hK7 (Ekholm et al., 2000).

KLK6 can hydrolyse amyloid precursor protein and is thought to be implicated in the

deposition of amyloid plaques in Alzheimer’s disease (Little et al, 1997).

Furthermore, the mouse ortholog of the KLK6 gene was suggested to play a role in the

processes occurring after oligodendrocyte maturation, such as myelination or turnover

of proteins in the myelin (Yamanaka et al., 1999). Other studies investigating the

16

role of hK6 in central nervous system demyelination, observed that excessive hK6

resulted in a dramatic loss of processes from differentiated oligodendrocytes

(Scarisbrick et al., 2002).

KLK8 may play an essential role in neural plasticity (Yoshida et al., 1998). Studies by

Oka et al. (2002) proposed that mouse K8 (mK8) was involved in neurite outgrowth

and fasciculation during the development of the nervous system. Furthermore, mouse

mK8 can degrade the ECM protein fibronectin (Shiosaka and Yoshida, 2000).

Additionally, Oka et al. (2002) reported a study in preparation by Matsumoto-Mayai

et al, where mK8 could degrade the cell adhesion molecule, L1. It is proposed from

these studies that K8 might modulate neuritic outgrowth and fasciculation via the

fragmentation of fibronectin and L1 in the hippocampus (Oka et al., 2002).

Recombinant K15 was shown to activate the precursor of PSA (pro-PSA) and it was

suggested from these studies that K15 might be the physiological activator of PSA

(Takayama et al., 2001b).

Of the remaining kallikreins, KLK9-14, there are no studies to date regarding their

function although their expression has been associated with several hormone-

dependent cancers (HDCs) (see Section 1.6.4). Thus, the KLK gene family is reported

to be involved in a number of patho-physiological processes particularly with respect

to ECM remodelling and tumour progression. The next section outlines current

knowledge with respect to KLK expression and hormonal regulation in HDCs of the

prostate, ovary and breast and the association of KLK expression with disease

progression.

1.6. KALLIKREIN EXPRESSION AND REGULATION IN HORMONE-

DEPENDENT CANCERS (HDCs)

The association between KLKs and cancer is well established, where numerous

reports indicate that nearly all of the KLK gene family are expressed to varying

degrees in cell lines and tissues including skin, brain, placenta, kidney, mammary

gland, prostate, testis, ovary, uterus and lung (see Harvey et al, 2000 and Diamandis

et al, 2000a; Yousef and Diamandis, 2002a,b for recent reviews) as well as in HDCs

such as breast, prostate, ovary and uterus (reviewed in Yousef and Diamandis, 2003).

Additionally, steroid hormones regulate the expression of most, if not all of the KLKs

17

(reviewed in Diamandis et al., 2000a). Therefore, the following sections will outline

the expression profiles for the KLK gene family, and their regulation by steroid

hormones, particularly estrogen, progesterone and androgens and thus provide some

insight into why the KLKs have become recognised as important players in HDCs.

1.6.1. KLK1 Expression and Hormonal Regulation

On Northern blot analysis, it first appeared that KLK1 expression was primarily

restricted to the salivary gland, kidney and pancreas in the mouse, rat and human

(Swift et al., 1982; Ashley and MacDonald, 1985; Baker and Shine, 1985; Fukushima

et al., 1985; Van Leeuwen et al., 1986). However, use of the sensitive Reverse

Transcription-Polymerase Chain Reaction (RT-PCR) clearly indicates that KLK1 is

ubiquitously expressed in a number of tissues and cell types including cancers of the

oesophagus, breast, ovary, prostate and endometrium (Rehbock et al, 1995; Dlamini

et al., 1999; Rae et al., 1999; Diamandis et al., 2000a; Harvey et al., 2000; Myers and

Clements, unpublished data). The precise role of KLK1 in these cancers is less clearly

defined.

Early hormonal studies of rat kallikrein 1 (rKLK1) gene expression identified high

levels of expression in the anterior pituitary. These levels declined following

ovariectomy but could be restored by estradiol administration (Powers, 1986; Fuller et

al., 1988; Clements et al., 1986, 1989). Similarly, studies by Chen et al. (1992)

showed that ovariectomy resulted in a decrease of renal rKLK1 mRNA levels and that

estradiol replacement restored levels to that observed for sham-operated rats.

Additionally, progesterone treatment had a greater effect than estradiol and resulted in

increased renal rKLK1 mRNA levels over that of the estradiol treatments. Clements

and Mukhtar, (1994) found endometrial KLK1 mRNA levels to be differentially

expressed across the human menstrual cycle, with an expression pattern that was

indicative of estrogen regulation. Moreover, increased levels of KLK1 were identified

in estrogen-induced prolactin tumours (Powers, 1990). Clearly, estrogen and

progesterone regulate KLK1 expression. Indeed, putative HREs for the estrogen,

progesterone and glucocorticoid receptors as well as cAMP have been identified

(Table 1.1 and Figure 1.4) (Murray et al., 1990), although these elements are yet to be

functionally characterised.

18

Table 1.1. Location, position and function (if known) of the regulatory elements within the KLK1-

3 promoter regions.

The ? denotes unknown functionality; the negative values regarding position (bp) are 5’ of the

published +1 site for transcription.

* 1. Evans et al., 1987; 2. Murray et al., 1990; 3. Xiong et al., 1997; 4. Song et al., 1997; 5. Riegman et

al., 1991; 6. Young et al., 1992; 7. Murtha et al., 1993; 8. Mitchell et al., 2000; 9. Yu et al., 1999; 10.

Cleutjens et al., 1996; 11. Schuur et al., 1996; 12. Perez-Stable et al., 2000; 13. Huang et al., 1999.

Gene Regulatory Element Position (bp) Functional Reference(s)*

KLK1 TATA-box CAAT-box GRE cAMP PRE ERE Enhancer Negative Regulator Repressor Element Inducer Element

-23 -74 -159 -206 -400 -640 -301 to –201 -801 to –301 -166 to -144 -144 to -98

? ? ? ? ? ? ? ? ? ?

1, 2 1, 2 2 2 2 2 3 3 4 4

KLK2 TATA-box CAAT-box Sp1 (GC-box) ARE CREB AP-1 c-Fos Enhancer Repressor Element

-28 to -23 -70 to -80 -48 to -53 -160, -3819 -2843 -4076 -4412 -5200 to -3400 -468 to -323

? ? ? Yes ? ? ? Yes Yes

5 5 5 6 -8 9 9 9 8, 9 7

KLK3 TATA-box GC-box CACCC-box ARE CREB AP-1 c-Fos Enhancer GATA Non-consensus AREs GRE (half-site)

-28 to -23 -53 to -48 -129 to -125 -170, -440, -4136 -3196 -4420 -4734 -5800 to -3700 -4194 to -4034 -4224 to -4079 -4726 (+ strand) -4079 (- strand)

? ? ? Yes ? ? ? Yes Yes Yes ? ?

5, 10 5, 10 5, 10 5, 9 -12 11 11 11 11 12 13 11 11

19

Figure 1.4. Schematic Diagram Representing the 5’ Promoter and Enhancer Regions of KLKs1-3.

Note: the above figure is not drawn to scale and the positions of the regulatory elements are only

approximations. The rectangles denote KLK1, KLK2 and KLK3 coding regions of the gene, while the

thin lines 5’ of these rectangles represent the promoter and enhancer regions. Each element identified

is described in the key below the schematic. The negative values represent the position of specific

elements (bp) relative to the published +1 site for transcription.

20

Little work has been performed on the promoter region for KLK1. Studies by Xiong et

al, (1997), using an in vivo mouse model and deletion constructs of the hKLK1

promoter, identified a negative regulatory element located between -801 and -301 bp

and an enhancer-like element between -301 and -201 bp (Table 1.1 and Figure 1.4).

Additional studies by Song et al, (1997), demonstrated a repressor element(s) between

-166/-144 and an inducer between -144/-98, regions that was important for basal

promoter activity (Figure 1.4 and Table 1.1). However, since these studies, no further

characterisation of the KLK1 promoter has been reported.

1.6.2. KLK2 and KLK3 Expression and Hormonal Regulation

Both hK2 and PSA are highly homologous at the amino acid level (80%) and the co-

expression of these two proteins in the prostate may suggest an analogous

relationship. However, the two prostatic localised KLKs appear to differ significantly

in their relative abundance in benign hyperplasia and prostate cancer cells (reviewed

in Rittenhouse et al., 1998). Differences in protein expression of hK2 and PSA have

found that PSA is generally expressed less in poorly differentiated prostate tumours

while hK2 appears to be highly expressed in poorly differentiated prostate cancer cells

(reviewed in Rittenhouse et al., 1998). Although KLK2 and KLK3 expression has

been predominately detected in the prostate, RT-PCR analysis has detected lower

levels of expression in other tissues and cell lines such as breast tumours and cell

lines, ovarian and lung tumours and endometrial cancer tissue and cell lines

(Clements and Mukhtar, 1994; Monne et al, 1994; Yu et al, 1994; Zarghami et al,

1997; Myers and Clements, unpublished data). The precise role(s) in the latter tissues

and cell lines is yet to be established.

The hormonal regulation of both KLK2 and KLK3 have been studied extensively

particularly with respect to androgen regulation. Earlier studies suggested that these

two genes are similarly regulated by androgens in the prostate cancer cell line, LNCaP

(Young et al, 1991; Henttu et al, 1992). Subsequently, both KLK2 and KLK3 gene

expression was shown to be regulated at the transcriptional level via androgen

receptor (AR) binding through several characteristic androgen response elements

(AREs) and (Riegman et al, 1991; Murtha et al, 1993; Luke and Coffey, 1994;

Cleutjens et al, 1996, 1997; Schuur et al, 1996; Pang et al, 1997; Sato et al, 1997; Sun

21

et al, 1997; Zhang et al, 1997; Brookes et al, 1998;Yu et al, 1999; Mitchell et al, 2000;

Yeung et al, 2000).

1.6.2.1 Transcriptional Regulation of KLK2

Earlier sequencing of the KLK2 promoter identified a putative ARE-like element at

approximately -160 bp upstream of the +1 site that differs from the consensus ARE

sequence by 3 bp (Young et al., 1992) (Figure 1.4 and Table 1.1 and Table 1.2).

Studies of this region by Murtha et al. (1993), in the androgen receptor negative

prostate cancer cell line, PC-3, that was co-transfected with the AR and KLK2

promoter constructs, established that deletion of the putative ARE (-160 bp) in effect,

eliminated androgen-induced gene transcription of a chloramphenicol

acetyltransferase (CAT) reporter construct. Moreover, a 171 bp construct, that still

retained the putative ARE, showed limited CAT activity under androgen influence.

These data suggest that additional elements were required to induce gene expression

under androgenic stimulus.

Further studies by Yu et al. (1999), sequenced 12.3 Kb of the 5’ flanking region of the

KLK2 gene, and by computer analysis identified several consensus sequences for a

number of transcription factors such as c-Fos, activation protein 1 (AP-1), and cAMP

response element binding protein (CREB) (Figure 1.4 and Table 1.1). However, these

elements are yet to be functionally characterised. A number of KLK2 deletion

constructs were fused to a luciferase reporter gene and transfected into the androgen-

responsive LNCaP cell line. Here, Yu et al. (1999) identified an androgen-dependent

enhancer region (-3.4 to -5.2 Kb) (Figure 1.4) that increased luciferase expression 100

-fold in the presence of the synthetic androgen, R1881. This enhancer region contains

an ARE (-3819 to -3805 bp) (Figure 1.4 and Table 1.2), that matches the consensus

ARE sequence in 12/15 positions. In addition, this ARE is almost identical to the

ARE (-4136) identified in the KLK3 AREIII enhancer region (Schuur et al., 1996)

(Figure 1.4, and Table 1.1 and 1.2). Additionally, when mutated, this enhancer was

no longer inducible by R1881.

In the further studies of this region, Mitchell et al. (2000), utilising 5 kb of the KLK2

promoter and “up-stream” regions, transfected a number of CAT deletion constructs

(5, 3.5, 2.8 and 0.8 kb) (Figure 1.5a) into LNCaP cell lines. The 5 kb fragment

22

Table 1.2. Consensus Androgen Response Element (ARE) and Non-Consensus ARE Sequences

for Both the KLK2 and KLK3 Genes

Gene Position bp Relative to +1 (see Figure 1.4)

Consensus ARE 5’-GGTACAnnnTGTTCT-3’

Reference

Non-consensus ARE

KLK2 -160

5’-GGAACAgcaAGTGCT Young et al. 1992

KLK2 -3819 to –3805

5’-GGAACAtatTGTATT-3’ Yu et al. 1999

KLK3 -170

5’-AGAACAgcaAGTGCT Riegman et al. 1991

KLK3

-400

5’-GGTACAgggAGTCTC Cleutjens et al. 1996

KLK3 -4136 to –4148

5’-GGAACAtatTGTATC-3’ Schuur et al. 1996

KLK3 -3955 to -4298 5’-ACTGGGACAACTTGCAAACCTGCTC-3’ 5’-ATTATCTTCATGATCTTGGATTG-3’ 5’-TCTGGAGGAACATATTGTATTGA-3’ 5’-CTTTATTATCTAGGACAGTAAGC-3’

Huang et al. 1999

23

Figure. 1.5. Schematic Diagram of KLK2 (Panel a) and KLK3 (Panel b) Deletion Constructs. This

work was performed by Mitchell et al, 2000 (KLK2) and Riegman et al, 1991 (KLK3). Solid black

lines represent the deletion constructs, while the reporter system is represented as a solid grey

rectangle. The size of each construct (bp) is shown above the first construct. The black diamond

represents the ARE and the asterix represents the degree of promoter activity with **** being highest

activity and * lowest activity.

24

incurred full androgen induction, while the 3.5 and 2.8 kb constructs resulted in a

large decrease in CAT activity following androgenic stimulation, even in the presence

of an intact proximal promoter. The 0.8 kb region, that contains the putative ARE (-

160 bp) (Figure 1.4 and 1.5a), also showed diminished CAT activity following

androgenic stimulation. These results indicated that the region from -3.5 to -5.0 kb is

important for androgen stimulation of the KLK2 promoter in the androgen-responsive

LNCaP cell line. In addition, without the upstream ARE (-3819 to -3805 bp) (Figure

1.4, 1.5a and Table 1.1 and Table 1.2), androgenic induction of the proximal promoter

containing the ARE at -160 bp, was insignificant in LNCaP cells.

Collectively, the identification of this enhancer region, suggests that other elements,

possibly other AREs, may be required to interact with the KLK2 proximal ARE for

favourable androgen induction. For example, the rat probasin gene (Kasper et al., 1994) and the androgen receptor gene itself, contain at least two AREs (Grad et al.,

1999) that are required for the high expression of these genes. In fact, multiple AREs

have been identified in many genes (Lucas and Granner, 1992). It has been suggested

that multiple AREs may act synergistically to stimulate androgen receptor responsive

gene expression (Huang et al, 1999).

1.6.2.2. Transcriptional Regulation of KLK3

Early studies by Riegman et al. (1991), utilising DNase 1 foot-printing studies on the

KLK3 gene proximal promoter (-320 to +12 bp) from LNCaP cells, identified several

protected areas including a variant TTTATA-box (-28 to -23 bp), a GC-box (-53 to -

48 bp) and the sequence AGAACAgcaAGTGCT (-170 to -156 bp) which resembles

the reverse complement of the consensus sequence GGTACAnnnTGTTCT for ARE

(Figure 1.4. and Table 1.1 and 1.2). A number of deletion constructs of the KLK3

promoter (-1600, -630, -539, -320 and -155 bp all extending to +12 bp) were cloned

into a CAT reporter gene, and along with the androgen receptor (AR), were

transfected into COS cells in the absence and presence of 1 nmol/L of the synthetic

androgen, R1881 (Figure 1.5b). High CAT-activity was observed in the -1600, -630

and -539 bp fragments whilst low activity was observed when the -539 to -320 bp

fragment was removed (Figure 5.1b). No regulation by R1881 was observed in the -

155 bp fragment (contains the proximal ARE at -156 to –170 bp) (Figure 1.5b).

These data suggest that, like KLK2, other regulatory elements, further upstream of the

25

-320 bp fragment were required to induce maximal androgen-regulated expression of

the KLK3 promoter.

Further studies by Cleutjens et al. (1996), utilised a 35 bp sequence upstream of the

proximal ARE, starting at -400 bp, that contained a putative androgen responsive

region, ARR (Figure 1.4 and Table 1.1 and 1.2). Here, these authors fused three

copies of the ARR to a minimal KLK3 promoter (approximately 630 bp 5’ of the

5’UTR) and found that this promoter was induced 104-fold on the addition of R1881.

Further analysis of this ARR region identified a low affinity AR binding site. Gel

retardation and transfection data revealed a degenerate palindromic sequence

(GGTACAgggAGTCTC) where half of the positions are identical to the ARE

consensus sequence (GGTACAnnnTGTTCT) (Table 1.2) (Cleutjens et al, 1996).

Interestingly, transfection studies additionally indicated that the ARR and minimal

KLK3 promoter activity is cell dependent. Even in the presence of high levels of

androgen and glucocorticoid receptors (AR and GR, respectively), ARR activity in

LNCaP cells was greater than non-prostatic cell lines COS, HeLa, Hep3B and T47D

(Cleutjens et al., 1996). Consequently, these data may suggest the recruitment of

tissue-specific factors other than AR and GR that are involved in the tissue-specific

regulation of the KLK3 promoter.

To identify additional factors upstream of the proximal promoter that are required to

induce androgen responsive KLK3 gene expression, Schuur et al. (1996) identified an

enhancer region located between -5800 and -3700 bp that is androgen responsive and

requires a promoter for activity (Figure 1.4 and Table 1.1). Computer analysis of this

region identified a number of consensus binding sites. An ARE (-4148 to -4136 bp)

was identified that matched the consensus ARE in 11 out of 15 positions (Table 1.2).

Glucocorticoid response element half-sites were also identified at -4726 bp (+ strand)

and -4079 bp (- strand) and potential sites for AR, AP-1, Fos and cAMP-response

element binding protein (CREB) were also identified (Figure 1.4 and Table 1.1).

Three KLK3 CAT-reporter constructs (-5322, -4136 and -541 all extended to +15)

were transfected into LNCaP cell lines and treated with R1881. Interestingly, only

the 5322 construct was inducible under these conditions. Upon further delineation of

this region an 822 bp and 455 bp minimal core region, encompassing an ARE, was

identified. To determine if the identified sequence was indeed a “true” enhancer,

26

Schuur and colleagues inserted the enhancer fragment upstream of a KLK3 promoter

gene in both orientations. Here they found the “up-stream” enhancer could be moved

as a unit and reversed relative to the promoter without affecting promoter activity.

Although the proximal promoter plays an important role in the activation of KLK3, a

study by Huang et al. (1999), reported that the KLK3 promoter is synergistically

activated by at least four tandem, non-consensus AREs within a region of -3955 to –

4298 bp relative to the +1 (Table 1.2). These non-consensus AREs, fused to a CAT

reporter, and co-transfected into baby hamster kidney (BHK) and prostate cancer

(LNCaP) cell lines, were found to be physiologically relevant in conferring a response

to AR. Moreover, the removal of one or more of these AREs strongly negated

reporter activity in the LNCaP cell line. Thus, it appears from these studies that the

cooperative binding of AR to tandem non-consensus AREs, can contribute to an

overall responsiveness of KLK3 expression.

Recently, some exciting work has been published on the “real-time” in vivo

recruitment of the AR to all three of the KLK3 AREs (-170, -440, -4136, Table 1.1

and Figure 1.4) (Shang et al., 2002). Here, these authors used the chromatin

immunoprecipitation assay (ChIP) (see Chapter 6) to establish the recruitment of the

AR to the known PSA AREs. Previous studies on these elements, as mentioned

above, are an indirect “in vitro” analysis of the transcriptional mechanisms and do not

take into account the effects of chromatin remodelling, acetylation/deactylation and

cascade regulatory effects that occur in vivo. However, the ChIP assay is a direct in

vivo method that takes into account, all of these factors. These authors further

characterised the requirements for an active transcriptional complex. Both the

enhancer regions and proximal promoter of KLK3 were needed to recruit and

assemble AR, the co-activators (αGRIP1, CBP) and RNA polymerase II under

dihydrotestosterone (DHT) stimulation. Additionally, on the addition of the anti-

androgen, biclutamide, these co-activators were not recruited to the enhancer or

promoter region of KLK3, and moreover, the AR was only recruited to the promoter

and not the enhancer regions. However, biclutamide-bound AR was able to recruit

the nuclear co-repressors, NCoR and SMRT. These data suggest that co-activator

complex formation initiated by agonist-bound AR involves synchronisation of both

the proximal promoter and enhancer regions, whereas co-repressor complex formation

27

initiated by antagonist-bound AR only involves the promoter. Other studies by Jia et

al. (2003), also using ChIP, found the AR was recruited rapidly to the PSA enhancer

within one hour of DHT treatment. These same authors, using the putative ligand-

independent activators of AR, forskolin and interleukin 6 (IL-6), found forskolin

stimulated, while IL-6 inhibited, PSA mRNA and protein expression. Although IL-6

did not inhibit DHT-dependent AR occupancy on the PSA enhancer, it inhibited the

assembly of the co-activators CBP/p300, histone H3 acetylation, and cell

proliferation.

Although androgens have been largely implicated in the transcriptional activation of

KLK3, other studies have identified androgen-independent induction of the KLK3

gene via the cross talk between the AR and protein kinase A signal transduction

pathway (Sadar, 1999). In addition, KLK3 is repressed by the interactions between

the AR and AP-1/c-Jun (Sato et al, 1997). Additional reports have demonstrated

KLK3 involvement with an Ets transcription factor (Oettgen et al, 2000), estradiol

activation of the prostate androgen receptor and KLK3 secretion (Nakhla et al, 1997)

and the androgenic regulation of KLK3 through GATA transcription factors (Perez-

Stable et al, 2000). From these data it is clear that multiple factors are involved in

KLK3 activation and it is probably the concerted effect of these factors along with a

cohort of unidentified elements that eventually leads to the tissue-specific expression

of KLK3.

1.6.3. Expression and Hormonal Regulation of KLK4

KLK4 was concomitantly identified at the mRNA level by three groups (Nelson et al.,

1999a; Stephenson et al., 1999; Yousef et al., 1999b). These authors found KLK4 to

be highly expressed in the prostate. Furthermore, KLK4 mRNA (like KLK3) is also

expressed in a number of other hormone-responsive tissues and cell lines such as the

breast cancer cell line BT-474, uterine, mammary gland and testis tissue, and

endometrial and ovarian cancer cell lines (Yousef et al., 1999b; Harvey et al., 2000;

Myers and Clements, 2001; Dong et al., 2001). To date there is little data on KLK4

regulation and its promoter region has not been studied in any detail. Nelson et al.

(1999a) supplemented LNCaP cell lines with 1 nmol/L R1881 for 24 hours and found

KLK4 expression decreased to 50% of steady-state levels. However, these levels rose

to reach a 1.7-fold increase over 48 hours. Yousef et al. (1999b) found KLK4 to be

28

up-regulated, at the semi-quantitative RT-PCR level, by 10-8 mol/L DHT and

norgesterol treatment over 24 hours in the human breast cancer cell line, BT-474.

Myers and Clements, (2001) found hK4 to be up-regulated at the protein level on the

addition of 10 nmol/L 17β-estradiol benzoate and progesterone treatment for 24 hours

in a poorly differentiated endometrial cancer cell line, KLE. Moreover, intracellular

levels of hK4 were progressively up-regulated by 100 nmol/L 17β-estradiol benzoate

over a time-course of 0, 8, 16, 24 and 30 hours in the ovarian cancer cell line,

OVCAR-3 (Dong et al., 2001).

Three putative androgen response elements (AREs) have been identified in the 5’

flanking region of KLK4 gene at approximately -190 bp, -390 bp and -440 bp 5’ of the

putative ATG site for translation (Stephenson et al., 1999), however these have not

been functionally characterised. Nevertheless, given that the progesterone receptor

can bind to similar response elements this may indicate that progesterone regulation

of KLK4 occurs through these AREs or similar elements. To date, estrogen response

elements (EREs) have not been identified in the KLK4 promoter or distal “up-stream”

regions. More work is required to determine the regulatory mechanisms of KLK4

transcription through these or other novel elements.

1.6.4. Expression and Hormonal Regulation of the Additional Family Members,

KLK5-15

As noted earlier, the expression patterns of the KLK5-15 genes are quite diverse.

Most of these newer members are also expressed to varying levels in HDCs of

prostate, breast and ovary (reviewed in Yousef and Diamandis, 2003) however, there

is little information to date of their role in these cancers.

KLK5 is thought to be an indicator of poor prognosis in ovarian (Kim et al., 2001) and

breast cancers (Yousef et al., 2002a). KLK7 expression is also associated with a

poorer prognosis for ovarian cancer patients (Kyriakopouloua et al., 2003). KLK9 has

been suggested to be a new favourable prognostic marker for breast cancer (Yousef et

al., 2003a). KLK10 is considerably down regulated in breast and prostate cancer cells

compared to normal tissue and is suggested to be a tumour suppressor gene (Goyal et

29

al., 1998). Moreover, this gene may be a candidate tumour suppressor gene in normal

and malignant testicular cancer (Luo et al., 2001). Furthermore, a single nucleotide

variation at codon 50 is suspected to be significantly associated with prostate cancer

risk (Bharaj et al., 2002).

KLK11 has been suggested to be a new marker for ovarian and prostate cancers where

elevated levels of hK11 were detected in serum from patients with these cancers

(Diamandis et al., 2000a). KLK12 is down regulated in breast cancer (Yousef et al.,

2000d) and KLK13 is thought to be an indicator of favourable prognosis in breast

cancers (Chang et al., 2002). KLK14 has been proposed to be a marker of favourable

prognosis in ovarian cancer due to its significantly higher expression in patients with

early stage disease (Yousef et al., 2001b). Additionally this gene is also highly over-

expressed in prostatic cancers compared to non-cancerous tissue and has been

suggested to play a role in tumour spread (Yousef et al., 2003b). KLK15 has been

suggested to be an independent and favourable prognostic marker for breast cancers

(Yousef et al., 2002c) or a potential serum marker for prostate cancers (Stephan et al.,

2002).

As noted previously, the newer KLKs are less characterised than the original KLKs1-

3. For hKLK5-15, little work has been published in terms of their regulation and no

studies on their regulatory elements have been performed. The majority of the

regulatory studies to date have been performed by one group using semi-quantitative

RT-PCR in the breast cancer cell line, BT-474. These will be discussed below.

Using RT-PCR Yousef and Diamandis, (1999) found KLK5 to be up-regulated by 10-8

mol/L of estradiol and norgesterol in the breast cancer cell line, BT-474 over 24 hr.

Furthermore, no consensus estrogen or progesterone response elements (EREs and

PREs, respectively) were identified. In similar studies, using RT-PCR and the BT-

474 cell line, KLK6 mRNA levels were up-regulated by 10-8 mol/L of estrogen and

progesterone, and to a lesser extent by DHT (Yousef et al., 1999c). Following

treatment with 10-8 to 10-10 mol/L androgens, progestins, estrogens and

glucocorticoids, KLK7 was only up-regulated by estrogens and glucocorticoids at the

10-10 mol/L dose Yousef et al. (2000b). The hormonal regulation of the KLK8 and

KLK9 genes has not been studied. However, given that most of the kallikreins studied

30

so far are regulated by estrogen or progesterone, and both of KLK8 and KLK9 are

highly expressed in ovarian cancer cell lines (Harvey et al., 2000), it seems plausible

that these steroids may also regulate these two genes.

KLK10 expression was found to be up-regulated at the mRNA level in BT-474 cells

two hours post estradiol (10-11 mol/L) treatment and after eight hours of DHT (10-10

mol/L) treatment (Luo et al, 2000). Additionally, in this study the synthetic anti-

estrogens (ICI 182,780) and 4-hydroxytamoxifen (TAM) and the anti-progesterone

(RU486), effectively blocked the up-regulation of KLK10. These authors suggested

that KLK10 is primarily regulated by estradiol and to a lesser extent by DHT and

progesterone. Yousef et al., (2000c) found KLK11 to be up-regulated at the mRNA

level by 10-8 mol/L estradiol and dexamethasone, but not by DHT in BT-474 cells.

KLK12 is also regulated at the RT-PCR level by DHT and norgesterol in the prostate

cancer cell line, LNCaP (Yousef et al., 2000d). Additionally, in BT-474 cells, KLK12

was up-regulated by estradiol, DHT and to a lesser extent by norgesterol. Moreover,

KLK12 was up-regulated in the breast cancer cell line, T47D by DHT and norgesterol

and to a lesser extent by estradiol (Yousef et al., 2000d). The difference in steroid

responsive potency observed between the two breast cancer cell lines may perhaps

simply reflect the abundance of the particular steroid hormone receptor in these cell

types. The gene encoding KLK13 is also up-regulated by norgesterol and DHT and to

a lesser extent by estradiol at the RT-PCR level in BT-474 (Yousef et al., 2000e),

however, it is not clear what dose was used by these authors. The regulation of

KLK14 is currently unknown, however, given that this gene is over expressed in

prostate cancer tissue (Yousef et al., 2003b) it may suggest that androgens regulate

this gene. KLK15 was shown to be up-regulated by RT-PCR analysis in the prostate

cancer cell line, LNCaP, by 10-8 mol/L of estradiol, norgesterol, mibolerone (a

synthetic androgen), DHT and aldosterone (Yousef et al., 2000f). These authors also

suggested that the up-regulation of KLK15 is associated with a more aggressive form

of prostate cancer (Yousef et al., 2002b), however, these finding are yet to be tested.

Clearly steroid hormones, predominantly estradiol, androgens and progestins, in

breast and prostate cancer cell lines, regulate the mRNA levels of the majority of the

31

newer kallikreins, KLK5-15. However, the mechanisms underlying this regulation are

still not clear.

1.7. PREVIOUS WORK TO THIS THESIS

Prior to my PhD candidature, previous work was performed in the Clements

laboratory on the expression and regulation of the human KLK1-4 genes in

endometrial cancer cell lines of well to poorly differentiated phenotypes (Myers and

Clements, unpublished observations/Honours thesis. At the time of these studies

(early 1999) the KLK gene family was limited to three members, KLKs1-3. Towards

the end of 1999 an additional family member, KLK4 was identified and cloned in this

laboratory (Stephenson et al., 1999) and by one other group in the USA (Nelson et al.,

1999a) as noted previously. This newer family member, like KLK2 and KLK3, was

suggested to be involved in prostate cancer due to the high expression profile of this

gene in the prostate and its regulation by DHT in the prostate cancer cell line, LNCaP

(Nelson et al., 1999a).

Therefore, to determine the possible involvement of the KLK1-4 genes in other

hormone-dependent cancers, their expression was analysed in the endometrial cancer

cell lines, HEC1A, HEC1B and RL95-2 (moderately differentiated), Ishikawa (well

differentiated) and KLE (poorly differentiated). From these studies it was clear that

KLK1-4 were expressed to varying levels in these cell lines, and two of these genes,

KLK1 and KLK4, were chosen for further analysis for this PhD thesis due to their

higher expression profiles in the endometrial cancer cell lines. Both of these genes

were also chosen based on earlier studies where KLK1 was proposed to be regulated

by estrogen in the human menstrual cycle (Clements et al., 1994) and the more recent

studies of KLK4 regulation by androgens and progesterone in the breast cancer cell

line, BT-474 (Yousef et al., 1999b).

Both KLK1 and KLK4 are suggested to play a role in tumourigenesis, either through

the activation of kinins or the matrix metalloproteases (by hK1) leading to a number

of functions such as cell proliferation and extracellular matrix (ECM) degradation,

respectively (Mignatti and Rifkin, 1993; MacDonald et al., 1988; Marceau et al.,

1998), or through the post-translational processing of other proteins including the

KLKs or the degradation of ECM components (hK4) (Dong et al., 2001; Myers and

32

Clements, 2001; Nelson et al., 1999a; Takayama et al., 2001). Therefore the aim of

the extended PhD project was to more fully understand the hormonal regulation of the

KLK1 and KLK4 genes in hormone dependent cancer cell lines.

1.8. SUMMARY AND RELEVANCE TO THE PROJECT

Hormone-dependent cancers share underlying similarities in terms of hormonal

regulation by the steroid hormones, estrogen, progesterone and androgens.

Importantly, the “down-stream” target genes that are modulated through interacting

hormone-receptor complexes are currently a major interest in tumour-based biology.

A family of genes that are clearly regulated by the steroid hormones, and implicated

in the patho-biology of hormone-dependent cancers, are the tissue kallikreins (KLKs).

The KLKs are a multi-gene family of serine proteases involved in normal and patho-

physiological functions. The steroid regulation of the KLKs has been extensively

characterised for KLK2 and KLK3 in terms of androgen regulation. These genes are

regulated at the transcriptional level through several consensus and non-consensus

AREs. Although information is available on the ARE regulation of KLK2 and KLK3,

little information is available on the underlying mechanisms involved in hormonal

regulation of KLK1 and KLK4. Identifying and understanding how these regulatory

regions, (the proximal promoter and enhancer regions) are involved in KLK1 and/or

KLK4 expression is important for the development of model systems to further

understand the role played by KLKs at both the physiological and patho-physiological

levels. To further elucidate these underlying mechanisms, structural analyses of the

complex regulatory regions of these genes are required.

Therefore, the overall objectives of this study were to confirm the expression profiles

of KLK1-4 in a number of hormone-dependent endometrial and breast cancer cell

lines to identify which cell line would provide the best model system. From this data

two of these genes, KLK1 and KLK4, were chosen for further investigation of their

hormonal regulation in endometrial and breast cancer cell lines. A major focus of this

project was to delineate the specific regulatory elements of the KLK4 gene promoter

region that may be involved in this regulation.

33

1.8.1. SPECIFIC AIMS

1. To identify the expression of the KLK1 and KLK4 gene in hormone-dependent

cancer cell lines of the endometrium and breast and to determine the nature of

their regulation.

From these studies, KLK4 was clearly regulated by progesterone and thus, the

focus of the following aims was to address KLK4 regulation in the breast

cancer cell line, T47D.

2. To identify the transcription initiation site (TIS) and thus the promoter region

of the KLK4 gene,

3. To perform bio-informatics to identify any potential hormonal response

elements in the proximal promoter and enhancer regions of the KLK4 gene,

4. To identify promoter and/or enhancer regions responsible for the progesterone

regulation of KLK4 with a set of deletion constructs and reporter gene assays,

5. To test these identified regions in vitro for functionality utilising

electromobility shift assays (EMSA), and supershift assays with specific

antibodies directed at the specific binding regions, and

6. To test these same regions, in vivo, with chromatin immunoprecipitation

assays (ChIP) for the recruitment of these factors to native chromatin in “real-

time”.

CHAPTER 2

MATERIALS AND METHODS

35

2.1. INTRODUCTION

All of the Materials and Methods, used in the following Chapters in this thesis, are

outlined in detail below. In the individual chapters, some aspects of the Materials and

Methods pertinent to each Chapter will be repeated briefly for convenience in order to

maintain a better connection with the subsequent Result pages.

2.2. GENERAL REAGENTS AND CHEMICALS

All general reagents and chemicals of Analytical grade were obtained from Ajax

Chemicals (Melbourne, Australia), BDH Chemicals (Kilsyth, Australia) or Sigma

Chemical Company (Castle Hill, Australia), unless otherwise stated.

2.3. TISSUE SAMPLES AND CELL LINES.

The following cell lines were obtained from the American Type Culture Collection

(ATCC): HaCAT (keratinocyte), HEC1A/HEC1B (uterus; endometrium;

adenocarcinoma, patient with stage IA endometrial cancer), Ishikawa, KLE (uterus;

endometrium; late stage adenocarcinoma) and RL95-2 (endometrial cancer), OVCAR-3

(ovarian), MDA-231 (breast), DU145, PC3, and LNCaP (prostate cancer). The T47D

breast cancer cell line (metastatic site, pleural effusion ductal carcinoma) was obtained

from Professor Wayne Tilley, Flinders University, South Australia. The ALVA 41

(prostate cancer cell line) was obtained from Dr. A. Nakla, St Luke’s Hospital, New

York. The normal kidney tissue and the renal cell carcinoma cell lines, Caki1 and

Sn12K1, were a gift from Dr. David Nicol, Princess Alexandra Hospital, Brisbane,

Australia. The prostate tissue samples were obtained during surgery by Dr. Frank

Gardiner, Royal Brisbane Hospital, Brisbane, Australia. The ovarian cancer cell line,

PEO1, was obtained from Dr. Michael McGukin, Mater Medical Research Institute,

Brisbane, Australia. The salivary gland tissue total RNA was purchased from

CLONTECH (Palo Alto, California, USA) and the salivary gland cell line was obtained

from Dr. Ray McDonald, University of Texas, South Western Medical Center, Dallas,

Texas, USA.

36

2.4. CELL CULTURE

All the above cell lines were maintained at 37°C with 5% CO2 in an IR Sensor Incubator

(Sanyo, Quantum Scientific, Brisbane, Australia). The cell lines were cultured in

Dulbecco's Modified Eagle's Medium (DMEM) (Gibco BRL Life Technologies,

Melbourne, Australia) with 10% heat-inactivated fetal calf serum (FCS) (Life

Technologies) supplemented with 50 U/mL Penicillin G and 50 ug/mL of Streptomycin

(CSL Biosciences, Brisbane, Australia). FCS was inactivated by agitation and heating at

65°C for 1-2 hours in a water bath. Fresh DMEM was added at three-day intervals and

cell morphology and viability was monitored with microscopic observation and regular

Mycoplasma testing.

2.5. CELL COUNTING

Calculations for cell numbers were performed as instructed by Sigma Life Science

Research Catalog, 2003-2004, page 1011. Briefly, cells were grown to approximately

80% confluency, resuspended in 10 ml of phosphate-buffered saline (PBS) and

centrifuged at 1000 x g in a bench top centrifuge. Following aspiration of the PBS, the

cells were resuspended in 5 ml of DMEM. Ten µl of the cell suspension was then mixed

with 40 µl of 0.4% Trypan Blue and 10 µl of this solution was added to each side of a

hemocytometer cell counting chamber. Viable cells stained blue were then counted in 8

square areas and averaged. Then the average cell count was multiplied by the dilution

factor (5 ml) and by 104 to determine cells/ml.

2.6. STEROID TREATMENTS

For the steroid treatments, cell lines (see specific experiments) were seeded into T-80 cm2

tissue culture flasks and grown to approximately 70% confluency as outlined above.

Following this, serum-free, phenol red-free DMEM (Life Technologies) or 2% charcoal-

stripped FCS (Life Technologies) in phenol red-free DMEM, was added to the cultures

for 24 hours or 72 hours (see specific experiments). 17β-estradiol benzoate and/or

progesterone (Sigma, Castle Hill, Australia) were prepared by dissolving each steroid in

100% AR-grade ethanol at a concentration of 1 µmol/L (stock solution), and

subsequently diluted in phenol-red free DMEM to a working concentration of 10 nmol/L.

37

The cells were then treated with each steroid (see specific experiments). The treated cells

were then collected by a cell scraper (Sarstedt, Newton, USA), and centrifuged at 1000 x

g for 5 min in a bench top centrifuge. All of the cell pellets were snapped-frozen with

liquid nitrogen and stored at -80°C.

2.7. PREPARATION OF DNA, RNA AND NUCLEAR AND CYTOPLASMIC

PROTEIN EXTRACTS.

2.7.1. Total RNA Preparation

Total RNA from all of the cell lines was extracted from near confluent T-80 cm2 culture

flasks using TRIZOL (Life Technologies) as instructed by the manufacturer’s protocol

except the final RNA precipitation stage was carried out at -20°C instead of room

temperature (RT). Cells were collected in TRIZOL reagent and vortexed at 4°C to lyse

the cell pellet and the samples then left at room temperature (RT) for 5 min. To separate

the RNA, chloroform (0.2 ml/ml TRIZOL) was added and the sample was then vortexed

for 15 seconds at RT and centrifuged at 14000 x g at 4°C for 20 min, the aqueous phase

removed, and isopropanol (0.5 ml/ml TRIZOL) was used to precipitate the RNA. The

sample was then stored at -20°C for at least 1 hour, to aid in the precipitation process,

followed by centrifugation at 14000 x g for 10 min at 4°C. The resulting RNA pellet was

washed by the addition of 70% ethanol, and a final centrifugation at 4°C for 10 min.

Following centrifugation, the ethanol was removed and the pellet left to air-dry for 5 min.

The sample was then resuspended in 100 µl of nuclease-free water with the addition of

1U of DNase and 1 X DNase buffer (Roche, Brisbane, Australia) and incubated at 37°C

for 15 min. The subsequent RNA was then purified through an RNA-Easy column as per

the manufacturer’s procedure (QIAGEN, Victoria, Australia) and electrophoresed on a

1% agarose gel to determine the integrity of the preparation. RNA concentration was

determined by spectrophotometric analysis (GeneQuant, Pharmica Biotech, Victoria,

Australia) in triplicate where 1OD at A260nm is equal to approximately 40 µg of RNA.

Additionally, the 260/280 ratios were recorded to monitor the purity of the sample, where

a ratio of 2.0 indicates a pure sample, free from protein and solvent contamination. RNA

preparations were resuspended in nuclease-free water with the addition of 1U of RNase

38

inhibitor (Roche) and subsequently stored at -80°C. For the kidney and prostate tissue

samples, total RNA was extracted from 50 mg of tissue per ml of TRIZOL by

homogenisation of the samples with at least 3 x 10 sec bursts on ice (20000 x g) in a

Polytron homogeniser (P-3000, Kinematica AG, Switzerland). The subsequent extract

was then prepared exactly as above for the cell lines.

2.7.2. DNA Extraction

DNA was extracted from the breast (T47D) cancer cells by the addition of an equal

volume of phenol/chloroform (500 µl of each). This solution was then vortexed for 3 x

10 sec bursts and centrifuged at 14000 x g for 10 min at 4°C. Following centrifugation,

the aqueous phase was removed and placed on ice for 2 min followed by the addition of

1/10 volume of 3 mol/L sodium acetate (pH 5.2) and 2.5 volumes of ice-cold 100%

ethanol. The samples were then left at -20°C for at least 30 min to aid in the precipitation

process. Following precipitation, the samples were centrifuged at 14000 x g for 10 min at

4°C, the supernatant was removed, and the DNA pellet washed in ice-cold 70% ethanol.

The DNA pellet was then resuspended in 100 µl of nuclease-free water and 1U of RNase

was added and the sample incubated at 37°C for 15 min. To remove the RNase and

digested RNA, the DNA was purified through a QIAGEN DNA spin column (QIAGEN,

Melbourne, Australia) as per the manufacturer’s procedure. All DNA sample

concentrations were determined in triplicate by spectrophotometric analysis (GeneQuant)

where 1OD at A260nm is equal to approximately 50 µg/ml of DNA. Additionally, a

260/280 ratio of 1.8 indicates that the sample is free from contaminating protein and

solvents. DNA samples were then aliquoted and stored at -80°C.

2.7.3. Isolation of Soluble Protein

Soluble protein was isolated by the addition of 1 ml of lysis solution (10 mmol/L Tris pH

7.5, 150 mmol/L NaCl, 1% Triton-X 100) and the addition of one protease tablet (Sigma,

contains 4-[2-aminoethyl]benzenesulfonyl fluoride (AEBSF), E-64, bestatin, leupeptin,

aprotinin and sodium EDTA) per 50 ml of lysis solution and vortexing for 3 min. The

samples were then passed through a 26-gauge needle three times, and centrifuged for 20

min at 10000 x g (4°C) in a bench top centrifuge. The supernatant was then passed again

39

through a 26-gauge needle three times and re-centrifuged at 10000 x g at 4°C for 5 min.

The supernatant was collected and the total protein concentration determined in triplicate

using the Bicinchoninic Acid (BCA) protein assay as described below (2.8).

Nuclear and cytoplasmic soluble protein was isolated using the NE-PERTM Nuclear and

Cytoplasmic Extraction Reagents essentially as the manufacturer’s instructions (Pierce,

Brisbane, Australia). Thus, to 20 µl of packed cell volume (approximately 40 mg), 200

µl of ice-cold cytoplasmic extraction reagent (CER1TM) was added and the sample

vortexed for 20 sec and incubated on ice for 10 min. Then 11 µl of CER2TM was added,

the sample vortexed, and then centrifuged for 5 min at 14000 x g at 4°C to collect the

supernatant (contains cytoplasmic extract). To the remaining pellet, 100 µl of nuclear

extract reagent (NERTM) was added and the sample placed on ice for 60 min with 15 sec

vortexing every 10 min. Centrifugation was then performed at 14000 x g for 10 min at

4°C and the supernatant (contains nuclear extract) was removed. All cytoplasmic and

nuclear extracts were aliquoted into 10 µl volumes and stored at -80°C. Nuclear protein

concentrations were determined in triplicate utilising the BCA reagent kit (Pierce) as

described below (2.8).

2.8. BICINCHONINIC ACID (BCA) ASSAY

The BCA assay was performed essentially as described by the manufacturer (Pierce) in

96-well microplates. Using 2.0 mg/ml BSA stock, a set of protein standards was made

by diluting the BSA into 1 X PBS so that the desired concentrations were achieved. Then,

enough working reagent (supplied in the Pierce kit) was made to apply 200 µl to each

well. Twenty-five µl of each BSA standard, blank control (PBS) and protein samples

under test were added to each well and mixed by pipetting and then incubated for 30 min

at 37°C. Once cooled to RT, the samples were read at 560 nm in a microplate reader.

2.9 PURIFICATION OF THE CLONTECH PROSTATE cDNA LIBRARY

The prostate cDNA library pTriplEX (CLONTECH, California, USA) was obtained by

using a sterile “stab” technique that involved placing the library on dry ice, and under a

40

sterilising flame, a pipette tip was used to “stab” a sample of the library from the original

stock. This sample was then placed in a 100°C heating block for 5 min and then placed

on ice. Then 10 µg of pTriplEX vector/library was linearised with 2 µl of EcoR V

(Roche) in a total volume of 20 µl of nuclease-free water, and incubated overnight at

37°C. To de-phosphorylate the vector, 10 µl of phosphatase buffer and 2 µl of calf

intestinal phosphatase (Roche) was added to the 20 µl of cut vector and nuclease-free

water to a total volume of 100 µl. This reaction was then placed at 37°C for

approximately 60 min and the resulting DNA sample then purified through a QIAGEN

DNA purification column as per the manufacturer’s procedures (QIAGEN).

2.10. PREPARATION OF BACTERIAL ARTIFICIAL CHROMOSOME AND

COSMID DNA

A bacterial artificial chromosome (BAC) clone (#85745), and the Cosmid (#28781) were

used to amplify the KLK4 promoter region as they contain the full KLK4 genomic

sequence (Harvey et al., 1999). Both COSMID and BAC preparations were placed on

dry-ice and under sterile conditions, scraped into 5 ml of LB/Kanamycin (COSMIDS)

(50 ml LB/20 µl Kanamycin) or 5 ml LB/chloramphenicol (BACS) (50 ml LB/25µl

chloramphenicol) and shaken at 225 rpm, overnight at 37°C. Following this, the culture

was centrifuged at 9000 x g for 15 min at 4°C and the pellet resuspended in 20 ml of

buffer P1 (QIAGEN, maxi-preps). Then buffer P2 was added and the suspension was

inverted 6 times and left to stand at RT for 5 min. Then buffer 3 was added and the

solution inverted 6 times, left on ice for 5 min, and then centrifuged at 20000 x g for 30

min at 4°C. The supernatant was then collected and 84 ml of RT isopropanol was added,

mixed, and then left at RT for 10 min. The solution was then centrifuged at 22000 x g for

30 min at 4°C. Following this, the supernatant was discarded and the DNA pellet was

resuspended in 1 ml of nuclease-free water with the addition of 60 µl of RNase A

(Roche). The solution was then incubated at 37°C for 30 min. The DNA was then

extracted as outlined in Section 2.7.2, and the concentration was determined

spectrophotometrically, where 1OD at 260nm was equated to approximately 50 µg/ml of

DNA.

41

2.11. REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION (RT-

PCR).

2.11.1. Reverse Transcription

Two µg of total RNA was reversed transcribed into complementary DNA (cDNA) using

SuperScript II Reverse Transcriptase as instructed by the manufacturer (Life

Technologies). Total RNA (2 µg) was mixed with an oligo dT primer d(T)18 (Life

Technologies) (100 ng/µl) and heated at 70°C for 10 min. Then, deoxynucleotide

triphosphates (dATP, dTTP, dGTP and dCTP; 10 mmol/L), cDNA synthesis buffer (1 X),

dithiothreitol (DTT, 0.01 mol/L) and SuperScript II (1U) were added and the reaction

incubated for 60 min at 42°C. To inactivate the enzyme, the reaction was heated at 70°C

for 15 min. All cDNA samples were aliquoted into smaller volumes (5 µL) and stored at

-20°C.

2.11.2. The Polymerase Chain Reaction (PCR)

All PCR cycles were performed on a PTC-200 Peltier thermal cycler DNA Engine

(Bresatec, South Australia). The PCR reactions were performed in a final volume of 20

µl containing the following reagents: 2 µl of 10 X buffer containing 1.5 mmol/L Mg2+

(Roche), 0.2 µl of Platinum Taq (Life Technologies) or the proof-reading enzyme pfu

(Life Technologies) (see PCR of promoter constructs, Chapter 5), 0.2 µl of 10 mmol/L

dNTPs (Roche), 0.25 µl of 100 ng/µl forward and reverse primers (see specific

experiments) and 1 µl of cDNA template. PCR amplification parameters were performed

as outlined in each specific experiment.

2.12. ELECTROPHORESIS OF PCR AMPLICONS

All PCR amplicons were electrophoresed and separated by molecular size on either 1 or

2% (w/v) agarose gels. The agarose was dissolved in 1 X TAE (Tris Acetate Ethylene

diaminetetra-acetate, EDTA) buffer and microwaved at high settings for 1-2 min and

cooled to approximately 50°C. To this solution 1 µl of ethidium bromide (10 mg/ml)

was added per 100 ml) and the gel was left to set for 30 minutes before the PCR

amplicons were loaded. The PCR products (10 µl) were mixed with either 1 µl of

42

loading dye (0.25% bromophenol blue, 0.25% xylene cynol, 30 % glycerol) or 1 µl of

Rose Pink food dye (Queen, Alderley, Brisbane) that was made up in a 1:1 food dye:

80% glycerol concentrate. This dye was used to monitor the migration of the amplicons

in the gel system as this dye runs at approximately 40 base pairs (bp) and therefore does

not “shadow” the amplicons under test. The electrophoresis was carried out at 100V in a

BioRad Minigel System (BioRad, Sydney, Australia) for approximately 30 minutes and

the image was captured using a Syngene UV system (Gene Works, Adelaide, SA,

Australia).

2.13 SOUTHERN BLOTTING ANALYSIS

Southern blot analysis and the subsequent probe labelling and hybridisation procedures

(2.13.1 to 2.13.3) are outlined in The DIG Systems User’s Guide for Filter Hybridisation

(Boehringer Mannheim, 1995) and are outlined below.

2.13.1. Preparation of PCR Amplicons for Southern Blot Analysis

Following electrophoresis, the PCR amplicons in the agarose gel were denatured by the

addition of denaturing solution (1.5 mol/L NaCl, 0.5 mol/L NaOH) for 20 min with

gentle agitation. Then, the gel was soaked in neutralisation buffer (1.5 mol/L NaCl, 0.5

mol/L Tris, pH 7.4) for a further 20 min. Transfer of the resulting denatured amplicons

to a positively charged nylon membrane (Hybond NTM, Amersham, Sydney, Australia)

was achieved by capillary transfer for approximately 12 hours using 20 X sodium

chloride, sodium citrate (SSC), as described by Sambrook and Russell, (2001).

Following the transfer, the membrane was incubated in a solution of 2 X SSC and washed

for 5 minutes. UV cross-linking for approximately 3 minutes then permanently fixed the

PCR amplicons to the membrane.

2.13.2. 3’-Digoxigenin-deoxyuraciltriphosphate (DIG-dUTP) Oligonucleotide Probe

Labelling

Oligomers (see specific experiments) were labelled at the 3’ end with the alkaline labile

DIG-dUTP labelling kit (Roche) by mixing 25 pmoles of oligomer with a 1 in 10 dilution

of Terminal Transferase buffer, 5 mmol/L of CoCl2, 0.05 mmol/L of DIG-dUTP, 0.5

43

mmol/L of dATP, 25 units (25U) of terminal transferase, and sterile water to a final

volume of 20 µl. The labelling reaction was then incubated at 37°C for 15 min and

stopped by the addition of 0.01 mol/L EDTA to stop the reaction. All labelled probes

were aliquoted in smaller volumes and stored at -20°C.

2.13.3. DNA Hybridisation

Southern blotted membranes (section 2.13.1) were pre-hybridised in DIG-Easy Hyb

(Roche) for approximately 20 min at 37°C in a hybridisation oven. Following the pre-

incubation period, fresh 37°C DIG-Easy Hyb (4 µl), 1 µl of specific kallikrein DIG-

labelled oligonucleotide probe (see specific experiments) and 80 µl of denatured Salmon

sperm (10 mg/ml) was added and the membranes incubated overnight at 37°C in a

hybridisation oven with constant rolling. Following hybridisation, the membranes were

rinsed in deionised water and washed consecutively at 37°C for 20 min each in solutions

containing 0.5 X SSC, 0.1% w/v sodium dodecyl sulphate (SDS), 0.2 X SSC, 0.1% w/v

SDS and 0.1 X SSC, 0.1% w/v SDS. This procedure removes the unbound and loosely

bound non-specific probe from the membrane. The membranes were then equilibrated in

washing buffer (0.1 mol/L Tris (pH 7.5), 0.15 mol/L NaCl, 0.3% v/v Tween 20) for 5

min. To block non-specific binding sites, the membrane was incubated in 1% Casein

(1% Casein in 0.1 mol/L Tris-HCl, pH 7.5, 80 µl of denatured Salmon sperm) for

approximately 60 minutes at room temperature. Following the blocking procedure, an

anti-DIG-AP antibody (Roche) (Fab fragments conjugated to alkaline phosphatase)

diluted 1 in 20,000 in 0.5% Casein was added to the membranes and incubated at room

temperature for approximately 30 minutes. The membranes were then washed four times

(10 minutes each) at room temperature in washing buffer and then equilibrated for 5

minutes in detection buffer (0.1 mol/L Tris pH 9.0, 0.1 mol/L NaCl). To detect the

hybridised probes, CDP-starTM (Roche) (a chemiluminescence alkaline phosphatase

substrate) was diluted 1 in 200 in detection buffer then applied evenly over the membrane

for 10 minutes. The membranes were then exposed to an X-ray film (Curix Blue HC-S

plus, Curix, Agfa, Brisbane, Australia) and developed in a Curix 60 automatic developer.

44

2.14. ANTIBODY DESIGN FOR K4

Peptides for generation of kallikrein 4 (K4) polyclonal antibodies were designed by Dr.

Tracey Harvey, QUT by overlaying a three-dimensional model of the K4 protein on K3

(prostate-specific antigen, PSA) (data not shown) to determine potential antigenic targets.

Three distinct epitopes were identified and the corresponding amino acid sequences from

these epitopes were analysed by BLAST program (www.ncbi.nlm.nih.gov) to ensure

specificity. From these sequences, the peptide Ac-SEEVCSKLYDPLYHPS-NH2 (Ac-

acetyl) (K4 #673305) corresponding to amino acid residues 174-189 of the hK4 protein

(Stephenson et al., 1999), was used to generate the anti-peptide antibody used in this

thesis. Both the peptide and anti-peptide antibody was manufactured by Chiron

Technologies, Victoria, Australia. New Zealand White Rabbits (6-24 months old) were

immunized with the above peptide sequence and the resulting polyclonal antibody was

affinity purified (Chiron).

2.15. SODIUM DODECYL SULPHATE-POLYACRYLAMDE GEL

ELECTROPHORESIS (SDS-PAGE).

SDS-PAGE using 12% resolving gels was used to separate total protein. A total of 10 µg

of total protein extract was boiled for 5 min in loading buffer (250 mmol/L Tris-HCl, pH

6.8, 2% SDS, 10% glycerol, 20 mmol/L β-mercaptoethanol, 0.01% bromophenol blue)

and electrophoresed in running buffer (0.025 mol/L Tris, 0.25 mol/L glycine, 0/1% w/v

SDS, pH 8.3) on a Protean II Minigel Apparatus (BioRad, Sydney, Australia). SDS-

PAGE gels were run at 70 volts until the loading dye had reached the end of the stacking

gel, and then at 100 volts until the loading dye was approximately 1 cm from the bottom

of the resolving gel. A pre-stained molecular weight protein marker (low range, BioRad)

was used to determine the molecular sizes of the resulting bands.

2.15.1 Western Blotting Analysis

The proteins separated by SDS-PAGE were then transferred to a nitrocellulose membrane

(Protran, Schleicher and Schell, Medos, Brisbane, Australia) using a transfer blot

apparatus (BioRad). Initially, the nitrocellulose membrane and the SDS-PAGE gel were

equilibrated in 3-[cyclohexylamino]-1-propane-sulfonic acid (CAPS) buffer (Sigma) with

45

the addition of 10% methanol, or 1 X carbonate buffer (40 X stock, 16.8g NaHCO3,

6.35g Na2CO3, pH 9.9 with the addition of 10% methanol to a 1 X solution) for 15

minutes at room temperature. The protein samples were then electrotransfered to a

nitrocellulose membrane in CAPS or 1 X carbonate buffer, for 40 minutes at 4°C using

constant current of 200 milliamps. To monitor transfer efficiency and equal protein

loading, the membrane was stained with Ponceau S (Sigma) for 5 minutes, rinsed in tap

water and the resulting proteins visualised. Following the Ponceau S staining, non-

specific protein binding sites were blocked by incubating the membrane in 5% w/v skim-

milk power diluted in 0.5 % Tween-20 in Tris-buffered saline (TBS-Tween) overnight at

4°C.

The primary anti-peptide K4 antibody (#673305) or KLK-L1 (K4) antibody (Novus

Biologicals, Littleton, CO, USA) was then diluted 1:1000 or 1:2000, respectively in TBS-

Tween and incubated with the membrane at RT for 60 min. Secondary antibodies (anti-

rabbit HRP-conjugate for K4 or KLK-L1) were diluted 1:1000 in TBS-Tween and

incubated with the appropriate membrane at room temperature for 60 min. Following

secondary antibody incubation and washing in TBS-Tween (4 x 15 min), Lumi-Light

plus Western Blotting Substrate Solution (Pierce) was applied directly to the membrane

as directed by Pierce. Detection of K4 was carried out using X-ray film (Curix Blue HC-

S plus, Curix, Agfa, Brisbane, Australia) to visualise the chemiluminescence signal.

2.16. TRANSCRIPTION INITIATION START SITE (TIS) MAPPING.

To directly identify the TIS, and thus the regulatory regions of the KLK4 gene, primer

extension analysis with a 32P or FAM-labelled primer, and RLM-RACE was performed

as outlined below.

2.16.1. Phosphorus 32 [γ32P]-ATP Labelled Primer Extension.

For the [γ32P]-ATP primer extension, three KLK4-specific primers were used; exon 3a/s,

exon 4a/s and exon 5a/s (100pmol/µl) (see Chapter 4, Table 4.1 and Figure 4.5 for

sequences and the gene-specific location). These were labelled, along with the control

primer as outlined in the manufacturer’s protocol (Promega, Brisbane, Australia). The

46

control primer (Promega) (5pmol/µl; 2µl) and the three KLK4-specific primers (2 µl of

each) were mixed with T4 polynucleotide kinase (T4PNK) buffer (1 µl), T4

polynucleotide kinase (10U), [γ-32P]-ATP (3,000Ci/mmol) (Geneworks, Adelaide,

Australia) and sterile water to a final volume of 10 µl. This solution was then incubated

at 37°C for 10 min and subsequently heated at 90°C for 2 min. The control primer was

diluted to 100 µl (100 fmol/µl) and the test primers to 200 µl (1000 fmol/µl). For each

separate reaction, the following reagents were added: control RNA (1.2 Kb Kanamycin

positive control RNA, 5 µl) and T47D RNA (20 µg), [γ32P]-ATP labelled primer, 2 X

AMV extension buffer (5 µl) and sterile water to 11 µl. All the reactions were placed at

58°C for 20 min followed by RT incubation for 10 min. Following this, each reaction

mixture was combined with 2 X AMV extension buffer (5 µl), Sodium pyrophosphate

(40 mmol/L, 1.4 µl), AMV reverse transcriptase (1U) and sterile water to a final volume

of 9 (l and subsequently incubated at 42(C for 30 min. After the final incubation, the

solution was mixed with 20 (l of loading dye (Promega) and each tube heated at 90(C for

10 min, pulse-centrifuged and loaded directly onto a 8% sequencing gel (see below

2.16.2). The gels were then run at 250V for approximately 6 hr, wrapped in plastic film

wrap, dried at 80(C, placed in an X-ray film box and exposed to X-ray film (Curix Blue

HC-S plus, Curix, Agfa, Brisbane, Australia) without an intensifying screen overnight or

for 1 week at -70(C. Following exposure, the X-ray film was developed in a Curix 60

automatic developer.

2.16.2. Primer Extension 8% TBE Sequencing Gel

Primer sequencing gels, (2.16.1) were prepared as follows. Twenty-one grams of urea

was mixed with 10 ml of 40% acrylamide (BioRad, Sydney, Australia) and the total

volume brought up to 30 ml with sterile water. This solution was then filter sterilized

through a 10 ml syringe followed by the addition of 5 ml of 10 X TBE and the total

volume brought up to 45 ml with sterile water. Sixty-five (l of ammonium persulfate

(APS, 25%) and 50 (l of TEMED (N,N,N’,N”-Tetramethylethylenediamine) (BioRad)

was then added, mixed and the gel poured and left at room temperature to polymerise.

47

2.16.3. Carboxyfluorescein (CF)-Labelled Primer Extension

The anti-sense KLK4 primers, K4PE110 and K4PE50 (Life Technologies) (5’-

CAGTCCTCGCCGTTTATGATT-3’ and 5’-AGGATGAGGTACCCCAGGAAC-3’,

respectively), were labelled at the 5’ end with a 5’-carboxyfluorescein (FAM) (Life

Technologies). The primer extension assay was carried out as follows: To 40 (g of

T47D total RNA, 4 (l of CF-labelled primer (100 ng/(l) was added and the reaction

mixture was diluted in nuclease-free water to 30 (l, followed by heating at 65(C for 5 min

and then placed on ice. Subsequently, 5 X cDNA buffer, 0.1 mol/L DTT, RNase Out, 10

mmol/L dNTPs and SuperScript II (Life Technologies) was added and the reaction

incubated at 50(C for 60 min. The cDNA was then precipitated with isopropanol for 60

min at -20(C, centrifuged at 12000 x g for 10 min at 4(C and the pellet washed twice in

70% ethanol. The samples were then sent for size analysis to the Australia Genome

Research Facility (AGRF), The Walter and Eliza Hall of Medical Research, Melbourne,

Australia.

2.16.4. 5’ RNA Ligase Mediated-Random Amplification of Complementary Ends (RLM-

RACE)

2.16.4.1. Calf-Intestinal De-Phosphorylation of Non-Capped RNA and Precipitation

To identify the transcription initiation site (TIS), 5'-RLM-RACE (FirstChoice RLM-

RACE kit, Ambion, Texas, USA) was performed essentially according to the

manufacturer’s instructions, except Superscript II reverse transcriptase was typically used

instead of AMV for the synthesis of the cDNA. To dephosphorylate non-capped RNA,

10 (g of total RNA was incubated at 37 (C for 60 min with 2 (l of calf intestinal

phosphatase (CIP), 2 (l of 10 X CIP buffer and nuclease-free water to 20 (l. To terminate

the CIP reaction and extract the RNA, 15 (l of ammonium acetate solution (0.5 mol/L),

115 (l of nuclease-free water and 150 (l of acid phenol:chloroform (pH 4.2) was mixed

thoroughly with the RNA by vortexing the sample and centrifugation at 14000 x g for 5

min at RT. Following this, the aqueous phase was removed and 150 (l of chloroform was

added, the sample vortexed and centrifuged at 14000 x g for 5 min at RT. The aqueous

phase was again removed and 150 (l of isopropanol was added, vortexed thoroughly and

left at -20(C for at least 60 min to precipitate the RNA. Following precipitation, the

48

sample was centrifuged at 14000 x g for 20 min and the RNA pellet rinsed in ice-cold

70% ethanol and air-dried and dissolved in 11 (l of nuclease-free water. One (l was

removed for the no TAP treatment below (2.16.4.2).

2.16.4.2. Tobacco Acid Pyrophosphatase (TAP) Treatment to Remove the 7-Methyl-

Guanosine, (m7G) 5’CAP-Site from Capped RNA

To remove the m7G from capped RNA, the sample was incubated with 5 (l of CIP-

treated RNA, 1 (l of 10 X TAP buffer, 2 (l of tobacco acid pyrophosphatase (TAP) and 2

(l of nuclease-free water and the sample incubated for 60 min at 37(C. The 1 (l removed

from 2.16.4.1 for the no TAP treatment was also processed this way, except no TAP was

added and instead 3 (l of nuclease-free water was substituted. The no TAP treated

sample was also processed exactly as the TAP sample from this point.

2.16.4.3. Ligation of the RNA 5’ RLM-RACE Adapter

Following the TAP reaction, an RNA 5’RLM-RACE adapter oligonucleotide sequence

5’-GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA-3’

was incubated with 5 (l of CIP/TAP-treated RNA and the no TAP RNA, by the addition

of 1(l of adapter (0.3 (g/ml), 1 (l of 10 X RNA ligase buffer, 1(l of T4 RNA ligase (2.5

U/(l) and 4 (l of nuclease-free water and incubated at 37(C for 60 min.

2.16.4.4. Reverse Transcription of the CIP/TAP, RNA Adapter-Ligated RNA

To synthesise complementary DNA (cDNA), 2 µl of ligated RNA, and no TAP RNA,

was mixed with 4 µl of dNTPs (deoxynucleotide triphosphates, dATP, dCTP, dGTP and

dTTP, 10 mmol/L), 2 µl of random decamers (100 ng/µl), 2 µl of SuperScript II (Life

Technologies) or MMLV 10 X reaction buffer, 1 µl of RNase inhibitor and 1 µl of

SuperScript II or MMLV transcriptase and nuclease-free water to 20 µl. The samples

were then mixed gently, and incubated at 42°C for 60 min.

2.16.4.5. Polymerase Chain Reaction (PCR) from 5’RLM-RACE cDNA

First round PCR was performed in a final volume of 20 µl with the addition of 0.25 µl of

49

the 5’RLM-RACE outer primer (sense, 5’-GCTGATGGCGGATGAATGAACACTG-3’,

10 µmol/L and a KLK4 gene-specific outer primer, K4PE242, anti-sense, 5'-

AGCCCGATGGTGTAGGAGTT-3', 10 µmol/L), 0.2 µl of platinum Taq (Life

Technologies), 0.2 µl of 10 mmol/L dNTPs, 2 µl of 10 X reaction buffer (Roche) and 1 µl

of cDNA. PCR parameters were 94°C for 5 min, followed by 35 cycles of 94°C

denaturation (30 sec), 55°C annealing (30 sec), 72°C extension (1 min) and a final 72°C

extension for 10 min. Second round PCR was performed as the first round PCR except

5µl of first round PCR product was used as the template, and the volumes were all scaled

up 2-fold. Additionally, the 5’RLM-RACE inner primer (sense, 5’-

CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG-3’, 10 µmol/L) and the KLK4

gene-specific inner primer, K4PE238, anti-sense, 5' CGATGGTGTAGGAGTTCTGGAA

ACAGTG-3', 10 µmol/L) was used in the second round PCR. The annealing temperature

was set at 62°C and 40 cycles were performed. PCR products were electrophoresed on a

2% agarose gel and the products visualized by ethidium bromide staining and UV light.

2.17. CLONING

In order to sequence the PCR products of interest, the PCR amplicons were purified,

ligated into pGEM-T Easy Vector Systems (Promega, Annandale, Australia), transformed

into high efficiency JM109 competent E. coli cells, (Life Technologies) and screened by

blue/white colony selection as described below.

2.17.1 PCR Amplicon Gel Excision and Purification

PCR amplicons of interest were visualised under UV light and excised from agarose gels

using a sterile scalpel blade. The purification of the PCR amplicons was performed using

a QIAGEN DNA extraction kit as per the manufacturer’s procedures (QIAGEN,

Melbourne, Australia).

2.17.2. Ligation of PCR Amplicons Into pGEM-T Easy Vectors

PCR products were cloned into pGEMT-T (Promega) by following the supplier’s

methods. Briefly, 3 µl of purified PCR amplicons (approx. 50 ng), 5 µl of 2 X rapid

50

ligation buffer, 1 µl of pGEM-T Easy Vector (50 ng), and 1 µl of T4 DNA ligase (3

Weiss units/µl) were mixed and incubated at RT for 60 min or overnight at 4°C.

2.17.3. Transformation of pGEM-T Easy Vector Into JM109 High Efficiency E. coli,

Competent Cells by Heat-Shock

The ligated pGEM-T Easy vectors (containing the PCR amplicon of interest) were then

transformed into JM109 bacterial cells (Life Technologies) by mixing 3 µL of ligation

mixture and 40 µL of JM109 cells and incubating on ice for 20 min. Following this, the

transformation was performed by heat shocking the JM109 bacterial cells at 42°C for 40

sec. The transformed cells were then incubated in 960 µl of medium containing 2.0 g of

Bacto-tryptone, 0.5 g Bacto-yeast extract, 1 ml of 1 mol/L NaCl, 0.25 ml of 1 mol/L

KCl, 1ml of 2 mol/L Mg2+ and 1 ml of 2 mol/L glucose, and shaken at 225 rpm for 60

min at 37°C.

2.17.4 Plating of Transformation Cultures onto LB/Ampicillin/IPTG/X-Gal Plates

Following the 37°C incubation of the transformation culture, centrifugation of the culture

was performed at 14000 x g for 2 min and the resulting supernatant removed. The

bacterial pellet was then resuspended in 100 µl of Luria Bertani (LB) medium (LB; 10 g

Bacto-tryptone, 5 g Bacto-yeast extract, 5 g of NaCl per litre) and spread out on LB

ampicillin/IPTG/X-Gal plates (LB plates; 15 g agar to 1 litre of LB medium, ampicillin to

a final concentration of 100 µg/ml, 0.5 mol/L IPTG and 80 µg/ml of X-Gal) and

incubated at 37°C overnight.

2.17.5. Identification of Positive Colonies

The pGEM-T Easy Vector contains a multiple cloning site within the lacZ gene that is

involved in lactose metabolism. Thus, using this selection process, colonies that remain

blue can still use the lacZ gene and therefore have no insert, while colonies that cannot

use the lacZ gene have an insert and appear white. Subsequent white and control blue

colonies (no insert) were picked and grown up in LB (10 ml) with 100 µg/ml AMP for 16

hr at 37°C with shaking at 225 rpm. Following this, the samples were centrifuged at

51

3000 x g for 5 min to collect the bacterial cell pellets and then prepared for plasmid

extractions as outlined below (2.17.6).

2.17.6. Extraction of Plasmid DNA Containing Inserts from the Bacterial Cell Pellets

The extraction of plasmid DNA was performed using the QIAprep spin Miniprep Kit as

outlined by the manufacturer (QIAGEN).

2.18. DNA SEQUENCING

Sequencing of resulting DNA products was performed by mixing approximately 500 ng

of sample with 8 µl of BigDye 2 Terminator mix (Applied Biosystems, Melbourne,

Australia) and 0.25 ng of gene-specific primers (see individual experiments) in a final

volume of 20 µl of nuclease-free water. The reaction was then carried out in a thermal

cycler with an initial 94°C denaturation step, followed by a 15 sec annealing step at 45°C

and a 4 min extension at 72°C for 25 cycles. To precipitate the samples, a 1/10 volume

of sodium acetate (3 mol/L, pH 5.2) and 2.5 volumes of 100% ethanol were added and

the sample left at -20°C for 60 min. Following this, the sample was centrifuged at 14000

x g for 20 min and the supernatant remove. The DNA pellet was then washed in 70%

ethanol and centrifuged at 14000 x g for 5 min. Automated fluorescent sequencing using

the ABI BigDye terminator was performed, at the Australian Genome Research Facility,

University of Queensland, Brisbane, Australia.

2.19. GENE ANALYSIS

2.19.1. Identification of Putative Regulatory Elements in the KLK4 Gene Promoter.

To identify regulatory elements in the putative promoter region of the KLK4 gene, three

independent gene analysis programs, MatInspector, SigScan and Cister (Quandt et al.

1995; Prestridge, 1991 and Frith. et al., 2003, respectively) were used. Approximately 3

Kb of the KLK4 promoter region (Gene Bank accession number: AF243527) was

screened for putative regulatory elements (see Chapter 4). All of the above programs

were maintained in the default position and the signal classes were set to mammalian.

52

2.20. REPORTER GENE ASSAYS ON THE KLK4 PROMOTER

In order to study the regulatory regions of the KLK4 gene, a number of KLK4 promoter

PCR amplicons were cloned into the pGL3-basic Luciferase reporter vector (Promega)

(see Chapter 5). These constructs were then transfected into the T47D breast cancer cell

line and assayed for reporter signals as described below.

2.20.1. Preparation of the pGL3-Basic Luciferase Reporter Vector for the Ligation of

KLK4 Promoter Constructs

In order to ligate the KLK4 promoter constructs into the pGL3-basic vector, this vector

was digested and de-phosphorylated as follows. A 20 µl reaction consisting of 2 µg of

pGL3-basic, 1 µl of HindIII, 1 µl of XhoI, 2 µl of R+ buffer (Progen, Brisbane, Australia)

was incubated at 37°C for 60 min. To determine the efficiency of the restriction digest 1

µl of digested sample and control (uncut) sample were electrophoresed. The remaining

digest was then incubated with 2 µl of calf intestinal phosphatase (CIP, Roche), 10 µl of

10 X CIP buffer in a 50 µl reaction at 37°C for approximately 60 min. Heating the

sample at 65°C for 15 min then stopped the reaction. The sample was then purified

through a QIAGEN DNA column as previously described. DNA sequencing was carried

out as described in 2.18 with KLK4-specific primers (see Chapter 5).

2.20.2. Ligation of KLK4 PCR Products into pGL3-Basic Luciferase Reporter Vectors

In order to clone PCR products amplified from the “proof reading” enzyme, pfu, into

pGEM-T, A-tailing of the PCR amplicons was performed. To approximately 800 ng of

PCR product, 1 µl of Platinum Taq (Life Technologies), 1 µl of 10X buffer, 1 µl of 2

mmol/L dATP and 3 µl of nuclease-free water was added and the solution incubated at

70°C for 30 min. Following this, the KLK4 PCR constructs (Chapter 5) were ligated into

pGEM-T Easy vector (Promega) as previously described 2.17.2 to 2.17.6, then released

from the vector using the restriction enzymes XhoI and Hind III and ligated into pGL3-

basic by the following method. One µg of pGEM-T Easy Clone vector containing the

KLK4 promoter constructs of interest were digested in the presence of 1 µl of XhoI and 1

µl of Hind III (Progen), 2 µl of 10X R+ buffer (Progen) and water to 20 µl at 37°C for 60

53

min. Following this, the samples were electrophoresed on a 1% agarose gel to determine

the extent of the digest. Digested KLK4 promoter constructs were then gel purified

through a QIAGEN DNA column (QIAGEN) as previously described. The KLK4

promoter constructs were then ligated into pGL3-basic by adding 3 µl of KLK4 promoter

template, 1 µl of restriction digested, de-phosphorylated pGL3-basic vector, 5 µl of 2 X

ligation buffer and 1 µl of ligase (Promega) and the sample incubated at RT for 60 min.

Ligated samples were then transformed into JM109 cells, grown and purified as

described previously (2.17.3-2.17.6).

2.20.3. Transfection of KLK4 pGL3 Promoter Constructs into T47D Breast Cancer Cell

Lines

To transfect the KLK4 pGL3-basic promoter constructs and assay for KLK4 promoter

activity, T47D cell lines were seeded at approximately 2.5 x 104 cells into 24-well plates

in DMEM (Life Technologies) with 10% heat-inactivated fetal calf serum (FCS) (Life

Technologies) without antibiotics and incubated at 37°C until approximately 90%

confluent. Then, 1 µg of KLK4 pGL3-basic vector plus 300 ng of control Renilla vector

(pRL-TK, Promega) was diluted in 50 µl of Opti-MEM-I reduced Serum Medium (Life

Technologies) and 3 µl of LipofectamineTM 2000 (LF2000, Life Technologies) in 50 µl of

Opti-MEM-I was added and mixed. This sample was then left at RT for 20 min and 100

µl was added to each well and incubated at 37°C for 24 hr. Furthermore, a pGL3 control

vector (1 ug) that contains a constitutively active SV40 promoter was also transfected

into T47D cell lines by the above method. After 24 hr, the cells were washed in PBS and

new medium was replaced and/or fresh medium added containing either 10 nmol/L

estradiol or 10 nmol/L progesterone (Sigma) and the samples incubated for a further 24

hr.

2.20.4. Reporter Gene Assays

Following the 24 hr incubation, the cells were rinsed in 1 X PBS and 100 µl of passive

lysis buffer (PLB, Promega) was added to each well and incubated with gentle shaking at

54

RT for 15 min. Then, 100 µl of LAR II (Luciferase Assay Reagent, Promega) was pre-

dispensed into a 1.5 ml tube and 20 µl of the PLB lysate was added and mixed. This was

then measured for luciferase activity with a luminometer. Then, 100 µl of Stop and Glo

reagent (Promega) was added and the Renilla luciferase activity was measured.

2.21. ELECTROMOBLITY SHIFT ASSAY AND SUPER SHIFT ASSAYS.

2.21.1. Design of KLK4 DNA constructs

The DNA elements to be used in the electromobility shift assays were all synthesised

with their complementary sequence (Proligo, Lismore, Australia) (see Chapter 6). These

were all labelled PRE0-PRE11 (Progesterone Response Element) and represent wild type

(PRE0) or deletion/mutant (PRE1-11) constructs. A control unrelated oligomer was also

used to monitor binding specificity (see Chapter 6).

2.21.2. 3’ Biotinylation of KLK4 DNA Constructs (Table 2.1)

Biotinylation (Pierce) of the 3’ end of the specific KLK4 oligonucleotides was performed

by mixing 5 pmoles of oligonucleotide with 5 X terminal transferase buffer (5 µl), 2.5 µl

of Biotin-N4-CTP (Pierce), 0.2U/µl of terminal transferase and a total volume of 25 µl of

nuclease-free water. This solution was then incubated at 37°C for 30 min followed by

the addition of 0.2 mol/L EDTA to stop the reaction. All 3’-biotinylated samples were

then stored in 5 µl aliquots at -20°C.

2.21.3. Electromobility Shift Assay (EMSA) Preparation

The EMSA was performed using a LightShift kit essentially as per the manufacturer’s

protocol (Pierce). The initial binding reaction was performed by mixing 10 µg of T47D

nuclear extracts (5 µl) or EBNA extract control (Pierce), with 10 X binding buffer (2µl),

50% glycerol (1 µl), 100 mmol/L MgCl2 (1 µl), 1 µg/µl Poly (dI•dC) (1 µl), 1% NP-40

(1 µl), 3’-biotinylated KLK4 probe (1 µl, 200 fmoles, see specific experiments, Chapter

6) or Biotin-EBNA control probe, 5’-Biotin-TAGCATATGCTA-3’ (20 fmoles) and

nuclease-free water to 20 µl. The reaction was then incubated at RT for approximately

30 min followed by the addition of 5 µl of loading buffer (Pierce).

55

2.21.4 Preparation of a 6% EMSA Gel

To perform electrophoresis on the binding reactions, the preparation was mixed, pulse-

centrifuged and loaded onto a 6% acrylamide sequencing gel. This was prepared by

dissolving 21 g of urea in 10 ml of acrylamide (40%) and 20 ml of deionised water on a

heated (37°C) stirrer. Once the urea was dissolved, the solution was filter sterilised, and

5 ml of 10 X TBE (tris-buffered EDTA), 65 µl of a 25% ammonium persulphate solution

(APS), 50 µl of TEMED, and deionised water to 50 ml was added. The solution was then

poured between two glass plates and a 0.5 mm, 20 tooth-comb (BioRad) was placed into

position. Once the gel was polymerised, it was placed in a Protean3 gel chamber

apparatus (BioRad).

2.21.5. Electrophoresis and Transfer of EMSA Products

The EMSA samples (from 2.21.3) were loaded and electrophoresis in 1 X TBE was

performed at 300 volts until the dye front was approximately 2 cm from the bottom of the

gel. Following this, the gel was carefully removed and placed on wetted 3 mm paper.

The transfer of the EMSA products was then performed exactly as the capillary transfer

as described by Sambrook and Russell, (2001). Following the capillary transfer, the

DNA was cross-linked to a nylon membrane (Hybond NTM, Amersham) by UV for

approximately 2 min.

2.21.6. Detection of EMSA Products by Chemiluminescence

To detect any electromobility shift from the assembly of protein onto the DNA

constructs, a detection system utilising chemiluminescence substrates was used (Pierce).

To perform the detection, the membrane was blocked in 20 ml of LightShiftTM Blocking

Buffer for 15 min at RT. The membrane was then incubated in 20 µl of LightShiftTM

Stabilised Streptavidin-Horseradish Peroxidase Conjugate diluted in 10 ml of

LightShiftTM blocking buffer for 15 min at RT. The membrane was then washed 4 x 15

min in LightShiftTM Wash Buffer followed by equilibration with 10 ml of LightShiftTM

equilibration buffer. The detection was then performed by the addition of 6 ml of

Luminol/Enhancer solution and 6 ml of stable peroxidase solution to the membrane for 5

min. This was then briefly washed from the membrane by deionised water and the

56

detection was performed on an X-ray film (Curix Blue HC-S plus, Curix, Agfa, Brisbane,

Australia) and visualisation of the chemiluminescence signal.

2.21.7. Super Shift Assay

The supershift assay was performed exactly as described above for the EMSA (2.21.3)

except antibodies to the progesterone (Santa Cruz Biotechnology, California, USA) and

androgen (Upstate Biotechnology, New York, USA) receptors (PR and AR, respectively)

were added to the DNA/nuclear extract or nuclear extract alone, prior to the gel

electrophoresis (see Chapter Six for specific details).

2.22. CHROMATIN IMMUNOPRECIPITATION (ChIP) ASSAY.

ChIP was performed essentially as described by Shang et al., 2000. T47D cell lines were

grown in phenol red-free DMEM (Life Technologies), supplemented with 2% charcoal-

stripped FCS. After 72 hours of cultivation, the cells were treated with 100 nmol/L of

progesterone (Sigma) for various times (see Chapter 6). Following steroid induction, the

cells were washed in PBS and cross-linked with 1% formaldehyde for 10 min at 37°C,

followed by two 5 min washes with ice-cold PBS and centrifuged at 1000 x g for 5 min.

The pellets were re-suspended in 300 µL of cell lysis solution (10 mmol/L Tris-pH 7.5,

NaCl 150 mmol/L, 1% triton X-100, protease inhibition cocktail tablet (Sigma) and

sonicated at 50% power for 3 x 10 sec bursts. Following centrifugation for 10 min at

10000 x g, the supernatants were collected and diluted in dilution buffer 1 (1 mL) (1%

Triton X-100, 2 mmol/L EDTA, 150 mmol/L NaCl, and 20 mmol/L Tris-HCl, pH 8.1).

At this point, 50 µL of supernatant was collected from each time point as the “input”

control. Immunoclearing was performed with a 1:1 slurry of sheared herring sperm DNA

and protein A-agarose for 2 hr at 4°C. Immunoprecipitation was performed for 16 hr at

4°C with 2 µg of PR antibody (Santa Cruz, Biotechnology, California, USA).

Following immunoprecipitation, a 1:1 slurry of sheared herring sperm and protein A-

agarose was added to the solution and further incubated at 4°C for 1 hr, followed by

centrifugation at 1000 x g for 5 min. The pellet was then washed sequentially for 15 min

each in the following wash solutions: Low salt wash buffer (LSWB: 0.1% SDS, 1%

57

Triton X-100, 2 mmol/L EDTA, 20 mmol/L Tris-HCl, pH 8.1 and 150 mmol/L NaCl),

High salt wash buffer (HSWB: as above for LSWB except 500 mmol/L NaCl was used)

and LiCl wash buffer (0.25 mol/L LiCl, 1% NP-40, 1% deoxycholate, 1 mmol/L EDTA

and 10 mmol/L Tris-HCl, pH 8.1). Following centrifugation at 1000 x g for 5 min, the

pellet was washed three times with 500 µL of TE solution and the DNA/protein

complexes were extracted three times with 50µL of 1 % SDS, 0.1 mol/L NaHCO3. All

three eluates were pooled and heated at 65°C for 6 hr to reverse the formaldehyde cross-

linking. The samples were then purified through a DNA purification system (High Pure,

Roche) and eluted in 30 µL of DNase-free water. Quantification of the DNA

concentration was carried out using DNA spectrophotometric analysis (GeneQuant) and

sequencing of the PCR amplicons was performed as outlined in section 2.18. For the

PCR reactions, 10 ng of DNA was used. Each PCR reaction was carried out in 20 µL as

above for the RT-PCR (see specific primer details in Chapter 6).

CHAPTER 3

THE EXPRESSION AND HORMONAL REGULATION OF

KALLIKREINS 1-4 (KLK1-4), IN HORMONE-DEPENDENT

CANCER CELL LINES OF THE ENDOMETRIUM AND

BREAST

59

3.1. INTRODUCTION

Is well established that the onset and development of hormone-dependent cancer (HDC)

is the result of estrogen and progesterone acting on “down-stream” target genes involved

in tumourigenesis (Terakawa et al., 1996; Sutherland et al., 1999). As noted in Chapter

One, one such family of target genes, that are expressed in both endometrium and breast

and are regulated by estrogen and progesterone, are the tissue kallikreins (KLKs)

(reviewed in Diamandis et al., 2000a).

The KLK genes to be studied in this Chapter are KLK1-4:

KLK1 is expressed in endometrial, prostate and breast cancer tissue (Rehbock et al.,

1995; Clements and Mukhtar, 1994; Wolf et al., 2001). Furthermore, this gene is

regulated by estradiol in rat uterus and the human endometrium (Corthorn and Valdes,

1997; Clements et al., 1994). It has been suggested that KLK1 might be important in the

progression of cancer via its role in angiogenesis, tumour blood flow (Maeda et al., 1999)

and/or invasion and metastasis via the degradation of the extracellular matrix (Wolf et al.,

2001).

As noted in Chapter One, hK2 and PSA are expressed in prostate and breast cancer and

regulated by androgens in prostate cancer cell lines (Riegman et al, 1991; Murtha et al.,

1993; Luke and Coffey, 1994; Cleutjens et al., 1996, 1997; Schuur et al., 1996; Pang et

al., 1997; Sato et al., 1997; Sun et al., 1997; Zhang et al., 1997; Brookes et al., 1998; Yu

et al., 1999; Mitchell et al., 2000; Yeung et al., 2000). Additionally, it has been

suggested that both of these genes are implicated in many aspects of tumourigenesis via

degradation of the extracellular matrix or activation of factors that promote tumour

growth (Mullins and Rohrlich, 1983; Webber et al, 1995; Dube and Tremblay, 1997;

Okabe et al, 1999; Pedersen et al., 2003; Schneider et al., 2003). Thus, they may provide

a mechanism for malignant cells to proliferate, migrate and metastasise.

KLK4 is highly expressed in prostate, ovarian and breast cancer and regulated by

androgens, estradiol and progesterone in these systems (Nelson et al., 1999a; Yousef et

60

al., 1999b; Kormaz et al., 2001; Takayama et al., 2001a; Dong et al., 2001). The

biological function of hK4 is not known, however, recombinant K4 can activate pro-PSA

and single-chain urokinase-type plasminogen activator (scUPA) (Takayama et al.,

2001a), two proteins that are implicated in cancer invasion and metastasis (Schneider et

al., 2003; Pedersen et al., 2003).

Previous studies in this laboratory (Myers and Clements, unpublished data, Chapter One)

identified KLK1-4 expression in a number of endometrial cancer cell lines. However, no

studies have been reported on the hormonal regulation of KLK expression in these cell

lines. Thus, the studies presented below are an extension of these findings. Initially, RT-

PCR was performed on a number of HDC cell lines and control tissues, kidney, prostate

and salivary gland to confirm the expression patterns of the KLK1-4 genes. From the RT-

PCR data, KLK2 and KLK3 was predominantly expressed in the prostate and not the

endometrial cancer cell lines, therefore, these genes were not included in the subsequent

studies. Both KLK1 and KLK4 were expressed to varying levels in endometrial and

breast cancer cell lines. Thus, further studies of KLK1/hK1 and KLK4/hK4 regulation by

estrogen and progesterone in the moderately (HEC1A/B) and poorly (KLE) differentiated

endometrial cancer cell lines and the T47D (tumour stage IV, infiltrating ductal

carcinoma) breast cancer cell line were thus performed.

61

3.2. MATERIALS AND METHODS

All the Materials and Methods below are outlined in detail in Chapter 2. To maintain

continuity, brief summaries of the Methods used are given below.

3.2.1. Cell Culture and Steroid Treatments

All cell lines were cultured in DMEM (Life Technologies, Melbourne, Australia) as

outlined in Chapter 2 (section 2.4). For the steroid treatments, the cell lines were grown

for 24 hr (unless otherwise stated) in phenol red-free DMEM prior to the addition of the

specific hormones, 17β-estradiol-benzoate or progesterone or the anti-progesterone and

anti-androgen, RU486 (Sigma Chemical Company, Castle Hill, Australia) diluted in a

final concentration of 0.01% ethanol. For specific doses (0-100 nmol/L and 0-10 µmol/L)

and time frames (0-96 hr) and number of times each experiment was performed, see

Results section. Vehicle (0.01% ethanol) controls were also performed.

3.2.2. RNA Extractions

Total RNA was extracted on at least three separate occasions from all of the above cell

lines or experimental procedures using the TRIZOL-Reagent (Sigma) as outlined in

Chapter 2 (section 2.7.1). All sample preparations were of high purity with a 260/280 nm

ratio in the range of 1.95-2.0.

3.2.3. Protein Extractions and Concentration

Total soluble protein was extracted on at least three separate occasions from each cell line

or experimental protocol with the protein lysis procedure outlined in Chapter 2, (section

2.7.3). Protein concentrations were determined in triplicate using the BCA kit (Pierce) as

outlined in Chapter 2 (section, 2.7.4).

3.2.4. Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

RT-PCR was performed as outlined in Chapter 2 (section 2.11.1) with the synthesis of

cDNA using SuperScript II reverse transcriptase (Life Technologies) and 2 µg of total

RNA. All PCR cycles were performed on a thermal cycler DNA Engine (Bresatec) in a

final volume of 20 µl containing 10 X buffer (1.5 mmol/L Mg2+), Platinum Taq (Life

62

Technologies) dNTPs (Roche), forward and reverse primers (Table 3.1) and 1 µl of

cDNA template. PCR amplification parameters were 94°C for 5 min initial denaturation,

then 30 cycles (unless otherwise stated in results section) of 94°C denaturation for 30 sec,

annealing temperature (variable, see Table 3.1) for 30 sec and a 72°C extension for 30

sec.

3.2.5. Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis (SDS-PAGE)

and Western Blot Analysis.

SDS-PAGE and Western blot was performed as outlined in Chapter 2 (sections 2.15.1).

The primary anti-peptide hK4 (#673305) (1:1000 dilution), KLK-L1 (K4) (1:5000

dilution) (Novus Biologicals, Littleton, CO, USA) or K1 antibody (1:400 dilution) (HUK,

Calbiochem) were incubated with the membrane for 60 min at RT followed by secondary

antibody incubation (anti- rabbit HRP-conjugate, K1 and K4, 1:1000 dilution) at RT for

60 minutes.

3.2.6. Quantitative Image Analysis

Quantitative Image analysis was performed on the scanned X-ray films using the

BIORAD GS-690 Image Densitometer as outlined by the supplier’s manual (BIORAD,

Sydney, Australia).

63

Table 3.1. Primer Sequences, Primer Position, Annealing Temperatures and Product Sizes for RT-

PCR of KLK1- KLK4 and β2-Microglobulin

F = forward and R = reverse primer sequences. The size of each amplicon is shown in base pairs (bp). The

position of each primer pair is based on the sequence identity shown for each gene where the first

nucleotide was designated +1. Gene sequence identity was obtained from the published sequence (NCBI,

www.ncbi.nlm.nih.gov).

Gene and

Sequence Identity

Primer 5’ to 3’ Primer Position

(bp and exon)

Annealing

Temp °C

Product

size (bp)

KLK1 (X13561) F 5’-TGGAGAACCACACCCGCCAAG-3’

R 5’-ACGGCGACAGAAGGCTTATTG-3’

F = + 353 (exon 3)

R = + 821 (exon 5) 60 468

KLK2 (S39329) F 5’-GCCTAAAGAAGAATAGCCAGGT-3’

R 5’-CTCAGACTAAGCTCTAGCACAC-3’

F = + 213 (exon 2/3)

R = + 588 (exon 4) 56 375

KLK3 (M26663) F 5’-GCATCAGGAACAAAAGCGTGA-3’

R 5’-CCTGAGGAATCGATTCTTCAG-3’

F = + 221 (exon 2/3)

R = + 359 (exon 3) 56 138

KLK4 (NM004917) F 5’-GCGGCACTGGTCATGGAAAAGG-3’

R 5’-CAAGGCCCTGCAAGTACCCG-3’

F = + 136 (exon 2)

R = + 662 (exon 5) 60 526

β2-Microglobulin

(NM004048)

F 5’-TGAATTGCTATGTGTGTCTGGGT-3’

F 5’-CCTCCATGATGCTGCTTACAT-3’

F = + 188 (exon 2)

R = + 438 (exon 3) 55 250

64

3.3. RESULTS

3.3.1. KLK1-KLK4 Expression Patterns in Endometrial and other Hormone-

Dependent Cancer (HDC) Cell Lines

Previously, the expression of the KLK1-4 genes was analysed in a number of endometrial

cancer cell lines of well to poorly differentiated phenotypes (data not shown). To re-

confirm these, and to further determine the tissue-specific distribution of the KLK1-4

genes in HDCs, particularly of the endometrium and breast, RT-PCR analysis was

performed on a number of cancer cell lines and control tissue samples (Figure 3.1). The

cancer cell lines used were T47D (breast), HEC1A, Ishikawa, KLE (endometrial), Caki1,

Sn12K1 (kidney), OVCAR-3, PEO1 (ovarian) and ALVA-41, DU145, PC3, LNCaP

(prostate). Additionally, a human salivary gland cell line and tissues from normal

salivary gland and kidney and a malignant prostate tissue were used as controls.

All four genes were detected to varying levels in the cell lines and tissue samples. KLK1

RT-PCR amplicons of the appropriate size (486 bp) were detected in all of the cell

lines/tissue except for the ALVA cell line (Figure 3.1, KLK1 panel). KLK2 (375bp) and

KLK3 (138bp) amplicons (Figure 3.1, KLK2 and KLK3 panels) were almost exclusively

expressed in the prostate tissue or LNCaP prostate cell line with no expression detected in

any of the endometrial or breast cancer cell lines. Two smaller amplicons were observed

in the prostate tissue samples for the KLK2 profile, and an amplicon of the correct size

was also observed in the salivary gland tissue for the KLK3 profile as well as two lower

bands in Ishikawa and KLE cells (Figure 3.1, KLK3 panel). However, these were not

further analysed

RT-PCR for KLK4 showed an amplicon of the appropriate size (526bp) was detected in

all of the endometrial and breast cancer cell lines (Figure 3.1, KLK4 panel). However,

the salivary gland tissue and cell line and cell lines Caki1, and ALVA were negative for

KLK4 expression. Additionally a number of larger and smaller amplicons were

occasionally observed. The larger amplicon (609 bp) is the result of the insertion of 83-bp

from intron three (Dong et al., 2001). The smaller KLK4 amplicon (389 bp) is derived

from a complete exon four deletion (Myers and Clements, 2001).

65

Lane Key T47D, breast cancer cell line, HaCAT, keratinocyte cell line, HEC1A, endometrial cancer cell line, Ishikawa, endometrial cancer cell line, KLE, endometrial cancer cell line, Prost. Tiss, prostate cancer tissue, Prost. Tiss, prostate cancer tissue, SGT, salivary gland tissue, SGC, salivary gland cell line, Kid. Tiss, kidney tissue, Caki1, kidney cancer cell line, Sn12K1, kidney cancer cell line, OVCAR-3, ovarian cancer cell line, PEO1, ovarian cancer cell line, ALVA, prostate cancer cell line, DU145, prostate cancer cell line, PC3, prostate cancer cell line, LNCaP, prostate cancer cell line

Figure 3.1. mRNA Expression Profile Analysis of the Human Kallikrein Gene Family Members

(KLK1-KLK4) in a Number of Cancer Cell Lines and Tissues by RT-PCR. The RT-PCR analysis was

performed on total RNA from the displayed cell lines and tissue samples using primers listed in Table 3.1.

Above the KLK1 panel represent the various tissue and cell lines and their descriptions are given in the key

below the Figure. To the left of each of the panel are the gene descriptions, KLK1-KLK4, respectively. To

the right of each panel are the sizes of each RT-PCR amplicon in base pairs (bp). These experiments were

repeated at least three times for each gene. Additionally, random amplicons were sequenced and analysed

by BLAST (www.ncbi.nlm.nih.gov) to confirm the specificity of the RT-PCR data (data not shown).

66

The beta2-microglobulin “housekeeping” gene was consistently expressed in all of the

samples (Figure 3.1, beta2-microglobulin panel) indicating the RNA preparation was of

high quality. The primer pairs for this gene span an intron of approximately 600bp and

therefore serve as a control for genomic DNA contamination. That is, any genomic DNA

contamination would yield a beta2-microglobulin amplicon of 850 bp, which is clearly

not present in these samples. Random amplicons were sequenced and analysed by

BLAST (www.ncbi.nlm.nih.gov) to confirm the specificity of the RT-PCR data (data not

shown).

From these data it is clear that the KLKs1-4 are expressed in a range of cell and tissue

types. However, of importance to this study were the expression patterns in endometrial

and breast cancer cell lines (Table 3.2). As the KLK2-3 genes were not detected in these

lines, subsequent studies were undertaken only analysing KLK1 and KLK4 gene and

protein expression.

3.3.2. KLK1/K1 Regulation by Estrogen and Progesterone in the HEC1A and KLE

Cell Lines

The HEC1A cell line was initially chosen as it expresses a functional estrogen and

progesterone receptor (ER and PR, respectively) and is highly responsive to the steroid

hormone estradiol and progesterone (Beato, 1996; Castro-Rivera and Safe, 1998;

Schneider et al., 1998). Thus it was of interest to determine if estradiol and/or

progesterone would have an effect on the regulation of KLK1 expression in this line. The

HEC1A cell line was treated with 10 nmol/L of 17β-estradiol-benzoate (E) or

progesterone (P) for 24 hours. Additionally, some cells were pre-treated or “primed” with

E followed by 24-hour treatments with P. It is well established that estrogen, through its

estrogen receptor (ER) can bind to estrogen response elements (EREs) on the promoter of

the PR and regulate the transcription of this gene (Kastner et al., 1990; Graham and

Clarke, 1997; Scott et al., 1997). Thus “priming” of the cells for 24 hours with estradiol

would allow for the up-regulation of the PR. A number of PCR cycles (20, 25 and 30)

were performed to identify the linear phase of amplification. Following 20 cycles of

PCR, no expression of KLK1 was observed in the HEC1A treated cells, although

67

Table 3.2. mRNA Expression Patterns of the Kallikrein Gene (KLK1-4) in Breast and Endometrial

Cell Lines as Obtained by RT-PCR Analysis

The following symbols were used to represent high expression (+ + +), moderate expression (+ +), low

expression (+), and (-) no expression as interpreted from the intensity of the PCR bands/amplicons. T47D

is a breast cancer cell line; HEC1A, Ishikawa and KLE are endometrial cancer cell lines.

Cell Line KLK1 KLK2 KLK3 KLK4

T47D + + + - - + +

HEC1A + + - - +

Ishikawa + + + - - + +

KLE + + - - + +

68

expression in the positive control, human salivary gland (HSG), was evident (Figure

3.2A). Following 25 cycles, low expression was observed in all of the treated samples,

with an observed increase in expression in the estrogen + progesterone (E + P) treatment

lane (Figure 3.2B). Following 30 cycles, all lanes displayed equal expression levels

indicating the saturation point of the PCR (Figure 3.2C). Therefore, the 25-cycle point

was chosen as the linear phase of amplification and PCR for KLK1 at 25 cycles was

performed along with the “house-keeping” gene, β2-microglobulin. Again low

expression was observed in all of the treated samples, although there appeared to be a

slight increase in expression with the E + P treatment (Figure 3.2.D). These studies were

repeated at least three times for each cycle number from three separate cell culture

experiments (n = 3).

3.3.3. Western Analysis of hK1 Protein Levels in the HEC1A and KLE Cell Lines

Treated With Estrogen and Progesterone Over 24 Hours. From the semi-quantitative

data (Figure 3.2) it appeared that there might be a slight increase in KLK1 transcript

levels at 25 cycles following a combination of estrogen/progesterone treatment over 48

hours. Therefore, to determine if any regulation was occurring at the protein level,

Western blots were performed with protein extracts from the E, P and combined E + P

treatment in the HEC1A cell line. This experiment was repeated three times from three

cell culture experiments and a representative blot is shown (Figure 3.3A). From the

Western blot data there was no clear indication that hK1 protein levels were regulated by

estrogen, progesterone or the combination of both in the HEC1A cell line (Figure 3.3A).

Since there was no clear indication that hK1 was regulated by estrogen or progesterone in

the HEC1A cell line, the poorly differentiated KLE line was then tested. A similar

paradigm was used with a 10 nmol/L dose of E and P or the combined treatment over 24

hours. The experiment shown in Figure 3.3B is indicative of three independent cell

culture experiments, however, densitometry was only performed on one of these blots to

show a graphical representation of the common trend observed. Here, hK1 protein levels

were more clearly regulated by estradiol, progesterone, and the combined treatment over

a 24-48 hour period (Figure 3.3B and C). Quantitative image analyses showed fold

69

Figure 3.2. Reverse Exposure of a Semi-Quantitative RT-PCR for KLK1 Expression in the

Endometrial Cancer Cell Line, HEC1A Following Treatment With Estradiol and Progesterone.

Panels A to C. KLK1 expression of (A) 20 cycles, (B) 25 cycles and (C) 30 cycles. Lanes are (left to

right), DNA marker in base pairs (marker IX, Roche), a negative control (-VE) no cDNA, ethanol control

(0.01% ethanol vehicle treatment), control (no hormone treatment), estrogen, progesterone, and estrogen

treatment for 24 hours followed by progesterone treatment for 48 hours (E + P), and the human salivary

gland control (HSG). The size of the KLK1 amplicon is as expected, 468 bp. Each cycle number is

represented at the bottom of each gel. In panel D, KLK1 amplicons (468 bp) at 25 cycles is shown

following co-amplification of β2-microglobulin (250 bp), which was used to monitor loading efficiencies.

This figure is representative of three independent RT-PCR and cell culture experiments (n = 3).

70

Figure 3.3. Western Analysis of hK1 Regulation by Estrogen and Progesterone in the Endometrial

Cancer Cell Lines, HEC1A and KLE. A (HEC1A) and B (KLE). The lanes are (left to right), a control

(HEC1A or KLE cell lines untreated), and then 10 nmol/L treatment with E (24 hr), P (24 hr) and E (24 hr)

plus P (additional 24 hr). The human salivary gland (HSG) was used as a control for hK1 expression. The

molecular weight of the hK1 protein was 38 kDa. This figure is representative of at least three independent

cell culture experiments. Equal protein loading was monitored by Ponceau S staining (data not shown) C. Quantitative image analysis of the fold changes in hK1 protein in the KLE cell line (Panel B) over that of

the control where C = control (=1), E = 17β-estradiol-benzoate, P = progesterone and E + P = the combined

treatment.

71

changes of 1.5 (E), 8 (P) and 10.25 (E + P) fold over that of the control (C), which was

set at 1 (Figure 3.3C). Equal protein loading was monitored by Ponceau S red staining of

the nitrocellulose membrane (data not shown).

3.3.4. Western Analysis of hK4 Expression in Endometrial, Breast and Prostate

Cancer Cell Lines.

Prior to performing regulatory studies in the endometrial cancer cell lines (HEC1A,

HEC1B, Ishikawa, KLE and RL95-2), Western blot analysis was performed to determine

the extent of expression of the hK4 protein (Figure 3.4). The prostate cancer cell line,

LNCaP was used as a positive control for hK4 expression and the T47D cell line was

added to determine the extent of hK4 expression in this line for later experiments.

Western blot analysis with the anti-peptide c-terminal K4 antibody (#673305) was

successful in identifying a hK4 protein of 38 kDa in the T47D, HEC1A, HEC1B,

Ishikawa, KLE and the control prostate cancer cell line, LNCaP (Figure 3.4). No hK4

expression was observed in the RL95-2 cell line. Additional bands were also evident in

the HEC1A, HEC1B, Ishikawa and KLE cell lines. In this laboratory we have

continually observed this phenomenon, however, the identity of these additional bands

are yet to be identified.

3.3.5. The Regulation of the hK4 Protein By Estrogen and Progesterone in the

Endometrial Cancer Cell Lines, HEC1A/B and KLE

The identification of hK4 in all of the endometrial cancer cell lines (except for RL95-2),

and in particular, the moderately differentiated HEC1A/HEC1B and poorly differentiated

KLE phenotypes, resulted in the selection of these cell lines for regulatory studies.

Treatment of the HEC1A and HEC1B cell lines with 10 nmol/L of E, P or combined

treatment of the two steroids, over 48 hours, resulted in what appeared to be a slight

increase in hK4 protein by E + P treatment in the HEC1A cell line (Figure 3.5A),

however, this result was not reproducible. No observable change in hK4 expression in

the HEC1B cell line was observed with these same treatments (Figure 3.5B).

Conversely, the treatment of the KLE cell line with these same steroids resulted in a

significant increase in hK4 protein (Figure 3.5C and D). It was observed that E induced

72

Figure 3.4. Western Blot Analysis of hK4 Protein in Endometrial, Breast (T47D) and Prostate

(LNCaP) Cell Lines. The lanes are (left to right), the breast cancer cell line, T47D, then the endometrial

cancer cell lines, HEC1A, HEC1B, Ishikawa, KLE, RL95-2 and the prostate cancer cell line, LNCaP. The

molecular weight is indicated at the right as 38 kDa. This figure is representative of three separate cell

culture experiments. Equal protein loading was monitored by Ponceau S staining (data not shown).

HEC

1A

HEC

1B

Ishi

kaw

aK

LE

RL9

5-2

LNC

aP

38 kDa

T47D

73

Figure 3.5. Regulation of hK4 By Estrogen, Progesterone in the HEC1A, HEC1B and KLE Cell

Lines. For panels A, B and C, from the left are the control (no treatment), then E, P and E “priming”

followed by P treatment. The molecular weight for the hK4 protein in all three panels (A, B and C) is

shown at 38 kDa. Panel D is a quantitative image analysis of the % increase in hK4 protein over that of the

control observed in panel C where C = control, E = estrogen, P = progesterone and E + P the combined

reatment. These experiments were repeated at least three times with different preparations and a similar

trend was observed. Equal protein loading was monitored by Ponceau S staining (data not shown). These

results from panel C and D have been published in the Journal of Clinical Endocrinology and Metabolism

(2001), 86:2323-2326.

74

hK4 expression at least 50% over the control (no treatment), 170% in the P-induced cells,

and 300% in the E + P treated cells (Figure 3.5C and D). These data are indicative of at

least three separate cell culture experiments. Equal loading controls were assessed by

Ponceau S red staining of the nitrocellulose membrane (data not shown).

3.3.6. Up Regulation of KLK4/hK4 at the RT-PCR and Protein Level By

Progesterone in the Breast Cancer Cell Line, T47D.

Previous studies have shown that the KLK4 gene is up-regulated by progesterone in the

breast cancer cell line, BT-474 (Yousef et al., 1999b). Thus, the question was, whether

KLK4 was similarly regulated in the T47D breast cancer cell line. T47D cell lines were

treated with 0, 1, 10 and 100 nmol/L progesterone over a 24 hr period. RT-PCR (30

cycles, a cycle number shown previously to be in the linear range, data not shown), of the

subsequent cDNA resulted in a slight up regulation of KLK4 at 1 nmol/L progesterone

and a marked increase at 10 nmol/L (Figure 3.6A). No KLK4 expression was observed in

the negative PCR control (no cDNA) as expected, and the control (non-treated T47D

cells) cDNA (Figure 3.6A) was also negative. At the 100 nmol/L progesterone dose there

was a clear down regulation of KLK4 mRNA levels (Figure 3.6A). The LNCaP positive

control for the KLK4 expression was positive as expected. Additionally, a number of

other amplicons were also observed in the 100 nmol/L treated T47D cells and the LNCaP

positive control. These amplicons are the result of either an intron three inclusion (609

bp) a 12 bp insertion of intronic sequence from intron 3 (401 bp) and an exon four

deletion (389 bp) (Figure 3.6A). At the Western level, hK4 protein was similarly

expressed in the 10 nmol/L progesterone treated T47D cells and to a lesser extent in

control (non-hormone treated) cells (Figure 3.6B) while the 1 and 100 nmol/L

progesterone-treated T47D cells showed no expression of hK4 protein. These data are

indicative of two separate cell culture experiments.

Having identified that KLK4/hK4 was up regulated by 10 nmol/L progesterone treatment

at 24 hours, a time-course was performed over 0, 2, 4, 8, 16, 24 and 48 hr. T47D cell

75

Figure 3. 6. KLK4/K4 Regulation By Progesterone in the Breast Cancer Cell Line, T47D. Panel A.

Reverse exposure of an ethidium bromide gel of KLK4 regulation by 10 nmol/L dose of progesterone over

a 24-hour peroid. The lanes are (left to right), M = marker (marker IX, Roche), -VE = no cDNA control 0,

(no hormone treatment), 1, 10 and 100 nmol/L progesterone respectively; LNCaP = prostate positive

control. Selected sizes (base pairs, bp) of the marker are given to the left and the amplicon sizes are

indicated to the right (526 bp = full length KLK4, 609, 401 and 389 bp are variant KLK4 mRNAs). Panel

B. Western blot analysis for K4 following progesterone treatment over a 24 hr period. The dose in nmol/L

is indicated at the top of the panel as 0, 1, 10 and 100 nmol/L progesterone. The size of the K4 protein

product is as expected at 38 kDa. Panel C. Western blot analysis of K4 protein expression following 10

nmol/L progesterone treatment over 48 hr. The time in hours is given at the top of the panel as 0, 2, 4, 8,

16, 24 and 48 hours respectively and the size of the protein is indicated to the right at 38 kDa . Equal

protein loading was monitored by Ponceau S staining (data not shown).

76

lines were treated with 10 nmol/L of progesterone over this time-period and analysed by

Western blot at least twice from separate cell culture experiments. Similar results were

obtained and a representative blot is shown (Figure 3.6C). A marked increase in hK4

expression was observed at the 2 hr time-point that was sustained until 24 hr, followed by

low expression at 48 hr (Figure 3.6C). The 0 hour (non-hormone treated) showed no hK4

protein expression (Figure 3.6C).

3.3.7. The hK4 Protein Is Down Regulated By the Anti-Progestin Antagonist RU486

In the Breast Cancer Cell Line, T47D.

The finding that KLK4/hK4 expression was regulated by progesterone, led to the question

as to whether this was occurring through the progesterone receptor (PR). Therefore, the

anti-progesterone, RU486 was used. RU486 competes with progesterone and blocks the

binding of this steroid ligand at the PR and therefore, in most cases, silences

progesterone-regulated target genes (Liu et al., 2002a). Pre-treatment of T47D cells with

increasing concentrations of RU486 (0, 1, 10, 100 nmol/L and 1, 10 µmol/L) over 24

hours followed by 10 nmol/L of progesterone treatment for a further 6 hours resulted in a

clear reduction of hK4 levels at 100 nmol/L, 1 and 10 µmol/L of RU486 treatment

(Figure 3.7A, lanes 5, 6 and 7). Additionally, the control lane (no RU486 or progesterone

treatment, Figure 3.7A, lane 1) was also positive for hK4 expression. Moreover, an

increase in hK4 expression levels was observed when only 10 nmol/L progesterone was

administered (Figure 3.7A, lane 2). Equal loading was monitored by staining the

Western blot membrane with Ponceau S (Figure 3.7B). These studies are indicative of

three independent cell culture experiments.

77

Figure 3.7. Inhibition of hK4 Progesterone Regulation by RU486 in the Breast Cancer Cell Line,

T47D. A. hK4 Western blot analysis following increasing concentrations of RU486 pre-treatment. The

lanes are, 1. no RU486 or progesterone treatment, 2. 10 nmol/L progesterone treatment, 3-5. 1, 10 and 100

nmol/L RU486 treatment for 24 hr followed by 10 nmol/L progesterone treatment for 6 hr. 6 and 7. 1 and

10 µmol/L RU486 treatment for 24 hr followed by 10 nmol/L progesterone treatment for 6 hr. B. Ponceau

S staining of A for equal loading of protein samples.

78

3.4. DISCUSSION

In this Chapter, the expression and regulation of human kallikrein 1 and 4 gene/protein

(KLK1/hK1 and KLK4/hK4) by estradiol and progesterone was examined in endometrial

(HEC1A, HEC1B, KLE) and breast (T47D) cancer cell lines. Although KLK1 is

regulated by estradiol and progesterone in other systems (reviewed in Clements, 1998)

the data presented here for the regulation of KLK1/hK1 and hK4 in the endometrial

cancer cell lines, HEC1A and B, were not conclusive. However, there was a marked

increase in hK1 and hK4 protein expression following treatment with 10 nmol/L

estradiol, progesterone and a combination of both over 24-48 hours, in the poorly

differentiated endometrial cancer cell line, KLE. Moreover, in the breast cancer cell line,

T47D, KLK4/hK4 gene/protein levels were up-regulated by 10 nmol/L of progesterone

over 24 hours. A progesterone-stimulated time-course over 48 hr resulted in the rapid

expression of hK4 protein at the 2 hr time-point in T47D cells suggesting a

transcriptional response. Furthermore, treatment of T47D breast cancer cell lines, with

the anti-progestin, RU486, prior to progesterone treatment resulted in an inhibition of

hK4 expression.

The expression of the KLK1 and KLK4 gene in the endometrial cancer cell lines, HEC1A,

Ishikawa and KLE is consistent with earlier findings (Myers and Clements, 1999,

unpublished data) and Harvey et al. (2000). Although KLK1 and KLK4 are both

expressed in the HEC1A/HEC1B cell lines, there was little indication of hormonal

regulation by estradiol, progesterone or the combined “priming” treatment. The lack of

hK1/hK4 responsiveness in these cell lines may reflect their moderately differentiated

state, or simply, that these steroids do not regulate these genes in this system. The

analysis of KLK1 gene regulation by estradiol and progesterone in the HEC1A cell line

was purely at a semi-quantitative level, but it would still appear that this gene was not

responsive to these steroids in this system. Although, “real-time” quantitative PCR could

have been performed, at the time of these studies, this laboratory was using an early

model Roche Light Cycler and “real-time” analysis and optimisation was problematic

and very lengthy (personal communication with laboratory colleagues Daniel McCulloch

and Rachael Collard). In addition, there was no clear change in hK1 protein levels in

79

HEC1A cells. It has been suggested that most endometrial cells lose the PR and part of

their differentiated phenotype during the culturing process (Beato, 1996). Although

there does not appear to be any data on the loss of E or P responsiveness in HEC1A cells,

studies in the well-differentiated endometrial cancer cell line, Ishikawa, by Hanekamp et

al. (2002), reported a loss of PR expression after several cell passages. However, the

mechanism behind this loss is not clear. Although HEC1A is responsive to both E and P

(Beato, 1996; Castro-Rivera and Safe, 1998; Schneider et al., 1998) KLK1 or KLK4 did

not appear to be regulated by these hormones in this case. Only one other study (Chen et

al., 1992) identified that progesterone treatment of ovariectomised female rats resulted in

an increase in kidney tissue kallikrein mRNA levels. Most of the other studies to date

have shown KLK1 to be up-regulated by estradiol in prolactin tumours (Powers, 1986), or

in the rat anterior pituitary (Fuller et al., 1988; Clements et al., 1986, 1989). In contrast,

the combined estradiol/progesterone “priming” treatment resulted in a slight increase in

hK4 expression in the HEC1A cell line, but subsequent similar studies in this line were

not conclusive.

In marked contrast, a clear significant increase in hK1 protein expression was observed

over the control (un-treated cells) in the KLE cell line after treatment with estrogen (1.5-

fold) and progesterone (8-fold). Pre-treatment with estradiol followed by progesterone

resulted in a further increase in hK1 expression of 10.25-fold. Additionally, a marked

increase in hK4 protein over the control (un-treated) was also observed in the KLE cell

line following estradiol (1.5-fold), progesterone (2.7-fold) and the combination of the two

(4-fold). While this was an interesting finding it was also puzzling. The KLE cell line

has been reported to harbour a defective estrogen receptor ER, in that, it does not

translocate to the nucleus (Richardson et al., 1984).

Thus, how does estrogen stimulation result in a marked increase in both the hK1 and hK4

protein? One possibility is a “non-genomic” response. For example, the activation of the

adenylate cyclase pathway by estrogen in rodent endometrial cells suggests mediation by

a membrane-bound ER (Oehler et al., 2000). Furthermore, since these earlier studies

with the KLE cell line were performed prior to the identification of two ER types, this

80

may simply reflect the expression of perhaps the ERβ and not the ERα. However, no

studies to date have been performed for ERβ in the KLE cell line. Nonetheless, studies

using the KLE cell line observed that 5 µmol/L of tamoxifen (an anti-estrogen) induced

70% growth inhibition of KLE cells that is not reversed by estrogen (Grenman et al.,

1998). Thus, these results suggest that tamoxifen inhibition of KLE growth may be

mediated through another mechanism(s), exclusive of ER or perhaps through ERβ. It

was shown that tamoxifen could behave as a full antagonist for both ERα and ERβ (Liu

et al., 2002b).

Progesterone treatment of KLE cells also resulted in a marked increase in hK1 and hK4

expression. Previous studies have shown both KLK1 and KLK4 to be regulated by

progesterone in other systems. For example, Chen et al. (1992) identified that

progesterone treatment of ovariectomised female rats resulted in an increase in renal klk

mRNA levels. Studies by Yousef et al. (1999b) found KLK4 to be up regulated by

progesterone in the prostate and breast cancer cell lines, LNCaP and BT-474,

respectively. Apart from the data presented here for the progesterone regulation of hK1

and hK4 in the KLE cell line, to my knowledge, there are no other reports on

progesterone induced gene regulation in this cell line. It is difficult to say whether

estradiol or progesterone regulation of hK1 and hK4 are the result of a transcriptional

response as these studies were all performed at 24-48 hr of treatment. As noted in

Chapter 1, the promoter region of KLK1 has hormone response elements (HREs) for both

estrogen and progesterone (Murray et al., 1990) however these are yet to be tested for

functionality. Additionally, the promoter region of the KLK4 gene has not been fully

elucidated and no functional HREs have been described.

In the breast cancer cell line, T47D, the initial RT-PCR suggested that KLK4 mRNA

levels were up-regulated by 10 nmol/L progesterone. This was similarly reflected in the

K4 protein levels. Interestingly, the control lane (no hormone treatment) was also

positive for K4 expression. This may simply reflect endogenous hK4 that was still

present after the 24 hr incubation in serum-free, phenol red-free media, prior to the assay

although it was surprising that the 1 and 100 nmol/L treatment showed low/no hK4

81

protein expression. Further experiments to analyse the dose range were not performed at

this stage and await further experimentation.

The complete down-regulation of KLK4 with 100 nmol/L of progesterone was surprising

although clearly reflected in the hK4 protein levels. This may suggest steroid toxicity at

this dose, or possibly some kind of negative feedback mechanism where a higher dose

has an inhibitory effect on its target gene. In fact, increasing concentrations of

mibolerone (a synthetic androgen) were observed to down-regulate a KLK2 reporter

construct at the 100 nmol/L dose in the androgen receptor negative prostate cancer cell

line, PC3 (Murtha et al., 1993) however, it was not clear as to why this effect was

observed.

Nevertheless, from the RT-PCR data and the Western blot analysis there is a clear

KLK4/hK4 response to progesterone. This is further highlighted in the results from the

(0-48 hr) time-course. These data suggest that hK4 protein is rapidly produced at or

before 2 hours of progesterone stimulation in T47D cells and is sustained for 24 hours.

These data may suggest an early transcriptional response of the KLK4 gene. Like KLK4,

other members of the kallikrein family, namely KLK2 and KLK3, are also rapidly

regulated by steroids at the transcriptional level. For example, KLK3 mRNA levels were

increased at 45 min, concurrently with the recruitment of RNA polymerase II to the

proximal promoter region of this gene under the influence of androgens (Shang et al.,

2002). The K4 response at 48 hr was minimal and perhaps suggests the degradation of

progesterone at this time point or PR turnover. Studies in T47D cell lines identified that

PR mRNA levels decreased 4-20 hr following progesterone treatment (Lange et al.,

2000). Additionally, studies by Mullick and Katzenellenbogen (1986), utilising dense

(15N, 13C, 2H) amino acid incorporation found that PR was reduced to half its initial value

in 12 hr.

The inhibition of hK4 expression by RU486 suggests the progesterone receptor is

implicated in this response. RU486 competes with the progesterone ligand for the PR

and thus, effectively blocks the stimulatory effects of a progesterone response at

82

progesterone-specific target genes. Although RU486 bound PR can bind to progesterone

response elements (PRE) located in progesterone-specific target genes (Edwards et al.,

1998), these target genes remain transcriptionally inactive. The failure of an antagonist-

occupied receptor to activate transcription is presumably due to the inability to interact

with the basal transcriptional machinery (Zhang et al., 1998). From these data, it is clear

that the KLK4 gene is a target for progesterone-bound PR.

3.5. CONCLUSIONS

In this study, it was shown that estrogen and progesterone effectively up regulated the

hK1/hK4 proteins in the poorly differentiated endometrial cancer cell line, KLE.*

Although these data are interesting, the KLK1/KLK4 expression and regulation in this

endometrial cancer cell line will not be followed further as it is unclear as to the

mechanism involved in this regulation. Of more interest to this project, progesterone

effectively up-regulated KLK4/hK4 gene/protein expression in the breast cancer cell line,

T47D. Moreover, the rapid two-hour production of hK4 protein by progesterone in T47D

cell lines may suggest a direct transcriptional event. Furthermore, the inhibitory action of

RU486 on hK4 protein expression may suggest that hK4 is regulated by progesterone

through a functional progesterone receptor. These findings now allow for a more detailed

study of progesterone receptor regulation of KLK4 in the breast cancer cell line, T47D.

* These data for the hK4 protein were published in The Journal of Clinical Endocrinology and Metabolism, (2001). 86: 2323-2326.

CHAPTER 4

MAPPING THE TRANSCRIPTION INITIATION SITE (TIS)

AND THE IDENTIFICATION OF PROMOTER-SPECIFIC

REGULATORY MOTIFS IN THE KALLIKREIN 4 (KLK4)

GENE

84

4.1. INTRODUCTION

Gene transcription is a fundamental process that allows the timely expression of specific

target genes that are required for the growth, maintenance and viability of a cell and thus,

the tissue type. In order to direct transcription of a specific target gene, a number of

regulatory motifs in the proximal promoter and distal enhancer regions, upstream of the

coding region, recruit specific factors that are involved in target gene modulation. These

factors interact with the general transcriptional machinery to elicit transcription of the

specific target gene at the transcription initiation site (TIS) (Figure 4.1).

The TIS is defined as a region where RNA polymerase II makes contact with the target

gene in order to transcribe a messenger RNA (mRNA) molecule (Figure 4.1). The

nucleotide at the start of this region is denoted as plus one (+1) and is the start site for the

5’ untranslated region (5’-UTR) of the gene. Identifying the TIS is paramount to

differentiate the promoter region of the gene, and thus, the regulatory motifs that control

gene transcription.

In Chapter Three it was shown that KLK4/hK4 gene/protein levels were regulated by

progesterone in the breast cancer cell line, T47D. Importantly, this response was rapid

(in 2 hr) suggesting a transcriptional response. Thus, to further understand the mechanism

underlying progesterone regulation of the KLK4 gene it was essential to identify the TIS

and thus the promoter region of this gene.

To date, identification of the putative KLK4 TIS was based on the comparison of this

gene with the exon one region of KLK3 (Stephenson et al., 1999), partial sequencing of a

bacterial artificial chromosome (BAC) clone (Nelson et al., 1999a), and the use of gene

prediction software (Nelson et al., 1999a; Yousef et al., 1999b). However, these methods

did not present conclusive evidence regarding the position of the KLK4 TIS. Recently,

two groups have reported the predicted TIS for KLK4 in a human unidirectional prostate

cDNA library (Hu et al., 2000), and the human prostate cancer cell line, LNCaP, and

CWR22 prostate cancer xenograft (Korkmaz et al., 2001). The KLK4 transcript

identified by Hu et al. (2000), has an additional 5’ exon that extends the TIS to 59 bp 5’

85

Figure 4.1. Schematic Diagram Showing the General Transcription Machinery Complex Interacting

with an Enhancer, Promoter Region and RNA Polymerase II (RNA Pol II). The solid spiral lines

represent the DNA double helix, the enhancer and promoter regions are represented by a red and grey

rectangle respectively, the general transcriptional machinery complex is represented by coloured circles and

ovals and the RNA Pol II enzyme is a large black oval. The +1 is given as the transcription initiation site

(TIS) and an arrow shows the direction of transcription.

Enhancer

PromoterRNA Pol II

TranscriptionalMachineryComplex

+1

Direction ofTranscription

(TIS)

86

of the putative ATG previously identified in exon one (Nelson et al., 1999a; Stephenson

et al., 1999; Yousef et al., 1999b) which now, according to Hu et al. (2000), equates to

exon two (Figure 4.2). The only transcript identified by Korkmaz et al. (2001), extends

25 bp upstream from an in-frame ATG start codon in exon three (Figure 4.2). From this,

it was determined that the most highly expressed KLK4 transcript in LNCaP and the

CWR22 prostate cancer xenograft is a truncated form (Korkmaz et al., 2001) that does

not possess the pre/pro signal domain, predicted to be in exon two of the full-length

KLK4 (Figure 4.2) (Nelson et al., 1999a; Stephenson et al., 1999). Thus, in the above

experiments, the KLK4 gene appears to give rise to two transcripts in normal prostate and

prostate cancer cell lines/xenografts and perhaps may include two promoter regions.

However, the precise transcript expressed, and the status of the KLK4 TIS and promoter

region in other cancer cell lines, such as breast (T47D), is unknown.

Therefore, the main aim of this study was to map the TIS for the KLK4 gene in the breast

cancer cell line, T47D. In addition, controls for the reported prostatic expression of

KLK4 transcripts were also used. These were the prostate cancer cell line, LNCaP, and a

prostate cDNA library. These were considered important controls as the two separate

short and long 5’UTRs and corresponding transcripts were defined in these cell

types/systems (Hu et al., 2000; Korkmaz et al., 2001). Identification of the TIS, and the

precise KLK4 transcript expressed in T47D cell lines, would then allow for an extensive

search of the proximal promoter (approximately 500 to 1000 bp 5’ of the identified TIS)

and enhancer regions (further upstream of the proximal promoter) to identify any

potential progesterone response elements (PREs) that may be involved in the regulation

of KLK4.

A number of techniques were employed to map the TIS, such as prostate library

screening, radioactive [γ32P]-ATP primer extension, CF-labelled primer extension and 5’-

RLM-RACE. To this end, the latter technique gave the most conclusive and definitive

result. It should be noted that at the outset of this study, the two putative TISs had not

been identified and only the ATG1 (see Figure 4.2) was known. Thus, it was logical to

design primers around this region as it was thought that the TIS for the KLK4 gene must

87

Figure 4.2. Schematic Diagram of the Genomic Structure of the KLK4 Gene Indicating the Two

Putative Transcription Initiation Sites (TIS) and ATG Sites. The above diagram for the KLK4 gene

illustrates the two putative ATG start sites for translation (ATG 1, Nelson et al., 1999a; Stephenson et al.,

1999; Yousef et al., 1999b and ATG 2, Korkmaz et al., 2001) and the two potential transcription initiation

sites (TIS 1, Hu et al., 2000 and TIS 2, Korkmaz et al., 2001). Coding (short blue bars) and untranslated

exons (red bars) and the two putative K4 proteins (long blue bars) that would result from the use of either

ATG site for translation are also indicated. The numbers 1-6 below the exons indicate exon numbers

according to Hu et al. (2000). The three amino acids of the catalytic triad, essential for catalytic activity,

are also shown- Histidine (His), Aspartate (Asp) and Serine (Ser). Note, this figure is not drawn to scale

and the relative positions of the two TIS, two ATG sites and the catalytic triad are approximations.

ATG 1 ATG2

TIS 1 TIS 2

Exons (coding)

Untranslated Exons

(Hu et al., 2000) (Korkmaz et al., 2001)

His

His Asp

Asp

Ser

SerPre/ProRegion

Protein Coding Region

1 2 3 4 5 6

88

be 5’ of this identified ATG. However, the identification of the TIS by Korkmaz et al.

(2001) led to a re-evaluation of the primer sites to be used in the subsequent TIS mapping

studies and therefore a new set of primers were designed 3’ of the putative TIS identified

by Kormaz et al. (2001) (see Figure 4.3, p.93).

89

4.2. MATERIALS AND METHODS

All the Materials and Methods below are outlined in detail in Chapter 2. To maintain

continuity, brief summaries of the methods used are given below.

4.2.1. Cell Culture of T47D and LNCaP Cell Lines

Cell culture was performed as outlined in Chapter 2 (section, 2.4). In preparation for the

RNA extractions (4.2.2, below), the cells were grown to approximately 90% confluency,

washed twice with phosphate buffered saline (PBS), scraped with a cell scraper (Sarstedt,

Newton, USA), and centrifuged at 1000 x g for approximately 3 minutes. The

subsequent cell pellets were then used below for the preparation of RNA.

4.2.2. RNA Extraction

RNA was extracted from the above cell lines using TRIZOL (Gibco BRL Life

Technologies, Melbourne, Australia) (see Chapter 2, section 2.7.1). All RNA

preparations were analysed for concentration and purity using spectrophotometric

analysis (260/280 OD) and stored at -80°C with the addition of 1U of RNase inhibitor

(Roche, Brisbane, Australia).

4.2.3. Purification and Prostate Library Screening

The prostate library (ClonTech, California, USA) was digested with EcoR V to linearise

the vector, followed by de-phosphorylation to ensure the vector did not re-circularise.

The digested vector was then purified through a QIAGEN DNA column (QIAGEN,

Victoria, Australia) and screened for the TIS using the vector forward primer and KLK4-

specific reverse primers (Table 4.1 and Chapter 2, section, 2.9).

4.2.4. Primer Design for Each Assay

Primers (Life Technologies, Melbourne, Australia or Proligo, Lismore, Australia) were

designed to specific regions of the KLK4 gene by using the Primer3 software available

online (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3). All parameters were

maintained in the default position. The primer sequences and their specific locations for

each experiment are shown in Table, 4.1 and Figure 4.3. All the primers were designed

90

Table 4.1. Assay Type, Primer and Primer Sequence for Mapping the KLK4 TIS.

Each set of primers used for each particular assay type is indicated above. K4 = kallikrein 4 and PE =

primer extension, EX = exon and a/s = antisense. The position of each primer on the KLK4 mRNA

(accession number AF113140, NCBI) is outlined in Figure 4.3. CF = CarboxyFluorescein, RLM-RACE =

RNA Ligase Mediated-Random Amplification of cDNA Ends

ASSAY PRIMER SEQUENCE 5’ to 3’

[γ32P]ATP-Labelled

Primer Extension

Ex3 a/s

Ex4 a/s

Ex5 a/s

CGTTTTCCATGACCAGTGCCGCCTGC

CCCAGCCCGATGGTGTAGGAG

CTCGCACTGCAGCACGGTAG

CF-Labelled Primer

Extension

K4PE110

K4PE50

CAGTCCTCGCCGTTTATGATT

AGGATGAGGTACCCCAGGAAC

5’ RLM-RACE

K4242- Outer

K4238- Inner

K4PE25

K4PE73

K4PE110

AGCCCGATGGTGTAGGAGTT

CGATGGTGTAGGAGTTCTGGAAACAGTG

CCCAGGGATTTCCTGCTGTGGCCAT

AGACGAGCGATCCTGCGACACCAAG

CAGTCCTCGCCGTTTATGATT

Prostate Library (PCR) K4PE73

K4PE25

Vector Primer

Beta2 Forward

Beta2 Reverse

AGACGAGCGATCCTGCGACACCAAG

GGGATTTCCTGCTGTGGCCAT

AAGCGCGCCATTGTGTTGGT

TGAATTGCTATGTGTGTCTGGGT

CCTCCATGATGCTGCTTACAT

91

Figure 4.3. Schematic Diagram of the KLK4 Gene Structure (Hu et al., 2000) and the Positions of

Primers Used for TIS Determination in Relation to the Two TIS Sites and the Two ATG Sites (not

drawn to scale). Exons are in blue and untranslated regions in red. The two ATG sites are shown and the

two TIS sites as identified by Hu et al. (2000) and Kormaz et al. (2001) are marked. The intervening dark

lines between the exons are introns. The position for each of the primers used in each of the experiments

(see Table 4.1) are also shown below the exons and directed at the approximate position within each exon.

The size in base pairs under the primers is the distance from the first ATG in exon 2 (ATG 1). The primers

K4PE238/242, overlap each other, and they both span exon 3 and exon 4 regions to allow detection of

genomic contamination.

ATG 1 ATG 2

TIS 1 TIS 2(Hu et al., 2000) (Korkmaz et al., 2001)

Ex3a/s157bp

Ex4a/s245bp

Ex5a/s504bp

K4PE110110bp

K4PE238K4PE242238bp and 242bp

K4PE50

K4PE25K4PE73

92

from the human KLK4 mRNA sequence, accession number, AF113140,

www.ncbi.nlm.nih.gov.

4.2.5. Phosphorus 32 [γ32P]-ATP Labelled Primer Extension.

Primer extension was carried as per the manufacturer’s methods (Promega, Annandale,

Australia), (Chapter 2, section, 2.16.1). [γ32P]-ATP (Geneworks, Adelaide, Australia)

was used to label KLK4-specific primers; exon 3a/s, exon 4a/s and exon 5a/s

(100pmol/µL) (see Table 4.1 and Figure 4.3 for sequences and their gene-specific

location).

4.2.6. CarboxyFluorescein (CF) -Labelled Primer Extension.

This assay is based on the reverse transcription of mRNA to cDNA with a CF-labelled

KLK4-specific oligomer. The resulting cDNA product is then run on a 6% acrylamide

sequencing gel and the resulting trace peak represents the distance in base pairs the

extension has travelled 5’ from the initial binding site of the oligomer. The anti-sense

KLK4 primers, K4PE110 and K4PE50 (Table 4.1) were labelled at the 5’ end with a 5’-

(CF) label (Life Technologies) (Chapter 2, section, 2.16.3). Briefly, total T47D RNA and

CF-labelled primers were reverse transcribed with SuperScript II (Life Technologies).

The cDNA was then precipitated and sent for size analysis to the Australia Genome

Research Facility (AGRF), The Walter and Eliza Hall of Medical Research, Melbourne,

Australia.

4.2.7. Southern Hybridisation

Southern Blotting and Digoxigenin-11-dUTP (DIG) (Roche) Hybridisation were

performed as outlined in Chapter 2 (section, 2.13). The labelled probe used in this

experiment was the K4PE25 (see Table 4.1 and Figure 4.3).

4.2.8. RNA Ligase Mediated-Random Amplification of cDNA Ends (RLM-RACE)

5'-RLM-RACE (First Choice RLM-RACE kit, Ambion, Texas, USA) was carried out

essentially as per the manufacturer’s instructions, except either AMV (Ambion) or

Superscript II (Life Technologies) reverse transcriptase was used for the synthesis of the

93

cDNA (see Chapter 2.16.4). Briefly, 10 µg of total RNA was de-phosphorylated in the

presence of calf intestinal phosphatase (CIP) and the RNA extracted using

phenol/chloroform. CIP-treated RNA was then incubated with tobacco acid

pyrophosphatase (TAP) followed by ligation of a 5'-RACE adapter. Ligated RNA and

random decamers were then used to synthesize cDNA using Superscript II or AMV

reverse transcriptase as per the manufacturer’s directions (Life Technologies and

Ambion, respectively) (Figure 4.4).

4.2.9. Identification of Putative Progesterone Response Elements.

Bionavigator software (www.angis.org.au) was used to align at least 5 Kb of genomic

sequence from the KLK2, KLK3 and KLK4 genes to determine the extent of conservation

between known Class III steroid hormone response elements. The Gene-Bank data

entries used were AF174646 (KLK2), AF394907 (KLK3) and AF243527 (KLK4)

(www.ncbi.nlm.nih.gov). The free software, SigScan, (Prestridge, 1991)

(http://bimas.dcrt.nih.gov/molbio/signal) and MatInspector (Quandt et al., 1995)

(http://www.gsf.de/biodv/matinspector.html) were used to identify any potential cis-

specific elements in approximately 1.4 kb of KLK4 genomic sequence 5’ of the identified

TIS (Korkmaz et al., 2001). Another program, Cister was also used (Frith et al., 2001;

http://sullivan.bu.edu/~mfrith/cister.shtml). This program will only search for and

identify regulatory motifs that form clusters (such as Sp1 and AP1 sites) and therefore are

more likely to be involved in basal levels of transcription. All the parameters from these

programs were maintained in the default position.

94

Figure 4.4. Schematic Diagram of the 5’-RLM-RACE Procedure. Step 1 and 2: RNA is subjected to

treatment with Calf Intestinal Phosphatase (CIP) and uncapped RNA is de-phosphorylated, but capped

RNA remains intact. Step 2 and 3: The capped RNA is then de-capped by the addition of Tobacco Acid

Pyrophoshatase (TAP) that results in a single overhanging phosphate. Step 3 and 4: An RNA linker primer

is then ligated to the single phosphate from the de-capped RNA. Step 5: RT-PCR is then carried out on the

transcripts using RACE and gene specific primers (see Table 4.1).

RLM-RACE

P-P-P

Cap

A = Poly An

A n

P A n

CIPP-P-P A

n

A nHO

TAPA

nP-P +Ligase

A nP--------OH

RNA Linker

RT-PCR

P-------- A n

1.

2.

3.

4.

5.

95

4.3. RESULTS

4.3.1. Prostate Library Screening

Initial attempts at screening the prostate cDNA library for the KLK4 TIS, using the vector

primer and KLK4-specific, exon 3, 4 and 5 a/s primers (Table 4.1), were not successful

and sequencing of the resulting amplicons resulted in E.coli sequence (data not shown).

4.3.2. Primer Extension Using a [γ32P]-ATP-Labelled KLK4 Oligomer Probe. After

many unsuccessful attempts to identify the TIS for KLK4 using the prostate cDNA

library, the approach was changed to analyse prostate RNA and not cDNA. This led to

the development of a primer extension assay utilising [γ32P]-ATP-labelled KLK4

oligomer probes (see Table 4.1). Initially, LNCaP RNA (positive control for KLK4

expression), and a number of radioactive [γ32P]-ATP oligomer probes, exon 3, 4 and 5 a/s

(Table 4.1 and Figure 4.3) were used in the primer extension assay and the resulting

autoradioautograph analysed. In figure 4.5A, the kanamycin positive control RNA

(Promega) gave the expected product size of 82bp. No products were observed for the

primer extension using Ex3a/s or Ex5a/s oligomers, however, using the Ex4a/s oligomer,

a faint band of approximately 140bp was observed after one week of exposure (Figure

4.5A). The no RNA control was negative as expected. The position of this Ex4a/s

primer and the extension data (140 bp 5’ of the priming site) would place the TIS for

KLK4 in LNCaP to approximately the same position observed by Korkmaz et al. 2001

(Figure 4.5B). This assay was performed at least three times, however, the result

observed in figure 4.5A could not be repeated.

4.3.3. CF-Labelled KLK4 Primer Extension in T47D Cells.

Since the radioactive primer extension for KLK4 in LNCaP produced a very weak signal

(Figure 4.5A) this assay was unlikely to work for T47D cells. Thus, a more sensitive

approach using a CF-labelled primer extension was then used to try to identify the TIS in

T47D cells. In some reports, the CF-labelled primer extension has been suggested to be

just as, if not more sensitive than [γ32P] (Christensen et al., 1999; Hesley et al., 2002).

96

Figure 4.5 A. [γ32P]-ATP Primer Extension for the KLK4 TIS in the Prostate Cancer Cell Line,

LNCaP. The lanes are (from left to right), no RNA control, the kanamycin positive control RNA, then,

[γ32P]-ATP labelled KLK4 oligomers, Ex3a/s, Ex4a/s and Ex5a/s. The control product of 82 bp was as

expected. The product seen in the Ex3a/s lane is 140 bp. Free excess probe is at the bottom of the gel. B.

A similar schematic of the KLK4 gene as seen in Figure 4.3, however, in this case, only the Ex4a/s

oligomer and the position of the primer extension 140 bp from the initial oligomer-binding site is shown.

This 140 bp extension correlates with the position of the TIS identified by Korkmaz et al. (2001).

Control 82bp

No R

NA

Cont

rol

Ex3a

/sEx

4a/s

Ex5a

/s

140bp

Free Probe

A.

ATG ATG

TIS TIS (Hu et al., 2000) (Korkmaz et al., 2001)

Ex4a/s

B.

97

Two CF-labelled oligomers, K4PE110 and K4PE50 were used (see Table 4.1 and Figure

4.3). Initially, the primer extension assay was performed using the K4PE110 primer at

42°C, and although a large peak was observed at 165 bp from the initial oligomer-binding

site, a number of smaller peaks were also identified as non-specific priming events (data

not shown). Therefore, the assay was repeated and the primer extension carried out at

60°C. From these data, the K4PE110 oligomer again resulted in a large peak at

approximately 165bp from the initial oligomer-binding site with no background priming

events observed. (Figure 4.6A). This would place the TIS for KLK4 in the T47D cell line

at approximately the same position observed by Hu et al. (2000) (Figure 4.6B). The

K4PE50 trace data was inconclusive and could not be evaluated (data not shown).

4.3.4. 5’-RLM-RACE for the TIS in T47D and LNCaP RNA.

Having identified two different KLK4 TISs in the prostate and breast cancer cell lines,

LNCaP and T47D, respectively, a further method was required to confirm these findings.

The question was - is the difference in the TIS a tissue-specific phenomenon or, are both

TISs found in the two different tissues, or is this the result of the assay type used?

Therefore, the recently described and more robust 5’-RLM-RACE method was chosen to

clarify these suspected differences. This method has been successfully used to identify

the TIS for at least 1031 genes (Suzuki et al., 2001).

4.3.4.1. Optimisation of the 5’-RLM-RACE

Utilising 5’-RLM-RACE, total RNA from T47D and LNCaP cells were assayed. In the

initial 5’-RLM-RACE procedure (see Chapter 2, section 2.16.4), a phenol/chloroform

extraction was performed with a further extraction following subsequent phosphatase

treatments. The RNA yields obtained by this procedure were extremely small and

therefore the subsequent cDNA was screened using the “house-keeping” gene, β2-

microglobulin to determine the status of the original RNA preparation. This resulted in

no expression of β2-microglobulin in the two cell lines although a control cDNA

(LNCaP) sample that was not prepared by the above method established that the PCR

worked (Figure 4.7A). The negative control (no cDNA) in this and two subsequent

experiments (Figures 4.7A, B and C) were also appropriately negative. To identify why

98

Figure 4.6. CF-Labelled Primer Extension for the KLK4 TIS in T47D Cell Lines. A. This is the AGRF

sequencing trace which shows a peak at 164.61 (165bp). This peak represents the distance in base pairs the

primer extension has extended from the initial binding site (see Figure 4.3). The KLK4 primer used was

K4PE110, which is derived from a sequence 110 bp from the reputed ATG1 (see Table 4.1 and Figure 4.3).

The scale to the right (100-300) corresponds to the peak height in arbitrary units. B. The schematic in this

figure represents the K4PE110 binding site and the primer extension in base pairs (165 bp) from this initial

annealing site. The TIS identified using this method corresponds to that identified by Hu et al. (2000).

ATG 1 ATG 2

TIS 1 TIS 2(Hu et al., 2000) (Korkmaz et al., 2001)

K4PE110

B.

99

Figure 4.7. Optimisation of the 5’-RLM-RACE Procedure. β2-microglobulin PCR screens of three

RLM-RACE experiments. A. T47D and LNCaP 5’-RLM-RACE products prepared from twice extracted

RNA. The lanes (left to right) are the DNA marker IV (Roche), with selected sizes in bp, then a negative

control (no cDNA), T47D, LNCaP and LNCaP control cDNA not obtained by the 5’-RLM-RACE method.

The control β2-microglobulin amplicon is 250 bp as expected. B. Testing the two reverse transcriptases for

cDNA synthesis activity. The lanes (left to right) are the DNA marker IV (Roche) with selected sizes in bp

indicated, next is a negative control (-VE, no cDNA), then AMV and SuperScript II reverse transcriptase

treated LNCaP RNA. The β2-microglobulin product is 250 bp as expected. C. Screening a new 5’-RLM-

RACE preparation of LNCaP cDNA using RNA prepared by Qiagen RNA-Easy column purification. The

lanes (left to right) are, the 100 bp DNA marker (Progen) with selective sizes in bp, a negative control (-

VE, no cDNA), and the LNCaP β2-microglobulin amplicon at 250 bp as expected.

Mar

ker

-VE

AM

V

Supe

rScr

ipt I

I

310 bp118 bp

250 bp

B.

Mar

ker

-VE

LNC

aP200 bp

500 bp

250 bp

C.

Mar

ker

-VE

T47D

LNCa

PCo

ntro

l

601 bp

310 bp 250 bp

A.

118 bp

100

none of the RLM-RACE preparations would amplify β2-microglobulin, an experiment

was performed to determine if the 5’-RLM-RACE kit AMV reverse transcriptase was

active. The RNA from LNCaP cell lines were treated with AMV reverse transcriptase

and SuperScript II reverse transcriptase (as a control) and the subsequent cDNA screened

for β2-microglobulin. Both of these enzymes resulted in the synthesis of cDNA that was

of high quality and allowed the amplification of β2-microglobulin (Figure 4.7B). Thus, it

was determined that the reverse transcriptase was active.

To further assess the problem of low RNA yields, another sample of LNCaP RNA was

prepared. However, the initial processing of the sample with phenol was omitted and

instead, the RNA was purified using an RNA-Easy column (QIAGEN). Following RT-

PCR a strong β2-microglobulin amplicon was observed (Figure 4.7C). Thus, the initial

5’-RLM-RACE procedure where the RNA was extracted twice resulted in the loss of a

large amount of product. Therefore, for the following 5’-RLM-RACE assays, this RNA

processing stage was omitted and the RNA was purified through an RNA-Easy column.

Following this modification of the RNA preparation in the 5’-RLM-RACE procedure, the

KLK4 TIS in T47D and LNCaP were re-assayed.

Both of the RNA preparations from the LNCaP (Figure 4.8A) and the T47D (Figure

4.9A) cell lines were equally of high quality with the 28S and 18S ribosomal RNA intact

for both samples. Several different sets of primers 5’of ATG2 were not successful in

obtaining the KLK4 TIS (data not shown). However, in the subsequent 5’- RLM-RACE

assay, using both the K4242 outer and K4238 inner primers (Table 4.1 and Chapter 2,

section 2.16.4), both the LNCaP (Figure 4.8B) and T47D (Figure 4.9B) RNA samples

yielded clean PCR products of 190 bp and 220 bp respectively. Additionally, the

negative TAP controls for both of these figures were negative as expected. The

amplicons from these products were cloned and sequenced, resulting in the identification

of the TIS for KLK4 in both of the LNCaP (Figure 4.8C) and T47D (Figure 4.9C) RNA

extracts. The identification of the TIS for KLK4 in the LNCaP RNA extract (Figure 4.8)

supported that identified by Korkmaz et al. (2001) however, the sequence from this data

101

Figure 4.8. 5’-RLM-RACE to Identify the KLK4 TIS in the Prostate Cancer Cell Line, LNCaP. A.

RNA integrity from the LNCaP cell line was monitored to validate its quality for the 5’-RLM-RACE assay.

The intensity of the ribosomal RNA, 28S and 18S bands indicate the integrity of the RNA sample. B. A

reverse exposure of the ethidium bromide stained gel of the 5’-RLM-RACE using LNCaP RNA. The lanes

(left to right) are the 100 bp DNA marker (Progen), a negative TAP control (-VE TAP), and the LNCaP 5’-

RLM-RACE product showing an amplicon at approximately 190 bp. C. BLAST analysis and sequence

alignment of the 5’-RLM-RACE product from B. The query sequence is the input sequence data from

AGRF, and the subject is the match with the BLAST database. The match is 100% Homo sapiens KLK4

and the TIS is the first “g” nucleotide. The ATG identified by Korkmaz et al. (2001) is shown as a

rectangle and is 42 bp downstream of the identified TIS.

102

Ribosomal RNA

28S

18S

5S

A.

Mar

ker

-VE

-VE

TAP

T47D

200

500

220 bp

B.

gi|24234714|ref|NM_004917.2| Homo sapiens kallikrein 4 (prostase, enamel matrix, prostate) (KLK4), mRNA Length = 1280 Score = 335 bits (169), Expect = 1e-89 Identities = 169/169 (100%) Strand = Plus / Plus Query: 1 gtctctggtagctgcagccaaatcataaacggcgaggactgcagcccgcactcgcagccc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 70 gtctctggtagctgcagccaaatcataaacggcgaggactgcagcccgcactcgcagccc 129 Query: 61 tggcaggcggcactggtcatggaaaacgaattgttctgctcgggcgtcctggtgcatccg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 130 tggcaggcggcactggtcatggaaaacgaattgttctgctcgggcgtcctggtgcatccg 189 Query: 121 cagtgggtgctgtcagccgcacactgtttccagaactcctacaccatcg 169 T47D |||||||||||||||||||||||||||||||||||||||||||||||||

C.

Figure 4.9. 5’-RLM-RACE to Identify the KLK4 TIS in the Breast Cancer Cell Line, T47D. A. RNA

integrity from the T47D cell line was monitored to validate its quality for the 5’-RLM-RACE assay. The

intensity of the ribosomal RNA, 28S, 18S and 5S bands indicate the integrity of the RNA sample. B. A

reverse exposure of the ethidium bromide stained gel of the 5’-RLM-RACE using T47D RNA. The lanes

(left to right) are the 100 bp DNA marker (Progen), a negative control (no cDNA), a negative TAP control

(-VE TAP), and the T47D 5’-RLM-RACE product showing an amplicon at approximately 220 bp. C.

BLAST analysis and sequence alignment of the 5’-RLM-RACE product from B. The query sequence is the

input sequence data from AGRF, and the subject is the match with the BLAST database. The match is

100% Homo sapiens KLK4 and the TIS is the first “g” nucleotide. The ATG identified by Korkmaz et al.

(2001) is shown as a rectangle and is 78 bp downstream from the identified TIS.

103

extended 4 bp 5’ to that identified by these authors (Figure 4.10). Moreover, the KLK4

TIS for the T47D extract extended 35 bp 5’ of the TIS identified in the LNCaP RNA

(Figure 4.10) and 78 bp from the ATG identified by Korkmaz et al. (2001) (Figure 4.10).

These experiments were repeated at least three times for both LNCaP and T47D cell lines

to confirm the transcripts identified.

4.3.5. Identification of the KLK4 Promoter Region and Potential Regulatory Motifs.

The identification of the KLK4 TIS allowed for the screening of the promoter region for

potential regulatory elements. To do this, a number of approaches were used. Initially,

the 5’ flanking promoter and upstream regions of KLK2 and KLK3 were aligned with the

same region of KLK4 to try to identify any common regulatory elements (Figure 4.11).

Both KLK2 and KLK3 are highly conserved (approximately 80% from -300 bp to -1bp

with respect to the TIS) in the 5’ flanking regions and share remarkable conservation in

their androgen response elements (AREs) (Murtha et al., 1993). It is well recognised that

these AREs are the consensus sequence for a number of other steroid hormone receptors,

namely the glucocorticoid and progesterone receptors (GR and PR, respectively)

(Massaad et al., 2000). As KLK4 shares 37% homology at the amino acid level with K2

and K3 (Stephenson et al., 1999) and 52% similarity with K3 (Nelson et al., 1999a), it

seemed logical to see if they also share some conserved regulatory motifs such as the

ARE. Therefore, the 5’ flanking regions of all three genes (at least 5 Kb) were aligned

from approximately their TISs (the TIS from Korkmaz et al., 2000 was used for KLK4) to

determine the extent of conservation between the known AREs for KLK2 and KLK3 and

to determine if KLK4 also shared this conservation. From these data, it was clear that

KLK2 and KLK3 share high sequence similarity within the promoter region and upstream

distal regions as previously described (Murtha et al., 1993) (Figure 4.11). Additionally,

the well-characterised proximal AREs for both KLK2 and KLK3 share high sequence

similarity and are in similar locations; however, there was no conservation within these

regions for the KLK4 promoter (Figure 4.11). Although KLK4 did appear to share some

sequence similarities to KLK2 and KLK3 in a number of regions, these were not

characteristic of class III steroid receptor motifs.

104

Figure 4.10. Sequence Data Representing the Transcription Initiation Site (TIS) from the 5’-RLM-

RACE Experiment for the KLK4 Gene in the Breast Cancer and Prostate Cancer Cell Line, (T47D

and LNCaP, respectively). The KLK4 sequence is outlined above with the nucleotides given in lower

case and the amino acids in upper case. The bold lower case region represents the 5’-untranslated region

(5’-UTR), the capitalised and underlined ATG is that identified by Kormaz et al. (2001), the arrow at the

(g) nucleotide represents the TIS for KLK4 in T47D cells, 78 bp upstream from the ATG, whilst the V at

the (g) nucleotide signifies the TIS for KLK4 in LNCaP cell lines, 42 bp upstream from the ATG (4 bp 5’

of the identified TIS in LNCaP by Kormaz et al., 2001). The asterisk after the last serine amino acid

denotes the stop codon (taa).

105

Figure 4.11. Representative Sequence from 5 Kb of 5’ Up-Stream Regions from KLK2-4, Location of

AREs, and Relative Position to each Gene Region. Regulatory elements are shaded (grey) and the AREs

for KLK2 and KLK3 are shown with their approximate distance in bp from the TIS region. The schematic

below the sequence is a pictorial view.

KLK2 AAATCCTCAATCTT---ATAAGAAGGTA-CTAGCAAACTTGTCCAGTCTTTGTATCTGACGGAGATATTAT KLK3 GAATCCTCAATCTT---ATACTGGGACAACTTGCAAACCTGCTCAGCCTTTGTCTCTGATGAAGATATTAT KLK4 GGATGAAGGAGGAGGGGAGAGAGAGAGAGAGATTTAATTTAAAAAGAGAAAGAACATGAGAGAGAACAGGA ARE (approx. –4 Kb) KLK2 CTTTATAAT--TGGGTTGAAAGCAGACCTACTCTGGA GGAACATATTGTATT TATTGTCCTGAACAGTA KLK3 CTTCATGATCTTGGATTGAAAACAGACCTACTCTGGA GGAACATATTGTATC GATTGTCCTTGACAGTA KLK4 GAGAATGAGA-GGAAATGAAAGAAAAC--AC----GA GAAAAATAATGA--- GAGAGAGAATGAGAG-A ARE (-400 bp) KLK2 AACAAATCTGCTGTAAAA AGGAGAATCG--GTTGA--GTCTGGGAGT--TCAAGGCTACAGGGA KLK3 AACAAATCTGTTGTAAG- ATAAAAGTTCTAGTTTCTGGTCTCAGAGTGGTGCAGGGATCAGGGA KLK4 AAGAAAGAAG----AAGA ---------------------------------------------- KLK2 GCTGCGATCACGCC-----GCTGCACTC------CAGCCTGGGAAACAGAGTGAGACTG-TCTCAGA KLK3 GTCTCACAATCTCCTGAGTGCTGGTGTCTTAGGGCACACTGGGTCTTGGAGTGCAAAGGATCTAGGC KLK4 ------------------------------------------------------------------- ARE (-170 bp) KLK2 TGCCTCCAGACTGATCTAGTATGTGT GGAACAGCAAGTGCT GGCTCTCCCTCCCCTTCCACAGCTCT KLK3 TGCATCCAGGGTGATCTAGTAATTGC AGAACAGCAAGTGCT AGCTCTCCCTCCCCTTCCACAGCTCT KLK4 ----------------------------------------------------------------------

+1 ARE

Approx. -170 bp

ARE

-400 bp

ARE

Approx. Approx. -4 Kb

106

Therefore, an extensive search of the proximal promoter and distal 5’ flanking sequence

(approximately 1.5 Kb) of the KLK4 gene was performed using the transcription factor

databases, SigScan (Prestridge, 1991), MatInspector (Quandt et al., 1995) and Cister

(Frith et al., 2003). From these studies potential clusters of Sp1 sites were identified

using the Cister software (Figure 4.12 and 4.13). Another common element found in

promoters is an initiator (Inr) (5’-TCATCTC-3’) usually localised around -5 to + 6 of the

TIS (Suzuki et al., 2001). This element is thought to be involved in basal levels of

transcription either in the presence or absence of a TATA-box (Wolner and Gralla, 2000).

Analysis of the KLK4 TIS region from the T47D 5’RLM-RACE data revealed an

initiator-like sequence of 5’-TCGTCTC-3’ where there is one nucleotide difference, that

is, a G nucleotide at position 3 is replaced by an A nucleotide (Figure 4.12). Additionally,

the palindromic sequence 5’-CTGCAG-3’, that has been shown to be statistically over-

represented in 5-UTRs, was identified (Pesole et al., 2001) (Figure 4.12).

107

Nelson, Stephenson 1601 GAGGGATGGA GAGACTTGGG CTGAAGATCC CCAGACACGG CTAAGTCTCA GTCCTCATCC CCAGGTGCTG ACGTGATGGC 1681 CACAGCAGGA AATCCCTGGG GCTGGTTCCT GGGGTACCTC ATCCTTGGTG TCGCAGGTAT CTGAGTATGC GTGTGTGTGT 1761 CTGTCCGTGC TTGGGGGCAC AGTGTTTGTT AATGTTCAGG TGTGACTCAG TGTCCTCTTG CTTGTGACTG CAAAGCTGCC 1841 TGTGAGACGG TACCGTGTTA TCCGTCCCCC ATGGCTGTGC CCCTGCAACT CCTTGTATCG TGGTAAATTT GTGTGTGGCA 1921 GTGTGCCTGG GTGTGTGGTT GTACCTGTGA GACTCTGACA GTTTGTGCCT CTGAATATCT GGTGGAGTGA CAACAGTGTA 2001 ATGATGATAT GGGGACAGGG GAAGCCGAGG GTGCAGGAGA TTGTGCTTCC TGGGGCGTGA TCCATTGCTG GGAATCTGTG 2081 CCTGCTTCCT GGGTCTTCAG TCCTGAGATC CCCCTCTCCC ATCCCCAAGG AACTCACCTC ACAGGACTAT AAAACGGTGT 2161 TTTGGTGTGC ATGGGCTTGT GGCTTGGTGT GACTGTGGGC AAGGCTGGGA GAGGATAGGA GTGACTCGGC GCAGGACCGA 2241 CTCTTTGAGC ATCAGTCTGC GCAGACAAGT GACCCGATCC TTGCTCCCAG CAACAACTCC ACCCCCTGAG CTTTAATTCA 2321 CCCCGAAGGA CCCGATCCTA CTGCTATGAG CCTAGACTCC TCTGTTGAAC CCCTCCTGAC CGTGGCTTTG CACCGCGATG 2401 GCACCAGTCT CACCTCCAGA GCTCACCCCA GAGCCCTGAC TCCGCCCCAG AAGCCCTGGT CCCACCTTCT GAGACTGCCT 2481 CTAGCCATAA CCCAGCTCTT GAAGCCTTGA TGGCGCCCCT GCGCTGTAAC CCCAACCCTA GGAGCACTGA TCCCGCCTTC 2561 TCAGCCCACC CCCATGCCCT GACTCTCCTC CCAGGAGCCC TGACTACCCT GAATCCCTGA CCAGGCTCCT GCACCGTGAT SP1 2641 CACCGCCCCT GGGAGCCCTA GGCCTATATC CTGGACCAGC CCCTGAAGCT CCGATCATGA CCCCTGCACC ATAACCCCAC SP1 SP1 2721 CCCCAGGAGC CCTGGGTCCG CCCCCTGGGC CCGCCCCCAG CCCTGACTCG GCCCCCCAAG AGTCCTGACT GCTCCTGAAG SP1 SP1 SP1 2801 CCCTGACCAC GCCCCTGCTC GGTAACCCCT CCCCCAAGAG CCCTGGGCCC GCCTCCTGAG CCCGTTCCCA GCCCTGACTC SP1 SP1 SP1 2881 CGCCCCGAGG AGCCCTGACT GCTCCTGAAC CTCTGACCAC GCCCCTGCTC GGTAAGCCCA CCCCCAGGAA CCCTGGGCCC Sp1 T47D TIS 2961 GCCTCCTGGT CCCGATCCCA TCCCTGACTC CGCCCTCAGG ATCGCTCGTC TCTGGTAGCT GCAGCCAAAT CATAAACGGC LNCaP TIS Korkmaz 3041 GAGGACTGCA GCCCGCACTC GCAGCCCTGG CAGGCGGCAC TGGTCATGGA AAACGAATTG TTCTGCTCGG GCGTCCTGGT 3121 GCATCCGCAGTGGGTGCTGTCAGCCGCACACTGTTTCCAGAA

Figure 4.12. Sequence of Part of the KLK4 5’-Flanking Proximal Promoter Region Genomic DNA

and Exonic Regions and Position of the Sp1 Sites, Transcription Initiation Sites, and ATG Sites for

Translation. This diagram shows the motifs identified by SigScan, MatInspector and Cister. The yellow

indicates the exons 2 and 3; the red ATG shows the putative translation sites (Nelson et al., 1999a;

Stephenson et al., 1999 and Korkmaz et al., 2001). The pink shows the SP1 clusters as identified by Cister.

The green represents the TIS as identified by Korkmaz et al. (2001) in LNCaP and in this study in T47D.

The grey shading represents a common palindrome that is statistically over-represented in 5’UTRs. The

potential Initiator element (Inr) is underlined at the T47D TIS.

108

Figure 4.13. Cister Scan and Plot of Potential Cis-Acting Motifs in Approximately 3 kb of KLK4 5’

Flanking Genomic Sequence. The coloured lines represent the cluster of transcription factors at a

common region; for example, a large number of Sp1 sites (blue) were identified between positions 2700 bp

and 2900 bp (corresponds to -200 bp from the KLK4 TIS). Additionally, these lines represent the

probability of Cis-motifs in these positions, and the potential to bind trans-acting factors such as Sp1. The

black curve represents the overall probability that these motifs will occur in a cluster. Lines in the upper

half of the plot indicate the direct strand, whilst lines in the bottom half of the plot represent the

complementary strand. The position in base pairs is given at the top of the graph where 3000 bp represents

the TIS site region as identified from the 5’-RLM-RACE in T47D cell lines. Other factors identified were

the TATA-box (red), CCAAT-box (green) and AP-1 sites (pink), however, these were of low probability

and did not match classic regulatory sequences.

109

4.4. DISCUSSION

Currently there is some confusion in the literature regarding the exact position of the

KLK4 TIS and thus the flanking promoter regions. Early studies on the characterisation of

the KLK4 gene identified up to five exons utilising either sequencing of EST libraries

and/or comparative exon prediction analysis with other members of the kallikrein gene

family (Stephenson et al., 1999; Nelson et al., 1999a; Yousef et al., 1999b) but the

precise TIS was not identified. However, recently, two groups identified the KLK4 TIS

from a human unidirectional prostate cDNA library (Hu et al., 2000) and in the prostate

cancer cell line (LNCaP) and a prostate cancer xenograft, CWR22 (Kormaz et al., 2001).

Both of these authors identified two different sized KLK4 transcripts, one that is derived

from six exons (Hu et al., 2000) and the other derived from only four exons (Korkmaz et

al., 2001) (see Figure 4.2). The larger transcript encodes the full-length pre/pro enzyme

while the latter would encode a truncated transcript that excludes the reputed signal and

pro domain.

Therefore, the aim of this study was to determine the status of the KLK4 TIS in the breast

(T47D) cancer cell line, and to identify potential progesterone elements that may be

involved in the regulation of the KLK4 gene. The outcome of these experiments

confirmed the existence of a truncated KLK4 transcript previously identified in LNCaP

by Korkmaz et al. (2001) in both the breast and prostate (T47D and LNCaP, respectively)

cancer cell lines. Additionally, it is possible that the six-exon KLK4 transcript identified

by Hu et al. (2000) in a prostate cDNA library also exists in the T47D cell line, although

this was not verified. A number of regulatory motifs were identified such as a cluster of

Sp1 sites; however, a consensus sequence for the progesterone receptor was not identified

in the region up to 1.5 Kb “up-stream” of the designated TIS.

Initially, the LNCaP prostate cancer cell line, and a prostate cDNA library were used as

controls to validate the different approaches to be used. The attempts to identify the

KLK4 TIS using these controls were not always successful. Similarly, experiments with

T47D RNA were inconsistent. These problems could have been due to a number of

factors such as primer design, sample purity, RNA extraction procedures or the relative

110

abundance of KLK4 mRNA. Indeed, the abundance of KLK4 mRNA is greater in LNCaP

than T47D cells. Data was successfully obtained for the [γ32P]-ATP KLK4-labelled

primer extension in LNCaP cells and the KLK4-labelled CF primer extension in T47D

cells. It is presumed that these gene products represent “true” KLK4 transcripts but there

is no way to determine if non-specific priming occurred. This is one of the major

problems associated with primer extension assays, as this technique depends solely on a

gene-specific priming event to occur. However, given that the size of the extension

products (LNCaP [γ32P]-ATP KLK4, 140 bp and T47D CF-labelled KLK4, 165 bp)

corresponded to the transcripts identified by Korkmaz et al., 2001 and Hu et al., 2000,

respectively, and a BLAST search of these primers showing they were KLK4-specific, it

is likely that these data are valid. Although several primers were tried with labelled

[γ32P]-ATP, only those primers 5’ of ATG2 (CF-labelled) preferentially identified the

TIS previously reported by Hu et al. (2000).

A re-evaluation of the 5’-RLM-RACE procedure was required to maximise RNA yields

and assay conditions. Hence, a more stringent process was undertaken, whereby, RNA

was screened for highest purity and quality, primers were re-designed to provide

maximum specificity and amplification and processing of the RNA was kept to a

minimum to avoid any loss of material. Following these modifications the TIS for the

KLK4 transcripts in the breast and prostate cancer cell lines, T47D and LNCaP,

respectively, were identified. These transcripts appear to be the most highly expressed

forms in these cell lines and are derived from only four exons, therefore excluding the

reputed pre/pro signal peptide of the full-length published sequences (Nelson et al.,

1999a; Stephenson et al., 1999; Yousef et al., 1999b; Hu et al., 2000).

Although it may be possible that the 5’-RLM-RACE transcription did not go to

completion and missed the larger transcript previously identified (Hu et al., 2000; Nelson

et al., 1999a; Stephenson et al., 1999; Yousef et al., 1999b), this scenario is probably

unlikely for three reasons. First, the transcript identified by Korkmaz et al. (2001)

supports our findings. Secondly, the 5’-RLM-RACE method only will identify those

transcripts that have a “true” 5’- CAP (7-methyl-guanosine, m7G) and not those

111

transcripts that are uncapped. The 5’-m7G plays an important role in facilitating the

attachment of the cap-binding translation factor, eIF4E that in turn, facilitates the 40S

ribosomal subunit complex assembly on the mRNA (Day and Tuite, 1998). Thus, non-

capped transcripts will not be able to recruit the ribosomal complex and therefore will not

usually be translated. Although there are reports of 5’-m7G-independent ribosome

binding through Y-shaped secondary structures, denoted Internal Ribosome Entry Site

(IRES), these have mainly been restricted to viruses such as the picornavirus, retroviruses

and some Flaviviruses (Bonnal et al., 2003). Thirdly, the original studies by Stephenson

et al. (1999), Nelson et al. (1999a) and Yousef et al. (2000b) could not identify the

putative KLK4 exon one and thus, relied on bioinformatic analysis to identify this region.

Thus the 5’-RLM-RACE is a more robust system for identifying genuine mRNA

transcripts via determination of the CAP sites and therefore the TIS.

Although the full-length KLK4 transcript has been reported (Hu et al., 2000; Nelson et al.,

1999a; Stephenson et al., 1999; Yousef et al., 1999b), from the studies reported in this

thesis, full-length KLK4 is likely to be expressed at extremely low levels in the LNCaP

and T47D cell lines. In this laboratory, we have repeatedly observed only low expression

of the full-length KLK4 particularly in the LNCaP cell line (Rachael Collard, personal

communication, QUT), a finding that supports the observation of Korkmaz et al. (2001).

Thus, the high abundance of the truncated transcript would probably out-compete the

full-length transcript for reagents when performing 5’-RLM-RACE studies. An

alternative scenario as to why the 5’-RLM-RACE did not pick up the sequence identified

by Hu et al. (2000) could be that the primers 3’ of ATG2 preferentially primed the

Korkmaz sequence. Additionally, primers 5’ of the ATG2 did not amplify the region

previously identified by Hu et al. (2000). An alternative proposition is that both

transcripts are differentially regulated, however this was not tested.

Another important factor in determining the validity of the TIS in these studies is the

inclusion of a negative TAP control. This sample is taken from the original RNA extracts

prior to the TAP treatment and then processed in exactly the same manner as the TAP-

treated sample. A negative TAP sample ensures that the initial CIP treatment has gone to

112

completion. Any amplicon observed in the negative TAP sample would indicate

phosphorylated transcripts that would be able to bind to the RNA hydroxylated-adapter

sequence. Importantly, as the capped transcripts are protected from the CIP treatment

and binding of the adapter sequence, products in the negative TAP sample would not be

full-length transcripts. Additionally, it is extremely important to identify the adapter in

the resulting sequence of the 5’ extended product. From these studies, it is clear that the

TIS has been mapped for KLK4 in the T47D and LNCaP cell lines as all of the above

controls have been stringently observed.

It is interesting to note, despite the major importance for identifying the promoter region

of a gene, entries into the Eukaryotic Promoter Database are limited (http://www.epd.isb-

sib.ch; Perier et al., 2000). Only 273 human promoters have been registered (Suzuki et

al., 2001). This is probably due to the extreme difficulty in obtaining “true” mRNA 5’-

CAP sites, as most of the conventional methods (primer extension, 5’-RACE, S1

mapping) for acquiring these sites are challenging and often inaccurate.

In light of this, we have demonstrated that the foremost expressed KLK4 transcript in

LNCaP and T47D cell lines consists of only four exons. The absence of the first exon is

important as this region has the potential to encode the signal domain that targets the

enzyme for secretion (Korkmaz et al., 2001). Moreover, the absence of the signal region

suggests that the hK4 protein is not secreted and consequently may perhaps be retained

intracellularly. Interestingly, studies from our laboratory (Dr. Jon Harris and Dr. Ying

Dong, personal communication, QUT) and others (Korkmaz et al., 2001) using a KLK4-

GFP (green fluorescence protein) construct and K4-specific antibodies have identified

nuclear localization of this protein. In addition, Western blot analysis and ELISA studies

in our laboratory using spent medium from LNCaP cell lines, identified extremely low

levels of secreted hK4 (Rachael Collard, personal communication, QUT).

The absence of a signal peptide and the possibility that K4 is retained intracellularly may

suggest that this protein is constitutively active and possess distinct intracellular

substrates. Crucially, the serine protease catalytic triad, histidine, aspartate and serine

113

(essential for the catalytic activity of the protease) are still conserved. Computer

modelling studies of this variant form suggests that the correct folding conformation of

this enzyme will still be conserved (Dr. Jon Harris, personal communication, QUT) and

therefore the enzyme would still most likely function as a serine protease. Nevertheless,

despite the unknown function of the truncated KLK4 transcript, from the studies

presented in Chapter Three, both the KLK4 gene and hK4 protein expression is

hormonally regulated by progesterone.

The identification of the TIS for the KLK4 gene enabled exploration of the potential

promoter region. A consensus TATA-box within -25 to -30 bp upstream of the TIS could

not be identified; however, there are many examples of genes that are TATA-less (Wiley

et al., 1992; Ince and Scotto., 1995; Weis and Reinberg., 1997). Although a putative

TATA-box was identified by Hu et al. (2000) upstream of the putative TIS1, it has not

been functionally tested. Interestingly, it has been shown that approximately 50% of

promoters in Drosophila are TATA-less (Arkhipova., 1995). Additionally, a large-scale

study performed by Suzuki et al. (2001) employed the 5’-RLM-RACE technique to

identify the TIS for at least 2251 genes. From this study, 1031 transcription initiation

sites were identified and only 329 (32%) of these harbored the TATA box element

consensus sequence approximately -25 to -40 bp from the TIS (Suzuki et al., 2001).

However, it is interesting to note that the frequency of a GC box (-74 to -45 bp from the

TIS) for these 1031 genes was 97% and this may suggest that the GC box is implicated in

a more fundamental role in transcription than the TATA box.

Analysis of the proximal KLK4 promoter revealed a number of GC box sites (Sp1,

CCCgCCC) upstream from the TIS in the T47D cell line. It is well established that Sp1

sites are involved in basal transcription and studies on the TATA-less lactate

dehydrogenase-B (Ldh-B) promoter from Fundulus hetroclitus (fish) reveals a cluster of

Sp1-like sequences within the proximal promoter region (Crawford et al., 1999). It has

been suggested that the sequence-specific transcription factor, Sp1, binds to these GC box

sites and tethers the preinitiation complex to TATA-less promoters by interacting with a

component of transcription factor II D (TFIID) (Weis and Reinberg, 1997). It is

114

interesting to note that within 3 Kb of KLK4 DNA sequence the only cluster of Sp1 sites

identified were within the TATA-less region of the TIS and therefore, may suggest a role

for SP1 regulation of the KLK4 gene.

Early studies using the TATA-less murine terminal deoxynucleotidyltransferase (TdT)

promoter identified a second core element, the initiator (Inr) that encompasses the TIS

and is sufficient to position the basal transcriptional machinery in the absence of a TATA

element (Smale and Baltimore, 1989). The consensus sequence for this Inr element is

debatable, however, the large study by Suzuki et al. (2001) demonstrated the Inr element

in 872 genes consisted of NCANNNNN (where N = an A, T, G or C). However, other

studies identified the Inr element as TCANTCT where A = the +1 and N = any nucleotide

(Adams et al., 1998). It is possible that the TIS for T47D may contain a “loose” Inr

(TCGCTCT, where G = the +1), however this requires further testing. From these data, it

is clear that the initiator element is probably gene-specific as well as tissue-specific.

Additionally, among statistically over-represented motifs in the 5’UTR of many genes is

the palindrome CTGCAG (Pesole et al., 2001). In the data presented here a consensus

motif CTGCAG was also identified in the 5’UTR region of the KLK4 promoter however,

the nature of this motif is yet to be identified.

Utilising bioinformatics, there were not any potential PREs identified in the proximal

KLK4 promoter region. This may indicate that there are alternative mechanisms of

progesterone regulation. However, there are many cases where hormone response

elements have diverged from their consensus sequence (Kepa et al., 1996; Zhang et al.,

1997; Zhou et al., 1997; Klinge, 2001) to provide tissue and receptor-based specificity.

However, the analysis of further 5’ flanking regions needs to be performed to determine

if putative PREs are present in the distal 5’ flanking regions. Moreover, studies at the

proximal promoter level for basal activity and hormonal response need to be performed

to confirm if this identified promoter region is transcriptionally active. Thus, these

studies are the basis for Chapter 5.

115

4.5. CONCLUSIONS

In this study, we have successfully identified, for the first time, the TIS for the KLK4

gene in T47D cell lines, and have confirmed the transcript identified by Korkmaz et al.

(2000) in the LNCaP cell line. This truncated KLK4 transcript appears to be the most

highly expressed form in both LNCaP and T47D cell lines. This transcript does not

contain the putative pre/pro signal domain, predicted in the full-length sequence, and

thus, is unlikely to be secreted and may encode a constitutively active serine protease.

However, the data presented in Chapter Three clearly shows progesterone regulation of

KLK4 gene and hK4 protein levels in whole cell extracts, and therefore, a possible role

for the truncated form intracellularly. The successful identification of the promoter

region, enabled the identification of several Sp1 sites that may be involved in basal levels

of transcription however, no PREs were identified. Thus, to determine if this proximal

KLK4 promoter region is functional and contains PREs, reporter assays are to be

performed. These are the basis of Chapter Five.

CHAPTER 5

INTERROGATION OF THE PROXIMAL PROMOTER

REGION OF THE KLK4 PROMOTER FOR BASAL AND

HORMONAL ACTIVITY

117

5.1. INTRODUCTION

To understand the mechanisms of transcriptional regulation of a gene, one first needs to

identify and characterise the promoter region. The promoter is usually located proximal

to, or overlapping the TIS, and contains several sequence motifs that are important in

recruiting specific trans-acting factors involved in transcriptional regulation (Suzuki et

al., 2001). Thus far, only KLK2 and KLK3 have been studied in any detail at the

transcriptional level. In these studies, the proximal promoters of both genes contain

androgen response elements (AREs) that are responsive to androgens and are involved in

the transcriptional regulation of both of these genes (Cleutjens et al, 1996, 1997; Brookes

et al, 1998; Riegman et al, 1991; Zhang et al, 1997; Pang et al, 1997; Yu et al, 1999;

Luke and Coffey, 1994; Sun et al, 1997; Schuur et al, 1996; Mitchell et al, 2000; Sato et

al, 1997; Murtha et al, 1993; Yeung et al, 2000).

In Chapter Four, the identification of the transcription initiation site (TIS) for KLK4 was

identified in the breast cancer cell line, T47D. Additionally, this KLK4 transcript would

only encode for four exons and not five as previously identified (Nelson et al., 1999a;

Stephenson et al., 1999) and would yield a protein product that excludes the pre/pro

region (30 residues) and 19 residues of the mature N-terminal region of the hK4 protein.

Only one other group has reported a truncated KLK4 transcript, consisting of four exons,

in the prostate cancer cell line, LNCaP and the CWR22 prostate cancer xenograft

(Korkmaz et al., 2001). As mentioned in Chapter Four, Nelson et al. (1999a) and

Stephenson et al. (1999) could not identify the five exon-coding KLK4 transcript by

molecular techniques and therefore relied on an alignment with KLK3 to identify the

missing exon.

Bioinformatic analysis of the proximal promoter region of the KLK4 gene (approx. 1.5

Kb) identified a number of putative Sp1 sites in what appeared to be the minimal

promoter region of this gene (see Chapter 4). It has been suggested that Sp1 sites are

important for basal levels of transcription by tethering the pre-initiation complex to

TATA-less promoters by interacting with a component of Transcription Factor II D

118

(TFIID) (Weis and Reinberg, 1997). Therefore, the question was -does this putative

minimal promoter region of the KLK4 gene confer basal promoter activity when fused to

a synthetic reporter gene?

To answer this question, two KLK4 promoter constructs were studied. One construct

(K4-446) was designed to encompass the putative Sp1 sites identified in Chapter 4

(Figure 5.1A and B). The other construct (K4-898) includes the entire K4-446 construct

plus an additional 452 bp of 5’ sequence (Figure 5.1A and B). Both of these constructs

were fused to a luciferase reporter gene vector and transfected into T47D cell lines to

measure basal as well as progesterone and estrogen transcriptional activity.

119

Figure 5.1. KLK4 Promoter Sequence Analysed for the Design of KLK4 Deletion Constructs in the

Proximal Promoter Region. A. The KLK4 sequence is approximately 1.5 Kb in length and represents the

region analysed for the construction of the PGL3-basic KLK4 promoter constructs. The length of the two

constructs designed is shown by the arrows (construct K4-898 and construct K4-446 are both the forward

primers, while the anchor primer is common to both constructs). Underlined regions in brown indicate the

Sp1 sites as identified in Chapter 4, the G nucleotide in larger font size represents the TIS as identified for

KLK4 in T47D breast cancer cell lines and the blue nucleotides represent the 5’ untranslated regions

(UTRs). The ATG (Korkmaz et al., 2001) and the boxed ATG (Stephenson et al., 1999, Nelson et al.,

1999a) represent the two putative ATG start sites for translation (see Chapter 4, Figure 4.2). B. Schematic

diagram of the above sequence showing the relative positions of the two ATGs (1 and 2), TISs (1 and 2),

Sp1 sites and primer locations for both the K4-446 and K4-898 constructs. The black squares represent the

common anchor primers. The first three exons are only shown where the red regions indicate 5’-UTRs and

the blue regions indicting the coding regions. Note, the numbers given for K4-446 and K4-898 are the

distance in bp from the anchor primer.

120

121

5.2. MATERIALS AND METHODS

All the procedures for the experiments below are listed in Chapter 2; however, to

maintain continuity a brief outline will be given below.

5.2.1. Promoter Construct Design and Strategy

In order to design promoter constructs for the KLK4 gene sequence, it was first important

to interrogate the KLK4 promoter region for restriction enzyme (RE) sites that were

compatible with RE cloning sites in the pGL3-basic Luciferase reporter gene vector.

Thus, it was important that the RE sites in the Luciferase vector were not located within

the KLK4 promoter. Additionally, it is important that the promoter region under test is

inserted in the correct orientation, that is, in the direction of transcription. Therefore,

approximately 1.5 Kb of KLK4 promoter region, including sequence flanking the TIS

(Myers, Unpublished data) (Figure 5.1) was analysed for restriction sites using the Web-

Cutter Software (www. Firstmarket.com/cgi_bin/cutter). All the parameters for this

software were set in the default position except the “show only enzymes that do not cut”

box was highlighted. The pGL3-basic Luciferase vectors used in this study contain a

multiple cloning site (MCS) that enables the insertion of a specific DNA sequence under

test.

5.2.2. Preparation of Bacterial Artificial Chromosome and COSMID DNA

The preparation of BAC and COSMID DNA was performed as described in Chapter 2

(section 2.10). A bacterial artificial chromosome (BAC) clone (#85745), and the Cosmid

(#28781) were used as they both contain the full-length KLK4 genomic sequence (Harvey

et al., 1999).

5.2.3. PCR Amplification of the KLK4 Promoter

The PCR was performed essentially as described in Chapter 2 (section 2.11.2) except the

“proof-reading” enzyme pfu was used instead of platinum Taq polymerase. The primers

for these constructs were, K4-898-5’-CCCCTCGAGAAAACGGT GTTTTGGTGTG-3’,

K4-446-5’-CCCCTCGAGCTACCCTGAATCCCTGACCA-3’, (forward primers; the

underlined region is the XhoI restriction site) and K4.Anchor-5’-

122

CCCAAGCTTCAGTCCTCGCCGTTTATGAT-3’ (reverse primer; the underlined

region is the HindIII restriction site). Cycling conditions were 94°C for 5 min followed

by 35 cycles of 94°C denaturation for 30 sec, 56°C annealing for 30 sec and 72°C

extension for 1 min and a final extension at 72°C for 5 min. All PCR amplicons were

electrophoresed on a 1% agarose TAE-gel, the amplicons excised and purified through a

QIAGEN PCR purification system as outlined by the manufacturer (QIAGEN).

5.2.4. Cloning PCR Amplicons into pGEM-T Easy and pGL3-basic Luciferase

Vector.

PCR amplicons were cloned into pGEM-T Easy Vectors (Promega) and transformed into

JM109 E.coli cells (Life Technologies) as outlined in Chapter 2 (section 2.17.2-2.17.6).

The PCR products were then cut from pGEM-T with the REs, XhoI and HindIII and

cloned into pGL3-basic Luciferase vectors as outlined in Chapter 2 (section 2.20.2-

2.20.3). Transformation and purification of the vectors containing the insert was

performed as described in Chapter 2 (section 2.17.3-2.17.6). Isolated clones were

sequenced in both directions with pGL3-basic Luciferase primers that flank the multiple

cloning site (MCS) (RVPrimer3-5’-CTAGCAAAATAGGCTGTCCC-3’ and

RVPrimer4-5’-GACGATAGTCATGCCCCGCG-3’).

5.2.5. Transfection of K4-446 and K4-898 Constructs into T47D Breast Cancer Cell

Lines and the Analysis of Luciferase Activity.

The transfection of K4-446 and K4-898 constructs into the breast cancer cell lines, T47D,

and the measurement of luciferase activity was performed as outlined in Chapter 2

(section 2.20.4-2.20.5). Briefly, T47D cell lines were seeded at approximately 2.5 x 104

cells into 24-well plates in DMEM (Gibco BRL Life Technologies, Melbourne,

Australia). Then, at approximately 90% confluency, 1 µg of K4-446 or K4-898

luciferase DNA construct or 1 µg of pGL3-basic control DNA vector, was diluted in 100

µl of Opti-MEM-I reduced Serum Medium (Life Technologies) with 3 µl of

LipofectamineTM 2000 (LF2000, Life Technologies) and added to the cells. Additionally,

to monitor transfection efficiencies, 300 ng of control Renilla vector (pRL-TK, Promega)

was co-transfected with the K4 constructs or the PGL3-basic control vector. After 24 hr,

123

fresh medium containing either 10 nmol/L estradiol (Sigma) or 10 nmol/L progesterone

(Sigma) was added to the T47D cells. Following 24 hr incubations, 100 µl of passive

lysis buffer (PLB, Promega) and 100 µl of LAR II (Luciferase Assay Reagent, Promega)

was added and mixed. The solution was then measured for luciferase activity using a

luminometer. Then, 100 µl of Stop and Glo reagent (Promega) was added and the

Renilla luciferase activity was measured.

124

5.3. RESULTS

5.3.1. Identification of Restriction Sites for the Cloning of KLK4 Constructs into

pGL3-basic Luciferase Vector

In order to identify potential regions for the cloning of the KLK4 constructs into pGL3-

basic luciferase vector, a restriction map was required to identify two restriction sites that

cut the pGL3-basic vector once each, and would not cut the KLK4 sequence.

Importantly, the KLK4 sequence needed to be inserted into pGL3-basic vector in the

correct orientation. That is, the promoter needed to be inserted in the 5’ to 3’ direction,

relative to the 5’ to 3’ direction of the luciferase gene. Thus a restriction map analysis

was performed using the software from WebCutter (www.firstmarket.com/cgi_bin/

cutter). From this analysis, a number of restriction enzymes that do not cut the KLK4

sequence were identified, two of which were HindIII and XhoI (data not shown). These

sites were also common in the pGL3-basic luciferase vector multiple cloning site and in

the correct orientation. Therefore, PCR primers were designed to include the XhoI

(forward) and HindIII (reverse) restriction sites at the 5’ end of each oligo (Figure 5.2).

5.3.2. PCR of KLK4 Constructs K4-898 and K4-446 from BAC and COSMID DNA

PCR constructs K4-898 and K4-446 containing the restriction sites, XhoI and HindIII

were amplified from BAC or COSMID DNA with the “proof reading” enzyme, pfu and

electrophoresed on 1% agarose gels. Both products amplified successfully with the K4-

898 and K4-446 products resulting in amplicon sizes of 898 and 446 bp, respectively

(Figure 5.3A).

5.3.3. Cloning of KLK4 Promoter Constructs into pGEM-T Easy Vector and pGL3-

Basic Luciferase Reporter Vector.

The PCR K4-898 and K4-446 products were subsequently cloned initially into pGEM-T

Easy vector (Promega) and a number of clones were isolated for each construct. Cloned

PCR products were then digested from this vector using the restriction enzymes, XhoI

and HindIII. This was successful for most of the clones showing liberated fragments of

898 and 446 bp, corresponding to the constructs K4-898 and K4-446, respectively

(Figure 5.3B). These were subsequently gel purified and electrophoresed on a 1%

125

Figure 5.2. Schematic Diagram of the pGL3-Basic Luciferase Vector (modified from Promega’s

technical manual, pGL3 Luciferase Reporter Vectors, part# TM033) and a Region of the KLK4

Promoter Sequence. The KLK4 promoter region was designed to include a XhoI and HindIII sequence at

either end of the primers that will be used to amplify the promoter regions (bold and underlined at both

ends of the KLK4 promoter). These can then be cloned into the pGL3-Lucferase vector using the same

restriction sites, XhoI and HindIII, bold and underlined within the MCS. The MCS represents the

restriction enzyme sites within this region, the Luciferase gene is boxed, and the arrows denote the

direction of transcription for both the Luciferase gene and the KLK4 gene. The Poly(A) site is denoted and

represents the termination signal for transcription of the Luciferase gene. Note, this diagram is not drawn

to scale and only contains specific information relevant to the cloning procedure.

Kpn Sac Mlu Nhe Sma BglI, I, I, I, I, , II, IXho HinI dII

Multiple Cloning Site (MCS)

Luciferase Gene

SV40 Poly(A)

Direction ofTranscription

KLK4 Promoter

Direction ofTranscription

XhoI HindIII

Luciferase Vector

126

Figure 5.3. PCR, Cloning and Purification of K4-898 and K4-446 Constructs Into pGEM-T Easy and

pGL3-Basic Vectors. A. PCR amplification of K4-898 and K4-446 from BAC and COSMID DNA. To

the left of the figure the molecular marker (100 bp marker, Pierce) is shown with selected bp sizes, then

across the top are the two K4 PCR products, K4-898 and K4-446, respectively, and to the right are the

molecular sizes in bp of each PCR product. B. XhoI and HindIII restriction digest of K4-898 and K4-446

constructs from pGEM-T Easy Vectors. Selected bp for the molecular weight marker (marker X, Roche)

are shown at the left of the panel, constructs K4-898 and K4-446 are indicated at the top of the panel, and

molecular size of each construct and the vector are indicated in bp by arrows to the right of the panel. C.

Gel purification of K4-898 and K4-446 constructs liberated from B. To the left of the panel are selected

marker (marker IX, Roche) molecular weights in bp, at the top of the panel are the K4 constructs and to the

right are the sizes of each of the purified products in bp. D. Liberation of K4-898 and K4-446 from pGL3-

basic constructs following RE digestion with XhoI and HindIII. The top of the gel panel are the K4

constructs and to the right are the molecular weights in bp of both constructs and the pGL3-basic vector.

127

agarose gel to determine their relative concentration for the cloning into pGL3-basic

luciferase vector (Figure 5.3C). Following purification, the KLK4 promoter constructs

were cloned into XhoI and HindIII restriction digested pGL3-basic vector. Following this

cloning procedure and to check for the presence of KLK4 promoter inserts, 1 µg of both

pGL3-basic constructs were cut with XhoI and HindIII REs and run on a 1% agarose gel.

It was observed that the cloning of the KLK4 promoter constructs into the pGL3-basic

luciferase vector was successful with liberation of both inserts by the RE digestion

(Figure 5.3D).

5.3.4. Sequence Analysis of K4-898 and K4-446 pGL3-Basic Luciferase Constructs

Following the successful cloning of KLK4 constructs, K4-898 and K4-446 into pGL3-

basic luciferase vectors, sequencing analysis was performed to ensure no errors were

inserted during the PCR amplification or the cloning procedure. The KLK4 constructs

were sequenced in both directions and then analysed by BLAST (www.ncbi.nlm.nih.gov)

against the human genome, where both constructs were 100% identical to a chromosome

19 genomic contig known to contain KLK4 genomic sequence (Figure 5.4A and B).

5.3.5. Analysis of K4-898 and K4-446 Promoter

To analyse KLK4 promoter activity, two constructs, K4-898 and K4-446 fused to a

luciferase reporter vector were co-transfected with an internal control vector, Renilla, into

T47D cells and treated with either 10 nmol/L 17β-estradiol-benzoate or progesterone for

24 hr. Renilla harbours a constitutive HSV promoter and is widely used to normalise

experimental variations including transfection efficiency. Additionally, a control pGL3-

luciferase vector, harbouring a SV-40 promoter was used to monitor transfection

efficiency. Luciferase activity was plotted as relative to that obtained for the control,

which was set at 100%. A no insert control was used to measure background

luminescence and this value was taken from all the other measurements. Note, no

statistical analysis was performed on these data due since the experiments were only

performed twice (3 replicates within each experiment); nonetheless, a general trend was

observed and a representative plot is shown in (Figure 5.5A). Basal activity was

128

Figure 5.4. BLAST Analysis of K4-898 and K4-446 Constructs. A and B. K4-898 and K4-446,

respectively, were analysed for complementarity against the human genome chromosome 19 (NCBI,

www.ncbi.nlm.nih.gov). Both constructs were 100% identical. Note: restriction sites that were placed at

the end of the primers used to amplify both K4-898 and K4-446 were not included in the blast sequence

and thus the size of the returned sequence hits are 889 (K4-898) and 439 (K4-446), respectively. The

information above each sequence is as follows- NT_011109.15 is the reference number and Hs19_11266 is

Homo sapiens, chromosome 19, locus 11266. The length of the contig where the match occurred is given

as 31383029 bp. The score (S) is a measurement of the quality of the alignment; the E-value (Expect) is

the number of alignments with scores equal to S that would be expected by chance alone and the identities

are given as 100%

129

A. K4-898 ref|NT_011109.15|Hs19_11266 Homo sapiens chromosome 19 genomic contig Length = 31383029 Score = 1704 bits (886), Expect = 0.0 Identities = 886/886 (100%) Strand = Plus / Plus Query: 4 tcgccgtttatgatttggctgcagctaccagagacgagcgatcctgagggcggagtcagg 63 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23680818 tcgccgtttatgatttggctgcagctaccagagacgagcgatcctgagggcggagtcagg 23680877 Query: 64 gatgggatcgggaccaggaggcgggcccagggttcctgggggtgggcttaccgagcaggg 123 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23680878 gatgggatcgggaccaggaggcgggcccagggttcctgggggtgggcttaccgagcaggg 23680937 Query: 124 gcgtggtcagaggttcaggagcagtcagggctcctcggggcggagtcagggctgggaacg 183 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23680938 gcgtggtcagaggttcaggagcagtcagggctcctcggggcggagtcagggctgggaacg 23680997 Query: 184 ggctcaggaggcgggcccagggctcttgggggaggggttaccgagcaggggcgtggtcag 243 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23680998 ggctcaggaggcgggcccagggctcttgggggaggggttaccgagcaggggcgtggtcag 23681057 Query: 244 ggcttcaggagcagtcaggactcttggggggccgagtcagggctgggggcgggcccaggg 303 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681058 ggcttcaggagcagtcaggactcttggggggccgagtcagggctgggggcgggcccaggg 23681117 Query: 304 ggcggacccagggctcctgggggtggggttatggtgcaggggtcatgatcggagcttcag 363 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681118 ggcggacccagggctcctgggggtggggttatggtgcaggggtcatgatcggagcttcag 23681177 Query: 364 gggctggtccaggatataggcctagggctcccaggggcggtgatcacggtgcaggagcct 423 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681178 gggctggtccaggatataggcctagggctcccaggggcggtgatcacggtgcaggagcct 23681237 Query: 424 ggtcagggattcagggtagtcagggctcctgggaggagagtcagggcatgggggtgggct 483 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681238 ggtcagggattcagggtagtcagggctcctgggaggagagtcagggcatgggggtgggct 23681297 Query: 484 gagaaggcgggatcagtgctcctagggttggggttacagcgcaggggcgccatcaaggct 543 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681298 gagaaggcgggatcagtgctcctagggttggggttacagcgcaggggcgccatcaaggct 23681357 Query: 544 tcaagagctgggttatggctagaggcagtctcagaaggtgggaccagggcttctggggcg 603 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681358 tcaagagctgggttatggctagaggcagtctcagaaggtgggaccagggcttctggggcg 23681417 Query: 604 gagtcagggctctggggtgagctctggaggtgagactggtgccatcgcggtgcaaagcca 663 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681418 gagtcagggctctggggtgagctctggaggtgagactggtgccatcgcggtgcaaagcca 23681477 Query: 664 cggtcaggaggggttcaacagaggagtctaggctcatagcagtaggatcgggtccttcgg 723 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681478 cggtcaggaggggttcaacagaggagtctaggctcatagcagtaggatcgggtccttcgg 23681537

130

Query: 724 ggtgaattaaagctcagggggtggagttgttgctgggagcaaggatcgggtcacttgtct 783 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681538 ggtgaattaaagctcagggggtggagttgttgctgggagcaaggatcgggtcacttgtct 23681597 Query: 784 gcgcagactgatgctcaaagagtcggtcctgcgccgagtcactcctatcctctcccagcc 843 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681598 gcgcagactgatgctcaaagagtcggtcctgcgccgagtcactcctatcctctcccagcc 23681657 Query: 844 ttgcccacagtcacaccaagccacaagcccatgcacaccaaaacac 889 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681658 ttgcccacagtcacaccaagccacaagcccatgcacaccaaaacac 23681703 B. K4-446 ref|NT_011109.15|Hs19_11266 Homo sapiens chromosome 19 genomic contig Length = 31383029 Score = 844 bits (439), Expect = 0.0 Identities = 439/439 (100%) Strand = Plus / Minus Query: 1 tgaatccctgaccaggctcctgcaccgtgatcaccgcccctgggagccctaggcctatat 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681250 tgaatccctgaccaggctcctgcaccgtgatcaccgcccctgggagccctaggcctatat 23681191 Query: 61 cctggaccagcccctgaagctccgatcatgacccctgcaccataaccccacccccaggag 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681190 cctggaccagcccctgaagctccgatcatgacccctgcaccataaccccacccccaggag 23681131 Query: 121 ccctgggtccgccccctgggcccgcccccagccctgactcggccccccaagagtcctgac 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681130 ccctgggtccgccccctgggcccgcccccagccctgactcggccccccaagagtcctgac 23681071 Query: 181 tgctcctgaagccctgaccacgcccctgctcggtaacccctcccccaagagccctgggcc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681070 tgctcctgaagccctgaccacgcccctgctcggtaacccctcccccaagagccctgggcc 23681011 Query: 241 cgcctcctgagcccgttcccagccctgactccgccccgaggagccctgactgctcctgaa 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23681010 cgcctcctgagcccgttcccagccctgactccgccccgaggagccctgactgctcctgaa 23680951 Query: 301 cctctgaccacgcccctgctcggtaagcccacccccaggaaccctgggcccgcctcctgg 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23680950 cctctgaccacgcccctgctcggtaagcccacccccaggaaccctgggcccgcctcctgg 23680891 Query: 361 tcccgatcccatccctgactccgccctcaggatcgctcgtctctggtagctgcagccaaa 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 23680890 tcccgatcccatccctgactccgccctcaggatcgctcgtctctggtagctgcagccaaa 23680831 Query: 421 tcataaacggcgaggactg 439 ||||||||||||||||||| Sbjct: 23680830 tcataaacggcgaggactg 23680812

131

Figure 5.5. Luciferase Activity of the K4-898 and K4-446 Constructs Transfected into T47D Breast

Cancer Cell Lines. Calculations were performed as outlined in Promega’s Dual-Glo Luciferase Assay

System (Promega, Part# TM058). The control Luciferase vector was set at 100% and the no insert control

was 0%. A. K4-898 and K4-446 constructs, respectively: on the X-axis is the % of relative luciferase

activity where the control sample was set to 100%. On the Y-axis from the top of the panel is the control

vector, no vector, then K4-898 and K4-446 constructs (white), and then K4-898 and K4-445 constructs

treated with 10 nmol/L of progesterone (red) and, K4-898 and K4-446 constructs treated with 10 nmol/L of

estradiol-benzoate (blue). Note, both experiments are shown. B. Schematic diagram (not to scale) showing

the relative positions of the K4-898 and K4-446 constructs in relation to the two ATG sites (1 and 2) as

previously described. The transcription initiation site (TIS) is as described for the T47D cell line in

Chapter 4. The Sp1 cluster shows the relative position of these sites as shown in Chapter 4.

132

19.417

54.839.8

47.732.9

00

100100

0 20 40 60 80 100 120

Relative Luciferase Activity %

Control Vector

No Insert Control

K4-446K4-898

K4-898

10 nmol/L Progesterone10 nmol/L Estrogen

K4-446K4-898

K4-446

A.

No Treatment

K4-898

K4-898

K4-898

Control Vector

5.6

25

28.9

0

100

3.4

22

23.6

0

100

0 20 40 60 80 100 120Relative Luciferase Activity %

K4-446

K4-446

K4-446

No Insert Control

Experiment 1

Experiment 2

133

identified in the K4-898 and K4-446 constructs with a 32.9/23.6 % and 47.7/28.9 % fold

change respectively relative to the control (Figure 5.5A, white bars, both experiments).

On the addition of 10 nmol/L progesterone, both K4-898 and K4-446 constructs showed

no real change over that of the basal levels (Figure 5.5A, red bars, both experiments). Of

interest, for the estrogen-treated samples, K4-898 construct resulted in a 15.9/20.2 % and

K4-446 a 28.3/23.3 % reduction respectively when compared to the basal activity (Figure

5.5A, blue bars, both experiments). The relative positions of each construct in relation to

the two previously identified KLK4 ATG sites (Nelson et al., 1999a; Stephenson et al.,

1999 and Korkmaz et al., 2001) and the identified TIS for the T47D cell line (Chapter 4)

are shown in Figure 5.5B.

5.3.6. Identification of Putative Progesterone and Estrogen Response Elements

(PREs and EREs, Respectively)

In Chapter Three it was observed that K4 was regulated by progesterone in the T47D cell

line. Although, basal levels of KLK4 promoter activity were observed, this study failed

to identify a progesterone-responsive region in the proximal KLK4 promoter.

Interestingly, the activity of the KLK4 promoter constructs appeared to be repressed on

the addition of estradiol. Therefore bioinformatic analysis was undertaken to identify

potential estrogen response elements and to interrogate a larger 5’ flanking sequence for

PREs. Using SigScan (Prestridge, 1991) and MatInspector (Quandt et al., 1995), a

number of ERE half-sites of the sequence 5’-TGACC-3’ (Kling et al., 1997a,b) were

identified within approximately 800 bp of the T47D TIS (Figure 5.6). On further analysis

of at least 3 Kb of KLK4 5’ sequence, two putative half-sites for the progesterone

receptor (progesterone response elements, PREs) separated by six nucleotides were also

identified at 2.4 Kb 5’ of the T47D TIS (Figure 5.6) and further “up-stream” from the

K4-898 region analysed in this study.

134

Figure 5.6. Sequence Analysis of KLK4 Promoter and Up-Stream Regions for Putative Progesterone

and Estrogen Response Elements (PREs and EREs, Respectively). The sequence above has been

extended from that seen in Figure 4.3, Chapter 4. The underlined sections with the * above the sequence

represents the ERE half-sites, the green shaded areas represent Sp1 sites as identified in Chapter 4, yellow

shading indicates the first three exons (1-3) while the red ATG in exons 2 and 3 indicates the putative

translation start site as identified by Hu et al. (2000) and Korkmaz et al. (2001), respectively. The blue

shading indicates the KLK4 transcription initiation sites (TISs) as identified by Hu et al. (2000) in a prostate

library, Korkmaz et al. (2001) in prostate cancer cell lines, LNCaP, and in Chapter 4 in the breast cancer

cell line, T47D. The K4-446 and K4-898 primers along with the common K4-Anchor primer are indicated

in bold and underlined. Note, the underlined region for K4-446 and K4-898 only indicates the relative

position of these primer pairs and not the entire nucleotide sequence. Two putative PRE half-sites

(AGAACA) are indicated in bold and underlined at approximately 2.4 Kb from the T47D TIS.

135

321 GACTTTTTAG TTCTCCCGCT CACCGAGAGC CTACAATGTG CCTGGCACTG TGTGCCTTTC CCTGAATTAC CTCTTTGAAT 401 CCACTTGGGA AATGGGGCAT AATGGTCACT CCAGTTTTAC AGTTGGAAAA ACAGGCTCAC AGGGGTGCAG TCACTTGCCC 481 AAGGTTCCAA AAATAGTTCG TGATGTAGGC TGGATACGAA CCTGGGGAAA TTTGCTGGAG AAGCACAGAA AGAGAGGGAT half-site half-site 561 GAAGGAGGAG GGGAGAGAGA GAGAGAGATT TAATTTAAAA AGAGAAAGAA CATGAGAGAG AACAGGAGAG AATGAGAGGA 641 AATGAAAGAA AACACGAGAA AAATAATGAG AGAGAGAATG AGAGAAAGAA AGAAGAAGAG AAAGAGAAAA TGAGAGATAC 721 AGGCAAGAGA GAGGTATCTC ATGAGAGAGA ATAAGAACAT GAAAAGAGAA AGAATGAGAG AGAGAGAGAG AAAGAAAAAG 801 GAGAGTGGAG TCTAGGATCT GGGCAGGGGT CTCCTCCCTG GGTCCCTAGA CCCTGCTGCC AGCCCCTTCT GGGCCCCCAA 881 CCACTGCCTG GTCAGAGTTG AGGCAGCCTG AGAGAGTTGA GCTGGAAGTT TGCAGCACCT GACCCCTGGA ACACATCCCC Hu et al. (2000) TIS 961 TGGGGGCAGG CCAGCCCAGG CTGAGGATGC TTATAAGCCC CAAGGAGGCC CCTGCGGGAG GCAGCAGGCT GGAGCTCAGC 1041 CCAGCAGTGG AATCCAGGAG CCCAGAGGTG GCCGGGTAAG AGGCCTGGTG GTCCCCCACT AAAAGCCTGC AGTGTTCATG 1121 ATCCAACTCT CCCTACAGCT CCATGTCGCT GGATTCTCAG CCTCTGTGCC TTCTGTCTCC ACATCTCTCT AGACAGATCT 1201 CTCACTGTCT CTAGTTAGGA GTCACTGTCT CTAGTTAGGG GTCTCTCTGT CTCTCTGAAT CTATATCTCC ATGTCTAACT 1281 CTCAGACTGT CTCTGAGGAT ATCTCTCAAG CACTCTGTCT CTCCGGCTCT GATTCTCTGT GTGTCTTCCC TCCATGCTTG 1361 TTTGTGGGTG GCTAGACACC ATCTCTCCCC ATTCACAGAT GGCTAGATGC TTTCTCTAAA CTTTCCTTTC TACCTAGTTC 1441 TCTCTCTCTC TCTCTTTTCC CATCTCTCTC TCTCTTTTTC TCTCTCAGTC TCTAAATCTG TCTCTCTAGG TTCTGGGTCC 1521 ATGGATGGGA GAGGGGGTAG ATGGTCTAGG CTCTTGCCTA CCTAATAACG TCCCAGAGGG AAGAAAGGGA GGGACAAAGA Nelson, Stephenson 1601 GAGGGATGGA GAGACTTGGG CTGAAGATCC CCAGACACGG CTAAGTCTCA GTCCTCATCC CCAGGTGCTG ACGTGATGGC 1681 CACAGCAGGA AATCCCTGGG GCTGGTTCCT GGGGTACCTC ATCCTTGGTG TCGCAGGTAT CTGAGTATGC GTGTGTGTGT 1761 CTGTCCGTGC TTGGGGGCAC AGTGTTTGTT AATGTTCAGG TGTGACTCAG TGTCCTCTTG CTTGTGACTG CAAAGCTGCC 1841 TGTGAGACGG TACCGTGTTA TCCGTCCCCC ATGGCTGTGC CCCTGCAACT CCTTGTATCG TGGTAAATTT GTGTGTGGCA 1921 GTGTGCCTGG GTGTGTGGTT GTACCTGTGA GACTCTGACA GTTTGTGCCT CTGAATATCT GGTGGAGTGA CAACAGTGTA 2001 ATGATGATAT GGGGACAGGG GAAGCCGAGG GTGCAGGAGA TTGTGCTTCC TGGGGCGTGA TCCATTGCTG GGAATCTGTG K4-898 Primer 2081 CCTGCTTCCT GGGTCTTCAG TCCTGAGATC CCCCTCTCCC ATCCCCAAGG AACTCACCTC ACAGGACTAT AAAACGGTGT 2161 TTTGGTGTGC ATGGGCTTGT GGCTTGGTGT GACTGTGGGC AAGGCTGGGA GAGGATAGGA GTGACTCGGC GCAGGACCGA * 2241 CTCTTTGAGC ATCAGTCTGC GCAGACAAGT GACCCGATCC TTGCTCCCAG CAACAACTCC ACCCCCTGAG CTTTAATTCA * 2321 CCCCGAAGGA CCCGATCCTA CTGCTATGAG CCTAGACTCC TCTGTTGAAC CCCTCCTGAC CGTGGCTTTG CACCGCGATG 2401 GCACCAGTCT CACCTCCAGA GCTCACCCCA GAGCCCTGAC TCCGCCCCAG AAGCCCTGGT CCCACCTTCT GAGACTGCCT 2481 CTAGCCATAA CCCAGCTCTT GAAGCCTTGA TGGCGCCCCT GCGCTGTAAC CCCAACCCTA GGAGCACTGA TCCCGCCTTC K4-445 Primer * 2561 TCAGCCCACC CCCATGCCCT GACTCTCCTC CCAGGAGCCC TGACTACCCT GAATCCCTGA CCAGGCTCCT GCACCGTGAT * SP1 2641 CACCGCCCCT GGGAGCCCTA GGCCTATATC CTGGACCAGC CCCTGAAGCT CCGATCATGA CCCCTGCACC ATAACCCCAC SP1 SP1 2721 CCCCAGGAGC CCTGGGTCCG CCCCCTGGGC CCGCCCCCAG CCCTGACTCG GCCCCCCAAG AGTCCTGACT GCTCCTGAAG * SP1 SP1 SP1 2801 CCCTGACCAC GCCCCTGCTC GGTAACCCCT CCCCCAAGAG CCCTGGGCCC GCCTCCTGAG CCCGTTCCCA GCCCTGACTC SP1 * SP1 SP1 2881 CGCCCCGAGG AGCCCTGACT GCTCCTGAAC CTCTGACCAC GCCCCTGCTC GGTAAGCCCA CCCCCAGGAA CCCTGGGCCC Sp1 T47D TIS K4-Anchor Primer 2961 GCCTCCTGGT CCCGATCCCA TCCCTGACTC CGCCCTCAGG ATCGCTCGTC TCTGGTAGCT GCAGCCAAAT CATAAACGGC Korkmaz et al. (2001) Korkmaz 3041 GAGGACTGCA GCCCGCACTC GCAGCCCTGG CAGGCGGCAC TGGTCATGGA AAACGAATTG TTCTGCTCGG GCGTCCTGGT 3121 GCATCCGCAGTGGGTGCTGTCAGCCGCACACTGTTTCCAGAA

136

5.4 DISCUSSION

Previously, as shown in Chapter Four, the transcription initiation site (TIS, +1) for the

KLK4 gene in the breast cancer cell line, T47D, was identified. The goal of the studies in

this Chapter was to identify whether the proximal promoter region would confer basal

activity through a synthetic reporter gene assay. Two constructs (K4-898 and K4-446)

encompassing 898 and 446 bp respectively of the putative minimal promoter region were

fused to a synthetic luciferase reporter gene and transfected into the breast cancer cell

line, T47D. Both the minimal reporter constructs K4-898 and K4-446 could activate the

synthetic luciferase gene which may suggest constitutive promoter activity. In addition,

in the pilot studies reported here, it appears that estradiol benzoate treatment inhibited the

transactivation of the luciferase gene through the KLK4 promoter while progesterone

treatment resulted in no change.

To date, the characterisation of transcriptional activity for the KLK gene family is limited.

Only KLK2 and KLK3 have been studied in detail at the transcriptional level in prostate

cancer cell lines. Studies with the proximal promoter of these two genes have identified

that basal levels of transcription through a reporter assay system were low without further

“up-stream” elements. For example, Brookes et al. (1998) found that the core promoter

region of the PSA gene showed extremely low activity in both LNCaP and PC-3 prostate

cell lines, unless co-transfected together with the androgen receptor (AR). These findings

are consistent with previous reports from Riegman et al. (1991) and Schuur et al. (1996)

where these authors did not observe any significant CAT activity with the proximal

promoter region of the PSA gene transfected into LNCaP cell lines. Other studies with

the proximal promoter region of the KLK2 gene and co-transfection of this promoter

construct into PC-3 cells with the AR, also identified that this region was only active on

the addition of androgens and furthermore, required “up-stream” elements to increase

transcription of the KLK2 reporter construct (Murtha et al., 1993). Other studies by

Huang et al. (1999) identified several non-consensus AREs centred between -3955 bp

and -4298 bp of the PSA gene that contributed significantly to androgen-responsive

transcription of a CAT reporter gene in LNCaP cells. These authors, co-transfected AR

and PR with a reporter template containing four consensus ARE sites upstream of a

137

luciferase gene. In that study, AR and PR could effectively induce the activity of a

luciferase construct. However, when tested on a luciferase construct containing the PSA

enhancer and the non-consensus AREs, only AR was able to stimulate reporter activity.

These findings suggest that non-consensus sequences in KLK genes may play a pivotal

role in receptor specificity. Additionally, the above data clearly support the need for

additional up-stream regions for maximum transcriptional response of the KLK genes.

From this study, preliminary data has shown that the regions K4-898 and K4-446

proximal to TIS1 incurred basal activity in T47D cells, when compared with the vector

(no DNA insert) control alone. Within the K4-898 construct there is a cluster of (at least

ten) G/C-rich motifs that are putative binding sites for the Sp1 transcription factor. Sp1 is

a ubiquitously expressed protein with a zinc finger DNA binding domain (Botella et al.,

2001) which interacts directly with basal transcriptional machinery factors and cooperates

with several transcription activators (Saluja et al., 1998; Udvidia et al., 1995; Hirana et

al., 1998). Several studies have shown that Sp1 is a crucial factor for the regulation of

basal transcription of TATA-less promoters. For example, Botella et al. (2001) identified

an Sp1 site in the TATA-less promoter of the endoglin gene that was essential for basal

transcription. Furthermore, mutation of the Sp1 site completely abolished basal

transcription. In other studies, Jang and Steinert, (2002) demonstrated that the basal

regulation of the loricrin gene expression requires interactions among several

transcription factors such as Sp1, c-Jun and p300/CBP and it was proposed that these

factors act as a bridge to form an active transcription complex. Moreover, studies by Ross

et al. (2002) identified that GC-box binding Sp1 proteins contributed to the basal activity

of the TATA-less cyclin-dependent kinase 5 (cdk5/p35) gene. Additionally, in a more

recent study, Franco et al. (2003) identified a consensus Sp1 site centred at -60 bp from

the TIS of the PSA gene. A 100 bp PSA construct containing point mutations in the Sp1

site and fused to a luciferase reporter assay completely abolished proximal promoter

activity in the prostate cancer cell line, LNCaP. These authors concluded that the Sp1

site at -60 bp was essential for basal activity under androgen-independent conditions.

Clearly, from these studies, Sp1 is important in basal level transcription, particularly in

TATA-less promoters. It is also highly probable that the identified Sp1 sites in the

138

proximal KLK4 promoter are also essential for basal level transcription, although these

are yet to be functionally tested.

KLK4 is highly expressed in the prostate (Nelson et al., 1999a; Yousef et al., 1999b;

Korkmaz et al., 2001; Day et al., 2002; Obiezu et al., 2002) and in other hormone-

dependent cancer (HDC) cell lines derived from the endometrium (Myers and Clements,

2000), breast (Yousef et al., 1999b) and ovary (Dong et al., 2001). Additionally, in

preliminary studies, KLK4 mRNA levels have been shown to be regulated by androgens,

estradiol and progesterone in the prostate cancer cell line, LNCaP (Nelson et al., 1999a;

Korkmaz et al., 2001), by androgens and progesterone in the breast cancer cell line, BT-

474 (Yousef et al., 1999b), by estradiol and progesterone in the endometrial cancer cell

line, KLE (Myers and Clements, 2000) and by estradiol in the ovarian cancer cell line,

OVCAR-3 (Dong et al., 2001).

Since these multiple hormones regulate KLK4 expression, it was surprising that

progesterone had no effect on the KLK4 proximal promoter given that Chapter Three

showed a clear up-regulation of this gene by progesterone. As noted earlier, a number of

studies with the KLK2 and KLK3 proximal promoters found minimal promoter activity

unless other “up-stream” elements were included (Riegman et al., 1991; Murtha et al.,

1993; Schuur et al., 1996; Brookes et al., 1998). In a more recent study, Shang et al.

(2002), using chromatin immunoprecipitation, identified that the proximal promoter ARE

and distal enhancer ARE regions of the PSA gene are both occupied by AR in response to

agonist binding and are required to form a stable transcription complex. These results

suggest a possible explanation as to why minimal activity is observed with the proximal

promoter region alone of the PSA gene, and possibly the KLK2 gene. As explained

earlier, it is possible that like KLK2 and KLK3, the proximal promoter region of the

KLK4 gene requires further “up-stream” elements to maximise transcriptional activity.

Additionally, since no consensus full palindromic PREs were identified, this perhaps

suggests the existence of novel PREs that have diverged from their consensus sequence.

Studies by Zhou et al. (1997) identified a non-consensus androgen-response element

(ARE) that binds the androgen receptor and cooperates in androgen-regulated activity of

139

the KLK3 promoter in CV-1 cells. Additional studies by Zhang et al. (1997) identified

two non-consensus AREs that are indispensable for androgen-mediated transactivation of

the KLK3 promoter.

While progesterone treatment resulted in what appeared to be no change over that of the

basal levels, estrogen appeared to inhibit this transactivation below that of the basal

levels. Whether estrogen is acting directly through one of its cognate estrogen receptors

(ERα or ERβ) and repressing the action of the KLK4 promoter-driven luciferase activity,

or acting indirectly through other factors, is not clear. Although no other studies have

been performed with the KLK4 promoter, or with estrogen treatment for the KLK2 and

KLK3 promoters, other studies with T47D breast cancer cell lines identified the up-

regulation of the KLK3 gene by androgens, progestins and glucocorticoids, but not

estrogen (Zarghami et al., 1997). Studies with other estrogen responsive genes such as

the monocyte chemoattractant protein (MCP-1) observed an inhibition of MCP-1

secretion and promoter activity with estradiol treatment in human keratinocyte cell lines

(Kanda and Watanabe, 2003). Other studies by Perillo et al. (2000) found that 17β-

estradiol treatment of the breast cancer cell line, MCF-7, resulted in the inhibition of the

bcl-2 gene via two estrogen-response elements located within the coding region.

Moreover, studies by Klinge et al. (1997b) identified the chicken ovalbumin upstream

promoter-transcription factor interacts with the ER, binds to ERE half-sites, and inhibits

estrogen-induced gene expression of a luciferase reporter gene. Although KLK4/K4 has

been shown to be up-regulated by estradiol in the prostate, LNCaP (Korkmaz et al.,

2001), endometrial, KLE (Myers and Clements, 2000) and ovarian, OVACAR-3 (Dong

et al., 2001) cancer cell lines, it is probable that tissue, receptor type and hormone

response element specificity all play a role in determining the outcome of the

transcriptional response. Indeed, studies by Liu et al. (2002a) compared the effects of

the anti-progesterone, RU486 on PR-dependent transcription in T47D and Hela cell lines.

Here it was identified that RU486 exhibited a differential ability to activate transcription

of PR, and is modulated by the ratio of co-activators, SCR-1 (SRC-1, steroid receptor co-

activator) to co-repressors (SMRT, silencing mediator for retinoid and thyroid hormone

receptor) in these cell lines. Thus, gene regulation is a complex process and the binding

140

of transcription factors to DNA consensus, non-consensus and half-sites response

elements and the availability of co-activators and co-repressors, all play a role in the

transactivation of the gene in question.

The data presented here suggest a region of the KLK4 proximal promoter is basally active

and furthermore can be inhibited by estradiol. A bioinformatic analysis of these regions

failed to identify any full estrogen response elements (EREs), although there did appear

to be a number of ERE half-sites with the sequence 5’-TGACC-3’ (Kling et al., 1997a).

Studies by these authors, using a purified estrogen receptor (ER), a synthetic ERE and

electromobility shift assays, identified similar motifs that assembled the ER on three

tandem copies of the ERE half-site. Other work performed by Aumais et al. (1996) also

identified ER and glucocorticoid receptor (GR) binding to direct repeat half-sites with a

different number of nucleotide spacings between each half-site. From this data it was

suggested that binding of the ER and/or the GR to these half-sites provides a form of

flexibility on the DNA template where the “looping out” of intervening DNA between

the half-sites would provide receptor specificity.

From Chapter Four, it was identified that KLK4 consists of two TIS regions. To date, the

regulatory studies of the KLK4 gene/ K4 protein by estradiol, androgens and progesterone

have not been performed to discriminate between the two KLK4 transcripts as identified

by Hu et al. (2000) and Korkmaz et al. (2001). Thus, it is possible that both of these

transcripts are regulated differentially. However, further studies are required to delineate

if differential regulation of these two transcripts can occur.

It is possible that KLK4 may contain other elements further up-stream of the TIS

identified by Hu et al. (2000), which are involved in KLK4 regulation. Thus, further

studies are needed to extend the number of KLK4 constructs to cover the regions “up-

stream” of both TISs and to test these for functionality. In this regard, the identification

of a putative PRE half-site at approximately –2.4 Kb from the T47D TIS, but only 400 bp

“up-stream” of the TIS identified by Hu et al. (2000), is of interest and perhaps will be a

good candidate element for further studies.

141

5.5. CONCLUSIONS

In this study, basal level activity was observed in the proximal promoter region of the

KLK4 gene and the levels of luciferase gene expression could be inhibited by estrogen.

Although these data are preliminary, it is consistent with replicate studies and a general

trend was always observed. The data obtained in Chapter Four where the exact mapping

of the transcription initiation site (TIS) was performed, and the data obtained here,

suggest that a proximal promoter region of the KLK4 gene has been identified. Although

consensus EREs were not identified, several ERE half-sites were identified that may be

perhaps be involved in the inhibition of luciferase expression observed by estrogen

treatment. It is also possible that estrogen responsive regions have diverged considerably

from their consensus sequence and are therefore not identifiable with conventional

bioinformatic analysis. Additionally, the data obtained from studies showing minimal

promoter activity with KLK2 and KLK3 and the requirement for up-stream enhancer

regions to incur an active transcriptional response suggest that other elements are

required. Therefore, it is possible that to activate the KLK4 promoter through

progesterone stimulation, other elements further up-stream is required. The identification

of a PRE half-site in the far up-stream region (-2.4 Kb) of the KLK4 gene could perhaps

be a candidate and requires functional studies. These studies will form the basis of

Chapter Six.

CHAPTER 6

THE PROGESTERONE RECEPTOR (PR), COMPLEXES IN

VITRO, AND IS RECRUITED IN “REAL-TIME, TO A

PROGESTERONE-RESPONSIVE REGION IN THE KLK4

PROMOTER IN THE BREAST CANCER CELL LINE,

T47D.

143

6.1. INTRODUCTION

Previously in Chapter Five, a region of the minimal KLK4 promoter was assayed for

functionality. Although basal levels of promoter activity were observed when fused to a

luciferase reporter construct, progesterone treatment resulted in no activity. As it was

clear that KLK4/hK4 was regulated by progesterone (Chapter Three), sequence analysis

of the KLK4 gene was extended further 5’ up-stream of the minimal promoter region.

From these studies, two putative PREs were identified that are half-sites of the sequence

5’-AGAACA-3’ separated by six nucleotides (Figure 6.1). Additionally, flanking the two

half sites were the repeat sequences, 5’-AGAGAA-3’ (Figure 6.1). Based on studies by

Kepa et al. (1996), who also identified non-consensus repeat motifs of a PRE in the

promoter region of the rat gonadotropin releasing hormone gene that bound the PR

directly, it was of interest to analyse these non-consensus regions further.

Therefore, in this Chapter, the question asked was whether this particular motif was

functional, that is, could this sequence bind the PR in vitro, and if so, could the PR be

recruited and assembled onto this element in “real-time” in vivo in the breast cancer cell

line, T47D. To answer these questions an electromobility shift assay (EMSA) and

chromatin immunoprecipitation (ChIP) assay were established. These techniques will be

explained in detail below.

The EMSA (Garner and Revzin, 1981) (Figure 6.2) relies on the principle that a fragment

of DNA to which a protein is bound will migrate more slowly in gel electrophoresis than

the same fragment without bound protein. The EMSA is performed by labelling a

specific DNA sequence, such as a putative HRE, whose protein properties are being

investigated. Then, the labelled DNA is incubated with nuclear extract from the cell type

of interest and protein/DNA complexes are allowed to form. The complexes are

electrophoresed on non-denaturing polyacrylamide gels and the position of the labelled

DNA is visualised by autoradiography. If no proteins are bound to the labelled DNA,

144

Figure 6.1. Schematic Diagram of the KLK4 Gene and the Relative Position of the Identified

Progesterone Response Element, PRE and Flanking Sequence. The KLK4 gene is shown above with

exons in blue colour while the untranslated regions are red. All exons are numbered 1-6. The transcription

initiation site (TIS) as identified by Korkmaz et al. (2001) and Hu et al. (2000) are shown along with the

Kormaz ATG (exon 3) and the ATG (exon 2) identified by Stephenson et al. (1999) and Nelson et al.

(1999a). The putative progesterone response element (PRE) is shown as a grey box, and the sequence of

this region is below. The putative PRE binding sites, AGAACA, are indicated in bold. Flanking both of the

putative half-sites is the repeat sequence AGAGAA and is shown within the boxed region. The distance in

bp from both TISs is given at the top of the schematic.

145

Figure 6.2. Schematic Diagram Representing the Electromobilty Shift Assay (EMSA). 1 and 2.

Nuclear extract (consisting of a number of factors represented as coloured circles) is incubated with

labelled DNA (green stars) that contains the potential hormone response element (HRE) of interest. 3.

After the HRE probe has bound the factor of interest (blue circles) the sample can then be electrophoresed

and/or then treated with an antibody (red square) to the suspected protein is then added to the nuclear

extract and labelled probe. 4. The binding reaction is then incubated for a specific time, and gel

electrophoresis of the EMSA products (5) is then performed. A = free probe that is not bound by any

factors so this band migrates the fastest through the gel matrix. B = the HRE that has bound a particular

factor of interest, and thus its mobility is restricted and runs more slowly, and C = the HRE plus the bound

factor plus an antibody raised against the suspected binding protein and therefore migrates even more

slowly than the HRE bound factor alone.

146

147

then all the label will be at the end of the gel, whereas if a protein-DNA complex has

formed, labelled DNA to which the protein has bound, will migrate more slowly and

hence will be visualised near the top of the gel (Figure 6.2). Additionally, a supershift

can be performed by adding an antibody to the suspected factor in the nuclear fraction

which has bound to the labelled DNA. A slower migrating band, compared with nuclear

extract and labelled DNA alone, may indicate what the specific factor is bound to the

HRE of interest. The EMSA therefore provides an excellent means to identify a particular

factor(s) that is bound to the specific DNA sequence in question.

The chromatin immunoprecipitation (ChIP) assay is a powerful and demanding technique

that will identify factors that are recruited and assembled onto native chromatin in “real-

time” under the influence of a particular treatment (for an excellent review see Wells and

Farnham, 2002), and therefore provide a “snapshot” of the native chromatin and factors

that are associated with the DNA. The ChIP assay involves treating cells with

formaldehyde to cross-link proteins to the native DNA. The chromatin is then isolated

and sheared into fragments of approximately 500 base pairs in length. Then, an antibody,

specific for the modified protein believed to be associated with the DNA, is then used to

immunoprecipitate cross-linked chromatin fragments. After reversing the cross-linking,

the DNA is subjected to PCR with primers that flank the suspected binding site of the

protein of interest (Figure 6.3).

Thus, in these studies, the PR could indeed assemble on the synthetic KLK4 PRE, in

vitro, and furthermore, a specific PR antibody could out-compete this binding event.

Moreover, the sequence involved in binding was determined by using a series of deletion

constructs. This region consists of the sequence 5’-AGAACAGGAGAGAATGAG-3’

and is similar (9/15 bp) to the androgen response element at -170 bp for PSA (Riegman,

et al., 1991). Additionally, the assembly of the PR onto the KLK4 progesterone

responsive region in “real-time appeared to be progesterone regulated.

148

Figure 6.3. ChIP Assay. Cells are grown in charcoal-stripped serum for 72 hours followed by treatment

with the steroid of interest for various times to allow a receptor-DNA complex to form (1-2). The cells are

then treated with formaldehyde to cross-link (X-link) protein/protein, DNA/protein interactions (3).

Following sonication and shearing of the chromatin into fragment sizes of approximately 500 bp, (4) a

specific antibody to the protein of interest is used to immunoprecipitate out the DNA/protein complexes

(5). These complexes are then dissociated from the chromatin by reversing the formaldehyde cross-linking

at 65°C for 6 hours (6). The remaining DNA is then purified and the resulting fragments are subjected to

PCR with gene-specific primers flanking the suspected binding site of the DNA/protein complex (7).

149

1. 2.

3.

4. 5.

6. 7.

150

6.2. MATERIALS AND METHODS

All the Materials and Methods are outlined in detail in Chapter 2. To maintain

continuity, a brief outline of these procedures will be given below.

6.2.1. T47D Cell Culture

The T47D and progesterone receptor (PR) negative breast cancer cell line, MDA-231,

were maintained at 37°C with 5% CO2 in Dulbecco's Modified Eagle's Medium (DMEM)

(Life Technologies) with 10% heat-inactivated FCS supplemented with 50 U/mL

Penicillin G and 50 ug/mL of Streptomycin (CSL Biosciences). Cells were subjected to

FCS-free, phenol red-free DMEM for 24 hours prior to 10 nmol/L progesterone (Sigma)

treatment (see specific results section for the duration of the treatments). The cells were

then pelleted by centrifugation at 1000 x g for 2 minutes and the resulting pellets were

used for the isolation of nuclear extracts.

6.2.2. Extraction of Nuclear and Cytosolic Extracts from the Breast Cancer Cell

Line, T47D.

Nuclear and cytosolic extractions were performed in triplicate utilising the NE-PER

cytoplasmic and nuclear extraction kit (Pierce) as outlined in Chapter 2 (section, 2.7.3).

Briefly, T47D nuclear extracts were isolated from the cytosolic components with reagents

supplied in the kit. The final nuclear extract was extracted over a 60 min period at 4°C,

centrifuged at 14000 x g for 20 min and the resulting supernatant (nuclear extract) sub-

aliquoted into 20µl volumes, snap frozen in liquid N2 and stored at -80°C. Protein

concentrations were measured in triplicate using the BCA kit (Pierce) as described in

Chapter 2 (section, 2.8).

6.2.3. Design and Biotinylation of the Synthetic PRE and Variant Forms from the

KLK4 PRE Identified in Chapter 5.

The putative KLK4 PRE sequence identified in Chapter 5 was synthesised, along with a

number of deletion constructs (PRE1-PRE11, Table 6.1, Proligo, Lismore, Australia) and

labelled at the 3’ end with biotin (Pierce) as outlined in Chapter 2 (Section 2.21.2). Each

labelled oligomer and its complement were mixed in equal molar amounts, and left at RT

151

for 30 min to hybridise. The nomenclature used for the PRE oligo constructs will be

PRE0 (wild-type) and PRE1-11 for the mutant and deletion variants.

6.2.4. EMSA to Determine the Binding Capacity of the PRE0 Element and the

Deletion Constructs.

The EMSA was performed as outlined in Chapter 2 (Section 2.21.3). Briefly, the biotin-

labelled oligomers were mixed with binding reagents and T47D nuclear extracts using a

LightShiftTM Chemiluminescence EMSA kit as instructed (Pierce). Binding reactions

were left at RT for 30 min, unless otherwise stated, and then electrophoresed on 6%

TBE-acrylamide gels. The protein-DNA complexes were then transferred to a nylon

membrane (Hybond-N+, Amersham) by capillary transfer over night as described in

Chapter 2 (section 2.13.3). The DNA/protein complexes were then crossed-linked by UV

for 2 min, and the chemiluminescence signal was recorded on an X-ray film following

the addition of the chemiluminescence substrates (Pierce).

6.2.5. Super Shift Assay with a Progesterone and Androgen Receptor Antibody to

Determine Specific Binding Receptors.

For the supershift experiments, (Chapter 2, section 2.21.7) antibodies to the progesterone

(Santa Cruz Biotechnology) and androgen (Upstate Biotechnology) receptors (PR and

AR, respectively) were used. These were mixed with the progesterone-treated nuclear

extracts for either 1 or 4 hr, or stored at 4°C for 24 hr prior to their incubation with the

specific labelled oligomer (Table 6.1). These samples were then treated as above for the

EMSA.

6.2.6. The ChIP Assay

The ChIP assay was performed as outlined in Chapter 2 (2.22). Briefly, T47D breast

cancer cell lines were grown in the presence of 2% charcoal-stripped FCS for a period of

152

Table 6.1. Nomenclature and Sequence of each KLK4 PRE Construct

The PRE0 sequence is the wild-type sequence whilst the other sequences PRE1-PRE11, represent various

deletion or mutant constructs. The half-sites identified in Chapter 5, AGAACA and AGAGAA are in bold

and underlined along with the nucleotide changes made within these sites highlighted in bold and grey.

The dashed lines in PRE1-5 indicate nucleotide deletions. Note, only the forward sequence is shown and

not its complement. The unrelated probe oligomer was used as a control for PRE specificity.

OLIGOMER SEQUENCE 5’ to 3’

PRE0 5’-AAAAAGAGAAAGAACATGAGAGAGAACAGGAGAGAATGAG-3'.

PRE1 5’----------------------AGAACATGAGAGAGAACAGGAGAGAATGAG-3'

PRE2 5’-AAAAAGAGAAAGAACATGAGAGAGAACA----------------------------3’

PRE3 5’-AAAAAGAGAA-------------TGAGAGAGAACAGGAGAGAATGAG-3'.

PRE4 5’-AAAAAGAGAAAGAACATGAGAG--------------GGAGAGAATGAG-3'.

PRE5 5’-AAAAAGAGAA--------------TGAGAG--------------GGAGAGAATGAG-3’

PRE6 5’-AAAAAGAGAAAGAACATGAGAGAGAACAGGAGCTAATGAG-3'

PRE7 5’-AAAAAGCTAAAGAACA TGAGAGAGAACAGGAGAGAATGAG-3'.

PRE8 5’-AAAAAGCTAAAGAACA TGAGAGAGAACAGGAGCTAATGAG-3'

PRE9 5’-AAAAAGAGAAGGATCC TGAGAGAGAACAGGAGAGAATGAG-3’

PRE10 5’-AAAAAGAGAAAGAACA TGAGAGGGATCCGGAGAGAATGAG-3'

PRE11 5’-AAAAAGAGAAGGATCC TGAGAGGGATCCGGAGAGAATGAG-3'

Unrelated

control

5’- TCGAATTCGATCGGGGCGGGGCGAGCGGG-3’

153

72 hrs followed by treatment with 100 nmol/L of progesterone to completely saturate

progesterone receptor (PR) binding sites, over 0-24 hours. Following cross-linking with

1% formaldehyde and shearing of DNA/protein complexes, immunoprecipitation with a

PR antibody (Santa Cruz Biotechnology) was performed. The immunoprecipitated

complexes were then reverse cross-linked followed by purification of the chromatin.

6.2.7. DNA Extraction from T47D Cell Lines

The extraction of DNA from T47D cell lines was performed using TRIZOL (Life

Technologies) as described in Chapter 2 (section 2.7.2).

6.2.8. Oligonucleotide Primers for the ChIP Assay

The oligonucleotide primers (Proligo, Australia) used for this experiment are outlined in

Table 6.2. These primers were designed and synthesised by Proligo (Lismore, Australia).

6.2.9. PCR for the ChIP assay

The PCR was performed as out as outlined in Chapter 2 (section, 2.22). Briefly, PCR

primers KLK4-PRE0 (primers that amplify the predicted progesterone response element,

PRE0), KLK4-NoPRE0 (primers that do not flank the potential PRE0) and β2-

microglobulin (a house-keeping gene that is not regulated by progesterone) (see Table

6.2) were used. The subsequent amplicons were separated on a 2% agarose gel at 100 V

for approximately 30 minutes.

154

Table 6.2. Sequence, Position and Size of Each Primer Pair Designed for the ChIP Analysis.

Primer sequences are given in the 5’ to 3’ direction. The position of the primers relative to the +1 for KLK4

is based on the data from Chapter 4 (Figure 4.12 for T47D). For β2-microglobulin, the primers were also

designed relative to the +1 taken from the NCBI submitted sequence, AF092744. The size of each product

is indicated in base pairs (bp)

Primer Sequence 5’ to 3’

F= forward

R= reverse

Position Relative to +1 Product

Size (bp)

KLK4-PRE0 F. GGAAATTTGCTGGAGAAGCA

R. TGCCTGTATCTCTCATTTTCTC

- 2437

- 2237

200

KLK4-NoPRE0 F. GCCTGAGAGAGTTGAGCTGG

R. AGAAGGCACAGAGGCTGAGAA

- 2102

- 1833

269

β2-Microglobulin F. GCCGATGTACAGACAGCAAA

R. TGCTGTCAGCTTCAGGAATG

-290

-62

228

155

6.3. RESULTS

6.3.1. The KLK4 PRE0 Binds Factors From the T47D Nuclear Extract

The putative progesterone response element (PRE0) was assayed to determine if this

element could bind factor(s) from T47D nuclear extracts. These initial studies were

performed with T47D nuclear extracts that had not been previously treated with

progesterone. Therefore, the wild-type PRE (designated PRE0) was mixed with T47D

nuclear extracts and an EMSA was performed. Following the EMSA, a distinct shift was

observed with the PRE0 element (Figure 6.4). Additionally, a 200-molar excess of an

unrelated oligo probe Sp1 did not compete out the shift and therefore confirmed the

specificity of the binding reaction. Moreover, the labelled Sp1 probe and T47D nuclear

extract did not result in a specific shift and further highlights the specificity of the

reaction.

In this same EMSA a number of mutant constructs were assayed (PRE6-8) (Table 6.1).

These mutant forms were derived from the repeat sequence 5’-AGAGAA-3’ (Table 6.1)

and changes within this sequence (AG to CT) were made in order to identify if these

repeat elements were involved in binding of nuclear proteins to the PRE0. A distinct

shift was observed with the PRE6-8 mutant variants when combined with nuclear extract

from T47D cells (Figure 6.4). Although, the mutant forms did not abolish the binding of

nuclear factor(s) observed in the wild-type PRE0 element, there did appear to be

increased binding with the PRE7 and PRE8 mutants (Figure 6.4). These data are

representative of two individual experiments.

Following this, a further set of mutants, PRE9-11 (Table 6.1) were analysed to determine

if binding could be disrupted. Additionally, a titration was performed to determine that

an adequate amount of biotin-labelled oligo was used. Thus for each oligo, PRE0, and

PRE9-11, 500 fmole, 1 pmole and 2 pmole of biotin-labelled oligo were assayed (Figure

6.5). There was a distinct shift observed for all of the probe concentrations except when

only 500 fmoles was used (Figure 6.5). Additionally, there was no loss of a shift with the

156

Figure 6.4 EMSA for the Identification of T47D Nuclear Extract Protein Interactions with the PRE0

Element and Mutant Forms. T47D cell lines were grown in DMEM with 10% FCS until approximately

80% confluent then nuclear extracts were isolated as described in section 6.2.2. The PRE0 oligomer and

the mutant constructs, PRE6-8 and the unrelated control SP1 oligomer were all labelled at the 3’-end with

biotin and incubated with 10 µg of T47D nuclear extract for 30 min prior to the EMSA. The lanes are (left

to right) - PRE0 probe alone, PRE0 and 10 µg of T47D nuclear extract (NE), PRE 6 (mutant) + NE, PRE 7

(mutant) + NE, PRE 8 (mutant) + NE, PRE0 + 200-fold molar excess of “cold” (unlabelled) unrelated

sequence (UR) + NE, and labelled UR + NE. The shift is shown at the top of the gel while the excess free

probe is at the bottom of the gel. This gel is representative of at least three separate experiments. Below

the EMSA is the sequence of the PRE0 wild-type element, the mutant constructs PRE6-8 and the UR

oligomer. The boxed regions of the PRE6-8 constructs represent the repeat regions and the nucleotide

changes within these regions (AG to CT) are denoted by an arrow.

157

158

Figure 6.5. Titration Assay for Probe Concentration and EMSA With the PRE0 (wild-type) and PRE

9-11 Mutants. The lanes are: PRE0 (1-3), PRE9 (4-6), PRE10 (7-9), PRE11 (10-12). For each PRE

oligomer, 500 fmole, 1 or 2 pmole of biotin labelled oligomer was incubated with 10 µg of T47D nuclear

extract. An arrow at the top of the gel denotes the shift and the excess probe is shown at the bottom of the

gel. The sequences below show the sequence mutations in boxed regions (PRE9-11) where the sequence

was changed from AGAACA to GGATCC. This experiment is indicative of two separate experiments with

different T47D extracts.

159

160

mutant forms (PRE9-11) suggesting that these regions may not be involved in the

binding. These data is representative of two independent experiments.

6.3.2. The KLK4 PRE0 Binds Factors From the T47D Nuclear Extract that Appear

to Be Progesterone Regulated

The nuclear extracts used in the above experiments were derived from T47D cell lines

that were not treated with any steroid hormones. This time, the question was asked if

there would be a change in the binding patterns observed for any of the elements if the

T47D cell lines were treated with progesterone? Therefore, T47D cell lines were treated

with 10 nmol/L of progesterone over a time course of 24 hr (0, 2, 4, 8, 16 and 24 hr) and

nuclear extracts from these time points were analysed on an EMSA using the wild-type

biotinylated PRE0 (Table 6.1). Following progesterone treatment two specific shifts

occurred, one that appeared to be progesterone regulated and another that was consistent

across all time points (Figure 6.6A, top and bottom shift, respectively). Initially, at 0 and

2 hr there was no binding event observed with the top shift, however, at 4 and 8 hr a

strong binding reaction was observed that appeared to diminish by 16-24 hr (Figure

6.6A). Thus it appears from these studies that the top shift represents an event that is

progesterone regulated while the bottom shift may represent a factor that is constitutively

bound to this element (Figure 6.6A and B). These data are representative of at least two

separate experiments from different T47D nuclear preparations.

6.3.3. Factors from the T47D Nuclear Extract Bind Distinct Regions on the KLK4

PRE0

As there was clearly a binding event occurring at 4 hours following progesterone

treatment, another assay was performed to determine which of the deletion constructs

were involved in this event. T47D cell lines were treated with 10 nmol/L of progesterone

over 4 hours and the nuclear extracts incubated with the deletion constructs (PRE1-5) that

had various sections of the element deleted as well as either one of the half-sites

(AGAACA) abolished, or both deleted (Table 6.1 and Figure 6.7C). Following this

161

Figure 6.6. Progesterone-Regulated Binding on the KLK4 PRE0 in T47D Nuclear Extracts. A. The

breast cancer cell line, T47D was grown in phenol red-free, FCS-free DMEM for 24 hr, followed by the

addition of 10 nmol/L progesterone over a time course of 0-24 hr. Nuclear extracts were isolated and

incubated with the PRE0 element for 30 min prior to the EMSA. Two distinct shifts were identified, a shift

that appears to be regulated by progesterone after 4 hours of progesterone treatment (top shift) and a shift

that was consistently observed at all time points (bottom shift). The numbers at the top of the figure

represent the time in hours for each progesterone treatment and arrows indicate the two shifts. Note, free

probe is not shown as it was run off the end of the gel. B. Schematic diagram representing the event

observed in A. The black and grey ovals represent factors that are binding the PRE0 element with and

without progesterone stimulation (solid lines are the PRE0). This experiment is indicative of three separate

experiments.

162

Figure 6.7. EMSA of Variant Forms of PRE0 with Nuclear Extracts from Progesterone-Treated

T47D Cell Lines. A and B. At the top of each panel (A and B) are the PRE elements and their various

forms (PRE0-5) that were assayed. To the left of each shift pair are the PRE constructs alone without

nuclear extracts (NE) and to the right with the addition of nuclear extract (NE) Note, free probe is not

shown as it was run off the gel due to the size of the gels used to perform the EMSA. Each shift (PRE0-5)

is shown. C. Schematic diagram showing the various deletion constructs (PRE1-5) and wild-type form

(PRE0). The dashed lines represent the regions that have been deleted from the wild-type form (PRE0).

Each sequence is shown in the 5’-3’ direction and only the forward sequence is shown.

163

EMSA a number of shifts were observed. For the control PRE0 wild-type, a double shift

was identified as previously seen in Figure 6.6 (Figure 6.7). However, when the left side

of the wild-type element was deleted (PRE1) (Figure 6.7C) only a single shift was

observed and the top band previously identified in the PRE0 wild-type element, was

almost completely abolished (Figure 6.7A). Deleting the right side (PRE2) (Figure 6.7A)

resulted in the loss of the bottom shift. Additionally, the top band shift was observed as a

doublet (Figure 6.7A). The deletion of the left half-site AGAACA, PRE3 (Figure 6.7C)

did not abolish nuclear factors from binding to the element (Figure 6.7B). Moreover,

there was no difference between the shifts observed for the wild-type PRE0 and PRE3

(Figure 6.7A and B). However, the removal of the right half-site AGAACA (PRE4)

(Figure 6.8C) diminished the top shift (Figure 6.7B). Moreover, when both half-sites

were deleted (PRE5) (Figure 6.7C) diminished binding was observed for both shifts

(Figure 6.7B). Thus it appears from this data that the regions involved in binding the

nuclear factors are probably restricted to the far left side of the PRE0 element (5’-

AAAAAGAGAA-3’; PRE1) and on the right side - 5’-AGAACA-3’; PRE4 and 5’-

GGAGAGAATGAG-3’ (PRE2) (Figure 6.7C). Intriguingly, the left half-site AGAACA

does not appear to be involved in the binding event. Having identified a distinct shift with

the PRE0 element, the next question asked was, what is binding this element?

Additionally, why did the progesterone-treated T47D cells result in a double shift that

was not identified in the earlier non-progesterone treated samples? This led to the

possibility that progesterone was regulating the top shift, and it was probable that this

was occurring through the progesterone receptor (PR).

Therefore a supershift assay was performed where the progesterone-treated T47D nuclear

extract was incubated with 1 µg of PR antibody (Santa Cruz) and the PRE0 for thirty

minutes prior to the EMSA. Controls for non-specific binding were also included; these

were, PR antibody and PRE0 alone; PR antibody and nuclear extract; PRE0, nuclear

extract and a 200-fold molar excess of “cold” (unlabelled) PRE0; PRE0 and mouse IgG,

and PRE0 and nuclear extract from a PR negative breast cancer cell line, MDA-231

(Sutherland et al., 1999). All the controls were negative as expected and the 200-fold

molar excess of “cold” PRE out-competed the labelled PRE suggesting binding

164

specificity (Figure 6.8). Additionally, nuclear extracts from the MDA-231 cell line did

not shift the PRE0 element, further supporting a specific PR shift was occurring through

the PRE0 and nuclear extracts from T47D. However, although two shifts were identified

with the PRE0 and T47D nuclear extract, no supershift was identified (Figure 6.8).

As no supershift was observed in the above experiment, the incubation conditions were

changed so that either the PR antibody (Santa Cruz) was mixed with the progesterone-

treated T47D initially for 1 hr and then added to the PRE0, or pre-incubated for 4 hr at

RT prior to the addition of the PRE0 for a further one-hour. In addition to the PR, an

androgen receptor (AR) antibody (Upstate Biotech) was also used as a control as it is

well established that the AR could bind to similar sequence motifs as the PRE0. No

supershift was observed when either PR or AR antibodies were used (Figure 6.9)

although the expected double shift was observed as previously identified in progesterone-

treated nuclear extracts. IgG was used as a control for binding specificity and did not

result in a shift while the excess unlabelled PRE0 could compete out the shift as expected

(Figure 6.9).

6.3.4. The PR Binds to the KLK4 PRE0

Although distinct shifts were occurring with the PRE0 and the progesterone-treated T47D

nuclear extracts, there was no obvious supershift with the PR antibody. Therefore, a re-

evaluation of the EMSA pre-incubation conditions was required. This time, the PR

antibody (Santa Cruz) was mixed with the progesterone-treated T47D nuclear extracts for

twenty-four hours at 4°C before the addition of the PRE0 for a further hour incubation at

room temperature. Additionally the variants PRE1-4 were tested in this assay.

Following this EMSA and supershift assay, the PR antibody competed out the binding of

the PRE0 (Figure 6.10). Additionally, the androgen receptor antibody did not compete

out the PRE0 as expected and thus, supports the specificity of the interaction between the

165

Figure 6.8. EMSA and SuperShift Assay for the Binding of the PR to the PRE0. The lanes are (from

left to right) - free probe alone (PRE0), probe and nuclear extract (PRE0 + NE), PRE0 + NE and PR

antibody (PRE0 + NE + PR), PRE0 + PR, NE + PR (no probe), PRE0 + NE and an excess of un-labelled

“cold” PRE0, PRE0 + mouse IgG and PRE0 + MDA-231 NE. The two shifts are indicated at the top of the

gel while the free excess probe is at the bottom of the gel.

166

Figure 6.9. EMSA and SuperShift Assay Using Both Progesterone and Androgen Receptor (PR and

AR, respectively) Antibodies. Lanes from left to right are- the PRE0 element alone, PRE0 and T47D

nuclear extract (NE), PRE0 + NE + AR (both added to the PRE0 initially), PRE0 + NE + 200 fold molar

excess of “cold” unlabelled PRE0, PRE + NE + AR* (4 hr incubation with T47D NE before adding the

PRE0). The sample set to the right of the figure is exactly the same except the PR antibody was used. The

final lane is mouse IgG used as a control for binding specificity.

167

Figure 6.10. EMSA and Super Shift Assay With PR and AR Antibodies and PRE Variants 1-4.

Following a 24 hr incubation of AR or PR antibody with T47D nuclear extracts and RT incubation for a

further hour with PRE0-4, the samples were electrophoresed on a 6% non-denaturing gel. From the left is

the PRE0 (1 = free probe; 2 = PRE0 + nuclear extract, NE; 3 = PRE0 + NE + androgen receptor (AR)

antibody; 4 = PRE0 + NE + progesterone receptor (PR) antibody. For PRE1 (5-8), PRE2 (9-12), PRE3

(13-16) and PRE4 (17-20), the samples are in the same order as for PRE0. Arrows denote the shifts and the

free probe is at the bottom of the gel. The bottom sequences show the PRE0 and deletion constructs PRE1-

4. This is indicative of at least three separate experiments that all resulted in a similar pattern.

168

169

PR and the PRE0 (Figure 6.10). The PRE1 variant resulted in a double shift when mixed

with T47D nuclear extract (Figure 6.10). Additionally, the AR antibody did not compete

out this binding event although the PR antibody reacted strongly with almost complete

abolition of the upper band (Figure 6.10). Neither AR nor PR antibodies did compete out

the PRE2 interaction and moreover, as previously identified in Figure 6.7A, only the top

shift was observed (Figure 6.10). The PRE3 interaction remained unchanged from the

control PRE0, that is two shifts were identified (Figure 6.10) as was previously observed

in Figure 6.7B. Moreover, AR and PR antibodies had no effect on the binding

interactions although there now appeared to be an additional shift (between the upper and

lower bands) in the AR antibody lane (Figure 6.10, lane 15). The PRE4 interaction with

T47D nuclear extract gave rise to only one shift (lower shift) as previously described in

Figure 6.8B. Furthermore, AR and PR antibodies had no effect on the PRE4 interaction

with nuclear factors.

The successful identification of PR binding to the PRE0 construct was interesting, but it

also raised another important question. Is the binding of the PR to the PRE0 a reflection

of the in vitro assay system, or could this binding event be repeated in “real-time” in

vivo? To answer this question the chromatin immunoprecipitation (ChIP) assay was

performed.

6.3.5. The PR is Recruited and Assembled In “Real-Time”, In Vivo, to the KLK4

Progesterone-Responsive Region

To investigate the assembly of a PR transcription complex, the examination of the

recruitment of the PR coactivator to the promoter of the endogenous progesterone-

responsive KLK4 gene following progesterone treatment, was performed. T47D cell

lines were grown in the absence of progesterone for 72 hours followed by either no

treatment, or treatment with saturating levels (100 nmol/L) of progesterone for 24 hours.

The status of the endogenous PR present on the progesterone-responsive region of the

KLK4 promoter was determined using the ChIP assay. The presence of the KLK4

promoter in the chromatin immunoprecipitates was analysed by semi-quantitative PCR

using specific primer pairs spanning the progesterone-responsive region. I, III and V

170

(Figure 6.11A) represent the amplification of specific promoter regions of the KLK4 (I

and III) and β2-microglobulin genes (V). II, IV and VI represent the input DNA controls.

The input controls are chromatin taken from the preparation before the

immunoprecipitation step and therefore act as amplification controls for the PCR

reaction. The genomic DNA (gDNA) was extracted from a separate T47D sample that

was not used in the ChIP assay and served as an additional control for the PCR reaction.

The time-course was performed over 24 hours with 100 nmol/L of progesterone treatment

for 0, 15, 30, 45, 60 minutes, 2, 4 and 24 hours.

In this experiment it was observed that the PR antibody effectively immunoprecipitated

the progesterone-responsive region of the KLK4 gene in a manner that was dependent on

progesterone treatment and time (Figure 6.11A). In contrast, the PR antibody failed to

immunoprecipitate a region of the KLK4 promoter that did not contain a potential PRE,

and in addition, the chromatin from a non-progesterone responsive gene, β2-

microglobulin (Figure 6.11A, III and V, respectively). The respective input DNA

controls (Figure 6.11A, II, IV and VI), amplified the appropriate product indicating the

specificity of the PCR.

As expected, the gDNA controls were positive for all panels indicating the specificity of

the specific primer pairs. All samples were sequenced to confirm the specific product

amplified using each set of primer pairs (data not shown). It is clear that the PR is bound

to the native KLK4 chromatin that includes the putative PRE following progesterone

stimulation. Noticeably, the PR is assembled on the KLK4 chromatin within 15 min

following progesterone stimulation (Figure 6.11A, I). PR chromatin occupancy peaks at

about 45-60. This assay was performed at least two times under the same conditions

using a different T47D passage on each occasion from liquid nitrogen stocks. The results

from both of these studies resulted in a similar patterns.

171

Figure 6.11. ChIP Assay for the Recruitment of the PR to the Native KLK4 Chromatin. A. To the left

of this figure are the schematic diagrams for the regions 5’ of the +1 (TIS) that were amplified for the

KLK4 (I, -2496 to -2238 bp); (III, -2012 to -1839 bp) and β2-microglobulin (V, -290 to -62 bp) genes. The

flanking primers used in the PCR for all the fragments are given as negative numbers relative to the +1.

The upper schematic demonstrates the region of the KLK4 chromatin that contains a potential progesterone

response element (PRE, -2496 to –2283 bp). The middle schematic demonstrates a region of the KLK4

chromatin that does not contain a PRE (-2021 to –1839 bp), and the lower schematic represents a promoter

region of a non-progesterone-responsive gene, β2-microglobulin (Beta2) (-290 to -62 bp). II, IV and VI are

control samples that were PCR-assayed before the initial immunoprecipitation step and show that the input

DNA contains the reference gene. I, III and V represent the PCR of each of the regions given

schematically to the left of the gel following immunoprecipitation. Time points for analysis of 0, 15, 30,

45, 60 (minutes), 2, 4 and 24 (hours) are indicated at the top of A (I). The first lane of each gel is the

negative control (-ve) where no DNA was added to the PCR, and the last lane of each gel is the positive

control of untreated genomic DNA (gDNA) from T47D cell lines.

172

173

6.4 DISCUSSION

In Chapter Three, it was identified that KLK4/hK4 gene/protein expression was rapidly

up-regulated by 10 nmol/L of progesterone in T47D cells. In Chapters Four and Five, the

KLK4 promoter in T47D cells was identified and a putative PRE was identified in the far

“up-stream” region of the KLK4 5’ flanking DNA. Thus, the question asked in this

Chapter was whether this putative PRE was functional? To test the functionality of this

putative PRE in vitro and in vivo, EMSA and ChIP assays were used, respectively. From

the EMSA data, it was identified that the PR could complex with the putative PRE, in

vitro. Moreover, it appeared that the region where PR might be binding was restricted to

18 bp of the putative PRE0. This region consists of the sequence 5’-

TGAGAGAGAACA-3’ and contains only one (the second) of the half-sites (underlined

and in bold) identified previously in Chapter Five of the sequence (5’-AAAAAGA

GAAAGAACATGAGAGAGAACAGGAGAGAATGAG-3'). More importantly, using

ChIP analysis this progesterone-responsive region could recruit and assemble the PR in

“real-time”, in vivo.

The steroid nuclear receptors comprise a family of ligand-dependent transcription factors

that includes the progesterone, androgen, mineralocorticoid, glucocorticoid and estrogen

receptors (PR, AR, MR, GR and ER, respectively). These receptors play fundamental

roles both as transcriptional activators and as repressors in all aspects of biological

function, including development, metabolism and reproduction (Weigel, 1996). They are

characterised by a well-conserved DNA-binding domain (DBD) consisting of two Zn-

finger modules (Evans, 1988) that is involved in the assembly of the receptor onto the

gene-specific hormone response elements (HREs). The steroid receptors regulate

transcription by binding to HREs that contain conserved hexameric sequences which can

be arranged as either inverted or direct repeats, or monomeric sites (Khorasanizadeh and

Rastinejad, 2001). Based on dimerisation patterns, and the HREs to which they bind, the

steroid hormone receptors, AR, GR and PR, bind as homodimers to (partial) inverted

repeats of the core sequence, 5’-AGAACA-3’ that are separated by three spacer

nucleotides (Aumais et al., 1996; Claessens et al., 1996; Zhou et al., 1997; Nelson et al.,

1999b). However, there are clearly other sequences to which the receptors bind alone or

174

in combination with other proteins and many HREs have diverged from their consensus

sequence in such a way as to allow tissue specificity of regulation (Haelens, et al., 2002).

In this study, a nuclear factor, presumably the PR could complex with a synthetic KLK4

PRE0 derived from a sequence in the KLK4 promoter, approximately 2.4 Kb 5’ from the

TIS. This complex could be partially or completely competed out with a PR antibody.

Of the two bands observed, only one of these (the top shift) could be competed out by the

PR antibody. Additionally, this was the shift that appeared to be progesterone regulated.

These results may suggest that the top shift only was due to the assembly of the PR on the

PRE0 element. It is unclear what factor(s) may be contributing to the lower shift. It is

possible that the lower shift is not PR but some other transcription factor that is

constitutively bound. Studies with the glucocorticoid receptor (GR) have identified that

this steroid receptor also recognises the sequence AGAACA (Aumais et al., 1996; Zhou

et al., 1997). Studies by Rodriguez et al. (1990) found that progesterone was not

required for the chicken PR to dimerise and assemble onto PREs. Additionally; several

orphan receptors can bind DNA with high affinity as monomers (Aranda and Pascual,

2001). Whether these two shifts represent monomer and dimeric PR complexes, or un-

liganded PR, remains unclear.

The mutant PRE constructs did not appear to result in any clear loss of binding to nuclear

factors following EMSAs although there did appear to be an increase in a binding

complex with the PRE7 and PRE8 mutants. These data suggest that nucleotides mutated

from the wild-type PRE0 construct, might in fact, enhance nuclear factor binding at these

or flanking nucleotides. A number of studies with natural estrogen response elements

(EREs) from estrogen-responsive genes have identified that single or double base pair

mutations to one or both sides of the ERE half-site can either reduce or increase binding

of the estrogen receptor (ER) depending on the cell type (reviewed in Klinge, 2001).

Other studies by Verrijdt et al. (2000) identified an androgen-specific response element

of the core sequence 5’-GGCTCTTTCAGTTCT-3’ in the human secretory component

gene (sc-ARE1.2). Studies with the DNA binding domain of the AR and point mutations

in the left half site of the sc-ARE1.2 (an introduction of an A at -4; 5’-

175

GGCACTttcAGTTCT-3’) increased the affinity of the AR-DBD approximately 2-fold.

Furthermore, the affinity of the AR-DBD for sc-ARE1.2 could be augmented an

additional 3-fold by a subsequent T to A mutation at position -4 and -2

(GGCACTttcAGTTCT-3’). These kinds of studies highlight the selectivity of these

elements in binding their specific receptor types.

The deletion construct analysis for the putative PRE was interesting. In the absence of

the PRE2 element, a complete loss of the bottom shift was observed, while the deletion of

the PRE4 element resulted in a loss of the top band. These data suggest that the binding

of the PR and/or another factor to this region occurs within the sequence 5’-

AGAACAGGAGAGAATGAG-3’ that contains the consensus half-site, 5’-AGAACA-3’.

These data may also suggest that a specific factor is assembled onto the PRE4 and the PR

associated with the PRE2. The analysis of PRE0 may suggest that PR-PR antibody

complex cannot assemble onto the PRE0 due to steric hindrance by a factor bound at the

PRE2 region (Figure 6.12). However, when PRE2 is deleted, perhaps this would then

allow for the assembly of the PR onto the PRE0. When PRE4 is deleted, along with its

binding factor, PR-PR antibody complex cannot assemble onto the PRE0 element and

thus the bottom shift is observed, containing the unknown bound factor (Figure 6.12).

Nevertheless, these data suggest that the binding of the PR to this region occurs within

the sequence, 5’-AGAACAGGAGAGAATGAG-3’. Whether this is a new PRE or

perhaps PR binds as a monomer to the half-site (5’-AGAACA-3’) needs to be elucidated.

Moreover, the unknown factor presumably binds the right-hand side of the sequence, 5’-

GGAGAGAATGAG-3’.

176

Figure 6.12. Schematic Diagram Representing the Binding of the PR and Unknown Factor to the

PRE0. The wild-type PRE0 binds the PR (red circle) and an unknown factor(s) (black oval). PR

associated with the PR antibody (purple oval) inhibits the binding of the PR to the PRE0, however, upon

deletion of the PRE2, and the associated factor, PR-PR antibody can assemble onto the sequence.

177

Keeping in mind that the consensus motif for the steroid HREs are a 6 bp inverted or

direct repeat consisting of a 3 bp spacer, it is possible that the binding site for the PR on

the KLK4 PRE consists of the sequence, 5’-AGAACAggaGAGAAT-3’. This sequence

matches the KLK3 ARE at -170 bp in 9/15 bp, and the KLK2 ARE at –160 in 8/15 bp

where the left half-site of the KLK4 sequence, 5’-AGAACA-3’ is completely conserved

with the KLK3 ARE (Table 6.3). While the binding of the PR could be defined within

the KLK4 PRE sequence 5’-TGAGAGAGAACA-3’, other observations from these

deletion studies were not so clear. Although the AR antibody control did not compete out

the binding as observed with the PR antibody, it did appear to cross-react with an

unknown factor, evident in all of the AR antibody supershift lanes. However, further

analysis of this event was not pursued and awaits further investigation.

Additionally, it should be noted that the deletion constructs create “unreal” sequences

from the native PRE0 and therefore, it is possible that these deleted forms are not

recognised by the PR or other possible binding factors. Indeed, in vitro protein-DNA

interaction studies such as EMSAs generally reveal the most abundant and/or highest-

affinity interaction, but not necessarily the physiological interaction (Johnson and

Bresnick, 2002). Additionally, certain factors in nuclear extracts can inherently bind

more efficiently to DNA in vitro than related factors with similar DNA affinities in vivo

(Johnson and Bersnick, 2002). It should also be noted that there are two forms of the PR,

PRA and PRB, where PRB is identical to PRA except for an additional 164 amino acids

at the end terminal region (McGowan and Clarke, 1999). Numerous studies have been

performed with these isoforms and it appears that there is a very complex interplay

between these two receptor types (Wen et al., 1994; Graham et al., 1995; Clemm et al.,

2000). In the studies reported here the antibody used for the PR supershifts was raised to

a region common to both PRA and PRB and thus, it is impossible to tell from these

studies what isoform is bound to the PRE0. Some preliminary studies with a PRB

antibody failed to supershift the complex. Thus, whether the conditions under which the

supershift experiments were performed were not ideal, or simply that the PR was not

178

Table 6.3. ARE Sequences within the KLK3 and KLK2 Genes and their Homology with the KLK4

PRE

Note: HRE = Hormone Response Element, PRE and ARE = Progesterone and Androgen Response

Elements, respectively. The sequences are given in the 5’ to 3’ direction with the X indicating the regions

of both KLK2 and KLK3 AREs that are different from the KLK4 PRE. The underlined AGAACA are the

consensus half-sites.

GENE KLK4 KLK3 KLK2 HRE PRE ARE ARE Sequence AGAACAggaGAGAAT AGAACAgcaAGTGCT GGAACAgcaAGTGCT

Matches with KLK4

PRE AGAACAgxaXXXXXT XGAACAgxaXXXXXT

179

bound, is not yet clear. Undoubtedly, a number of studies to delineate whether the PRA,

PRB or a complex of PRA:PRB is bound to the PRE0 are required. Nevertheless, it has

been identified that the PR can indeed interact with the wild-type KLK4 PRE0 sequence

and that its interaction is possibly restricted to the sequence 5’-AGAACAggaGAGAAT-

3’. However, the question was, whether this same region could recruit and assemble the

PR in “real-time” in vivo?

Studies at the genetic and biochemical level have revealed that the process of gene

activation and transcription are extremely complex processes. Factors that bind to

oligomers in vitro, as in EMSAs may not have the same affinity for DNA-specific

sequences in vivo due to regulatory and/or repressive effects on chromatin and other

factors. This is a difficult problem to address when analysing data from these kinds of

studies. Importantly, the ChIP assay overcomes these problems by directly assaying in

physiological conditions. Using this assay the recruitment of the PR to a progesterone-

responsive region of endogenous KLK4 chromatin, in the breast cancer cell line, T47D,

has been identified. From these data, it is apparent that the PR or a PR complex is

recruited rapidly to the region that includes the putative PRE following progesterone

treatment. Although the assay is semi-quantitative, the recruitment of the PR to this

region appears to cycle onto, and off, the PRE in a time-dependent manner. One other

study has also observed a cyclic recruitment using the estrogen receptor α (ERα) and the

cathepsin D promoter and it has be suggested that the cycling onto, and off, target

promoters may represent a mechanism that facilitates continuous monitoring of the

external environment (Shang et al., 2000). Although it may be possible that the observed

cycling onto, and off, the KLK4 progesterone-responsive region could be due to epitope

masking (during the PR antibody immunoprecipitation) at those specific time points, this

is unlikely due to the reproducibility of these results which were identical on two

occasions. However, a stronger case for the cyclic recruitment of the PR to native KLK

chromatin could be confirmed with the use of another PR antibody that recognizes a

different epitope.

180

The cyclic recruitment of the steroid receptor to native chromatin is an interesting

observation. The scientific dogma that a co-activator remains in contact with the cis-

regulatory domain for the duration of a stimulus is inconsistent with a recent report that

the association of ER and the co-activator, AIB1, is a transient process that is disrupted

by acetylation of AIB1 by cyclic AMP response element binding protein (CREB-binding

protein, CBP) and related co-activator p300 (Chen et al., 1999). An important and

challenging field is to be able to dissect the molecular interactions between native

chromatin and protein(s). The study of other interacting factors such as co-repressors,

nuclear receptor co-repressor (NCoR) and silencing mediator for retinoid and thyroid

receptor (SMRT) and co-activators such as the p160 family (GRIP1, A1B1, SCR-1), are

now being performed (Shang et al., 2000, 2002; Rowan et al., 2000). The potential

involvement of these factors and other nuclear proteins in these processes cannot be

overlooked.

181

6.5. CONCLUSIONS

The EMSA resulted in the identification of a functional KLK4 PRE sequence that binds

the PR (and possibly an additional nuclear factor) in vitro. Although the mutant

constructs were not successful in delineating the region of PR binding, several deletion

constructs identified the region of PR binding to the sequence, 5’-

AGAACAGGAGAGAATGAG-3’. Moreover, a region of the KLK4 up-stream genomic

sequence containing the identified PRE can recruit and assemble the PR following

progesterone stimulation, in “real-time”, in vivo. Future studies into the progesterone-

stimulated transcriptional regulation of KLK4 via PR interaction with other factors are

required to fully understand the precise mechanisms of action. In summary, the above

data suggest a role for the functional coordination between the PR and a KLK4

progesterone-responsive region in T47D cells, and thus, provide a model system to

further study these events in vivo.

CHAPTER 7

GENERAL DISCUSSION

AND

FINAL CONCLUSIONS

184

7.1. INTRODUCTION

Breast cancer is second only to lung cancer as a cause of deaths in women in

industrialised societies (Sutherland et al., 1999) while endometrial cancer is the fourth

most common cancer affecting women in the US and is also the most common

malignancy in that country (Burke et al., 1997). Breast and endometrial cancer are under

the hormonal control of the steroids, estrogen and progesterone. Both of these hormones

are involved in regulating the “down-stream” genes that are implicated in the

development and progression of these cancers. One such family of “down-stream” genes

that are known to be regulated by estrogen, androgens and progesterone in many cancer

systems where they have been implicated in the development and progression of these

cancers, are the tissue kallikreins (reviewed in Diamandis et al., 2000a; Yousef and

Diamandis, 2003).

This thesis outlines the hormonal regulation of the human KLK1/KLK4 genes and

hK1/hK4 proteins in hormone-dependent cancers of the endometrium and breast.

Although initially some interesting data was obtained for the estrogen and progesterone

regulation of hK1 and hK4 in the endometrial cancer cell line, KLE, these findings were

not pursued further at this time. Rather, it was decided that the progesterone-responsive

KLK4/hK4 gene/protein in the breast cancer cell line, T47D, would perhaps provide a

better model system in which to study KLK4 regulation. The decision to characterise

KLK4 expression and regulation in T47D cell lines was based on the high, consistent

level, of KLK4/hK4 transcription and expression following progesterone treatment and its

inhibition by the anti-progesterone, RU486. Thus, the major focus was to delineate the

structural elements involved in the progesterone regulation of KLK4 by analysis of the

gene promoter and to further test these regions for functionality.

The breast cancer cell line, T47D, was used in this thesis as it has functional estrogen and

progesterone receptors and is widely used as a model system to study gene regulation

(Sutherland et al., 1999). It was also more readily available to us than the BT-474 cell

line which had been used previously to show KLK gene regulation by steroid hormones

(Diamandis et al., 2000a). Importantly, this is the first report of the regulation of the

185

KLK4 gene by progesterone in the T47D breast cancer cell line. In addition, this is also

the first report of the identification of the KLK4 promoter in the T47D cell line and the

identification of a functional progesterone responsive region that recruits and assembles

the progesterone receptor to the native KLK4 promoter in “real-time”. The significance of

this study is underscored by the development of many novel-based steroidal therapies that

target “down-stream” genes in an attempt to understand their role(s) in hormone-

dependent cancers.

7.2. THE EXPRESSION AND REGULATION OF KALLIREIN 1 AND

KALLIKREIN 4 IN ENDOMETRIAL CANCER CELL LINES.

The initial examination of KLK1 gene regulation by estradiol and progesterone in the

HDC cell line of the endometrium, HEC1A, showed that KLK1 was not responsive to

these steroids in our hands. However, a purely semi-quantitative RT-PCR was

undertaken. Studies of this kind probably do not reflect the “real” status of a regulatory

response, unless of course that response is dramatic and can be easily observed.

Quantitative PCR could have been performed, however, only an early model Roche Light

Cycler was available and not always reliable and therefore this method was not

undertaken at that time. Since these studies were performed, quantitative “real-time”

PCR is now used widely in this laboratory with reproducible data due to the newer

technology on hand (ABI Prism Light Cycler). Thus, these experiments could now be

repeated on this newer system with confidence that the data obtained is a “true” reflection

of the regulatory status of the gene in question. However, it did appear that the protein

data supported these findings where there was no change in hK1 protein levels from

estradiol and progesterone treatments in HEC1A cells. It is possible that these steroids

do not regulate KLK1 expression in this cell line and that other endometrial cancer cell

lines need to be examined. Indeed, most of the studies to date have shown KLK1 to be

up-regulated by estradiol in prolactin tumours (Powers, 1986), in the rat anterior pituitary

(Fuller et al., 1985; Clements et al., 1986, 1989; Chao et al., 1987) and in rat uterus

(Corthorn et al., 1997). It is also possible that this cell line has become hormone-

insensitive, possibly through the loss of either ER or PR in the culturing procedure.

Other studies have confirmed the loss of PR in endometrial cancer cell lines as part of the

186

culturing process (Beato, 1996). With this in mind, control studies with known genes

that are regulated by estradiol and progesterone in this cell line should be performed. In

contrast, the combined estradiol/progesterone treatments resulted in a slight increase in

hK4 expression in the HEC1A cell line, but subsequent similar studies in this line were

not conclusive.

Although KLK1/hK1 or hK4 were not responsive to estradiol or progesterone in HEC1A

cells, a marked increase in both hK1 and hK4 protein levels was observed with these

same treatments in the endometrial cancer cell line, KLE. Although this finding was

exciting, further studies were not performed as this cell line harbours a defective ER that

does not translocate to the nucleus (Richardson et al., 1984), and concurrently, the results

obtained with the breast cancer cell line, T47D, were more exciting (see below).

Undoubtedly, further studies could be performed to specifically delineate the hormonal

regulation of the KLK1/hK1 and KLK4/hK4 genes/protein in endometrial cancer. The

estrogen and progesterone responsive Ishikawa endometrial cancer cell line might also

provide a better model system to study. These studies are now ongoing in our laboratory.

7.3. THE SIGNIFICANCE OF KLK4/hK4 EXPRESSION AND REGULATION BY

PROGESTERONE IN THE BREAST CANCER CELL LINE, T47D

Previous studies have shown KLK4 to be up regulated by progesterone in the breast

cancer cell line BT-474 (Yousef et al., 1999b). The data presented in this thesis also

support the up-regulation of this gene by progesterone in a similar breast cancer cell line,

T47D. Moreover, hK4 protein expression was reduced when the anti-progesterone,

RU486 was administered to T47D cells in culture. RU486 competes with progesterone

for progesterone receptor (PR) binding and thus inhibits the transcription of

progesterone-responsive genes. This data further emphasises the premise that KLK4 is a

progesterone-regulated gene in the breast cancer cell line, T47D.

Time-course studies for the progesterone regulation of hK4 protein over 24 hours resulted

in the rapid expression of this protein at the two-hour time point. This quick response

does suggest that KLK4 becomes transcriptionally active directly via progesterone

187

receptor-DNA binding events. One of the most widely studied kallikreins, KLK3, is also

activated directly through androgen receptor binding to several androgen response

elements and increases in KLK3 mRNA can be observed at 45 minutes following

androgen treatment in the prostate cancer cell line, LNCaP (Shang et al., 2002).

The expression of hK4 at the protein level after serum starvation and no progesterone

treatment was interesting and probably reflects basal levels of protein synthesis.

Nevertheless, without progesterone treatment, expression at the mRNA level was not

observed; even 1 nmol/L progesterone was not enough to induce KLK4 expression. In

marked contrast, hK4 protein expression was observed on different occasions even

without progesterone treatment. It was not clear why in serum-free conditions that

sometimes hK4 was present, yet on other occasions it was not. One possibility is that the

different cell passage numbers used in the different experiments could perhaps display

divergent expression patterns and responses. Indeed, studies in the prostate cancer cell

line, LNCaP have observed this phenomenon with cells of low and high passage numbers

(Esquenet et al., 1997). Alternatively, perhaps the difference in cell confluency

contributed to the differential expression of hK4. Nevertheless, it was clear from

subsequent studies that hK4 was regulated by progesterone.

With “real-time” RT-PCR now available in our laboratory, a more rigorous assessment of

changes in mRNA levels that might reflect transcriptional responses could be performed.

These include further treatment with RU486 or the inclusion of DNA and protein

synthesis inhibitors such as actinomycin D and emetine, respectively, to clearly identify

transcriptional or translational events. Additionally, to correlate KLK4 expression with

PR occupancy on the promoter of KLK4, studies using chromatin immunoprecipitation

assays coupled with nuclear run-on assays for KLK4 transcription could be used. These

studies would then provide a link between the recruitment and assembly of the PR co-

activator to the promoter of KLK4 and the induction of KLK4 mRNA expression.

By using these kinds of technologies, one may study the effects of selective receptor

modulators such as the anti-progesterone RU486. For example, RU486 is known to

188

exhibit partial agonist activities in a cell-type-dependent manner (Liu et al., 2002a).

Thus, by employing an in vitro chromatin transcription system that recapitulates PR-

mediated transcription, one may study the molecular basis by which RU486 modulates

transcription of KLK4 in a cell-type specific manner. These studies could include

different cancer cell lines from well-differentiated, poorly-differentiated to aggressive

phenotypes.

7.4. MAPPING THE KLK4 TRANSCRIPTION INITIATION SITE (TIS) AND

THE 5’-FLANKING REGULATORY REGIONS

The identification of the KLK4 TIS allowed for a detailed study of the 5’-flanking

regulatory regions of the proximal promoter and distal “upstream” regions. The exact

mapping of the TIS for any gene can be problematic. Many of the techniques used to

identify the TIS of a given gene, such as S1 nuclease mapping, primer extension and 5’

random amplification of complementary ends (RACE) are often unsuccessful and only

approximations of the TIS can be generated. This can present major problems, when

trying to assess the 5’-flanking regulatory regions for motifs that may control the

expression of the gene in question. Moreover, there may be additional 5’ un-translated

regions that could be missed by using these above techniques. This could then lead to

incorrect assessments of a region that is not the promoter.

Initially, many attempts to obtain the KLK4 TIS were unsuccessful. Although, it was

highly unlikely that poor sample preparation was a contributor as all of the samples were

routinely screened for purity and integrity, it is however likely that low abundance of

KLK4 mRNA and assay sensitivity played a major part in the initial problems in

identifying the KLK4 TIS.

Although the [γ-32P]-ATP and fluorescence-based end-labelled primer extensions were

promising, it could not be ruled out that, 1) the correct sequence was obtained, 2) the

reaction had gone to completion; and 3) additional exon(s) were present. If this were the

case, then it would be impossible to identify these exon(s) based on the size of the gel

product alone from the above primer extension assays. Nevertheless, these primer

189

extension assays did result in similar sized KLK4 extension products that are supported

by previous work from Hu et al. (2000) and Korkmaz et al. (2001). However, the

sensitivity of the RT-PCR combined with the “robust” 5’ RNA mediated ligase-random

amplification of complimentary ends (RLM-RACE) technology successfully identified

the precise KLK4 TIS in the prostate cancer cell line, LNCaP, and is supported by

previous work performed by Korkmaz et al. (2001). Therefore the identified KLK4 TIS

in the breast cancer cell line, T47D, using this method, is most likely the “true” TIS.

Although the primer design for the 5’RLM-RACE may have been biased toward the

shorter KLK4 form (identified by Korkmaz et al., 2001 in the prostate cancer cell line,

LNCaP), this is probably unlikely as other primers further 5’ of this region into exon one

(identified by Stephenson et al., 1999 and Nelson et al., 1999a), could not amplify the

full-length transcript. Moreover, in support of this, studies by Stephenson et al. (1999),

Nelson et al. (1999a) and Yousef et al. (1999b), could not identify the putative KLK4

exon one region and relied on bioinformatic analysis to identify the missing exon.

Although the full-length KLK4 transcript has been reported (Hu et al., 2000), from the

studies reported in this thesis, full-length KLK4 is likely to be expressed at extremely low

levels in the LNCaP and T47D cell lines. In this laboratory, we have continually

identified only low levels of full-length KLK4 expression particularly in the LNCaP cell

line (Rachael Collard, personal communication, QUT), a finding that supports the

observation of Korkmaz et al. (2001). Thus, it would be useful to examine the expression

and regulation of both of these forms in normal breast and prostate cell lines to determine

if they are perhaps differentially expressed in normal vs cancer cells.

Further studies that could be performed would be to include a control gene whose TIS

has been previously mapped using this RLM-RACE method, although at the time of these

studies there were limited publications on this technique. Nevertheless, the exact TIS has

been successfully mapped for the KLK4 gene in the breast cancer cell line, T47D.

Although this transcript would only encode for four exons, where the N-terminal pre/pro

region is absent, the catalytic triad, essential for enzymatic activity is still conserved and

therefore would perhaps still retain its catalytic activity. However, enzymatic studies on

190

this exon 4 form are still yet to be performed. A number of other studies could now be

performed. 1) Antibodies or RNA interference oligomers could be generated against the

two forms to determine their function in T47D cells. Following these experiments a

number of cell biology-based assays could be performed such as cell proliferation,

migration and invasion assays to determine the role, if any, of the short transcript over

that of the full-length form in these processes 2) To determine if this form is

enzymatically active, substrate specificity could be analysed to determine the

physiological substrates and to determine if it is similar to that of the full-length form.

To do this, one would need to make recombinant proteins based on the full-length and

shortened forms, and 3) Large screening assays in a number of cancer types may perhaps

identify this form as a diagnostic marker. To discriminate between the full-length KLK4

transcript (has an additional 122 bp at the 5’ region) and the shortened transcript, “real-

time” quantitative PCR could be performed. For example, one forward primer could be

directed at the sequence-specific 122 bp region of the full-length transcript, and therefore

only detect this form, while the other primer would be common to both forms and

therefore detect total KLK4 mRNA. Thus, the amount of mRNA encoding the shortened

form could be calculated by subtracting the relative abundance of the full-length

transcript from that of total KLK4 mRNA. This kind of assay has been used successfully

to discriminate between two forms of the progesterone receptor, PRA and PRB where

PRB has an additional 164 amino acids at the N-terminal region (Mesiano, et al., 2002).

Additionally, antibodies could be raised against the N-terminal region of the full-length

KLK4 protein and a common region to both forms to delineate the relative abundance of

KLK4 protein in normal versus cancer cells.

From the TIS mapping studies, and analysis of approximately 1400 bp of 5’ flanking

regions encompassing the TIS, a TATA-box was not identified at the consensus location -

25 to -30 bp 5’ of the TIS. This was not unexpected as there are many genes that are

TATA-less. For example, it has been shown that approximately 50% of promoters in

Drosophila are TATA-less (Arkhipova, 1995). However, a number of putative

transcriptional motifs were identified, in particular, a cluster of proximal Sp1 sites.

Several studies have shown that Sp1 is an essential factor implicated in basal levels of

191

transcription in TATA-less promoters. For example, Botella et al. (2001) identified an

Sp1 site in the TATA-less promoter of the endoglin gene that was essential for basal

transcription. Additionally, a number of putative half-sites for the estrogen response

element (ERE) were identified. The ERE binding site consists of a half-site region of the

sequence 5’-TGACC-3’ and has been studied in detail. The Sp1 sites and EREs will be

discussed in more detail below in Section 7.5.

7.5. BASAL ACTVITY OF THE PROXIMAL KLK4 PROMOTER AND ITS

ACTIVATION AND REPRESSION BY PROGESTERONE AND ESTRADIOL,

RESPECTIVELY

The identification of the KLK4 promoter region allowed for the design of promoter

constructs to test for basal activity. KLK4 promoter constructs, fused to a luciferase

reporter gene vector, when transfected into T47D cell lines, gave an overall basal

response higher than that of the control (no insert) vector. Thus the identified proximal

promoter region in Chapter Four was basally active in a synthetic promoter setting.

Moreover, the discovery of multiple Sp1 clusters about the KLK4 TIS was interesting.

Multiple Sp1 sites are commonly associated with TATA-less promoters and involved in

tethering the basal transcriptional machinery factors for transactivation (Weis and

Reinberg, 1997). Additionally, as noted in Chapter 4, in a study of 1031 transcription

initiation sites only 329 (32%) of these encompassed a TATA-box element consensus

sequence approximately -25 to -40 bp from the TIS (Suzuki et al., 2001). However, the

frequency of an Sp1 binding sites clustered about the TIS for these 1031 genes was 97%

and this may suggest that Sp1 site are implicated in a more primary role in transcription

than the TATA box. Although a consensus TATA-box has been identified for the full-

length KLK4 (Hu et al., 2000) the functionality of this element is yet to be tested. Clearly

there is a need to design more KLK4 promoter constructs that encompass the putative

promoter region of the full-length form and further up-stream of this. Other studies could

include the deletion of some or all of these Sp1 sites and testing for basal activity.

Additionally, gel shift analysis and chromatin immunoprecipitation assays on these

motifs for the Sp1 protein would no doubt aid in understanding the mechanism of basal

KLK4 gene regulation.

192

The minimal response of the synthetic luciferase gene observed with estradiol treatment

and no change with progesterone treatment was interesting. Although no estrogen

response elements (EREs) or progesterone response elements (PRE) were identified in

the proximal KLK4 promoter, it is likely that non-consensus motifs exist that have

diverged considerably to allow for receptor selectivity. It is also possible that in order to

activate transcription by progesterone, further up-stream elements are required as was

subsequently shown in Chapter 6. It could also be that this region is not responsive to

progesterone at all, and it is possible that only the full-length KLK4 transcript is

responsive to progesterone although it would appear that in T47D cells, the major

transcript is the shortened form. Clearly these studies need to be addressed. Although

some ERE half-sites were identified, these have not been tested for functionality. Studies

to dissect these motifs could be performed by foot-printing assays where the fragments of

promoter that are protected following estradiol or progesterone treatment, would most

likely harbour these specific response elements. Additional studies using electromobility

shift assays and super shift assays to determine if these motifs bind ER or PR could be

performed. This would then allow for a greater insight into the function of the KLK4

promoter and its interacting transcription factors and perhaps provide some understanding

of the mechanisms of KLK4 regulation in breast cancer. Although this data is

preliminary, a general trend was observed in repeated experiments and suggests that the

KLK4 proximal promoter harbours functional EREs. Clearly a great deal of study is

required to delineate the mechanisms of hormonal regulation at the more distal as well as

proximal regions of the KLK4 promoter and up-stream sequences for both the full-length

and truncated forms.

7.6. THE RECRUITMENT AND ASSEMBLY OF THE PROGESTERONE

RECEPTOR TO A KLK4 PROGESTERONE-RESPONSIVE REGION IN VITRO

AND IN VIVO IN THE BREAST CANCER CELL LINE, T47D

From Chapter 3, it was clear that the KLK4/hK4 gene/protein was regulated by

progesterone. Additionally, the rapid increase in hK4 protein at two hours following

progesterone treatment suggested that this response was at the transcriptional level.

Thus, analysis of KLK4 promoter sequence was extended to approximately 3 Kb up-

193

stream of the TIS identified in Chapter 4. From this analysis a putative progesterone

response element (PRE) that consisted of two direct repeats separated by 6 bp (5’-

AGAACATGAGAGAGAACA-3’ was identified. Thus this region was then tested for

functionality both in vitro utilising electromobility shift assays (EMSAs) and in vivo,

using a chromatin immunoprecipitation assay (ChIP), respectively. Many initial attempts

to identify the factor that was bound to the KLK4 PRE were unsuccessful. Initially, the

progesterone receptor (PR) antibody was mixed with the T47D nuclear extracts and the

PRE labelled probe for thirty minutes prior to the EMSA. However, no super shifts were

observed and it was thought that perhaps the PR was the wrong target or maybe the time

frame of this procedure was too short and did not allow enough time for correct binding

of the PR antibody to the PR. However, an overnight incubation with the PR antibody

and the T47D nuclear extract resulted in clear competition for the binding of the PR to

the PRE. Thus, it appeared from these studies that the PR antibody-PR complex

conformation did not allow the binding to the KLK4 PRE. Additionally, an androgen

receptor (AR) control antibody did not shift or compete out the binding of nuclear factors

to the KLK4 PRE and suggests that the PR was specific for this KLK4 PRE. Typically,

super shift assays with a specific antibody to the factor of interest forms an antibody-

factor-DNA complex that will migrate more slowly in EMSAs and thus represent the

additional shift observed when compared to factor-DNA alone. However, there are many

studies that show an inhibitory nature between the DNA-bound factor and the antibody

(Ab) of interest, where a super shift is not observed, but the Ab-factor fails to bind the

DNA element under test (Sun et al., 1997; Petz and Nardulli, 2000; Perez-Stable et al.,

2000).

Although the top shift observed was clearly the PR binding to the KLK4 PRE, it was

unclear what factor was causing the bottom shift. It is possible that this shift was due to

non-specific binding, as many attempts to shift this migrating factor were unsuccessful

with both PR and AR antibodies. Nevertheless, it is clear from the EMSA and super shift

data that the PR was binding to the KLK4 PRE.

194

It was a little unclear as to what nucleotides were involved in the binding of the PR to the

KLK4 PRE from the mutant studies. The design of several deletion constructs that either

abolished one half of the AGAACA half-site, or both regions, resulted in the

identification of a suspected binding sequence of 5’-AGAACAGGAGAGAATGAG-3’

where only one of the half-sites, 5’-AGAACA-3’ was present. This sequence matches the

consensus PRE 5’-AGAACA-3’, however, a number of studies are now confirming that

consensus hormone response elements (HREs) are diverging. These HREs can be direct,

inverted or everted repeats, as well as half-sites separated by any number of spacing

nucleotides (Aumais et al., 1996; Klinge et al., 1997a,b; Zhou et al., 1997). It is possible

that by deleting various regions of the KLK4 PRE wild-type construct, binding of nuclear

factors was disrupted or perhaps enhanced, and this would not be mimicked in an in vivo,

setting. However, other studies have used this technique successfully to identify the

approximate binding nucleotides for a number of steroid receptors (Claessens et al., 1996;

Klinge et al., 1997a,b). Thus, these experiments need to be performed to confirm the

exact nucleotides involved in the binding of the PR. Additionally, transactivation

experiments could be performed with the various deletion constructs to determine if they

can activate a synthetic promoter, such as the luciferase reporter gene as described in

Chapter 5.

A number of controls were routinely used to monitor receptor-binding specificity. The

androgen receptor (AR) has also been shown to bind to direct repeats of the sequence 5’-

AGAACA-3’ (Zhou et al., 1997; Verrijdt et al., 2000), however, whether these receptors

that recognise identical elements activate gene transcription is dependent on the promoter

and cell context (Scheller et al., 1998). Thus, the AR was successfully used as a control

for PR specificity whereby no binding of the AR to the KLK4 PRE was observed utilising

super shift assays. The inclusion of an unrelated sequence was also negative for PR

binding and thus confirmed the specificity of the PR-PRE complex.

A number of other studies could now be performed on the KLK4 PRE element, such as

singe base pair mutations to identify the nucleotides involved in the binding of the PR,

further analysis of the type of PR (that is, PRA or PRB), and the identification of other

195

factors, such as co-activators or co-repressors that could be complexed on this KLK4 PRE

along with PR.

The identification of the KLK4 PRE-PR complex led to the question of whether this

binding event could be repeated in “real-time”, in vivo. Thus the chromatin

immunoprecipitation (ChIP) assay was performed. This technique was initially

problematic where the immunoprecipitation step required some optimisation in order to

successfully immunoprecipitate out PR bound DNA fragments. This was no doubt due to

the low quantity of antibody initially used; however adding more PR antibody rectified

this situation.

Following the successful immunoprecipitation of PR-bound DNA fragments harbouring

progesterone responsive regions, and PCR of the specific KLK4 sequence from these

complexes, the recruitment and assembly of the PR to native KLK4 chromatin was

observed. Thus, the PR was recruited and assembled onto the progesterone-responsive

KLK4 chromatin within fifteen minutes of progesterone stimulation. Other studies have

also observed the recruitment and assembly of the ERα to the cathepsin D promoter

(Shang et al., 2000).

Other studies using the ChIP assay could now be explored for the analysis of factors that

are recruited as a result of PR assembly. For example, the steroid receptor co-activators

(SRC-1) family of transcription factors can interact with agonist bound nuclear receptors

and are involved in coupling the nuclear receptors to multifunctional transcriptional co-

regulators such as CREB-binding protein (CBP), p300 and pCAF, all of which have

potential histone acetyltransferase activity (DiRenzo et al., 2000). To do this, the ChIP

assay could be employed with the inclusion of antibodies to these above factors.

The identification of in vivo targets of transcription factors using ChIP analysis could be

combined with DNA microarrays. Access to the human genome offers the possibilities to

create bioinformatic libraries of putative targets of DNA-binding proteins. Additionally,

modifications to this ChIP technology can be performed to study protein-DNA

196

interactions in whole tissues or whole mouse embryos. The ability to study tissue and

embryos could allow for the analysis of transcription factor binding patterns in mouse

and human tumour samples. At present, ChIP analysis is being performed in conjunction

with Western blot and mass spectrometry to study protein-protein interactions that may

be important in the analysis of tumours in which the transcription factor of interest may

have altered DNA-binding specificity and/or altered protein partners as compared to non-

neoplastic tissue (Wells and Farnham, 2002). Thus, the EMSA combined with ChIP

analysis are powerful techniques to determine if a suspected DNA motif is capable of

recruiting and assembling factors that modulate gene expression.

7.7. FINAL CONCLUSIONS

The characterisation of the KLK4 promoter and potential regulatory motifs were often

technically challenging: 1) the identification of the transcription initiation site (TIS) is

often problematical, and in most promoter-based publications, is usually not pursued to

great lengths due to the extreme difficulty in obtaining the “true” TIS. 2) the

electromobility shift assay (EMSA) had not been performed in this laboratory before.

Therefore, the optimisation of this technique was often problematic with various aspects

of the running conditions (probe amounts, protein samples, reagents etc), needing to be

rigorously tested. 3) the ChIP assay was new technology not used in this laboratory

before and therefore required optimisation and detailed planning in order to achieve a

working system. With these difficulties in mind, the outcomes of the project are as

follows:

1. KLK4 is highly expressed at the mRNA and protein level, regulated by

progesterone, and inhibited by the anti-progesterone, RU486, in the breast cancer

cell line, T47D. The rapid expression of hK4 protein at 2 hr following

progesterone treatment suggests a direct PR transactivation response via PREs

2. The KLK4 TIS in T47D RNA is located at 78 bp 5’ of the putative ATG site for

translation as identified by Korkmaz et al. (2001). This KLK4 gene transcript

consists of only four exons, and thus excludes the pre/pro signal peptide and

197

suggests that this form is constitutively active and possesses intracellular

substrates

3. A consensus TATA-box is not present within -25 to -30 bp 5’ of the identified

TIS, however, a number of consensus binding motifs for Sp1 and estrogen

receptor half-sites were identified. It is highly likely that the Sp1 sites are

involved in the basal levels of transcription for this gene. Additionally, a putative

progesterone response element (PRE) was identified in the far “up-stream”

regions of the KLK4 gene.

4. Basal levels of transcription were observed within the KLK4 proximal promoter

region when coupled to a luciferase reporter gene and transfected into T47D cell

lines. Additionally, the KLK4 proximal promoter region did not induce the

luciferase reporter gene expression when progesterone was added to the system,

however, estradiol was inhibitory for luciferase gene expression. This suggests

that the proximal promoter region of the KLK4 gene could contain functional

EREs but not PREs. In keeping with this hypothesis, some ER half-sites were

identified, but PR sites were not obvious within this region.

5. The identified PRE in the far “up-stream” region of the KLK4 gene could bind

the progesterone receptor in vitro, and in vivo, as assessed by electromobility shift

assays and chromatin immunoprecipitation assays (EMSAs and ChIPs),

respectively. The binding of the PR to the KLK4 PRE was successfully competed

out by a PR antibody and not by an androgen receptor antibody, and thus

confirms the specificity of the PRE-PR complex.

6. Additionally, the PR was recruited and assembled onto and off of the

progesterone-responsive KLK4 region in a cyclic fashion. Thus, these data

strongly suggest that the PR represents one of the core components of a

transcription complex for the KLK4 gene, and presumably also contribute in the

expression of this gene. Further investigation is required to delineate the

198

processes and components of the transcriptional complex and how they are

involved in KLK4 regulation.

7.8. SUMMARY

Overall, this thesis has identified an essential component of the transcriptional

machinery for the KLK4 gene. These results suggest a role for the functional

coordination between the PR and a KLK4 progesterone-responsive region in T47D cells,

and thus, provide a model system to further study these events in vivo. As progesterone

plays an important role in the pathophysiology of breast cancer, through the effects of

“down-stream” genes, it will be important to understand how KLK4 may be involved in

this process. The regulation of the KLK4 gene by progesterone, potentially through

progesterone-responsive regions or the inhibition of this gene by estradiol, could provide

a target for promoter-specific therapeutics in breast malignancies.

CHAPTER 8

REFERENCES

Chapter 8

199

Adams, M. J., Reichel, M. B., King, I. A., Marsden, M. D. Greenwood, M. D., Thirlwell,

H., Arnemann, J., Buxton, R. S and Ali, R. R. (1998). Characterization of the regulatory

regions in the human desmoglein genes encoding the pemphigus foliaceous and

pemphigus vulgaris antigens. Biochemical Journal, 329: 165-174.

Ali, S and Coombes, R. C. (2002). Endocrine-responsive breast cancer and strategies for

combating resistance. Nature Reviews Cancer, 2: 101-112.

Aranda, A and Pascual, A. (2001). Nuclear hormone receptors and gene expression.

Physiological Reviews, 81: 1269-1304.

Arkhipova, I. R. (1995). Promoter elements in Drosophila melanogaster revealed by

sequence analysis. Genetics, 139: 1359–1369.

Arnold, J. T and Isaacs, J. T. (2002). Mechanisms involved in the progression of

androgen-independent prostate cancers: it is not only the cancer cell’s fault. Endocrine-

Related Cancer, 9: 61–73.

Ashley, P. L and MacDonald, R. J. (1985). Kallikrein-related mRNAs of the rat

submaxillary gland: nucleotide sequences of four distinct types including tonin.

Biochemistry, 24: 4512-4519.

Aumais, J. P., Lee, H. S., DeGannes, C., Horsford, J and White, J. H. (1996). Function of

directly repeated half-sites as response elements for steroid hormone receptors. The

Journal of Biological Chemistry, 271: 12568-12577.

Baker, A. R and Shine, J. (1985). Human kidney kallikrein: cDNA cloning and sequence

analysis. DNA, 4: 445-450.

200

Balbay, M. D., Juang, P., Liansa, N., Willams, S., McConkey, D., Fidler, I. J and

Pettaway, C. A. (1999, abstract). Stable transfection of human prostate cancer cell line

PC-3 with prostate-specific antigen induces apoptosis both in-vivo and in-vitro.

Proceedings of 90th Annual Meeting of the American Association for Cancer Research.

40: 225-226.

Bardon, S., Vignon, F., Chalbos, D and Rochefort, H. (1985). RU486, a progestin and

glucocorticoid antagonist inhibits the growth of breast cancer cells via the progesterone

receptor. Journal of Clinical Endocrinology and Metabolism, 60: 692-697.

Beato, M. (1996). “Hormone-dependent Cancer”, in Pasqualini, J.R and

Katzenellenbogen, B.S. (eds.), Experimental models for endometrial cancer, Marcel

Dekker, Inc, New York, USA.

Bei, R., Paranavitana, C., Milenic, D., Kashmiri, S. V and Schlom, J. (1995). Generation,

purification, and characterisation of a recombinant source of human prostate-specific

antigen. Journal of Clinical Laboratory Analysis, 9: 261-268.

Berstein, L. M., Zheng, H., Yue, W., Wang, J. P., Lykkesfeldt, A. E., Naftolin, F.,

Harada, H., Shanabrough, M and Santen, R, J. (2003). International Congress on

Hormonal Steroids and Hormones and Cancer: New approaches to the understanding of

tamoxifen action and resistance. Endocrine Related Cancer, 10: 267-277.

Bharaj, B. B., Luo, L-Y., Jung, K., Stephan, C and Diamandis, E. P. (2002).

Identification of single nucleotide polymorphisms in the human kallikrein 10 (KLK10)

gene and their association with prostate, breast, testicular and ovarian cancers. The

Prostate, 51: 35-41.

Bhoola, K. D., Figueroa, C. D and Worthy, K. (1992). Bioregulation of kinins:

kallikreins, kininogens, and kininases. Pharmacological Reviews, 44: 1-78.

201

Blackledge, G. R., Cockshott, I. D and Furr, B. J. (1997). Casodex (bicalutamide):

overview of a new antiandrogen developed for the treatment of prostate cancer. European

Urology, 31: (suppl 2) 30-39.

Blais, Jr. C., Marceau, F., Rouleau, J-L and Adam, A. (2000). The kallikrein-kininogen-

kinin system: lessons from the quantification of endogenous kinins. Peptides, 1903-

1940.

Bonnal, S., Boutonnet, C., Prado-Lourenco, L and Vagner, S. (2003). IRESdb: the

Internal Ribosome Entry Site database. Nucleic Acids Research, 31: 427-8.

Botella, L. M., Sa´nchez-Elsner, T., Rius, C., Corbı´, A and Bernabe´u, C. (2001). Identification of a critical Sp1 site within the endoglin promoter and its involvement in

the transforming growth factor-stimulation. The Journal of Biological Chemistry, 276:

34486-34494.

Brattsand, M and Egelrud, T. (1999). Purification, molecular cloning, and expression of

human stratum corneum trypsin-like serine proteas with possible function in

desquamation. The Journal of Biological Chemistry, 274: 30033-30040.

Brookes, D. E., Zandvliet, D., Watt, F., Russell, P. J and Molloy, P. L. (1998). Relative

activity and specificity of promoters from prostate-expressed genes. Prostate. 35:18-26.

Burke, T. W., Eifel, P. J and Muggia, F. M. (1997). “Cancer, Principles and Practice of

Oncology”, in Caputo, G.R. (ed.), Cancer of the uterine body, Lippincott-Raven, 5th

Edition, Philadelphia, New York, USA.

Castro-Rivera, E and Safe, S. (1998). Estrogen-and antiestrogen-responsiveness of

HEC1A endometrial adenocarcinoma cells in culture. Journal of Steroid Biochemistry

and Molecular Biology, 64: 287-295.

202

Chang, A., Yousef, G. M., Scorilas, A., Grass, L., Sismondi, P., Ponzone, R and

Diamandis, E. P. (2002). Human kallikrein gene 13 (KLK13) expression by quantitative

RT-PCR: an independent indicator of favourable prognosis in breast cancer. British

Journal of Cancer, 86: 1457-1464.

Chao, J., Chao, L., Swain, C. C., Tsai, J and Margolius, H. S. (1987). Tissue kallikrein in

rat brain and pituitary: regional distribution and estrogen induction in the anterior

pituitary. Endocrinology, 120: 475-482.

Chen, L-M., Chung, P., Chao, S., Chao, L and Chao, J. (1992). Differential regulation of

kininogen gene expression by estrogen and progesterone in vivo. Biochimica et

Biophysica Acta, 1131: 145-151.

Chen, H., Lin, R. J., Xie, W., Wilpitz, D and Evans, R. M. (1999). Regulation of

hormone-induced histone hyperacetylation and gene activation via acetylation of an

acetylase. Cell, 98: 675-686.

Christensen, M., Sunde, L., Bolund, L and Orntoft, T.F. (1999). Comparison of three

methods of microsatellite detection. Scandavian Journal of Clinical Laboratory

Investigations, 59:167-177.

Claessens, F., Alen, P., Devos, A., Peeters, B., Verhoeven, G and Rombauts, W. (1996).

The androgen-specific probasin response element 2 interacts differentially with androgen

and glucocorticoid receptors. The Journal of Biological Chemistry, 271: 19013-19016.

Clark, C. L and Sutherland, R. L. (1990). Progestin regulation of cellular proliferation.

Endocrine Reviews, 11: 266-301.

Clements, J. A., Fuller, P. J., McNally, M., Nikolaidis, I and Funder, J. W. (1986).

Estrogen regulation of kallikrein gene expression in the rat anterior pituitary.

Endocrinology, 119:268-272.

203

Clements, J. A., Matheson, B. A., MacDonald, R. J and Funder, J. W. (1989). The

expression of the kallikrein gene family in the rat pituitary: oestrogen effects and the

expression of an additional family member in the neurointermediate lobe. Journal of

Neuroendocrinology, 1:199-203.

Clements, J. A and Mukhtar, A. (1994). Glandular kallikreins and prostate-specific

antigen are expressed in the human endometrium. Journal of Clinical Endocrinology and

Metabolism, 78: 1536-1539.

Clements, J. A. (1997). The molecular biology of the kallikreins and their roles in

inflammation. The Kinin System, Academic Press Limited, USA.

Clements, J. A. (1998). Current perspectives on the molecular biology of the renal tissue

kallikrein gene and the related tissue kallikrein gene family. Biological Research, 31:

151-159.

Clements, J., Hooper, J., Dong, Y and Harvey, T. (2000). The expanded human

kallikrein (KLK) gene family: organisation, tissue-specific expression and potential

functions. Biological Chemistry, 382: 5-14.

Clemm, D. L., Sherman, L., Boonyaratanakornkit, V., Schrader, W, T., Weigel, N. L and

Edwards, D. P. (2000). Differential hormone-dependent phosphorylation of progesterone

receptor A and B forms revealed by a phosphoserine site-specific monoclonal antibody.

Molecular Endocrinology, 14: 52-65.

Cleutjens, K. B., van Eekelen, C. C., van der Korput, H. A., Brinkmann, A. O and

Trapman, J. (1996). Two androgen response regions cooperate in steroid hormone

regulated activity of the prostate-specific antigen promoter. The Journal of Biological

Chemistry, 271: 6379-6388.

204

Cleutjens, K. B., van der Korput, H. A., van Eekelen, C. C., van Rooij, H. C., Faber, P. W

and Trapman, J. (1997). An androgen response element in a far upstream enhancer region

is essential for high, androgen-regulated activity of the prostate-specific antigen

promoter. Molecular Endocrinology, 11: 148-161.

Corthorn, J., Figueroa, C and Valdes, G. (1997). Estrogen and luminal stimulation of rat

uterine kallikrein. Biological Reproduction. 56: 1432-1438.

Crawford, D. L., Segal, J. A and Barnett, J. L. (1999). Evolutionary analysis of TATA-

less proximal promoter function. Molecular Biology of Evolution, 16: 194-207.

Crivellari, D., Spazzapan, S., Lombardi, D., Berretta, M., Magri, M. D., Sorio, R.,

Scalone, S and Veronesi, A. (2003). Treatment of older breast cancer patients with high

recurrence risk. Critical Reviews in Oncology and Hematology, 46: 241-246.

Day, D. A and Tuite, M. F. (1998). Post-transcriptional gene regulatory mechanisms in

eukaryotes: an overview. Journal of Endocrinology, 157: 361-371.

Day, C. H., Fanger, G. R., Retter, M. W., Hylander, B. L., Penetrante, R. B., Houghton,

R. L., Zhang, X., McNeill, P. D., Filho, A. M., Nolasco, M., Badaro, R., Cheever, M. A.,

Reed, S. G., Dillon, D. C and Watanabe, Y. (2002). Characterization of KLK4

expression and detection of KLK4-specific antibody in prostate cancer patient sera.

Oncogene, 21: 7114-20.

Deperthes D, Marceay F, Frenette G, Lazure C, Tremblay RR and Dube J. (1997).

Human kallikrein hK2 has low kininogenase activity while prostate-specific antigen

(hK3) has none. Biochmica et Biophyica Acta. 1343: 102-106.

Desrivieres, S., Lu, H., Peyri, N., Soria, C., Lagrand, Y and Menashi, S. (1993).

Activation of the 92 kDa type IV collagenase by tissue kallikrein. Journal of Cellular

Physiology, 157: 587-593.

205

Diamandis, E. P., Yousef, G. M., Luo, L-Y., Magklara, A and Obiezu, C.V. (2000a). The

new human kallikrein gene family: implications in carcinogenesis. Trends in

Endocrinology and Metabolism, 11: 54-60.

Diamandis, E. P., Yousef, G. M., Clements, J. A., Ashworth, L., Yoshida, S., Egelrud, T.,

Nelson, P. S., Shiosaka, S., Little, S., Lilja, H., Stenman, U-H., Rittenhous, H. G and

Wain, H. (2000b). New nomenclature for the kallikrein gene family. Clinical Chemistry,

46: 1855-1858.

DiRenzo, J., Shang, Y., Phelan, M., Sif, S., Myers, M., Kingston, R and Brown, M.

(2000). BRG-1 is recruited to estrogen-responsive promoters and cooperates with factors

involved in histone acetylation. Molecular and Cellular Biology, 20: 7541-7549.

Dlamini, Z., Raidoo, D and Bhoola, K. (1999). Visualisation of the tissue kallikrein and

kinin receptors in oesophageal carcinoma. Immunopharmacology, 43: 303-310.

Dong, Y., Kaushal, A., Bui, L., Chu, S., Fuller, P.J., Nicklin, J., Samaratunga, H and

Clements, J.A. (2001). Human kallikrein 4 (KLK4) is highly expressed in serous ovarian

carcinomas. Clinical Cancer Research, 7: 2363-2371.

Dube, J. Y and Tremblay, R. R. (1997). Biochemistry and potential roles of prostatic

kallikrein hK2. Molecular Urology, 1: 279-285.

Edwards, G. K., Leonhardt, S. A., Nordeen, S. K and Edwards, D. P. (1998). The

antagonists RU486 and ZK98299 stimulate progesterone receptor binding to

deoxyribonucleic acid in vitro and in vivo, but have distinct effects on receptor

conformation. Endocrinology, 139: 1905-1919.

Ekholm, E., Brattsand, M and Egelrud, T. (2000). Stratum corneum tryptic enzyme in

normal epidermis: a missing link in the desquamation process. Journal of Investigative

Dermatology, 114: 56-63.

206

El Etreby, M. F and Liang, Y. (1998). Effect of antiprogestins and tamoxifen on growth

inhibition of MCF-7 human breast cancer cells in nude mice. Breast Cancer Research

and Treatment, 49: 109-117.

Esquenet, M., Swinnen, J.V., Heyns, W and Verhoeven, G. (1997). LNCaP prostatic

adenocarcinoma cells derived from low and high passage numbers display divergent

responses not only to androgens but also to retinoids. Journal of Steroid Biochemistry

and Molecular Biology, 62: 391-399.

Evans, B. A., Drinkwater, C. C and Richards, R. I. (1987). Mouse glandular kallikrein

genes. Structure and partial sequence analysis of the kallikrein gene locus. Journal of

Biological Chemistry. 262: 8027-8034.

Evans, R.M. (1988). The steroid and thyroid hormone receptor superfamily. Science,

240: 889-894.

Foussias, G., Yousef, G. M and Diamandis, E. P. (2000). Identification and molecular

characterization of a novel member of the siglec family (SIGLEC9). Genomics, 67: 171-

178.

Franco, O. E., Onishi, T., Yamakawa, K., Arima, K., Yanagawa, M., Sugimura, Y and

Kawamura, J. (2003). Mitogen-activated protein kinase pathway is involved in

androgen-independent PSA expression in LNCaP cells. The Prostate, 56: 319-325.

Frenette, G., Tremblay, R. R., Lazure, C and Dube, J. Y. (1997). Prostatic kallikrein

hK2, but not prostate-specific antigen (hK3), activates single-chain urokinase

plasminogen activator. International Journal of Cancer, 71: 897-899.

Frith, M. C., Li, M, C and Weng, Z. (2003). Cluster-Buster: Finding dense clusters of

motifs in DNA sequences. Nucleic Acids Research, 31: 3666-3668.

207

Fukushima, D., Kitamura, N and Nakanishi, S. (1985). Nucleotide sequence of cloned

cDNA for human pancreatic kallikrein. Biochemistry, 24: 8037-8043.

Fuller, P. J., Matheson, B. A., MacDonald, R. J., Verity, K and Clements, J. A. (1988).

Kallikrein gene expression in estrogen-induced pituitary tumors. Molecular and Cellular

Endocrinology, 60: 225-232

Furr, B. J. A. (1996). The development of Casodex (biclutamide): preclinical studies.

European Urology, 29: (Suppl 2) 83-95.

Gan, L., Lee, I., Smith, R., Argonza-Barrett, R., Lei, H., McCuaig, J., Moss, P., Paeper, B

and Wang, K. (2000). Sequencing and expression analysis of the serine protease gene

cluster located in chromosome 19q13 region. Gene, 257: 119-130.

Garner, M.M and Revzin, A. (1981). A gel electrophoresis method for quantifying the

binding of proteins to specific DNA regions: application to components of the

Escherichia coli lactose operon regulatory system. Nucleic Acid Research, 9: 3047-3060.

Giangrande, P., Pollio, G and McDonnell, D.P. (1997). Functional and pharmacological

analysis of the A and B forms of the human progesterone receptor. Ernst Schering

Research Foundation Workshop, 24: 179-201.

Goyal, J., Smith, K. M., Cowan, J. M., Wazer, D. E., Lee, S. W and Band, V. (1998). The

role for NES1 serine protease as a novel tumor suppressor. Cancer Research, 58: 4782-

4786.

Grad, J. M., Dai, J. L., Wu, S and Burnstein, K. L. (1999). Multiple androgen response

elements and a Myc consensus site in the androgen receptor (AR) coding region are

involved in androgen-mediated up-regulation of AR messenger RNA. Molecular

Endocrinology, 13: 1896-1911.

208

Graham, J. D., Roman, S. D., McGowan, E., Sutherland, R. L and Clarke, C. L. (1995).

Preferential stimulation of human progesterone receptor B expression by estrogen in T-

47D human breast cancer cells. The Journal of Biological Chemistry, 270: 30693-30700.

Graham, J. D and Clarke, C. L. (1997). Physiological action of progesterone in target

tissues. Endocrinology Reviews, 18: 502-519.

Green, S and Furr, B. (1999). Prospects for the treatment of endocrine-responsive

tumours. Endocrine-Related Cancer, 6: 349-371.

Grenman, S. E., Roberts, J. A., England, B. G., Gronroos, M and Carey, T. E. (1988). In

vitro growth regulation of endometrial carcinoma cells by tamoxifen and

medroxyprogesterone acetate. Gynecological Oncology, 30: 239-250

Haelens, A., Verrijdt, G., Callewaert, L., Christiaens, V., Schauwaers, K., Peeters, B.,

Rombauts, W and Classens, F. (2002). DNA recognition by the androgen receptor:

evidence for an alternative DNA-dependent dimerisation, and an active role of sequences

flanking the response element on transactivation. Biochemical Journal, 369: 141-151.

Hanekamp, E. E., Kuhne, E. C. M., Smid-Koopman, E., de Ruiter, P. E., Chadha-Ajwani,

S., Brinkman, A. O., Burger, C. W., Grootegoed, J. A., Huikeshoven, F. J. M and Blok,

L. J. (2002). Loss of progesterone receptor may lead to an invasive phenotype in human

endometrial cancer. European Journal of Cancer, 38: (suppl 6) s71-s72.

Harvey, T. J., Hooper, J. D., Myers, S. A., Stephenson, S. A., Ashworth, L. K and

Clements, J. A. (2000). Tissue-specific expression patterns and fine mapping of the

human kallikrein (KLK) locus on proximal 19q13.4. The Journal of Biological

Chemistry, 275: 37397-37406.

209

Harrington, K. J., Linardakis, E and Vile, R. G. (2000). Transcriptional control: an

essential component of cancer gene therapy strategies? Advanced Drug Delivery Reviews,

44: 167-184.

Hecquet, C., Tan, F., Marcic, B. M and Erdos E. G. (2000). Human bradykinin B(2)

receptor is activated by kallikrein and other serine proteases. Molecular Pharmacology.

58: 828-836.

Henderson, B. E and Feigelson, H. S. (2000). Hormonal Carcinogensis. Carcinogenesis,

21: 427-433.

Henttu, P., Liao, S. S and Vihko, P. (1992). Androgens up-regulate the human prostate-

specific antigen messenger ribonucleic acid (mRNA) but down-regulate the prostatic acid

phosphatase mRNA in the LNCaP cell line. Endocrinology, 130: 766-772.

Hesley, J., Daijo, J and Ferguson, A.T. (2002). Stable, sensitive, fluorescence-based

method for detecting cAMP. Biotechniques, 33:691-694.

Hirano, F., Tanaka, H., Hirano, Y., Hiramoto, M., Handa, H., Makino, I., and Scheidereit,

C. (1998). Functional interference of Sp1 and NF-kappaB through the same DNA binding

site. Molecular and Cellular Biology, 18: 1266–1274

Hsieh, M. L., Charlesworth, M. C., Goodmanson, M., Zhang, S., Seay, T., Klee, G. G.,

Tindall, D. J and Young, C. Y. (1997). Expression of human prostate-specific glandular

kallikrein protein (hK2) in the breast cancer cell line T47-D. Cancer Research, 57: 2651-

2656.

Hu, J.C-C., Zhang, C., Sun, X., Yang, Y., Xiaohang, C., Ryu, O and Simmer, J. P.

(2000). Characterisation of the mouse and human PRSS17 genes, their relationship to

other serine proteases, and the expression of PRSS17 in developing mouse incisors. Gene.

251:1-8.

210

Huang, W., Shostak, Y., Tarr, P., Sawyers, C and Carey, M. (1999). Cooperative

assembly of androgen receptor into a nucleoprotein complex that regulates the prostate-

specific antigen enhancer. The Journal of Biological Chemistry, 274: 25756-25768.

Ince, T. A and Scotto, K. W. (1995). A conserved downstream element defines a new

class of RNA polymerase II promoters. The Journal of Biological Chemistry, 270:

30249-30252.

Jang, S.I and Steinert, P.M. (2002). Loricrin expression in cultured human keratinocytes

is controlled by a complex interplay between transcription factors of the Sp1,CREB,

AP1, and AP2 families. The Journal of Biological Chemistry, 277: 42268-42279.

Jia, L., Kim, J., Shen, H., Clark, P. E., Tilley, W. D and Coetzee, G. A. (2003).

Androgen receptor activity at the prostate specific antigen locus: steroidal and non-

steroidal mechanisms. Molecular Cancer Research, 1: 358-392.

Johnson, K. D and Bresnick, E. H. (2002). Dissecting long-range transcriptional

mechanisms by chromatin immunoprecipitation. Methods, 26: 27-36.

Kang, Z., Pirskenan, A., Janne, O. A and Palvimo, J. J. (2002). Involvement of

proteasome in the dynamic assembly of the androgen receptor transcription complex. The

Journal of Biological Chemistry, 277: 48366-48371.

Kanda, N and Watanabe, S. (2003). 17Beta-estradiol inhibits MCP-1 production in

human keratinocytes. Journal of Investigative Dermatology, 120: 1058-66.

Kasper, S., Rennie, P. S., Bruchovsky, N., Sheppard, P. C., Cheng, H., Lin, L., Shiu, R.

P. C., Snoek, R and Matusik, R. J. (1994). Cooperative binding of androgen receptors to

two DNA sequences is required for androgen induction of the probasin gene. The Journal

of Biological Chemistry, 269: 31763-31769.

211

Kastner, P., Krust, A., Turcotte, B., Stropp, U., Tora, L., Gronemeyer, H and Chambon,

P. (1990). Two distinct estrogen-regulated promoters generate transcripts encoding the

two functionally different human progesterone receptor forms A and B. The EMBO

Journal, 9: 1603-1614.

Kepa, J. K., Jacobsen, B. M., Boen, E. A., Prendergast, P., Edwards, D. P., Takimoto, G

and Wierman, M. E. (1996). Direct binding of progesterone receptor to nonconsensus

DNA sequences represses rat GnRH. Molecular and Cellular Endocrinology, 117: 27-39.

Khorasanizadeh, S and Rastinejad, F. (2001). Nuclear-receptor interactions on DNA-

response elements. Trends in Biochemical Sciences, 26: 384-390.

Killian, C. S., Corral, D. A., Kawinski, E and Constantine, R. I. (1993). Mitogenic

response of osteoblast cells to prostate-specific antigen suggests an activation of latent

TGF-β and a proteolytic modulation of cell adhesion receptor. Biochemical and

Biophysical Research Communications. 192: 940-947.

Klinge, C. M., Bodenner, D, L., Desai, D., Niles, R. M and Traish, A. M. (1997a).

Binding of type II nuclear receptors and estrogen receptor to half-site estrogen response

elements in vitro. Nucleic Acid Research, 25: 1903-1912.

Klinge, C. M., Silver, B. F., Driscoll, M. D., Sathya, G., Bambara, R. A and Hilf, R.

(1997b). Chicken ovalbumin upstream promoter-transcription factor interacts with

estrogen receptor, binds to estrogen response elements and half-sites, and inhibits

estrogen-induced gene expression. The Journal of Biological Chemistry, 272: 31465-

31474.

Klinge, C. M. (2001). Estrogen receptor interaction with estrogen response elements.

Nucleic Acids Research, 29: 2905-2919.

212

Korkmaz, K. S., Korkmaz, C. G., Pretlow, T. G and Sattcioglu, F. (2001). Distinctly

different gene structure of KLK4/KLK-L1/prostase/ARM1 compared with other members

of the kallikrein family: intracellular localisation, alternative cDNA forms, and regulation

by multiple hormones. DNA and Cell Biology, 20: 435-445.

Kumar, A., Mikolajczyk, S. D., Goel, A. S., Millar, L. S and Saedi, M. S. (1997).

Expression of pro form of prostate-specific antigen by mammalian cells and its

conversion to mature, active form by human kallikrein 2. Cancer Research, 57: 3111-

3114.

Kyriakopoulou, L.G., Yousef, G.M., Scorilasc, A., Katsarosd, D., Massobriod, M.,

Fracchiolid, S and Diamandis, E.P. (2003). Prognostic value of quantitatively assessed

KLK7 expression in ovarian cancer. Clinical Biochemistry, 36: 135–143.

Lange, C. A., Shen, T and Horwitz, K. B. (2000). Phosphorylation of human

progesterone receptors at serine-294 by mitogen activated protein kinase signals their

degradation by the 26s proteasome. Proceedings of the National Academy of Science,

USA, 97: 1032-1037.

Liao, D. J and Dickson, R. B. (2002). Role of androgens in the development, growth, and

carcinogenesis of the mammary gland. Journal of Steroid Biochemistry and Molecular

Biology, 80: 175-189.

Lilja H. (1985). A kallikrein-like serine protease in prostatic fluid cleaves the

predominant seminal vesicle protein. Journal of Clinical Investigation. 76: 1899-1903.

Little, S. P., Dixon, E. P., Norris, F., Buckley, W., Becker, G. W., Johnson, M., Dobbins,

J. R., Wyrick, T., Miller, J. R., MacKellar, W., Hepburn, D., Corvalan, J., McClure, D.,

Liu, X., Stephenson, D., Clemens, J and Johnstone, E. M. (1997). Zyme, a novel and

potential amyloidogenic enzyme cDNA isolated from Alzheimer’s disease brain. The

Journal of Biological Chemistry. 272: 25135-25142.

213

Liu, Z., Wong, J., Tsai, S. Y., Tsai, M-J and O’Malley, B. (2001). Sequential recruitment

of steroid receptor coactivator-1 (SCR-1) and p300 enhances progesterone receptor-

dependent initiation and reinitiation of transcription from chromatin. Proceedings of the

National Academy of Sciences,USA, 98: 12426-12431.

Liu, Z., Auboeuf, D., Wong, J., Chen, J. D., Tsai, S. Y., Tsai, M-J and O’Malley, B.

(2002a). Coactivator/corepressor ratios modulate PR-mediated transcription by the

selective receptor modulator RU486. Proceedings of the National Academy of Sciences,

USA, 99: 7940-7944.

Lu, H. S., Lin, F. K., Chao, L and Chao, J. (1989). Human urinary kallikrein- complete

amino acid sequence and sites of glycosylation. International Journal of Peptide Protein

Research, 33: 237-249.

Lucus, P. C and Granner, D. K. (1992). Hormone response domains in gene transcription.

Annual Reviews in Biochemistry, 61:1131-1173.

Luke, M. C and Coffey, D. S. (1994). Human androgen receptor binding to the androgen

response element of prostate specific antigen. Journal of Andrology, 15: 41-51.

Lundstrom A and Egelrud T. (1991). Stratum corneum chymotryptic enzyme: a

proteinase which may be generally present in the stratum corneum and with the possible

involvement in desquamation. Acta Derm. Venereol. 71: 471-474.

Luo, L. Y., Grass, L and Diamandis, E. P. (2000). The normal epithelial cell-specific 1

(NES1) gene is up-regulated by steroids in the breast cancer cell line BT-474. Anticancer

Research, 20: 981-986.

MacDonald, R. J., Margolius, H. S and Erdos, E. G. (1988). Molecular biology of tissue

kallikrein. Biochemistry Journal, 253:313-321.

214

MacDonald, R. J., Southard-Smith, E. M and Kroon, E. (1996). Disparate tissue-specific

expression of the tissue kallkrein multigene family of the rat. The Journal of Biological

Chemistry, 271: 13684-13690.

Maeda, H., Wu, J., Okamoto, T., Maruo, K and Akaike, T. (1999). Kallikrein-kinin in

infection and cancer. Immunopharmacology, 43: 115-128.

Magklara, A., Brown, T. J and Diamandis, E. P. (2002). Characterization of androgen

receptor and nuclear receptor co-regulator expression in human breast cancer cell lines

exhibiting differential regulation of kallikreins 2 and 3. International Journal of Cancer,

100: 507-514.

Manni, A. (1987). Tamoxifen therapy of metastatic breast cancer. Laboratory and

Clinical Medicine, 109: 290-299.

Marceau, F., Hess, J. F and Bachvarov, D. R. (1998). The B1 receptors for kinins.

Pharmacology Reviews, 50: 357-386.

Massaad, C., Garlatti, M., Wilson, E. M., Cadepond, F and Barouki, R. (2000). A natural

sequence consisting of overlapping glucocorticoid-responsive elements mediates

glucocorticoid, but not androgen, regulation of gene expression. Biochemical Journal,

350: 123-129.

McDonnell, D. P. (1995). Unravelling the human progesterone receptor signal

transduction pathway: insights into antiprogestin action. Trends in Endocrinology and

Metabolism, 6: 133-138.

McGowan, E. M and Clarke, C. L. (1999). Effect of overexpression of progesterone

receptor A on endogenous progestin-sensitive endpoints in breast cancer cells. Molecular

Endocrinology, 13: 1657-1671.

215

Mesiano, S., Chan, E-G., Fitter, J. T., Kwek, K., Yeo, G and Smith, R. (2002).

Progesterone withdrawal and estrogen activation in human parturition are coordinated by

progesterone receptor A expression in the myometrium. The Journal of Clinical

Endocrinology and Metabolism, 87: 2924-2930.

Mignatti, P and Rifkin, D. B. (1993). Biology and biochemistry of proteinases in tumor

invasion. Physiological Reviews, 73: 161-195.

Mitchell, S. H., Murtha, P. E., Zhang, S and Young, C. Y. (2000). An androgen response

element mediates LNCaP cell dependent androgen induction of the hK2 gene. Molecular

and Cellular Endocrinology, 168: 89-99.

Monne, M., Croce, C. M., Yu, H and Diamandis, E. P. (1994). Molecular characterisation

of prostate-specific antigen messenger RNA expressed in breast tumours. Cancer

Research, 54: 6344-6347.

Moore, M. R., Zhou, J-L., Blankenship, K. A., Strobl, J. S., Edwards, D. P and Gentry, R.

N. (1997). A sequence in the 5’ flanking region confers progestin responsiveness on the

human c-myc gene. Journal of Steroid Biochemistry and Molecular Biology, 62: 243-

252.

Mullick, A and Katzenellenbogen, B. S. (1986). Progesterone receptor synthesis and

degradation in MCF-7 human breast cancer cells as studied by dense amino acid

incorporation. The Journal of Biological Chemistry, 261: 13236-13243.

Mullins, D. E and Rohrilich, S. T. (1983). The role of proteinases in cellular

invasiveness. Biochimica et Biophysica Acta. 695: 177-214.

Murray, S. R., Chao, J., Lin, F-K and Chao, L. (1990). Kallikrein multigene families and

the regulation of their expression. Journal of Cardiovascular Pharmacology, 15: S7-S16.

216

Murray, S. R., Chao, J and Chao, L. (1992). Evolution of the kallikrein gene family.

Agents Actions Suppl 38 ( Pt 1):26-33.

Murtha, P., Tindall, D. J and Young, C. Y. F. (1993). Androgen induction of a human

prostate-specific kallikrein, hKLK2: characterisation of an androgen response element in

the 5’ promoter region of the gene. Biochemistry, 32: 6459-6464.

Myers, S. A and Clements, J. A. (2001). Kallikrein 4 (KLK4), a new member of the

human kallikrein gene family is up-regulated by estrogen and progesterone in the human

endometrial cancer cell line, KLE. Journal of Clinical Endocrinology and Metabolism,

86: 2323-2326.

Nakhla, A. M., Romas, N. A and Rosner, W. (1997). Estradiol activates the prostate

androgen receptor and prostate-specific antigen secretion through the intermediacy of sex

hormone-binding globulin. The Journal of Biological Chemistry, 272: 6838-6841.

Navarro, D., Luzardo, O. P., Fernandez, L., Chesa, N and Diaz-Chico, B. N. (2002).

Transition to androgen-independence in prostate cancer. Journal of Biochemistry and

Molecular Biology, 81: 191-201.

Nelson, P. S., Gan, L., Ferguson, C., Moss, P., Gelinas, R., Hood, L and Wang, K.

(1999a). Molecular cloning and characterization of prostase, an androgen-regulated

serine protease with prostate-restricted expression. Proceedings of the National Academy

of Sciences, USA, 96: 3114-3119.

Nelson, C. C., Hendy, S. C., Shukin, R. J., Cheng, H., Bruchovsky, N., Koop, B. F and

Rennie, P. S. (1999b). Determinants of DNA sequence specificity of the androgen,

progesterone, and glucocorticoid receptors: evidence for differential steroid receptor

response elements. Molecular Endocrinology, 13: 2090-2107.

217

Obiezu, C. V., Soosaipillai, A., Jung, K., Stephan, C., Scorilas, A., Howarth, D. H and

Diamandis, E. P. (2002). Detection of human kallikrein 4 in healthy and cancerous

prostatic tissues by immunofluorometry and immunohistochemistry. Clinical Chemistry,

48: 1232-1240.

Oehler, M. K., Rees, M. C. P and Bicknell, R. (2000). Steroids and the endometrium.

Current Medicinal Chemistry, 7: 543-560.

Oettgen, P., Finger, E., Sun, Z., Akbarali, Y., Thamrongsak, U., Boltax, J., Grall, F.,

Dube, A., Weiss, A., Brown, L., Quinn, G., Kas, K., Endress, G., Kunsch, C and

Libermann, T. A. (2000). PDEF, a novel prostate epithelium-specific Ets transcription

factor, interacts with the androgen receptor and activates prostate-specific antigen gene

expression. The Journal of Biological Chemistry, 275: 1216-1225.

Oka, T., Akisada, M., Okabe, A., Sakurai, K., Shiosaka, S and Kato, K. (2002).

Extracellular serine protease neuropsin (KLK8) modulates neurite outgrowth and

fasciculation of mouse hippocampal neurons in culture. Neuroscience Letters, 321: 141-

144.

Okabe, E., Kajihara, J-I., Usami, Y and Hirano, K. (1999). The cleavage site specificity

of human prostate specific antigen for insulin-like growth factor binding protein-3.

European Journal of Biochemistry /FEBS, 447: 87-90.

Olsson, A. Y and Lundwall, A. (2002). Organization and evolution of the glandular

kallikrein locus in Mus musculus. Biochemical and Biophysical Research

Communications, 299-305-311.

Overall, C. M and Limeback, H. (1988). Identification and characterization of enamel

proteinases isolated from developing enamel. Amelogeninolytic serine proteinases are

associated with enamel maturation in pig. Biochemistry Journal, 256: 965-972.

218

Pang, S., Dannull, J., Kaboo, R., Xie, Y., Tso, C. L., Michel, K., deKernion, J. B and

Belldegrun, A. S. (1997). Identification of a positive regulatory element responsible for

tissue-specific expression of prostate-specific antigen. Cancer Research, 57: 495-499.

Pedersen, A. N., Mouridsenb, H. T., Tenneyc, D. Y and Brunnera, N. (2003).

Immunoassays of urokinase (uPA) and its type-1 inhibitor (PAI-1) in detergent extracts

of breast cancer tissue. European Journal of Cancer, 39: 899–908.

Perez-Stable, C. M., de las Pozas, A and Roos, B. A. (2000). A role for GATA

transcription factors in the androgen regulation of the prostate-specific antigen gene

enhancer. Molecular and Cellular Endocrinology, 167: 43-53.

Perillo, B., Sasso, A., Abbondanza, C and Palumbo, G. (2000). 17β-estradiol inhibits

apoptosis in MCF-7 cells, including bcl-2 expression via two estrogen-responsive

elements present in the coding sequence. Molecular and Cellular Biology, 20: 2890-

2901.

Pesole, G., Mignone, F., Gissi, C., Grillo, G., Licciulli, F and Liuni, S. (2001). Structural

and functional features of eukaryotic mRNA untranslated regions. Gene, 276: 73-81.

Petz, L. N and Nardulli, A. M. (2000). Sp1 binding sites and an estrogen responsive

element half-site are involved in regulation of the human progesterone receptor A

promoter. Molecular Endocrinology, 14: 972-985.

Planas-Silva, M. D and Weinberg, R. A. (1997). Estrogen-dependent cyclin E-cdk2

activation through p21 redistribution. American Society for Microbiology, 17: 4095-

4069.

Poulin, R., Baker, D., Poirier, D and Labrie, F. (1991). Multiple actions of synthetic

progestins on the growth of ZR-75-1 human breast cancer cells: an in vitro model for the

219

stimultaneous assay of androgen, progestin, estrogen, and glucocorticoid agonistic and

antagonistic activities of steroids. Breast Cancer Research and Treatment, 17: 197-210.

Powers, C. A. (1986). Anterior pituitary glandular kallikrein: trypsin activation and

estrogen regulation. Molecular and Cellular Endocrinology, 46: 163-174.

Powers, C. A and Hatala, M. A. (1990). Prolactin proteolysis by glandular kallikrein: in

vitro reaction requirements and cleavage sites and detection of processed prolactin in

vivo. Endocrinology, 127: 1916-1927.

Prestridge, D. S. (1991). SIGNAL SCAN: a computer program that scans DNA

sequences for eukaryotic transcriptional elements. Computer Applications in the

Biosciences,CABIOS, 7: 203-206.

Quandt, K., Frech, K., Karas, H., Wingender, E and Werner, T. (1995). MatInd and

MatInspector: new fast and versatile tools for detection of consensus matches in

nucleotide sequence data. Nucleic Acids Research, 11: 4878-4884.

Rae, F., Bulmer, B., Nicol, D and Clements, J. (1999). The human tissue kallikreins

(KLKs1-3) and a novel KLK1 mRNA transcript are expressed in a renal cell carcinoma

cDNA library. Immunopharmacology, 45: 83-88.

Rehault, S., Monget, P., Mazerbourg, S., Tremblay, R., Gutman, N., Gauthier, F and

Moreau, T. (2001). Insulin-like growth factor binding proteins (IGFBPs) as potential

physiological substrates for human kallikreins hK2 and hK3. European Journal of

Biochemistry, 268: 2960-2968.

Rehbock, J., Buchinger, P., Hermann, A and Figueroa, C. (1995). Identification of

immunoreactive tissue kallikrein in human breast carcinomas. Journal of Cancer

Research and Oncology, 121: 64-68.

220

Richardson, G. S., Dickersin, G. R., Atkins, L., MacLaughlin, D. T., Raam, S., Merk, L.

P and Bradley, F. M. (1984). KLE: A cell line with a defective estrogen receptor derived

from undifferentiated endometrial cancer. Gynecological Oncology, 17: 213-230.

Riegman, P. H., Vlietstra, R. J., van der Korput, H. A., Romijn, J. C and Trapman, J.

(1991). Identification and androgen-regulated expression of two major human glandular

kallikrein-1(hGK-1) mRNA species. Molecular and Cellular Endocrinology, 76: 181-

190.

Riegman, P. H. J., Vlietstra, R. J., Suurmeijer, L., Cleutjens, C. B. J. M and Trapman, J.

(1992). Characterisation of the human kallikrein locus. Genomics, 14: 6-11.

Rittenhouse, H. G., Finlay, J. A., Mikolajczyk, S. D and Partin, A. W. (1998). Human

kallikrein 2 (hK2) and prostate-specific antigen (PSA): two closely related, but distinct,

kallikreins in the prostate. Critical Reviews in Clinical Laboratory Sciences, 35: 275-

368.

Rodriguez, R., Weigel, N. L., O'Malley, B. W and Schrader, W. T. (1990). Dimerization

of the chicken progesterone receptor in vitro can occur in the absence of hormone and

DNA. Molecular Endocrinology, 12: 1782-1790.

Ross, S., Tienhaara, A., Lee, M-S., Tsai, L-H and Gill, G. (2002). GC Box-binding transcription factors control the neuronal specific transcription of the cyclin-dependent

kinase 5 regulator p35. The Journal of Biological Chemistry, 277: 4455-4464.

Rowan, B. G., Garrison, N., Weigel, N. L and O’Malley, B. W. (2000). 8-Bromo-cyclic

AMP induces phosphorylation of two sites in SRC-1 that facilitate ligand-independent

activation of the chicken progesterone receptor and are critical for functional cooperation

between SRC-1 and CREB binding protein. Molecular and Cellular Biology, 20: 8720-

8730.

221

Sadar, M. D. (1999). Androgen-independent induction of prostate-specific antigen gene

expression via cross-talk between the androgen receptor and protein kinase A signal

transduction pathway. The Journal of Biological Chemistry, 274: 7777-7783.

Saluja, D., Vassallo, M. F and Tanese, N. (1998). Distinct subdomains of human

TAFII130 are required for interactions with glutamine-rich transcriptional activators.

Molecular and Cellular Biology, 18: 5734-5743.

Sambrook, J and Russell, D. W. (2001). Molecular Cloning: A Laboratory Manual. Cold

Spring Harbour Laboratory Press, New York, USA.

Sato, N., Sadar, M. D., Bruchovsky, N., Saatcioglu, F., Rennie, P. S., Sato, S., Lange, P.

H and Gleave, M. E. (1997). Androgenic induction of prostate-specific antigen gene is

repressed by protein-protein interaction between the androgen receptor and AP-1/c-Jun in

the human prostate cancer cell line LNCaP. The Journal of Biological Chemistry. 272:

17485-17494.

Scarisbrick, I. A., Blaber, S. I., Lucchinetti, C. F., Genain, C. P., Blaber, M., Rodriguez,

M. (2002). Activity of a newly identified serine protease in CNS demyelination. Brain

125: 1283-1296.

Scheller, A., Hughes, E., Golden, K. L and Robins, D. M. (1998). Multiple receptor

domains interact to permit, or restrict, androgen-specific gene activation. The Journal of

Biological Chemistry, 273: 24216-24222.

Schellhammer, P. F., Sharifi, R., Block, N. L., Soloway, M. S., Venner, P. M., Patterson,

A. L., Sarosdy, M. F., Vogelzang, N. J., Schellenger, J. J and Kolvenbag, G. L. (1997).

Clinical benefits of biclutamide compared with flutamide in combined androgen blockade

for patients with advanced prostatic carcinoma: final report of a double-blind,

randomised, multicenter trial. Casodex combination study group. Urology, 50: 330-336.

222

Schneider, C. C., Gibb, R. K., Taylor, D. D., Wan, T and Gerecl-Taylor, G. (1998).

Inhibition of endometrial cancer cell lines by mifepristone (RU486). Journal of the

Society for Gynecological Investigations, 5: 334-338.

Schneider, J., Polla´n, M., Tejerina1, A., Sa´nchez1, J and Lucas, A. R. (2003).

Accumulation of uPA – PAI-1 complexes inside the tumour cells is associated with

axillary nodal invasion in progesterone-receptor-positive early breast cancer. British

Journal of Cancer, 88: 96 – 101.

Schuur, E. R., Henderson, G. A., Kmetec, L. A., Miller, J. D., Lamparski, H. G and

Henderson, D. R. (1996). Prostate-specific antigen expression is regulated by an

upstream enhancer. The Journal of Biological Chemistry, 271: 7043-7051.

Scorilas, A., Plebani, M., Mazza, S., Basso, D., Soosaipillai, A. R., Katsaros, N., Pagano,

F and Diamandis, E.P. (2003). Serum human glandular kallikrein (hK2) and insulin-like

growth factor1 (IGF-1) improve the discrimination between prostate cancer and benign

prostatic hyperplasia in combination with total and % free PSA. The Prostate, 54: 220-

229.

Scott, R. E. M., Wu-Peng, S., Yen, P. M., Chin, W. W and Pfaff, D. W. (1997).

Interactions of estrogen- and thyroid hormone receptors on a progesterone receptor

estrogen response element (ERE) sequence: a comparison with the vitellogenin A2

consensus ERE. Molecular Endocrinology, 11: 1581-1592.

Shang, Y., Hu, X., DiRenzo, J., Lazar, M. A and Brown, M. (2000). Cofactor dynamics

and sufficiency in estrogen receptor-regulated transcription. Cell, 103-843-852.

Shang, Y., Myers, M and Brown, M. (2002). Formation of the androgen receptor

transcription complex. Molecular Cell, 9: 601-610.

223

Shiosaka, S and Yoshida, S. (2000). Synaptic microenvironments -structural plasticity,

adhesion molecules, proteases and their inhibitors, Neuroscience Research, 37: 85-89.

Simmer, J. P., Fakae, M., Tanabe, T., Yamakoshi, Y., Uchida, T., Xue, J., Margolis, H-

C., Shimizu, M., DeHart, B. C., Hu, C-C and Bartlett, J. D. (1998). Purification,

characterization, and cloning of enamel matrix serine protease 1. Journal of Dental

Research, 77: 377-386.

Smale, S. T., and Baltimore, D. (1989). The "initiator" as a transcription control element.

Cell, 57: 103–113.

Song, Q., Chao, J and Chao, L. (1997). DNA polymorphisms in the 5’-flanking region

of the human tissue kallikrein gene. Human Genetics, 99: 727-734.

Stephan, C., Jung, K., Diamandid, E. P., Rittenhouse, H. G., Lein, M and Loening, S. A.

(2002). Prostate-specific antigen, its molecular forms, and other kallikrein markers for

detection of prostate cancer. Urology, 59: 2-8.

Stephenson, S. A., Verity, K., Ashworth, L. K and Clements, J. A. (1999). Localisation of

a new prostate-specific antigen-related serine protease gene, KLK4, is evidence for an

expanded human kallikrein gene family cluster on chromosome 19q13.3-13.4. The

Journal of Biological Chemistry. 274:23210-23214

Sun, Z., Pan, J and Balk, S. P. (1997). Androgen receptor-associated protein complex

binds upstream of the androgen-responsive elements in the promoters of human prostate-

specific antigen and kallikrein 2 genes. Nucleic Acid Research, 25: 3318-3325.

Sutherland, R. L., Watts, C. K. W., Lee, C. S. L and Musgrove, E. A. (1999). “Human

Cell Culture” in Masters, J.R.W and Palssons, B. (eds.), Breast Cancer, Kluwer

Academic Publishers, Great Britain, UK.

224

Suzuki, Y., Tsunoda, T., Sese, J., Taira, H., Mizushima-Sugano, J., Hata, H., Ota, T.,

Isogai, T., Tanaks, T., Nakamura, Y., Suyama, A., Sakaki, Y., Morishita, S., Okubo, K

and Sugano, S. (2001). Identification and characterisation of the potential promoter

regions of 1031 kinds of human genes. Genome Research, 11: 677-684.

Swift, G. H., Daghorn, J. C., Ashley, P. L., Cummings, S. W and MacDonald, R. J.

(1982). Rat pancreatic kallikrein mRNA: nucleotide sequence and amino acid sequence

of the encoded preproenzyme. Proceedings of the National Academy of Sciences, USA,

79: 7263-7267.

Takayama, T. K., Fujikawa, K and Davie, E. W. (1997). Characterisation of the

precursor of prostate-specific antigen. The Journal of Biological Chemistry. 272: 21582-

21588.

Takayama, T. K., McMullen, B. A., Nelson, P. S., Matsumura, M and Fujikawa, K.

(2001a). Characterisation of hK4 (prostase), a prostate-specific serine protease: activation

of the precursor of prostate specific antigen (pro-PSA) and single-chain urokinase-type

plasminogen activator and degradation of prostatic acid phosphatase. Biochemistry, 40:

15341-15348.

Takayama, T. K., Carter, C. A and Deng, T. (2001b). Activation of prostate-specific

antigen precursor (pro-PSA) by prostin, a novel human prostatic serine protease by

degenerate PCR. Biochemistry, 40: 1679-1687.

Terakawa, N., Harada, T., Minagawa, Y and Kigawa, J. (1996). “Hormone-dependent

Cancer” in Pasqualini, J. R and Katzenellenbogen, B. S. (eds.), Endometrial Cancer,

Marcel Dekker, Inc, New York, USA.

Tilley, W. D., Buchanan, G and Coetzee, G. A. (2003). “Androgen receptor signalling in

prostate cancer”, in Henderson, B. E., Ponder, B and Ross, R. K. (eds), Hormones, genes,

and cancer, Oxford University Press, London.

225

Trapman, J and Cleutjens, K. B. J. M. (1997). Androgen-regulated gene expression in

prostate cancer. Seminars in Cancer Biology, 8: 29-36.

Udvadia, A. J., Templeton, D. J., and Horowitz, J. M. (1995). Functional interactions

between the retinoblastoma (Rb) protein and Sp-family members: superactivation by Rb

requires amino acids necessary for growth suppression. Proceedings of the National

Academy of Science, USA, 92:3953-3957.

Van Leeuwen, B. H., Evans, B. A., Tregear, G. W and Richards, R. (1986). Mouse

glandular kallikrein genes. Identification, structure and expression of the renal kallikrein

gene. Journal of Biological Chemistry, 261: 5529-5535.

Vegeto, E., Shahbaz, M. M., Wen, D. X., Goldman, M. E., O’Malley, B. W and

McDonnell, D. P. (1993). Human progesterone receptor A form is a cell- and promoter-

specific repressor of human progesterone receptor B function. Molecular Endocrinology,

7: 1244-1255.

Verrijdt, G., Schoenmakers, E., Haelens, A., Peeters, B., Verhoeven, G., Rombauts, W

and Claessens, F. (2000). Change of specificity mutations in androgen-selective

enhancers. Evidence for a role of differential DNA binding by the androgen receptor.

The Journal of Biological Chemistry, 275: 12298-12305.

Wagner, B. L., Norris, J. D,, Knotts, T. A, Weigel, N. L and McDonnell, D. P. (1998).

The nuclear corepressors NCoR and SMRT are key regulators of both ligand- and 8-

bromo-cyclic AMP-dependent transcriptional activity of the human progesterone

receptor. Molecular and Cellular Biology, 18: 1369-1378.

Webber, M., Waghray, A and Bello, D. (1995). Prostate-specific antigen, a serine

protease, facilitates human prostate cancer cell invasion. Clinical Cancer Research. 1:

1089-1094.

226

Weigel, N. L. (1996). Steroid hormone receptors and their regulation by phosphorylation.

Biochemistry Journal, 319: 657-667.

Weis, L and Reinberg, D. (1997). Accurate positioning of RNA polymerase II on a

natural TATA-less promoter is independent of TATA-binding-protein-associated factors

and initiator-binding proteins. Molecular and Cellular Biology, 17: 2973-2984.

Wells, J and Farnham, P. J. (2002). Characterising transcription factor binding sites

using formaldehyde crosslinking and immunoprecipitation. Methods, 26: 48-56.

Wen, D. X., Xu, Y-F., Mais, D. E., Goldman, M. E and McDonnell, D. P. (1994). The A

and B isoforms of the human progesterone receptor operate through distinct signalling

pathways within target cells. Molecular and Cellular Biology, 14: 8356-8364.

Wiley, S. R., Richard, J. K and Mertz, J. E. (1992). Functional binding of the “TATA”

box binding component of transcription factor TFIID to the -30 region of TATA-less

promoters. Proceedings of the National Academy of Science, USA, 89: 5814-5818.

Wines, D. R, Brady, J. M, Southard-Smith, E. M and MacDonald, R. J. (1991).

Evolution of the rat kallikrein gene family: Gene conservation leads to functional

diversity. Journal of Molecular Evolution, 32: 476-492.

Wolf, W. C., Evans, D. M., Chao, L and Chao, J. (2001). A synthetic tissue kallikrein

inhibitor suppresses cancer cell invasiveness. American Journal of Pathology, 159:

1797-1805.

Woodley, C. M., Chao, J., Margolius, H. S and Chao, L. (1985). Specific identification

of tissue kallikrein in exocrine tissues and in cell-free translation products with

monoclonal antibodies. Biochemistry Journal, 231: 721-728.

227

Xiong, W., Wang, J., Chao, L and Chao, J. (1997). Tissue-specific expression and

promoter analysis of the human tissue kallikrein gene in transgenic mice. Biochemistry

Journal, 325: 111-116.

Yamanaka, H., He, X., Matsumoto, K., Shiosaka, S and Yoshida, S. (1999). Protease

M/neurosin mRNA is expressed in mature oligodendrocytes. Brain Research and

Molecular Brain Research, 71: 217–224.

Yeung, F., Li, X., Ellett, J., Trapman, J., Kao, C and Chung, L. W. (2000). Regions of

prostate-specific antigen (PSA) promoter confer androgen-independent expression of

PSA in prostate cancer cells. The Journal of Biological Chemistry, 275: 40846-40855.

Yoshida, S., Taniguchi, M., Hirata, A and Shiosaka, S. (1998). Sequence analysis and

expression of human neuropsin cDNA and gene. Gene. 213:9-16.

Young, C. Y., Montgomery, B. T., Andrews, P. E., Qui, S. D., Bilhartz, D. C and Tindall,

D. J. (1991). Hormonal regulation of prostate-specific antigen messenger RNA in human

prostatic adenocarcinoma cell line LNCaP. Cancer Research, 51: 3748-3752.

Young, C. Y. F., Andrews, P. E., Montgomery, B. T and Tindall, D. J. (1992). Tissue

specific and hormonal regulation of human prostate-specific glandular kallikrein.

Biochemistry, 31: 818-824.

Yousef, G. M and Diamandis, E. P. (1999). The new kallikrein-like gene, KLK-L2.

Molecular characterisation, mapping, tissue expression, and hormonal regulation. The

Journal of Biological Chemistry, 274: 37511-37516.

Yousef, G. M., Luo, L-Y and Diamandis, E. P. (1999a). Identification of novel human

kallikrein-like genes on chromosome 19q13.3-q13.4. Anticancer Research. 19:2843-

2852.

228

Yousef, G. M., Obiezu, C.V., Luo, L.Y., Black, M. H and Diamandis, E. P. (1999b).

Prostase/KLK-L1 is a new member of the human kallikrein gene family, is expressed in

prostate and breast tissues, and is hormonally regulated. Cancer Research. 59:4252-4256.

Yousef, G. M., Luo, L. Y., Scherer, S. W., Sotiropoulou, G and Diamandis, E. P. (1999c).

Molecular characterization of zyme/proteaseM/neurosin (PRSS9), a hormonally regulated

kallikrein-like serine protease. Genomics. 62:251-259.

Yousef, G. M., Chang, A., Scorilas, A and Diamandis, E. P. (2000a). Genomic

organisation of the human kallikrein gene family on chromosome 19q13.3-q13.4.

Biochemical and Biophysical Research Communications. 276: 125-133.

Yousef, G. M., Scorilas, A., Magklara, A., Soosaipillai, A and Diamandis, E. P. (2000b).

The KLK7 (PRSS6) gene, encoding for the stratum corneum chymotryptic enzyme is a

new member of the human kallikrein gene family- genomic characterization, mapping,

tissue expression and hormonal regulation. Gene, 254: 119-128.

Yousef, G. M., Scorilas, A and Diamandis, E. P. (2000c). Genomic organization,

mapping, tissue expression, and hormonal regulation of tyrpsin-like serine protease

(TLSP PRSS20), a new member of the human kallikrein gene family. Genomics. 63: 88-

96.

Yousef, G. M., Magklara, A and Diamandis, E. P. (2000d). KLK12 is a novel serine

protease and a new member of the human kallikrein gene family-differential expression

in breast cancer. Genomics. 69: 331-341.

Yousef, G. M., Chang, A and Diamandis, E. P. (2000e). Identification and

characterization of KLK-L4, a new kallikrein-like gene that appears to be down-regulated

in breast cancer tissues. The Journal of Biological Chemistry. 275: 11891-11898.

229

Yousef, G. M., Scorilas, A., Jung, K., Ashworth, L. K and Diamandis, E. P. (2000f).

Molecular cloning of the human kallikrein 15 gene (KLK15): Upregulation in prostate

cancer. The Journal of Biological Chemistry. 276: 53-61.

Yousef, G. M., Diamandis, M., Jung, K and Diamandis, E. P. (2001a). Molecular cloning

of a novel human acid phosphatase gene (ACPT) that is highly expressed in the testis.

Genomics, 74: 385-395.

Yousef, G. M., Magklara, A., Chang, A., Jung, K., Katsaros, D and Diamandis, E. P.

(2001b). Cloning of a new member of the human kallikrein gene family, KLK14, which

is down-regulated in different malignancies. Cancer Research, 61: 3425-3431.

Yousef, G. M and Diamandis, E. P. (2002a). Expanded human tissue kallikrein family-a

novel panel of cancer biomarkers. Tumor Biology, 23: 185-192.

Yousef, G. M and Diamandis, E. P. (2002b). Human tissue kallikreins: a new enzymatic

cascade pathway. Biological Chemistry, 383: 1045-1057.

Yousef, G. M and Diamandis, E. P. (2003). An overview of the kallikrein gene families

in humans and other species. Clinical Biochemistry, 36: 443-452.

Yousef, G. M., Scorilas, A., Kyriakopoulou, L. G., Rendl, L., Diamandis, M., Ponzone,

R., Biglia, N., Giai, M., Roagna, R., Sismondi, P and Diamandis E. P. (2002a). Human

kallikrein gene 5 (KLK5) expression by quantitative PCR: an independent indicator of poor prognosis in breast cancer. Clinical Chemistry, 48: 1241-1250.

Yousef, G.M., Obiezu, C.V., jung, K., Stephan, C., Scorilas, A and Diamandis, E.P.

(2002b). Diferential expression of kallikrein gene 15 in cancerous and normal testicular

tissues. Urology, 60: 714-718.

230

Yousef, G. M., Scorilas, A., Magklara, A., Memari, N., Ponzone, R., Sismondi, P., Biglia,

N., Abd Ellatif, M and Diamandis, E. P. (2002c). The androgen-regulated gene human

kallikrein 15 (KLK15) is an independent and favourable prognostic marker for breast

cancer. British Journal of Cancer, 87: 1294-1300.

Yousef, G. M., Scorilas, A., Nakamura, T., Ellatif, M. A, Ponzone, R., Biglia, N.,

Maggiorotto, F., Roagna, R., Sismondi, P and Diamandis, E. P. (2003a). The prognostic

value of the human kallikrein gene 9 (KLK9) in breast cancer. Breast Cancer Research

and Treatments, 78: 149-158.

Yousef, G. M., Stephan, C., Scorilas, A., Ellatif, M. A., Jung, K., Kristiansen, G., Jung,

M., Polymeris, M. E and Diamandis, E. P. (2003b). Differential expression of the human

kallikrein gene 14 (KLK14) in normal and cancerous prostatic tissues. Prosate, 56: 287-

292.

Yu, H,, Diamandis, E. P and Sutherland, D. J. A. (1994). Immunoreactive prostate-

specific antigen levels in female and male breast tumors and its association with steroid

hormone receptors and patient care. Clinical Biochemistry, 27: 75-79.

Yu, D-C., Sakamoto, G. T and Henderson, D. R. (1999). Identification of the

transcriptional regulatory sequences of human kallikrein 2 and their use in the

construction of calydon virus 764, an attenuated replication competent adenovirus for

prostate cancer therapy. Cancer Research, 59: 1498-1504.

Zarghami, N., Grass, L and Diamandis, E.P. (1997). Steroid hormone regulation of

prostate-specific antigen gene expression in breast cancer. British Journal of Cancer, 75:

579-588.

Zhang, S., Murtha, P. E and Young, C. Y. F. (1997). Defining a functional androgen

responsive element in the 5’ far upstream flanking region of the prostate-specific antigen

gene. Biochemical and Biophysical Research Communications. 231: 784-788.

231

Zhang, X., Jeyakumar, M., Petukhov, S and Bagchi, M.K. (1998). A nuclear receptor

corepressor modulates transcriptional activity of antagonist-occupied steroid hormone

receptor. Molecular Endocrinology, 12: 513-524.

Zhou, Z., Corden, J. L and Brown, T. R. (1997). Identification and characterisation of a

novel androgen response element composed of a direct repeat. The Journal of Biological

Chemistry, 272: 8227-8235.