K Catalli et al. Nature 462 , 7 82 -785 (2009) doi:10.1038/nature08 598

1
K Catalli et al. Nature 462, 782-785 (2009) doi:10.1038/nature08598 The Pv+pPv mixed-phase region with mantle geotherms and the pPv phase-fraction profiles in the mixed-phase region.

description

The Pv+pPv mixed-phase region with mantle geotherms and the pPv phase-fraction profiles in the mixed-phase region. K Catalli et al. Nature 462 , 7 82 -785 (2009) doi:10.1038/nature08 598. - PowerPoint PPT Presentation

Transcript of K Catalli et al. Nature 462 , 7 82 -785 (2009) doi:10.1038/nature08 598

Page 1: K Catalli et al. Nature 462 , 7 82 -785 (2009) doi:10.1038/nature08 598

K Catalli et al. Nature 462, 782-785 (2009) doi:10.1038/nature08598

The Pv+pPv mixed-phase region with mantle geotherms and the pPv phase-fraction profiles in the mixed-phase region.

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Structural Transitions in Amorphous Mantle Phases Dan Shim Massachusetts Institute of Technology Thanks to: K. Catalli, T. Grove, NSF CIDER 2004.

Structural Transitions in Amorphous Mantle Phases Dan Shim Massachusetts Institute of Technology Thanks to: K. Catalli, T. Grove, NSF CIDER 2004.

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

doi:10.1038/nature06481 LETTERS

doi:10.1038/nature06481 LETTERS

DOI: 10.1038/NNANO.2015 - Nature · Oxygen-Activated Growth and Bandgap Tunability of Large Single-Crystal Bilayer ... 10.1038/NNANO.2015.322 ULEENTARY ... Dual Beam235) was then

DOI: 10.1038/NNANO.2015 - Nature · Oxygen-Activated Growth and Bandgap Tunability of Large Single-Crystal Bilayer ... 10.1038/NNANO.2015.322 ULEENTARY ... Dual Beam235) was then

Macroporous nanowire nanoelectronic scaffolds …cmliris.harvard.edu/assets/10.1038-nmat3404.pdfARTICLES PUBLISHED ONLINE: 26 AUGUST 2012 |DOI:10.1038/NMAT3404 Macroporous nanowire

Macroporous nanowire nanoelectronic scaffolds …cmliris.harvard.edu/assets/10.1038-nmat3404.pdfARTICLES PUBLISHED ONLINE: 26 AUGUST 2012 |DOI:10.1038/NMAT3404 Macroporous nanowire

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

DOI: 10.1038/NGEO2405 Moist convection in hydrogen ...

DOI: 10.1038/NGEO2405 Moist convection in hydrogen ...

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

DOI: 10.1038/ncomms1280 molecular dynamics of single ...

DOI: 10.1038/ncomms1280 molecular dynamics of single ...

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

1 March 15, 2012 Ms. Loredana Catalli Sonier1 Office of the Child and Youth Advocate March 15, 2012 Ms. Loredana Catalli Sonier Clerk Legislative Assembly Province of New Brunswick

1 March 15, 2012 Ms. Loredana Catalli Sonier1 Office of the Child and Youth Advocate March 15, 2012 Ms. Loredana Catalli Sonier Clerk Legislative Assembly Province of New Brunswick

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

GI Motility online (May 2006) | doi:10.1038/gimo31

GI Motility online (May 2006) | doi:10.1038/gimo31

GI Motility online (May 2006) | doi:10.1038/gimo12

GI Motility online (May 2006) | doi:10.1038/gimo12

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum