Julia's M.Sc. proposal corrected May 16 2013 -...

BAR-ILAN UNIVERSITY

עכבריים ה Cdxתפקוד של חלבוני -אנליזת מבנה

מזבוב הפירות Caudal-ו

Structure-function analysis of mouse

Cdx and Drosophila melanogaster

Caudal proteins

Julia Sharabany

January 2013

Table of Contents Introduction ........................................................................................................................................................ 1

The role of the core promoter in the regulation of gene expression ..................................................... 2

Hox genes ...................................................................................................................................................... 3

Caudal ............................................................................................................................................................ 3

CDX ................................................................................................................................................................ 3

The importance of research ............................................................................................................................ 4

Results ............................................................................................................................................................... 5

Construction of mouse Cdx (mCdx) expression vectors ......................................................................... 5

Transcriptional activation of the ftz gene by Drosophila melanogaster Caudal (Cad) and mouse

Cdx family proteins ....................................................................................................................................... 5

Structure-function analysis of mCdx proteins ........................................................................................... 6

Effect of the polyQ and polyPQ deletions on Cdx2 transcriptional activation ...................................... 8

Structure-function analysis of Drosophila Caudal .................................................................................... 9

Future plans .................................................................................................................................................... 10

Materials and Methods .................................................................................................................................. 12

References ...................................................................................................................................................... 14

1

Introduction

The development, growth and survival of eukaryotic organisms require the proper regulation of tens

of thousands of genes [1]. Different mechanisms underlie the proper expression of these genes:

nucleosome remodeling, histone modifications and the binding of transcriptional activators and

coactivators to enhancers and promoters [2]. However, a precise recruitment of RNA polymerase II

(Pol II) to the initiation site plays a major role in dictating gene expression.

In eukaryotes, transcription initiation requires the assembly of basal transcription factors at the

promoter region. These transcription factors recruit RNA polymerase II to the transcription start site

(TSS) and together with the promoter form the preinitiation complex [3-5]. The region from -40 to

+40 relative to the TSS is required for accurate initiation of transcription by RNA polymerase II and

is defined as the core promoter [6, 7].

In the past, it was expected that the same core promoter structure would be found in every cellular

gene. It was believed that the TATA box (the first core promoter element discovered) is a general

feature of core promoters [8]. Following the development of functional assays, it has become clear

that core promoters are highly diverse in structure and function. It appears that there are no

universal core promoter elements [7].

There are various known focused core promoter elements that might contribute to promoter activity:

TATA box, BREu (upstream TFIIB recognition element), BREd (downstream TFIIB recognition

element), Inr (initiator), MTE (motif ten element), DPE (downstream core promoter element), DCE

(downstream core element) and XCPE1 (X core promoter element 1). The major core promoter

elements are depicted in Fig. 1.

My research primarily focuses on the Inr, DPE and TATA-box motifs.

The major core promoter elements. The arrow indicates the Fig.1:

transcription start site.

2

The Inr (Initiator)

The Inr is a specific core promoter element that is located around the TSS [9]. The Inr is considered

the most commonly appearing motif in focused core promoters [10]. The Inr serves as recognition

site for subunits of the general transcription factor TFIID [11].

The TATA box

The TATA box, which is considered the most ancient core promoter motif throughout nature, was

the first eukaryotic core promoter element to be identified. It represents the binding site for the

TATA-binding protein (TBP) subunit of the TFIID complex [12]. As noted above, early studies led to

the presumption that the TATA box is a general and essential component for transcription initiation.

However, recent computational analysis revealed that TATA box are present in a fraction of RNA

polymerase II transcribed genes: about 30% of Drosophila genes [13] and 10-15% of human genes

[14].

The DPE (downstream core promoter element)

The DPE was identified as a TFIID recognition site that is downstream of the Inr, and is mainly

present in core promoters that lack a TATA box motif [15-17]. Although the DPE was originally

identified in Drosophila, it is also present in humans. The DPE is precisely located from +28 to +33

relative to the A+1 nucleotide of the Inr. Moreover, the insertion or deletion of a single nucleotide

between the Inr and DPE reduces transcriptional activity and TFIID binding [16].

The role of the core promoter in the regulation of gene expression

Transcriptional activation often involves the direct binding of transcription factors to distal regulatory

regions such as enhancers, which are typically located hundreds of base pairs (bp) away from the

TSS but can be located many kilo bp away from it [18]. During transcription initiation, enhancers are

brought into proximity with promoters by a chromatin loop. This enhancer-promoter interaction is

necessary for the recruitment of the transcription factors and coactivators to the core promoter [19].

Early studies have found that some transcriptional enhancers exhibit core promoter specificity [20].

For instance, there are enhancers with activation preference for core promoters containing either

DPE or TATA box motifs.

A typical example of core promoter specificity is Drosophila homeotic (Hox) genes [21]. It was found

that almost all of the Drosophila Hox gene promoters, which lack TATA box elements, contain

functionally important DPE motifs. This evidence led to the hypothesis for the existence of DPE-

specific activators required for Hox gene expression. Following this hypothesis, it was discovered

that Caudal, a sequence-specific DNA-binding transcription factor and key regulator of the Hox

genes, is a DPE-specific activator. In addition, Caudal activates transcription of the Antennapedia

3

and Sex combs reduced Hox genes through DPE motifs in their core promoter region [21]. These

findings indicate an important role for the DPE motif in the regulation of the Hox gene expression.

Hox genes The clustered Hox family of homeobox genes is an evolutionarily highly conserved family of genes

that encode DNA-binding transcription factors that were first identified as key regulators of positional

identity along the anterior-posterior [22] body axis of animal embryos [23]. The core of this system

consists of a set of structurally similar genes that were originally discovered in Drosophila.

Homeobox genes encode a distinctive DNA-binding domain of 60 amino acids, known as

homeodomain (HD), which characterizes a large family of transcription factors [24].

In mammals, there are 39 Hox genes that are organized into four genomic clusters (A-D) located on

four different chromosomes and, based on homeobox sequence similarity, consist of 13 paralogous

groups. Hox genes exhibit a high degree of homology to the clustered homeotic genes of

Drosophila melanogaster, which are located in two clusters: the Antennapedia (Ant-C) and bithorax

complexes (BX-C).

Caudal Caudal (cad), a paralog of the Hox genes [25], was first identified in Drosophila melanogaster. The

cad gene encodes a homeodomain transcription factor expressed in a gradient-like manner at the

posterior of the embryo [26, 27]. Specification of the posterior axis during early embryogenesis

requires tight regulation of gene expression. A number of studies have revealed that Cad is a crucial

regulator of important developmental genes: fushi tarazu (ftz), hairy (h), forkhead (fkh) and giant (g)

[28-31], which in turn regulate the homeotic genes. The core promoters of four of these Caudal

target genes contain functional DPE motifs [21]. These findings indicated that Cad might be a DPE-

specific activator.

CDX In my research I will focus on vertebrate Cdx proteins. Cdx genes encode homeodomain

transcription factors related to the Drosophila caudal gene. In vertebrates, Cdx proteins appear to

be involved in specification of the posterior part of the embryo and pattering the anterior-posterior

axis in a manner analogous to Cad function in Drosophila [32-34]. Vertebrate Cdx proteins appear

to act upstream of Hox genes [35-37]. There are three members of Cdx gene family: Cdx1, Cdx2

and Cdx4, which are expressed at different time point during embryogenesis [33,38,39]

As noted above, Cdx transcription factors regulate anterior-posterior vertebral pattering. Studies

have demonstrated that mutations in Cdx genes can be lethal or cause posterior body truncations

4

[39-41]. In addition, over the past several years it has become evident that Cdx family members are

critical for ordered proliferation and differentiation of embryonic hematopoietic cells [42].

The importance of research

Cdx family members, Cdx1, Cdx2 and Cdx4, are critical regulators of antero-posterior pattering in a

variety of vertebrate and invertebrate embryos. Furthermore, Cdx2 and Cdx4 have also been

implicated in pathological conditions such as colon cancer and acute myeloid leukemia. Hence,

understanding the mechanism governing the function of Cdx proteins is of considerable importance.

Research aims

1. Identification and characterization of core promoter elements required for Cdx transcriptional

activation.

2. Structure-function analysis of mouse Cdx2.

3. Structure-function analysis of Drosophila Caudal

5

Results

Construction of mouse Cdx (mCdx) expression vectors mCdx1 and mCdx2 were kindly provided by Prof. David Lohnes (University of Ottawa). The DNA

sequence was verified and coding sequences of both mCdx1 and mCdx2 were subcloned into the

pAc expression vector for expression in Drosophila cells. For construction of mCdx4 expression

plasmid, I have employed nested PCR analyses using cDNA that was extracted from mouse

embryo (E7.5).

Transcriptional activation of the ftz gene by Drosophila melanogaster Caudal (Cad) and mouse Cdx family proteins To examine and characterize transcriptional activation by the vertebrate Caudal homologues I have

analyzed the activation of the fushi tarazu (ftz) gene, which naturally contains Inr, TATA box and

DPE core promoter elements and has been shown be regulated by Drosophila Caudal in a core

promoter preferential manner [21]. I employed two types of ftz firefly luciferase reporter genes: a

firefly luciferase reporter gene is either driven by a ftz promoter containing a mutation in TATA box

(ftz mTATA) or a ftz promoter containing a mutation in the DPE motif (ftz mDPE). Cad and Cdx

expression vectors were co-transfected with either ftz mDPE or ftz mTATA firefly luciferase reporter

vectors, as well as with a PolII-Renilla luciferase reporter vector (to normalize for transfection

efficiency) into Drosophila melanogaster Schneider (S2R+) cells. Cell extracts were assayed for

dual luciferase activities.

Fig.2: Transcriptional activation by full length FLAG-‐Caudal and Cdx family proteins. Drosophila S2R+ cells

were transfected with ftz reporter plasmids (containing either DPE or TATA motif) as well as a Drosophila

Caudal, mCdx1, mCdx2 and mCdx4 expression plasmids. To normalize for transfection efficiency, cells were

co-‐transfected with PolIII-‐Renilla luciferase plasmid and assayed for dual luciferase activity. Error bars

represent the SEM.

6

Co-transfection of a mCdx2 expression vector was found to induce a 30-fold increase in ftz mTATA

reporter activity (which is DPE-dependent) as compared to cells transfected with an empty vector

control (Fig.2). Co-transfection of a mCdx1 expression plasmid elicited a more modest response, as

compared to that of mCdx2, while mCdx4 demonstrated no preference for activation of the ftz

promoter in a core promoter motif-specific manner. Hence, Drosophila Caudal and mouse Cdx2

proteins activate the ftz promoter with a similar preference for the DPE motif.

The analysis of core promoter-specific activation by Cdx proteins is likely to contribute to the

structure-function analysis that I am performing on Drosophila Caudal (i.e. if a certain Cdx

demonstrates core promoter specificity, based on its homology to Drosophila Caudal, we might be

able to predict the domain/s that confer this specificity, see below).

Structure-function analysis of mCdx proteins To assess whether the strong activation of ftz mTATA promoter by mCdx2, as compared to the

other Cdx family members, could be explained by the protein’s composition, I have analyzed the

mCdx2 protein. Surprisingly, examination of the primary protein sequence of mCdx2, revealed a

polyglutamine (polyQ) stretch in the C-terminal part of the protein (Fig.3, aa 247-257). Compared to

mCdx2, mCdx1 has a relatively small stretch of consecutive Qs, while mCdx4 does not contain a

polyQ tract at all. In addition, I detected a polyproline (polyP) region in the mCdx2 protein, which is

C-terminally located relative to the polyQ stretch.

PolyQ stretches are often associated with neurodegenerative diseases such as Huntington's

disease [43]. However, polyQ tracts are normal features of many proteins. Experimental evidence

suggests a role for polyQ tracts in the activation of gene transcription. For instance, it was found

that the glutamine-rich activation domains of Sp1 transcription factor can stimulate transcription by

binding selectively and directly to the TATA box-binding protein (TBP) [44]. Moreover, polyP

stretches located C-terminally to polyQ stretches have been shown to stabilize adjacent polyQ tract

structures [45].

7

Fig.3: Predicted protein structures of mCdx protein family according to the XtalPred site. The mCdx1 and the mCdx2

polyglutamine (polyQ) regions are marked by green rectangles. The polyproline (polyP) stretch of mCdx2 is marked by

orange rectangle. mCdx4 does not contain either polyQ or polyP regions. Protein structure was predicted using

http://ffas.burnham.org/XtalPred-‐cgi/xtal.pl.

8

Effect of the polyQ and polyPQ deletions on Cdx2 transcriptional activation To assess the importance of the polyQ and polyP stretches in the Cdx2 protein activity, I decided to

delete these sequences by site-directed mutagenesis. The polyQ stretch (aa247-257) was deleted

independently as well as together with the polyP stretch (aa247-270). The wild type and the

mutated Cdx2 expression constructs were co-transfected into S2R+ cells with either ftz mDPE or ftz

mTATA reporters.

Deletion of the polyQ region resulted in decreased levels of transcription (Fig.4).Moreover, ftz

reporter construct containing a functional DPE motif showed significantly decreased promoter

transcription as compared to reporters containing TATA core promoter element, suggesting the

important role of the polyQ region of Cdx2 in DPE-dependent transcriptional activation.

Unexpectedly, compared to deletion of the polyQ stretch, deletion of the polyPQ stretch just slightly

reduced transcriptional activation (Fig.4B). Since both polyQ and polyP regions are involved in

protein-protein interactions I expected a low level of activation. It is of note that Fig.4B depicts the

results of a single experiment, which will soon be repeated to validate these results.

Fig.4: Transcriptional activation by wild type and mutant Cdx2 protein. Drosophila S2R+ cells were transfected with ftz

reporter plasmids (containing either DPE or TATA motif) as well as a Drosophila Caudal, mCdx2, mCdx2-‐ΔpolyQ and mCdx2-‐

ΔpolyPQ expression plasmids. To normalize for transfection efficiency, cells were co-‐transfected with PolIII-‐Renilla luciferase

plasmid and assayed for dual luciferase activity. A) Error bars represent the SEM. N=3. B) N=1

9

Structure-function analysis of Drosophila Caudal Another aspect of my research addresses the structure-function analysis of the Drosophila Caudal

protein. My approach was based on the thesis of Matan Filderman from our lab. The aim of Matan's

work was to identify regions in the Caudal protein that are essential for preferential activation of

DPE transcription. In order to understand the role of different domains of Caudal, he generated 6

deletion mutants. He found out that two of these deletions, aa399-420 and aa363-427, significantly

decreased DPE dependent activation by Caudal. Hence, these regions are necessary for DPE-

preferential activation. To examine whether these regions are sufficient for the preferential

transcriptional activation, I performed Gal4-based luciferase assays. To this end, I used the pAc-

Gal4Cad363-427 and pAc-Gal4Cad270-427 constructs, in which aa363-427 and aa270-427

fragments respectively, were fused to the Gal4 DNA-binding domain (DBD). pAc-Gal4VP16 was

used as a positive control. As a negative control I used the GAL4-DBD followed by a stop codon.

These constructs were co-transfected into S2R+ cells with a ftz reporter construct (either ftz mTATA

or ftz mDPE) containing Gal4-binding sites upstream of the firefly luciferase gene.

As can be seen in Fig.5 transcriptional activation by Gal4-VP16 is too high compare to other

constructs. I intend to examine the GAL4-full Caudal next, as a positive control. As expected,

Caudal did not activate the reporter, as there are no Caudal binding sites in the luciferase reporters

(in these experiments the untagged Caudal was employed. We have previously compared the

Fig.5: Activation of transcription by aa363-‐427 and aa270-‐427 of Drosophila Caudal fused in frame downstream

of the Gal4-‐DBD. Drosophila S2R+ cells were transfected with the indicated Gal4 fusion and reporter plasmids and

assayed for luciferase activity. Error bar represent the SEM.

10

activity of the untagged Caudal to FLAG-tagged Caudal and observed no differences). The GAL4-

Cad aa363-427 did not activate the GAL4 reporters. The GAL4-Cad 270-427 activated the reporters

but without any preference for a particular core promoter motif. Hence, although these C-terminal

regions of Caudal were necessary for core promoter motif preferential activation, they do not seem

to be sufficient to confer this property to the GAL4 fusion proteins.

Future plans

1. To test transcriptional activation by mCdx protein family members

To further characterize transcriptional activation by mCdx proteins I will analyze the activation of

the Drosophila giant gene. giant (gt) is an important developmental gene that, similarly to the ftz

gene, naturally contains Inr, TATA box and DPE core promoter elements. I will employ two types

of gt firefly luciferase reporter genes: driven by either a gt promoter containing a mutation in the

TATA box or a gt promoter containing a mutation in the DPE motif.

2. To examine the effect of the polyQ and polyP deletions on mCdx2 transcriptional activation

To date, I have obtained preliminary results of transcriptional activation by mCdx2 lacking polyQ

and polyP stretches. In the future I will repeat these experiments to confirm the data. In addition,

I will compare transcriptional activation by mCdx2 deletion mutants to wild type mCdx1 and

mCdx4.

3. To perform Structure-function analysis of Caudal

a. To examine whether the C-terminal regions of Drosophila Caudal are sufficient for

preferential transcriptional activation, I constructed pAc-Gal4-Cad expression vector in which

the Gal4 DNA-binding domain is fused in frame to full length Caudal. This plasmid will be

used as positive control to allow for a better comparison of the results of Gal4-based

luciferase assay.

b. As noted above, Matan has observed that deletions of aa399-420 and aa363-427 of Caudal

significantly reduced transcriptional activation. Sequence analysis of these regions revealed

the presence of a short polyglutamine stretch (a total of 5 Q residues over 9 aa) in the C-

terminal part of the protein. To investigate the influence of these glutamine residues on

transcriptional activation by Caudal, I constructed a Caudal expression plasmid in which

each one of these five glutamine residues was replaced by alanine. Alanine is a small, non -

polar amino acid, which doesn't cause a major change in the protein structure. In intend to

perform transfections followed by dual luciferase assays in S2R+ cells to compare the

transcriptional activation of this mutated Caudal protein to the full Caudal and the C-

terminally truncated Caudal proteins.

11

c. To rule out the possibility that preferential activation of some Caudal deletion constructs (e.g.

the C-terminal deletions) results from instability of the proteins, I will perform western blot

analysis using anti-FLAG antibodies.

4. To test whether Caudal interacts with dCBP (nejire)

Since Caudal-binding sites are located hundred of base pairs upstream of the activated

promoters, it is of interest to find co-factors, which might contribute to the interaction between

Caudal and the promoter region. One such candidate is the nejire gene, which is the Drosophila

homolog of CBP (CREB (cyclic AMP response element binding protein) binding protein).

CBP/p300 is a coactivator that can mediate target gene activation through direct association

with specific general transcription factors [46]. Cdx 2 has been shown to interact with p300 [47].

We therefore wanted to test whether Caudal interacts with CBP. Bacterial expression plasmids

encoding different motifs of dCBP protein fused to Glutathione-S- transferase [48] were kindly

provided by Dr. Mattias Mannervik (University of Stockholm). Due to the large size of the dCBP

protein, I have purified fusion proteins of different dCBP motifs using glutathione-Sepharose

beads following the induction of the GST-fusion proteins. I intend to perform in vitro

transcription-translation of Caudal in the presence of [35S] methionine and test the ability of

Caudal to directly interact with dCBP by in vitro interaction assays.

12

Materials and Methods

RNA isolation and nested PCR

Mouse embryo E7.5 was used for RNA extraction using the Trizol reagent (Invitrogen).

Complementary DNA (cDNA) was generated using oligo dT primers. Since Cdx4 PCR amplification

was problematic, a nested PCR approach was used with the following primers: Outer primers:

forward 5' CTCAGGATGGCTTAAGGGGC 3' and reverse 5' GCCCCCATATGACAGCATGG 3';;

Inner primers: forward 5' GCGGAATTCATGTATGGAAGCTGCCTTTTAG 3' and reverse 5'

TCGCGGCCGCTCATTCAGAAACTATGACCTGCTG 3'. The identity of the nested PCR product

was confirmed by sequencing.

Site directed mutagenesis

Deletions of polyQ and polyPQ stretches in mCdx2 were introduced by site directed mutagenesis

using Stratagene’s QuickChange protocol. To confirm I generated the correct constructs, plasmids

were sequenced (Hy Labs)

Primers for site directed mutagenesis:

Delta aa247-257 (polyQ)

Primer 1:

5’aggaaaatcaagaagaagcctccacagccgccgcca3’

Primer 2 (complementary to primer 1):

5' tggcggcggctgtggaggcttcttcttgattttcct3’

Delta aa247-270 (polyPQ)

Primer 1:

5’aggaaaatcaagaagaagggtgccctgcggagcgtg 3’

Primer 2 (complementary to primer 1):

5'cacgctccgcagggcacccttcttcttgattttcct 3'

Transfections and reporter gene assays Drosophila Schneider S2R+ adherent cells were cultured in Schneider’s Drosophila Media

(Biological Industries) that was supplemented with 10% heat-inactivated FBS. Cells were

transfected in 24-well plates by using the Escort IV reagent (Sigma). For dual luciferase assays,

cells were plated at 0.6 x 106cells per each well of a 24-well plate one day prior to transfection. The

firefly luciferase reporter constructs (60 ng) were cotransfected with the Pol III-Renilla luciferase

13

reporter (10 ng). Media was replaced the next morning and cells were harvested 36-48 hrs post

transfection and assayed for dual luciferase activities, as specified by the manufacturer (Promega).

To correct for transfection efficiency, the firefly luciferase activity of each sample was normalized to

the corresponding Renilla luciferase activity. Each transfection was performed in triplicate.

14

References

1. Butler, J.E. and J.T. Kadonaga, The RNA polymerase II core promoter: a key component in

the regulation of gene expression. Genes Dev, 2002. 16(20): p. 2583-92. 2. Smale, S.T. and J.T. Kadonaga, The RNA polymerase II core promoter. Annu Rev Biochem,

2003. 72: p. 449-79. 3. Orphanides, G., T. Lagrange, and D. Reinberg, The general transcription factors of RNA

polymerase II. Genes Dev, 1996. 10(21): p. 2657-83. 4. Thomas, M.C. and C.M. Chiang, The general transcription machinery and general cofactors.

Crit Rev Biochem Mol Biol, 2006. 41(3): p. 105-78. 5. Dikstein, R., The unexpected traits associated with core promoter elements. Transcription,

2011. 2(5): p. 201-6. 6. Sandelin, A., et al., Mammalian RNA polymerase II core promoters: insights from genome-

wide studies. Nat Rev Genet, 2007. 8(6): p. 424-36. 7. Juven-Gershon, T. and J.T. Kadonaga, Regulation of gene expression via the core promoter

and the basal transcriptional machinery. Dev Biol, 2010. 339(2): p. 225-9. 8. Lifton, R.P., et al., The organization of the histone genes in Drosophila melanogaster:

functional and evolutionary implications. Cold Spring Harb Symp Quant Biol, 1978. 42 Pt 2: p. 1047-51.

9. Smale, S.T. and D. Baltimore, The "initiator" as a transcription control element. Cell, 1989.

57(1): p. 103-13. 10. Gershenzon, N.I., E.N. Trifonov, and I.P. Ioshikhes, The features of Drosophila core

promoters revealed by statistical analysis. BMC Genomics, 2006. 7: p. 161. 11. Kaufmann, J. and S.T. Smale, Direct recognition of initiator elements by a component of the

transcription factor IID complex. Genes Dev, 1994. 8(7): p. 821-9. 12. Burley, S.K. and R.G. Roeder, Biochemistry and structural biology of transcription factor IID

(TFIID). Annu Rev Biochem, 1996. 65: p. 769-99. 13. Ohler, U., et al., Computational analysis of core promoters in the Drosophila genome.

Genome Biol, 2002. 3(12): p. RESEARCH0087. 14. Yang, C., et al., Prevalence of the initiator over the TATA box in human and yeast genes and

identification of DNA motifs enriched in human TATA-less core promoters. Gene, 2007.

389(1): p. 52-65. 15. Burke, T.W. and J.T. Kadonaga, The downstream core promoter element, DPE, is

conserved from Drosophila to humans and is recognized by TAFII60 of Drosophila. Genes

Dev, 1997. 11(22): p. 3020-31.

15

16. Kutach, A.K. and J.T. Kadonaga, The downstream promoter element DPE appears to be as

widely used as the TATA box in Drosophila core promoters. Mol Cell Biol, 2000. 20(13): p. 4754-64.

17. Burke, T.W. and J.T. Kadonaga, Drosophila TFIID binds to a conserved downstream basal

promoter element that is present in many TATA-box-deficient promoters. Genes Dev, 1996.

10(6): p. 711-24. 18. Blackwood, E.M. and J.T. Kadonaga, Going the distance: a current view of enhancer action.

Science, 1998. 281(5373): p. 60-3. 19. Marsman, J. and J.A. Horsfield, Long distance relationships: Enhancer-promoter

communication and dynamic gene transcription. Biochim Biophys Acta, 2012. 1819(11-12): p. 1217-27.

20. Butler, J.E. and J.T. Kadonaga, Enhancer-promoter specificity mediated by DPE or TATA

core promoter motifs. Genes Dev, 2001. 15(19): p. 2515-9. 21. Juven-Gershon, T., J.Y. Hsu, and J.T. Kadonaga, Caudal, a key developmental regulator, is

a DPE-specific transcriptional factor. Genes Dev, 2008. 22(20): p. 2823-30. 22. Lagrange, T., et al., New core promoter element in RNA polymerase II-dependent

transcription: sequence-specific DNA binding by transcription factor IIB. Genes Dev, 1998.

12(1): p. 34-44. 23. Krumlauf, R., Hox genes in vertebrate development. Cell, 1994. 78(2): p. 191-201. 24. Hayashi, S. and M.P. Scott, What determines the specificity of action of Drosophila

homeodomain proteins? Cell, 1990. 63(5): p. 883-94. 25. Brooke, N.M., J. Garcia-Fernandez, and P.W. Holland, The ParaHox gene cluster is an

evolutionary sister of the Hox gene cluster. Nature, 1998. 392(6679): p. 920-2. 26. Mlodzik, M. and W.J. Gehring, Expression of the caudal gene in the germ line of Drosophila:

formation of an RNA and protein gradient during early embryogenesis. Cell, 1987. 48(3): p. 465-78.

27. Macdonald, P.M. and G. Struhl, A molecular gradient in early Drosophila embryos and its

role in specifying the body pattern. Nature, 1986. 324(6097): p. 537-45. 28. Dearolf, C.R., J. Topol, and C.S. Parker, The caudal gene product is a direct activator of

fushi tarazu transcription during Drosophila embryogenesis. Nature, 1989. 341(6240): p. 340-3.

29. Rivera-Pomar, R., et al., Activation of posterior gap gene expression in the Drosophila

blastoderm. Nature, 1995. 376(6537): p. 253-6. 30. Rivera-Pomar, R. and H. Jackle, From gradients to stripes in Drosophila embryogenesis:

filling in the gaps. Trends Genet, 1996. 12(11): p. 478-83.

16

31. Wu, L.H. and J.A. Lengyel, Role of caudal in hindgut specification and gastrulation suggests

homology between Drosophila amnioproctodeal invagination and vertebrate blastopore.

Development, 1998. 125(13): p. 2433-42. 32. Chawengsaksophak, K., et al., Homeosis and intestinal tumours in Cdx2 mutant mice.

Nature, 1997. 386(6620): p. 84-7. 33. Gamer, L.W. and C.V. Wright, Murine Cdx-4 bears striking similarities to the Drosophila

caudal gene in its homeodomain sequence and early expression pattern. Mech Dev, 1993.

43(1): p. 71-81. 34. Lohnes, D., The Cdx1 homeodomain protein: an integrator of posterior signaling in the

mouse. Bioessays, 2003. 25(10): p. 971-80. 35. Shashikant, C.S., et al., Regulation of Hoxc-8 during mouse embryonic development:

identification and characterization of critical elements involved in early neural tube

expression. Development, 1995. 121(12): p. 4339-47. 36. Lafontaine, C.A., et al., Cdx1 Interacts Physically with a Subset of Hox Proteins.

Biochemistry, 2012.

37. Charite, J., et al., Transducing positional information to the Hox genes: critical interaction of

cdx gene products with position-sensitive regulatory elements. Development, 1998. 125(22): p. 4349-58.

38. Meyer, B.I. and P. Gruss, Mouse Cdx-1 expression during gastrulation. Development, 1993.

117(1): p. 191-203. 39. Beck, F., et al., Expression of Cdx-2 in the mouse embryo and placenta: possible role in

patterning of the extra-embryonic membranes. Dev Dyn, 1995. 204(3): p. 219-27. 40. van Nes, J., et al., The Cdx4 mutation affects axial development and reveals an essential

role of Cdx genes in the ontogenesis of the placental labyrinth in mice. Development, 2006.

133(3): p. 419-28. 41. Subramanian, V., B.I. Meyer, and P. Gruss, Disruption of the murine homeobox gene Cdx1

affects axial skeletal identities by altering the mesodermal expression domains of Hox

genes. Cell, 1995. 83(4): p. 641-53. 42. McGinnis, W. and R. Krumlauf, Homeobox genes and axial patterning. Cell, 1992. 68(2): p.

283-302.

43. Gatchel, J.R. and H.Y. Zoghbi, Diseases of unstable repeat expansion: mechanisms and

common principles. Nat Rev Genet, 2005. 6(10): p. 743-55. 44. Emili, A., J. Greenblatt, and C.J. Ingles, Species-specific interaction of the glutamine-rich

activation domains of Sp1 with the TATA box-binding protein. Mol Cell Biol, 1994. 14(3): p. 1582-93.

17

45. Schaefer, M.H., E.E. Wanker, and M.A. Andrade-Navarro, Evolution and function of

CAG/polyglutamine repeats in protein-protein interaction networks. Nucleic Acids Res, 2012.

40(10): p. 4273-87. 46. Kwok, R.P., et al., Nuclear protein CBP is a coactivator for the transcription factor CREB.

Nature, 1994. 370(6486): p. 223-6. 47. Hussain, M.A. and J.F. Habener, Glucagon gene transcription activation mediated by

synergistic interactions of pax-6 and cdx-2 with the p300 co-activator. J Biol Chem, 1999.

274(41): p. 28950-7. 48. Carninci, P., et al., Genome-wide analysis of mammalian promoter architecture and

evolution. Nat Genet, 2006. 38(6): p. 626-35.

Julia's M.Sc. proposal corrected May 16 2013 -...

Documents

Transcript of Julia's M.Sc. proposal corrected May 16 2013 -...