Cph

AR

a

ARR2A

KGIPTZ

1

uaz(ocdenl

NF

h0

Journal of Reproductive Immunology 114 (2016) 18–26

Contents lists available at ScienceDirect

Journal of Reproductive Immunology

jou rn al hom ep age: www.elsev ier .com/ locate / j repr imm

ontraceptive efficacy of recombinant fusion protein comprising zonaellucida glycoprotein-3 fragment and gonadotropin releasingormone

nanta Prasad Arukha1, Vidisha Minhas1, Abhinav Shrestha, Satish Kumar Gupta ∗

eproductive Cell Biology Lab., National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi 110 067, India

r t i c l e i n f o

rticle history:eceived 4 November 2015eceived in revised form8 December 2015ccepted 25 January 2016

eywords:onadotropin releasing hormone

mmunocontraceptionromiscuous T cell epitopeag-free recombinant fusion proteinona pellucida glycoprotein-3

a b s t r a c t

Contraceptive vaccines have been used for the management of wildlife population. In the present study,we have examined the contraceptive potential of Escherichia coli-expressed recombinant fusion proteincomprising of ‘promiscuous’ T cell epitope of tetanus toxoid [TT; amino acid (aa) residues 830–844] fol-lowed by dilysine linker (KK), dog ZP3 fragment (aa residues 307–346), triglycine spacer (GGG), T cellepitope of bovine RNase (bRNase; aa residues 94–104), GnRH, T cell epitope of circumsporozoite protein ofPlasmodium falciparum (CSP; aa residues 362–383), and GnRH. SDS-PAGE analysis of the purified refoldedprotein revealed a dominant ∼12 kDa band, which in Western blot reacted with mouse polyclonal anti-bodies against dog ZP3 fragment and mouse monoclonal antibodies against GnRH. Immunization offemale FvB/J mice following two booster schedule with the above recombinant protein supplementedwith alum led to high antibody titres against the immunogen as well as ZP3 and GnRH as determinedby ELISA. The immune sera reacted with zona pellucida of mouse oocyte and also inhibited in-vitrofertilization. The qRT-PCR studies showed decrease in the ovarian GnRH receptor in mice immunized

with the recombinant fusion protein. Mating studies revealed high contraceptive efficacy of the recom-binant protein as in two independent experiments, 90% of the immunized female mice failed to conceive.Following one booster immunization schedule, 50% of the immunized female mice failed to conceive.However, in adjuvanted controls, all the female mice became pregnant. To conclude, the recombinantprotein described herein has a good potential to be developed as candidate contraceptive vaccine.

© 2016 Elsevier Ireland Ltd. All rights reserved.

. Introduction

Infringement of wildlife boundaries owing to the increasingrbanization is leading to increased human-animal conflicts. Wildnimals act as reservoirs and/or vectors for various diseases ofoonotic importance and thus pose a major risk to the human healthhttp://www.cdc.gov/ncezid/). For example, street dogs are onef the vectors maintaining rabies virus circulation within humanommunities and high incidence of rabies is prevalent in severaleveloping countries, including India due to rabid dog bite (Knobel

t al., 2005; Reece, 2007; Sudarshan et al., 2007). Thus, there is aeed to develop new acceptable contraceptive strategies instead of

ethal means such as shooting, trapping and poisoning to control

∗ Corresponding author at: Emeritus Scientist, Reproductive Cell Biology Lab.,ational Institute of Immunology, Aruna Asaf Ali Marg, New Delhi 110 067, India.ax: +91 11 26742125.

E-mail address: skgupta@nii.ac.in (S.K. Gupta).1 Equal contribution.

ttp://dx.doi.org/10.1016/j.jri.2016.01.004165-0378/© 2016 Elsevier Ireland Ltd. All rights reserved.

wildlife population. Contraceptive vaccines based on native porcinezona pellucida (ZP) glycoproteins have been used successfully tomanage population of feral horses (Equus caballus) at AssateagueIsland National Seashore, MD, USA as well as white-tailed deer(Odocoileus virginianus) inhabiting Fire Island National Seashore,NY, USA (Kirkpatrick et al., 1990; Naugle et al., 2002). Long termfollow-up of the porcine ZP immunized wild horses and white-tailed deer did not reveal any significant debilitating health effects(Kirkpatrick and Turner, 2002; Curtis et al., 2007).

In addition to ZP-based contraceptive vaccine, immunocon-traceptive vaccine aiming to neutralize the biological activity ofgonadotropin releasing hormone (GnRH) has been proposed forinhibition of fertility in various animal models (Hodges and Hearn,1977; Carelli et al., 1982; Miller et al., 2000; Jung et al., 2005; Walkeret al., 2007). At least, four commercial GnRH-based contraceptivevaccines e.g. Improvac® (Pfizer Animal Health, Victoria, Australia),

Equity® (CSL, West Ryde, NSW, Australia), Repro-BlocTM (Ampli-con Vaccine LLC, Pullman, WA, USA) and GonaconTM (developed byNational Wildlife Research Center, USA) are available. These vac-

ductiv

cm2

ciZesoi(waOEti

2

2

crreeaf[ateagorpiLlufa

2

fIITTsogw5(fb�w

A.P. Arukha et al. / Journal of Repro

ines have shown variable contraceptive efficacy in various animalodels (Elhay et al., 2007; Miller et al., 2008; Yoder and Miller,

010; Brunius et al., 2011; Levy et al., 2011).In the present manuscript, we have addressed the issue, if higher

ontraceptive efficacy can be achieved by immunization with themmunogens that elicit simultaneously antibodies reactive withP and GnRH. Keeping this in view, recombinant fusion proteinncompassing a fragment of dog ZP3 encoded by exon 7 corre-ponding to the amino acid (aa) residues 307–346 and two copiesf GnRH was designed. The above stretch of ZP3 was selected as its responsible for binding of spermatozoa to the ZP matrix in miceWilliams et al., 2006). The T cell help to elicit immune responseas provided by inclusion of ‘promiscuous’ T cell epitope(s), having

bility to bind to various MHC II molecules (Lairmore et al., 1995;’Hern et al., 1997). The recombinant protein was expressed in. coli without any affinity tag. Its immunogenicity and contracep-ive efficacy have been studied in female mice prior to evaluationn female dogs.

. Materials and methods

.1. Cloning and expression of recombinant protein

The codon optimized synthetic gene encoding fusion proteinomprising ‘promiscuous’ T cell epitope of tetanus toxoid (TT; aaesidues 830–844), dilysine linker (KK), fragment of dog ZP3 (aaesidues 307–346), triglycine spacer (GGG), ‘promiscuous’ T cellpitope of bovine RNase (bRNase; aa residues 94–104), GnRH, T cellpitope of circumsporozoite protein of Plasmodium falciparum (CSP;a residues 362–383), GnRH and stop codon (TGA) was obtainedrom GenScript Corporation (Piscataway, NJ, USA) in pUC57 vectordesignated as ZP3-(GnRH)2]. Restriction sites for Nde1 and BamH1t 5′ and 3′ ends respectively were also incorporated in the syn-hetic gene. Using standard protocols, DNA was cloned in pET22b(+)xpression vector (EMD4 Biosciences, NJ, USA) under T7 promoternd used to transform BL21[DE3]pLysS Escherichia coli cells (Strata-ene, CA, USA). Transformed bacterial cells were grown in presencef appropriate antibiotic resistant markers at 37 ◦C until the OD600eached between 0.4 to 0.6 and the expression of recombinantrotein was induced with an optimized concentration of 1.0 mM

sopropyl-�-d-thiogalactopyranoside (IPTG; Sigma–Aldrich Inc., St.ouis, USA) for 3 h. The expressed recombinant protein was ana-yzed on 0.1% SDS-15% PAGE followed by Western blot analysissing mouse polyclonal antibodies against recombinant C-terminalragment of dog ZP3 (Shrestha et al., 2015) and mouse monoclonalntibody against GnRH (Talwar et al., 1985).

.2. Purification of the recombinant ZP3-(GnRH)2 protein

The recombinant protein lacking any affinity tag was purifiedrom inclusion bodies (IBs; Gupta et al., 2013; Shrestha et al., 2015).n brief, after induction of the recombinant protein by 1.0 mMPTG, bacterial cell pellet (1 g) was suspended in 10 ml of 50 mMris buffer, 5 mM ethylenediaminetetraacetic acid (EDTA), pH 8.0.he pellet was sonicated on ice using Branson Sonifier-450 (Bran-on Ultrasonic Corp., CT, USA) for 8 cycles timed 90 s each (30 Wutput) following which the IBs pellet was collected by centrifu-ation at 8000 × g for 30 min at 4 ◦C. Subsequently, the IBs pelletas processed by washing twice with 15 ml of 50 mM Tris buffer,

mM EDTA, pH 8.0 supplemented with 2% sodium deoxycholateAmresco, Solon, OH, USA), once with 50 mM Tris buffer, pH 8.0

ollowed by double distilled water. The purified IBs were solu-ilised in 5 ml of 100 mM citrate buffer with 8 M urea and 10 mM-mercaptoethanol, pH 4.0 at room temperature (RT) for 6–8 hith end to end mixing. The supernatant containing solubilized

e Immunology 114 (2016) 18–26 19

recombinant protein was collected by centrifugation at 12,000 × gfor 30 min at 4 ◦C. The protein was gradually diluted 10 folds withthe drop-wise addition of 100 mM citrate buffer, pH 4.0 with-out urea and �-mercaptoethanol at 4 ◦C. Diluted protein was thendialysed against 20 mM Tris, pH 6.0, and subsequently filteredthrough membrane of 0.45 �M pore size and concentrated by usingAmicon® Ultra-15 Centrifugal Filter Device with a cut-of 3 kDa(Merck Millipore Ltd., Carrigtwohill, Ireland). The concentration ofthe refolded protein was estimated by Bicinchonic acid (BCA) pro-tein estimation kit (Pierce, Rockford, IL, USA) using bovine serumalbumin (BSA) as a standard.

2.3. Immunization studies

2.3.1. Two boosters immunization schedule for immunogenicityand contraceptive efficacy

Inbred FvB/J mice, 8–10 weeks of age, kept under the con-ventional containment levels at the Small Experimental AnimalFacility, National Institute of Immunology, New Delhi, India, wereused. These studies were conducted as per the guidelines andapproval of the Institutional Animals Ethics Committee (IAEC).Female mice (n = 10) were immunized subcutaneously with 25 �gof recombinant ZP3-(GnRH)2 with alum (Sigma–Aldrich Inc.) asan adjuvant (200 �g aluminium content/injection/mouse). Controlgroup (n = 10) of FvB/J mice received only alum. Two booster injec-tions were given on days 21 and 42 intraperitoneally with thesame amount of recombinant protein with alum [Experiment I].Sera were collected through retro-orbital bleeding in compliancewith IAEC guidelines on days 0, 35 and 56. To confirm the repro-ducibility of our data, above experiment was repeated one moretime using the same number of animals and immunization schedule[Experiment II].

2.3.2. One booster immunization schedule for immunogenicityand contraceptive efficacy

For one booster schedule, additional female mice (n = 10) wereimmunized using same doses of recombinant ZP3-(GnRH)2 withalum and following same route of immunization as described fortwo booster schedule, except that the booster injection was givenon day 28. This group has separate adjuvant control group (n = 10).

2.3.3. Immunization schedule for ovarian GnRH receptor analysisIn addition, six female mice were also immunized along with

appropriate adjuvant control group (n = 6) following two boosterschedule to study the status of ovarian GnRH receptor.

2.4. ELISA

The serum antibody titres against the recombinant ZP3-(GnRH)2were determined by ELISA essentially as described previously(Gupta et al., 2013). In addition, antibody titres were also deter-mined against the recombinant protein encompassing T cellepitope of TT followed by dilysine linker and dog ZP3 fragment cor-responding to aa residues 165–346 (TT-KK-ZP3(C); Shrestha et al.,2014). To determine the antibody titres against GnRH, syntheticGnRH (Sigma–Aldrich Inc.) was conjugated with BSA in 40:1 molarratio using 1-step glutaraldehyde method as described previously(Gupta et al., 1985). Microtitration ELISA plates were coated withthe above proteins at 250 ng/well. In case of GnRH-BSA conjugate,

the concentration for coating ELISA plate was with respect to GnRHassuming that whole of it bound to BSA during conjugation. Anti-body titres are expressed as Antibody Unit (AU) that represent thereciprocal of serum dilution giving an absorbance of 1.0.

2 ductiv

2i

b45BgasoGwoo

2

i(dIdaat(sasihtta(um

2i

(md1pmOsedmmpGw3ai9ab

0 A.P. Arukha et al. / Journal of Repro

.5. Reactivity of the antibodies with the mouse oocyte byndirect immunofluorescence

To determine the reactivity of antibodies generated by recom-inant ZP3-(GnRH)2 with ZP of mouse oocytes, female mice (FvB/J,

week old) were super-ovulated by injecting intraperitoneally IU/mouse pregnant mare serum gonadotropin (PMSG; Intervet,oxmeer, Netherland) followed by 5 IU/mouse human chorioniconadotropin (hCG; Intervet India Pvt. Ltd.) after 48 h. The next day,nimals were euthanized by cervical dislocation, ovaries removedurgically, oocytes retrieved from Ampulla region and were washednce with Brister modified oocyte culture (BMOC) medium (Gibco,rand Island, NY, USA). To remove cumulus, oocytes were treatedith hyaluronidase (50 �g/ml) for 5 min at RT. The cumulus-free

ocytes were processed for indirect immunofluorescence as previ-usly described (Gupta et al., 2013).

.6. In-vitro fertilization (IVF) assay

The cumulus-free mouse oocytes were isolated as describedn Section 2.5 of Materials and methods. The unfertilized oocytesn = 13–20/treatment group) were transferred to BMOC mediumroplet (100 �l) submerged under mineral oil (Sigma–Aldrich Inc.).

n addition, mouse sperm were collected by flushing caudae epi-idymis from male FvB/J mice in BMOC medium and incubatedt 37 ◦C in a humidified atmosphere of 5% CO2 for 15 min tollow the sperm to swim-up. Sperm were further incubated for 1 ho allow capacitation, before use. Decomplemented pre-immunepool of 4 mice) and immune (pool of 4 mice, day 56 bleed)erum (5 �l) were added to BMOC medium droplet containing eggsnd incubated at 37 ◦C for 1 h. Subsequently, capacitated mouseperm (1.0 × 106/droplet) were transferred to the droplet contain-ng oocytes and test serum and kept for further incubation in aumid atmosphere of 5% CO2 for 4–6 h at 37 ◦C. After incubation,he oocytes were washed 3 times with BMOC medium, transferredo fresh medium and kept for overnight incubation in a humidtmosphere of 5% CO2 at 37 ◦C. Next day, number of fertilized eggsmarked by two-cell embryos or release of polar bodies) as well asnfertilized eggs were counted. The experiment was repeated oneore time.

.7. Quantitation of the ovarian GnRH receptor in micemmunized with the recombinant protein

To determine, if immunization with the recombinant ZP3-GnRH)2 led to decrease in the ovarian GnRH receptor, FvB/J female

ice (n = 6) were immunized with the recombinant protein asescribed above. Immunized animals were euthanized at days5 (n = 3) and 30 (n = 3) after third injection of the recombinantrotein and ovaries were removed. Ovaries from adjuvanted ani-als were also processed in similar manner as respective controls.varies were processed for isolation of RNA followed by cDNA

ynthesis using the standard protocols as described (Malhotrat al., 2015). Quantitative RT-PCR reactions were carried out inuplicates in 20 �l reaction mixture containing SYBR green qPCRaster mix (2x), synthesized cDNA from ovaries of 3 individualice and GnRH receptor gene specific primers (1 �M; forward

rimer: 5′ TGGTGGTGATTAGCCTGGAC 3′; reverse primer: 5′ CCT-AAGATATATAACTGTGGTCCT 3′). In parallel, qRT-PCR for 18S rRNAas also run using forward primer, 5′ GGAGAGGGAGCCTGAGAAAC

′ and reverse primer 5′ CCTCCAATGGATCCTCGTTA 3′. The temper-ture profile used for the amplification of target sequences was:

nitial denaturation at 95 ◦C for 10 min, followed by 40 cycles of5 ◦C for 15 s, amplification for 1 min at primer specific optimizednnealing temperature. Gene-specific amplification was confirmedy a single peak in the Dissociation Curve. Average threshold cycle

e Immunology 114 (2016) 18–26

(Ct) values for 18S rRNA were used to normalize average Ct valuesfor GnRH receptor. These values were used to calculate the averagefor each group from ovaries of 3 independent animals, and the rel-ative �Ct was used to determine the change in the GnRH receptorexpression between the two groups.

2.8. In-vivo contraceptive efficacy studies

For mating studies, two weeks after the second (one boosterschedule)/third (two boosters schedule) injection, 2 immunizedfemale mice were housed with one healthy male mouse of provenfertility for 15 days. Male mice were rotated every 5th day. Num-ber of pregnant mice and the pups delivered by each pregnantmouse were recorded for recombinant protein immunized groupand adjuvanted control group.

2.9. Statistical analysis

The statistical significance of the antibody titres in pregnant vsnon-pregnant mice immunized with the recombinant protein, in-vitro contraceptive efficacy of serum samples from recombinantprotein immunized mice vs serum samples from adjuvanted con-trol and ovarian GnRH receptor levels in the immunized vs controlwas determined by using paired student’s t-test assuming unequalvariance. A p-value of <0.05 was considered to be statistically sig-nificant.

3. Results

3.1. Characteristics of E. coli-expressed recombinant ZP3-(GnRH)2

To investigate the contraceptive potential of recombinant pro-tein comprising ZP3 and GnRH, synthetic gene corresponding tothe construct as shown in Fig. 1A was designed with Nde1 andBamH1 restriction sites. Fig. 1B shows the nucleotide and deducedaa sequence of the synthetic gene. The cDNA encoding ZP3-(GnRH)2was cloned downstream of T7 promoter in pET22b(+) expressionvector and the recombinant protein expressed in BL21[DE3]pLysSE. coli cells as described in Section 2. The recombinant proteinexpressed without any tag was purified from IBs. The average yieldof the purified refolded recombinant protein from 3 batches was4.70 ± 0.31 mg/g wet cell pellet. Analysis of the purified recombi-nant protein by 0.1% SDS-15% PAGE revealed a dominant singleband of ∼12 kDa (Fig. 1C). The recombinant protein reacted in West-ern blot with mouse polyclonal antibodies against recombinant ZP3(TT-KK-ZP3; Shrestha et al., 2014) and also mouse monoclonal anti-body (MA-P81662) against GnRH (Talwar et al., 1985) suggestingthe presence of ZP3 as well as GnRH and their accessibility to therespective antibodies (Fig. 1D and E).

3.2. Recombinant protein is immunogenic in female mice andgenerated antibodies reactive with ZP3 and GnRH

Immunization of female mice (FvB/J) with recombinant fusionprotein ZP3-(GnRH)2 supplemented with alum as an adjuvant fol-lowing two boosters immunization schedule led to generation ofhigh antibody titres against the recombinant protein as determinedby ELISA (Table 1). Boosting effect in antibody titres was observedafter administration of the 3rd injection (Table 1). Immunizationwith the recombinant fusion protein also led to generation of theantibodies against GnRH as revealed by the reactivity in ELISA of

mice sera with GnRH conjugated to BSA (Table 1). Reactivity of theimmune sera with recombinant TT-KK-ZP3(C) demonstrated thatthe antibodies generated against recombinant fusion protein alsorecognize independently ZP3 component (Table 1).

A.P. Arukha et al. / Journal of Reproductive Immunology 114 (2016) 18–26 21

Fig. 1. Cloning, expression and purification of the recombinant fusion protein. The schematic representation of the construct design is shown in Panel A. In panel B, codonoptimized nucleotide (351 bp) and deduced amino acid sequence (112 aa excluding Methionine from expression vector) for ZP3-(GnRH)2 are shown in upper and lower caserespectively. The restriction sites have been shown in italics. The aa sequence of construct was deduced by translation using the ‘Translate’ program available at http://ca.e % PAGr nal anr

maab(buEto((

xpasy.org/tools/#translate. Panel C represent the Coomassie stained 0.1% SDS-15epresent the Western profile of the same (2 �g/lane) probed with mouse polycloespectively.

In an attempt to reduce the number of injections, femaleice were also immunized following one booster schedule which

lso led to generation of antibodies against both ZP3 as wells GnRH (Table 2). In the group of mice immunized using oneooster, the antibody titres against recombinant ZP3-(GnRH)262.80 ± 15.00 × 103 AU) as observed on day 42 (14 days afterooster) were however, lower as compared to two boosters sched-le (87.00 ± 5.11 × 103 AU, Experiment I; 93.90 ± 27.16 × 103 AU,xperiment II) as observed on day 56. Even after primary injec-ion of recombinant ZP3-(GnRH)2 with alum led to generation

f antibodies against ZP3-(GnRH)2 (2.30 ± 0.39 × 103 AU), GnRH0.16 ± 0.02 × 103 AU) and ZP3 (0.27 ± 0.02 × 103 AU) in ELISATable 2).

E profile of the purified recombinant protein (5 �g/lane) whereas Panels D and Etibodies against recombinant TT-KK-ZP3 and monoclonal antibody against GnRH

3.3. Antibodies against recombinant fusion protein recognizemouse ZP and inhibit in-vitro fertilization

The pooled serum sample (day 56 bleed; 1:20 dilution) from fourimmunized mice with antibody titres against recombinant ZP3-(GnRH)2 ranging from 85 to 115 AU × 103 (pool A) reacted with ZPmatrix surrounding the mouse oocytes in an indirect immunoflu-orescence assay, which was abrogated by prior incubation of theimmune serum with the recombinant protein (10 �g/ml), suggest-ing the specificity of the reaction with the ZP of mouse oocytes

(Fig. 2A). Further, the serum samples from the adjuvant controlanimals failed to show any reactivity with the ZP of mouse oocytes(Fig. 2A). Two separate pools of immune serum samples of 4 mice

22 A.P. Arukha et al. / Journal of Reproductive Immunology 114 (2016) 18–26

Table 1Immunogenicity and contraceptive efficacy of the recombinant ZP3-(GnRH)2 in female FvB/J mice following two booster injections on days 21 and 42.

Immunogen Antigens used forELISA

Antibody titres in AU × 103

(Mean ± S.E.M.)% Of animals failed toconceive

Pups/mated female(mean ± S.E.M.)

p-Value of thedifference of Igtitres of pregnantandnon-pregnantmice on day 56

Day 0 Day 35 Day 56

Experiment-IAlum (n = 10) ZP3-(GnRH)2 <0.05 <0.05 <0.05 0 7.90 ± 0.31 NAZP3-(GnRH)2 (n = 10) ZP3-(GnRH)2 <0.05 58.90 ± 13.27 87.00 ± 5.11 90 0.80 ± 0.80 2 × 10−4

GnRH-BSA <0.05 2.07 ± 0.59 8.80 ± 1.63 6 × 10−3

TT-KK-ZP3(C) <0.05 1.69 ± 0.26 7.93 ± 0.17 3.2 × 10−3

Experiment-IIAlum (n = 10) ZP3-(GnRH)2 <0.05 <0.05 <0.05 0 9.40 ± 0.54 NAZP3-(GnRH)2 (n = 10) ZP3-(GnRH)2 <0.05 66.90 ± 8.72 93.90 ± 27.16 90 1.06 ± 1.06 8 × 10−3

GnRH-BSA <0.05 1.08 ± 0.16 7.20 ± 1.10 2 × 10−3

TT-KK-ZP3(C) <0.05 1.52 ± 0.25 8.60 ± 0.42 7.8 × 10−3

Table 2Immunogenicity and contraceptive efficacy of the recombinant ZP3-(GnRH)2 in female FvB/J mice following one booster on day 28.

Immunogen Antigens used forELISA

Antibody titres in AU × 103

(Mean ± S.E.M.)% Of animalsfailed to conceive

Pups/matedfemale(mean ± S.E.M.)

p-Value of difference of Igtitres of pregnant andnon-pregnant mice on day 42

Day 0 Day 21 Day 42

Alum (n = 10) ZP3-(GnRH)2 <0.05 <0.05 <0.05 0 9.40 ± 0.54 NA ± 15.

0.80 1.16

erAcrA((sv

3d

paGod1staePeGZHato3f

ZP3-(GnRH)2 (n = 10) ZP3-(GnRH)2 <0.05 2.30 ± 0.39 62.80GnRH-BSA <0.05 0.16 ± 0.02 2.90 ±TT-KK-ZP3(C) <0.05 0.27 ± 0.02 8.00 ±

ach (pool A, antibody titres against recombinant ZP3-(GnRH)2anging from 85 to 115 AU × 103 and pool B from 79 to 105U × 103) of day 56 bleed (Experiment I) were tested for their effi-acy to inhibit mouse in-vitro fertilization (IVF). Fig. 2B shows theesult of two independent experiments performed using either pool

or pool B of immune serum. Antibodies against recombinant ZP3-GnRH)2 as compared to pre-immune serum led to a significantp = 0.02) inhibition of mouse IVF. Inhibition of IVF by the immuneerum samples was not due to the adverse effects on either theiability or the motility of the sperm (Data not shown).

.4. Immunization of mice with recombinant fusion protein led toecrease in the ovarian GnRH receptor

Expression of GnRH and its receptor has been shown at extra-ituitary sites such as ovary, testis, prostrate and placenta (Hsuehnd Erickson, 1979; Clayton et al., 1979; Torrealday et al., 2013).nRH may act in paracrine or autocrine fashion and influencesvarian steroidogenesis and modulate proliferation, apoptosis andifferentiation of different ovarian cell types (Hsueh and Erickson,979; Kogo et al., 2000; Metallinou et al., 2007). Various reportsuggest that active immunization with GnRH-based contracep-ive vaccines lead to a decrease in the levels of gonadotropinsnd pituitary GnRH receptor in the immunized animals (Arimurat al., 1976; Takahashi et al., 1978; Esbenshade and Britt, 1985;opkin and Fraser, 1985; McCue et al., 1997; Fang et al., 2010; Hant al., 2015a,b). In the present manuscript, we explored, if the anti-nRH antibodies thus generated by recombinant fusion proteinP3-(GnRH)2, will have any effect on the ovarian GnRH receptor.ence, expression of ovarian GnRH receptor at transcript level wasnalysed by qRT-PCR in the immunized mice as described in Sec-

ion 2. A significant decrease in the transcript for GnRH receptor invaries obtained at days 15 (p = 0.002) and 30 (p = 0.016) after therd injection was observed as compared to the ovaries obtainedrom the respective adjuvant controls (Fig. 3).

00 50 3.20 ± 1.11 0.01 0.12

0.05

3.5. Immunization with recombinant fusion protein led tocurtailment of fertility

Mating studies revealed that the group of mice immunizedwith recombinant ZP3-(GnRH)2 following two boosters immu-nization schedule (Experiment I) led to failure in conception in9 out of 10 animals (Table 1). On the contrary, all female mice(n = 10) that received only alum became pregnant. The contra-ceptive efficacy of recombinant fusion protein was confirmed bya repeat experiment (Experiment II), which also showed similartrend (Table 1). The number of pups born in the adjuvant controlgroup was 7.90 ± 0.31 (Experiment I) and 9.40 ± 0.54 (ExperimentII) per mated female as compared to 0.80 ± 0.80 (Experiment I)and 1.06 ± 1.06 (Experiment II) pups/mated female in recombi-nant fusion protein immunized groups. However, female miceimmunized with recombinant ZP3-(GnRH)2 following one boosterimmunization schedule showed reduction in fertility by 50%(Table 2), which was lower as compared to group of mice immu-nized following two boosters immunization schedule (Table 1).Analysis of antibody titre against ZP3-(GnRH)2, TT-KK-ZP3(C) andGnRH conjugated to BSA in mice that failed to conceive as comparedto the one who conceived showed significant differences (exceptagainst GnRH conjugated to BSA in one booster schedule) suggest-ing that infertility induced in the immunized animals was mediatedby the antibodies (Tables 1 and 2).

4. Discussion

With respect to the contraceptive vaccines, one of the importantchallenges is to improve their efficacy to inhibit fertility. Higher in-vitro contraceptive efficacy has been reported with the immune

sera generated against the physical mixture of bonnet monkeyZP3 peptides, individually conjugated to DT, as compared to therespective individual peptide, suggesting that use of multiple B-cellepitopes of a given zona protein may be one possibility to enhance

A.P. Arukha et al. / Journal of Reproductive Immunology 114 (2016) 18–26 23

Fig. 2. Reactivity of polyclonal antibodies against ZP3-(GnRH)2 with mouse ZP matrix in an indirect immunofluorescence assay and inhibition of in-vitro fertilization. PanelA shows reactivity of the mouse oocytes with pooled immune serum (n = 4) sample (day 56 bleed; 1:20 dilution) generated against ZP3-(GnRH)2 (sub-panel ii) in an indirectimmunofluorescence assay. Sub-panel (i) shows reactivity with pooled serum sample (day 56 bleed; 1:20 dilution) from mice (n = 4) receiving alum only. Sub-panel (iii) showr ated

p b-panp

cgtZitaemeca2sec

eactivity of immune pooled serum sample as used for sub-panel (ii) but pre-incubicture and lower panel represent immunofluorescence profile for the respective suooled immune serum from mice immunized with recombinant ZP3-(GnRH)2.

ontraceptive efficacy (Afzalpurkar et al., 1997). Further, antibodiesenerated against chimeric synthetic peptide encompassing epi-opes of bonnet monkey ZP3 and ZP4 (previously designated asP1) showed higher inhibitory effect on human sperm-oocyte bind-ng in hemi-zona assay as compared to with antibodies againsthe individual peptides, suggesting that immune response gener-ted against multiple zona proteins may have higher contraceptivefficacy (Sivapurapu et al., 2005). Alternately, attempts have beenade to design chimeric synthetic peptides/recombinant proteins

ncompassing epitopes of ZP glycoproteins and spermatozoa spe-ific proteins with the premise that simultaneous generation ofntibodies against both the gamete will be more effective (Lea et al.,002; Hardy et al., 2004, 2008). These scientific endeavours demon-

trated that in principle, it is possible to improve the contraceptivefficacy when multiple antigens are used in the contraceptive vac-ine design. However, these efforts failed to achieve contraceptive

with recombinant ZP3-(GnRH)2 (10 �g/ml). Upper panel represent phase contrastels. Scale bar represent 50 �m. Panel B shows inhibition of in-vitro fertilization by

efficacy in the range of 80–90%. In the present study, we have triedto combine the contraceptive potentials of ZP3 and GnRH, which tobest of our knowledge has not been tried.

Contraceptive vaccines based on GnRH have either employedsynthetic GnRH conjugated to various carrier proteins (Hodgesand Hearn, 1977; Takahashi et al., 1978; Miller et al., 2008;Yoder and Miller, 2010; Brunius et al., 2011; Levy et al., 2011)or GnRH/multiple copies of GnRH along with defined T cell epi-topes (Gupta et al., 2004; Jinshu et al., 2004; Walker et al., 2007).However, antibodies generated against the carrier protein may leadto ‘carrier-mediated’ suppression of the antibody response againstGnRH (Sad et al., 1991). Hence, ‘promiscuous’ T non-B cell epitopefrom a variety of antigens have been proposed to provide T cell

help to generate antibodies against the self proteins (Lairmore et al.,1995; Lou et al., 1995; O’Hern et al., 1997; Lea et al., 1998). ‘Promis-cuous’ T non-B cell epitopes binds to various MHC II molecules and

24 A.P. Arukha et al. / Journal of Reproductiv

Fig. 3. Relative fold change in the levels of expression of GnRH receptor in theovaries of mice immunized with recombinant ZP3-(GnRH)2: Female FvB/J micewere immunized with recombinant ZP3-(GnRH)2 following two boosters scheduleas described in Section 2. After 15 and 30 days of the last injection, animals (n = 3for each group) were euthanized and ovaries were surgically removed. Expressionof GnRH receptor in ovaries from individual mice was analysed by qRT-PCR per-fm

tppT‘lievsottaobMt2fiod2diPm

ian GnRH receptor in the same GnRH immunized group, when

ormed in duplicate and their levels normalized with 18S rRNA. Each bar representean ± S.E.M. of relative �Ct vs. 18S derived from ovaries of 3 animals.

hus have better probability to generate antibody response in largerroportion of the outbred animal species including humans. In theresent construct, we have used ‘promiscuous’ T cell epitopes ofT, bRNase and CSP of P. falciparum. Dilysine linker used between

promiscuous’ T cell epitope of TT and ZP3 is the target site forysosomal protease cathepsin B, which is an important proteasen the context of MHC II antigen presentation (Lennon-Duménilt al., 2002). Triglycine spacer between ZP3 and GnRH may pro-ide flexibility for their independent recognition by the immuneystem. Glycine-rich linkers have been found in several naturallyccurring proteins that not only connect domains but also allowheir discrete functions (Chichili et al., 2013). The recombinant pro-ein, ZP3-(GnRH)2, described herein was expressed without any tags recombinant proteins with His6-tag may influence the efficacyf vaccine as demonstrated in the case of malaria vaccine. Anti-odies generated against His6-tag free recombinant P. falciparumSP1 have higher percent parasite growth inhibition as compared

o the antibodies generated against His6-tagged MSP1 (Khan et al.,012). As the recombinant ZP3-(GnRH)2 lacked any tag, it was puri-ed from IBs, which involved their isolation, processing to removether host proteins, solubilization at low pH (4.0), refolding by slowilution followed by dialysis (Gupta et al., 2013; Shrestha et al.,015). The expression of ZP3-(GnRH)2 in a lon- and ompT- protease-eficient E. coli strain, BL21[DE3]pLysS has permitted avoidance of

ts proteolytic degradation. The expressed protein in 0.1% SDS-15%AGE showed a ∼12 kDa band, which is very close to the theoreticalolecular mass of 1268 Da including methionine.

e Immunology 114 (2016) 18–26

Female mice immunized with recombinant ZP3-(GnRH)2 sup-plemented with alum following both one and two boosterimmunization schedules led to generation of antibodies againstthe immunogen as well as ZP3 and GnRH. Higher antibody titresobserved against recombinant ZP3-(GnRH)2 as compared to thoseobserved with either ZP3 or GnRH may represent summation ofantibody responses against both the components. There is an addi-tional possibility that new epitopes are generated in the fusionprotein, which can not be ruled out by the results reported in thepresent studies. The recognition of native mouse ZP by the antibod-ies against fusion protein may be due to the fact that there is 50%sequence identity of the dog ZP3 polypeptide with mouse ZP3. Theantibodies against the fusion protein also recognized dog ovarianZP3 (Data not shown). Interestingly, antibodies inhibited mouse in-vitro fertilization. It has been reported that monoclonal antibodiesreactive with porcine ZP3, do not always resulted in the inhibitionof in-vitro fertilization (Bagavant et al., 1993). It has been suggestedthat antibodies should react with the epitopes on ZP3 that are rele-vant for its biological activity with respect to sperm binding. Indeedrecombinant protein encoded by exon 7 of mouse ZP3 did inhibitbinding of the mouse sperm to the eggs in-vitro (Williams et al.,2006). Thus, recombinant ZP3-(GnRH)2 not only generated anti-bodies that are reactive with ZP matrix but are also bio-effective.Immunization of female bonnet monkeys (Macaca radiata) with thesynthetic peptide corresponding to aa residues 324–347 of bonnetmonkey ZP3 coupled with DT led to reversible block of fertility (Kaulet al., 2001). The above epitope, except aa 347, is incorporated inthe recombinant fusion protein.

Various studies have documented the expression of GnRHreceptor in ovaries (Kogo et al., 2000; Metallinou et al., 2007;Torrealday et al., 2013). After pituitary, ovaries have highest expres-sion levels of GnRH receptor, which however is 10-fold lesser ascompared to pituitary (Torrealday et al., 2013). There are conflict-ing reports available in the literature regarding effect of GnRH onthe expression of GnRH receptors. It has been reported that GnRH,its agonists or antagonists negatively affects the expression of GnRHreceptors in pituitary (Crowder et al., 1986; Wu et al., 1994; Lopotet al., 2008; Mo et al., 2010). On the other hand, there are reportswhich suggest that GnRH may induce GnRH receptor expression(Pieper et al., 1981; Lin and Conn, 1999; Norwitz et al., 2002). Natureof increase in GnRH (pulsatile/transient/continuous) has also beenshown to either down- or up-regulate pituitary GnRH receptorexpression (Turzillo et al., 1995; Adams et al., 1996; Maya-Núnezand Conn, 1999). Thus depending upon experimental conditionsand animal species under investigation, GnRH may up- or down-regulate GnRH receptor. In contrast to pituitary, administrationof GnRH agonist led to an increase in the ovarian GnRH receptor(Mo et al., 2010). Administration of GnRH has also been shown toincrease in the GnRH receptors in both follicular as well as lutealtissues of the ovary (Pieper et al., 1981). In our case, we hypothe-sized that anti-GnRH antibodies elicited after immunization withZP3-(GnRH)2 contraceptive vaccine will bind free GnRH and thusreduced its bio-availability in the immunized animals, which hasbeen shown to down-regulate pituitary GnRH receptor (Popkinand Fraser, 1985; McCue et al., 1997; Fang et al., 2010; Han et al.,2015a,b). In the present studies, the antibodies generated by thefusion protein led to down-regulation of ovarian GnRH receptorsuggesting that the antibodies thus generated interfered in the bio-logical activity of GnRH. On the contrary, in one of the previousstudy, immunization with GnRH led to an increase in the ovarianGnRH receptor as compared to control (Popkin and Fraser, 1985).In the same paper, however, authors reported a decrease in ovar-

the results were expressed as GnRH agonist bound in fmol/ovary(Popkin and Fraser, 1985). The physiological relevance of the down-regulation of ovarian GnRH receptor as observed in the present

ductiv

sf

pcait

ipiofinatfstioCiilieteponedemmacd

cmi

C

A

D(oFrd

R

A

A.P. Arukha et al. / Journal of Repro

tudy to curtail fertility in the immunized animals remained to beurther investigated.

Ninety percent of the female mice immunized with the fusionrotein failed to conceive. It is likely that high contraceptive effi-acy observed in these studies may be contributed by the antibodiesgainst both ZP3 as well as GnRH. However, using one boostermmunization schedule, only 50% of the immunized animals failedo conceive.

For wildlife population management, nonsurgical sterilizationncluding immunocontraception is increasingly advocated as aromising approach. Surgical sterilization of female dogs by ovar-

ohysterectomy may lead to complications such as hemorrhage,varian remnant syndrome, stump pyometra, stump granuloma,stula draining tracts and estrogen responsive urinary inconti-ence (Howe, 2006). Estrogen-responsive urinary incontinence islso observed in dogs undergoing ovarectomy instead of ovariohys-erectomy (Okkens et al., 1997). Surgical sterilization of workingemale dogs also lead to diminished ‘drive’ (or aggression) andtamina (Howe, 2006). On the other hand immunization of white-ailed deer with native porcine ZP vaccine showed minimal changesn blood chemistry without any serious side-effects on the healthf the immunized animals, except oophoritis (Miller et al., 2001;urtis et al., 2007). Further, long term follow-up of the porcine ZP

mmunized wild horses also did not reveal any significant debilitat-ng health effects (Kirkpatrick and Turner, 2002, 2003). However,onger breeding seasons have been observed in mares and deermmunized with porcine ZP-based contraceptive vaccine (McSheat al., 1997; Nunez et al., 2010). No alterations in the behaviour ofhe immunized animals have been reported (Powell, 1999; Delsinkt al., 2013). Mares vaccinated with GnRH vaccine showed sup-ressed estrous behaviour such that their behaviour resembles thatf seasonally anovulatory mares (Elhay et al., 2007). Further, immu-ization with GnRH vaccine does not lead to any adverse healthffects and vaccinated animals were found to be in better body con-ition than the unvaccinated animals (Curtis et al., 2008; Gionfriddot al., 2011). Thus, immunization with recombinant ZP3-(GnRH)2ay be a viable alternative to surgical sterilization for the manage-ent of street dogs population. Likely suppression of estrous and

ggressive behaviour due to anti-GnRH antibodies may be benefi-ial for the population management of ferral dogs as it may lead toecrease in the incidence of rabies due to dog bite.

To conclude, recombinant fusion protein reported herein thatan result in inhibition of fertility in 90% of the immunized femaleice is a promising candidate and need to be further evaluated for

ts contraceptive efficacy in female dogs.

onflict of interest

The authors declare that no competing interests exist.

cknowledgements

This work was funded by the financial support fromepartment of Biotechnology (DBT), Government of India

BT/PR5207/MED/15/81/2012) and National Institute of Immunol-gy, New Delhi. SKG would like to acknowledge Tata Innovationellowship awarded to him by DBT. The funding agencies had noole in study design, collection, analysis or interpretation of theata.

eferences

dams, B.M., Sakurai, H., Adams, T.E., 1996. Concentrations ofgonadotropin-releasing hormone (GnRH) receptor messenger ribonucleic acidin pituitary tissue of orchidectomized sheep: effect of estradiol and GnRH. Biol.Reprod. 54, 407–412.

e Immunology 114 (2016) 18–26 25

Afzalpurkar, A., Shibahara, H., Hasegawa, A., Koyama, K., Gupta, S.K., 1997.Immunoreactivity and in-vitro effect on human sperm-egg binding ofantibodies against peptides corresponding to bonnet monkey zona pellucida-3glycoprotein. Hum. Reprod. 12, 2664–2670.

Arimura, A., Shino, M., de la Cruz, K.G., Rennels, E.G., Schally, A.V., 1976. Effect ofactive and passive immunization with luteinizing hormone-releasing hormoneon serum luteinizing hormone and follicle-stimulating hormone levels and theultrastructure of the pituitary gonadotrophs in castrated male rats.Endocrinology 99, 291–303.

Bagavant, H., Yurewicz, E.C., Sacco, A.G., Talwar, G.P., Gupta, S.K., 1993. Delineationof epitopes on porcine zona pellucida relevant for binding of sperm to oocyteusing monoclonal antibodies. J. Reprod. Immunol. 23, 265–279.

Brunius, C., Zamaratskaia, G., Andersson, K., Chen, G., Norrby, M., Madej, A., et al.,2011. Early immunocastration of male pigs with Improvac®—effect on boartaint, hormones and reproductive organs. Vaccine 29, 9514–9520.

Carelli, C., Audibert, F., Gaillard, J., Chedid, L., 1982. Immunological castration ofmale mice by a totally synthetic vaccine administered in saline. Proc. Natl.Acad. Sci. U. S. A. 79, 5392–5395.

Chichili, V.P.R., Kumar, V., Sivaraman, J., 2013. Linkers in the structural biology ofprotein–protein interactions. Protein Sci. 22, 153–167.

Clayton, R.N., Harwood, J.P., Catt, K.J., 1979. Gonadotropin-releasing hormoneanalogue binds to luteal cells and inhibits progesterone production. Nature282, 90–92.

Crowder, M.E., Herring, R.D., Nett, T.M., 1986. Rapid recovery of gonadotrophfunction after down-regulation of receptors for GnRH in ewes. J. Reprod. Fertil.78, 577–585.

Curtis, P.D., Richmond, M.E., Miller, L.A., Quimby, F.W., 2007. Pathophysiology ofwhite-tailed deer vaccinated with porcine zona pellucidaimmunocontraceptive. Vaccine 25, 4623–4630.

Curtis, P.D., Richmond, M.E., Miller, L.A., Quimby, F.W., 2008. Physiological effectsof gonadotropin-releasing hormone immunocontraception on white-taileddeer. Hum. Wildl. Confl. 2, 68–79.

Delsink, A.K., Kirkpatrick, J.F., van Altena, J.J., Bertschinger, H.J., Ferreira, S.M.,Stotow, R., 2013. Lack of spatial and behavioural responses toimmunocontraception application in African elephants (Loxodonta africana). J.Zoo Wildl. Med. 44, S52–S74.

Elhay, M., Newbold, A., Britton, A., Turley, P., Dowsett, K., Walker, J., 2007.Suppression of behavioural and physiological oestrus in the mare byvaccination against GnRH. Aust. Vet. J. 85, 39–45.

Esbenshade, K.L., Britt, J.H., 1985. Active immunization of gilts againstgonadotropin-releasing hormone: effects on secretion of gonadotropins,reproductive function, and responses to agonists of gonadotropin-releasinghormone. Biol. Reprod. 33, 569–577.

Fang, F., Li, H., Liu, Y., Zhang, Y., Tao, Y., Li, Y., et al., 2010. Active immunization withrecombinant GnRH fusion protein in boars reduces both testiculardevelopment and mRNA expression levels of GnRH receptor in pituitary. Anim.Reprod. Sci. 119, 275–281.

Gionfriddo, J.P., Denicola, A.J., Miller, L.A., Fagerstone, K.A., 2011. Health effects ofGnRH immunocontraception of wild white-tailed deer in New Jersey. Wildl.Soc. Bull. 35, 149–160.

Gupta, J.C., Raina, K., Talwar, G.P., Verma, R., Khanna, N., 2004. Engineering,cloning, and expression of genes encoding the multimericluteinizing-hormone-releasing hormone linked to T cell determinants inEscherichia coli. Protein Expr. Purif. 37, 1–7.

Gupta, N., Chakrabarti, K., Prakash, K., Wadhwa, N., Gupta, T., Gupta, S.K., 2013.Immunogenicity and contraceptive efficacy of Escherichia coli-expressedrecombinant porcine zona pellucida proteins. Am. J. Reprod. Immunol. 70,139–152.

Gupta, S.K., Guesdon, J.L., Avrameas, S., Talwar, G.P., 1985. Solid-phase enzymeimmunoassays of human chorionic gonadotropin using monoclonalantibodies. J. Immunol. Methods 83, 159–163.

Han, X.F., Li, J.L., Zhou, Y.Q., Ren, X.H., Liu, G.C., Cao, X.H., et al., 2015a. Activeimmunization with GnRH-tandem-dimer peptide in young male rats reducesserum reproductive hormone concentrations, testicular development andspermatogenesis. Asian J. Androl., http://dx.doi.org/10.4103/1008-682X.156856.

Han, X., Gu, L., Xia, C., Feng, J., Cao, X., Du, X., et al., 2015b. Effect of immunizationagainst GnRH on hypothalamic and testicular function in rams. Theriogenology83, 642–649.

Hardy, C.M., Beaton, S., Hinds, L.A., 2008. Immunocontraception in mice usingrepeated, multi-antigen peptides: immunization with purified recombinantantigens. Mol. Reprod. Dev. 75, 126–135.

Hardy, C.M., Clydesdale, G., Mobbs, K.J., 2004. Development of mouse-specificcontraceptive vaccine: infertility in mice immunized with peptide andpolyepitopic antigens. Reproduction 128, 395–407.

Hodges, J.K., Hearn, J.P., 1977. Effects of immunisation against luteinising hormonereleasing hormone on reproduction of the marmoset monkey (Callithrixjacchus). Nature 265, 746–748.

Howe, L.M., 2006. Surgical methods of contraception and sterilization.Theriogenology 66, 500–509.

Hsueh, A.J., Erickson, G.F., 1979. Extrapitutary action of gonadotropin-releasing

hormone: direct inhibition of ovarian steroidogenesis. Science 204,854–855.

Jinshu, X., Jingjing, L., Duan, P., Zheng, Z., Ding, M., Jie, W., et al., 2004. Theimmunogenicity of recombinant and dimeric gonadotrophin-releasing

2 ductiv

J

K

K

K

K

K

K

K

L

L

L

L

L

L

L

L

M

M

M

M

M

M

M

Wu, J.C., Sealfon, S.C., Miller, W.L., 1994. Gonadal hormones andgonadotropin-releasing hormone (GnRH) alter messenger ribonucleic acid

6 A.P. Arukha et al. / Journal of Repro

hormone vaccines incorporating a T-helper epitope and GnRH or repeatedGnRH units. J. Immunol. Methods 289, 111–122.

ung, M.J., Moon, Y.C., Cho, I.H., Yeh, J.Y., Kim, S.E., Chang, W.S., et al., 2005.Induction of castration by immunization of male dogs with recombinantgonadotropin-releasing hormone (GnRH)-canine distemper virus (CDV) T helpcell epitope p35. J. Vet. Sci. 6, 21–24.

aul, R., Sivapurapu, N., Afzalpurkar, A., Srikanth, V., Govind, C.K., Gupta, S.K., 2001.Immunocontraceptive potential of recombinant bonnet monkey (Macacaradiata) zona pellucida glycoprotein-C expressed in Escherichia coli and itscorresponding synthetic peptide. Reprod. Biomed. Online 2, 33–39.

han, F., Legler, P.M., Mease, R.M., Duncan, E.H., Bergmann-Leitner, E.S., Angov, E.,2012. Histidine affinity tags affect MSP1(42) structural stability andimmunodominance in mice. Biotechnol. J. 7, 133–147.

irkpatrick, J.F., Liu, I.K.M., Turner Jr., J.W., 1990. Remotely-deliveredimmunocontraception in feral horses. Wildl Soc Bull. 18, 326–330.

irkpatrick, J.F., Turner, A., 2002. Reversibility of action and safety duringpregnancy of immunization against porcine zona pellucida in wild mares(Equus caballus). Reprod. Suppl. 60, 197–202.

irkpatrick, J.F., Turner, A., 2003. Absence of effects from immunocontraception onseasonal birth patterns and foal survival among barrier island horses. J. Appl.Anim. Welf. Sci. 6, 301–308.

nobel, D.L., Cleaveland, S., Coleman, P.G., Fèvre, E.M., Meltzer, M.I., Miranda, M.E.,et al., 2005. Re-evaluating the burden of rabies in Africa and Asia. Bull. WorldHealth Organ. 80, 360–368.

ogo, H., Lizuka-Kogo, A., Fujimoto, T., Mori, T., 2000. Direct ovarian effects of aGnRH agonist in hypophysectomized immature rats: inhibition oftheca-interstitial luteinizing hormone receptor mRNA expression andinduction of interstitial cell differentiation. Zoolog. Sci. 17, 83–88.

airmore, M.D., DiGeorge, A.M., Conrad, S.F., Trevino, A.V., Lal, R.B., Kaumaya, P.T.,1995. Human T-lymphotropic virus type 1 peptides in chimeric andmultivalent constructs with promiscuous T-cell epitopes enhanceimmunogenicity and overcome genetic restriction. J. Virol. 69,6077–6089.

ea, I.A., van Lierop, M.J., Widgren, E.E., Grootenhuis, A., Wen, Y., van Duin, M.,1998. A chimeric sperm peptide induces antibodies and strain-specificreversible infertility in mice. Biol. Reprod. 59, 527–536.

ea, I.A., Widgren, E.E., O’Rand, M.G., 2002. Analysis of recombinant mouse zonapellucida protein 2 (ZP2) constructs for immunocontraception. Vaccine 20,1515–1523.

ennon-Duménil, A.M., Bakker, A.H., Wolf-Bryant, P., Ploegh, H.L.,Lagaudrière-Gesbert, C., 2002. A closer look at proteolysis and MHC class-IIrestricted antigen presentation. Curr. Opin. Immunol. 14, 15–21.

evy, J.K., Friary, J.A., Miller, L.A., Tucker, S.J., Fagerstone, K.A., 2011. Long-termfertility control in female cats with GonaConTM, a GnRH immunocontraceptive.Theriogenology 76, 1517–1525.

in, X., Conn, P.M., 1999. Transcriptional activation of gonadotropin-releasinghormone (GnRH) receptor gene by GnRH: involvement of multiple signaltransduction pathways. Endocrinology 140, 358–364.

opot, M., Ciechanowska, M., Malewski, T., Mateusiak, K., Misztal, T., Przekop, F.,2008. Changes in the GnRH mRNA and GnRH receptor (GnRH-R) mRNA levelsin the hypothalamic-anterior pituitary unit of anestrous ewes after infusion ofGnRH into the third cerebral ventricle. Reprod. Biol. 8, 149–161.

ou, Y.H., Ang, J., Thai, H., McElveen, F., Tung, K.S.K., 1995. A zona pellucida 3peptide vaccine induces antibodies and reversible infertility without ovarianpathology. J. Immunol. 155, 2715–2720.

alhotra, S.S., Suman, P., Gupta, S.K., 2015. Alpha or beta human chorionicgonadotropin knockdown decrease BeWo cell fusion by down-regulating PKAand CREB activation. Sci Rep. 5, 11210.

aya-Núnez, G., Conn, P.M., 1999. Transcriptional regulation of thegonadotropin-releasing hormone receptor gene is mediated in part by aputative repressor element and by the cyclic adenosine 3′ ,5′-monophosphateresponse element. Endocrinology 140, 3452–3458.

cCue, J.M., Quirk, C.C., Nelson, S.E., Bowen, R.A., Clay, C.M., 1997. Expression of amurine gonadotropin-releasing hormone receptor-luciferase fusion gene intransgenic mice is diminished by immunoneutralization ofgonadotropin-releasing hormone. Endocrinology 138, 3154–3160.

cShea, W.J., Monfort, S.L., Hakim, S., Kirkpatrick, J., Liu, I., Turner, J.W., et al., 1997.The effect of immunocontraception on the behaviour and reproduction ofwhite-tailed deer. J. Wildl. Manage. 61, 560–569.

etallinou, C., Asimakopoulos, B., Schroer, A., Nikolettos, N., 2007.Gonadotropin-releasing hormone in the ovary. Reprod. Sci. 14, 737–749.

iller, L.A., Crane, K., Gaddis, S., Killian, G.J., 2001. Porcine zona pellucidaimmunocontraception: health effects on white-tailed deer. J. Wildl. Manage.

65, 941–945.

iller, L.A., Gionfriddo, J.P., Fagerstone, K.A., Rhyan, J.C., Killian, G.J., 2008. Thesingle-shot GnRH immunocontraceptive vaccine (GonaCon) in white-taileddeer: comparison of several GnRH preparations. Am. J. Reprod. Immunol. 60,214–223.

e Immunology 114 (2016) 18–26

Miller, L.A., Johns, B.E., Killian, G.J., 2000. Immunocontraception of white-taileddeer with GnRH vaccine. Am. J. Reprod. Immunol. 44, 266–274.

Mo, Y., Peng, P., Zhou, R., He, Z., Huang, L., Yang, D., 2010. Regulation ofgonadotropin-releasing hormone (GnRH) receptor-I expression in the pituitaryand ovary by a GnRH agonist and antagonist. Reprod. Sci. 17, 68–77.

Naugle, R.E., Rutberg, A.T., Underwood, H.B., Turner Jr., J.W., Liu, I.K., 2002. Fieldtesting of immunocontraception on white-tailed deer (Odocoileus virginianus)on Fire Island National Seashore New York, USA. Reprod. Suppl. 60, 143–153.

Norwitz, E.R., Xu, S., Xu, J., Spiryda, L.B., Park, J.S., Jeong, K.H., et al., 2002. Directbinding of AP-1 (Fos/Jun) proteins to a SMAD binding element facilitates bothgonadotropin-releasing hormone (GnRH)- and activin-mediatedtranscriptional activation of the mouse GnRH receptor gene. J. Biol. Chem. 277,37469–37478.

Nunez, C.M.V., Adelman, J.S., Rubenstein, D.I., 2010. Immunocontraception in wildhorses (Equus caballus) extends reproductive cycling beyond the normalbreeding season. PLoS One 5, 1–10.

O’Hern, P.A., Liang, Z.G., Bambra, C.S., Goldberg, E., 1997. Colinear synthesis of anantigen specific B-cell epitopte with a ‘promiscuous’ tetanus toxin T-cellepitope: a synthetic peptide immunocontraceptive. Vaccine 15, 1761–1766.

Okkens, A.C., Kooistra, H.S., Nickel, R.F., 1997. Comparison of long-term effects ofovariectomy versus ovariohysterectomy in bitches. J. Reprod. Fertil. Suppl. 51,227–231.

Pieper, D.R., Richards, J.S., Marshall, J.C., 1981. Ovarian gonadotropin-releasinghormone (GnRH) receptors: characterization, distribution, and induction byGnRH. Endocrinology 108, 1148–1155.

Popkin, R.M., Fraser, H.M., 1985. Changes in pituitary and ovarian LHRH receptorsafter active immunization of female rats against LH or LHRH. J. Reprod. Fertil.73, 491–496.

Powell, D.M., 1999. Preliminary evaluation of porcine zona pellucida (PZP)immunocontraception for behavioural effects in feral horses (Equus caballus). J.Appl. Anim. Welf. Sci. 2, 321–335.

Reece, J.F., 2007. Rabies in India. An ABC approach to combating the disease instreet dogs. Vet. Rec. 161, 292–293.

Sad, S., Gupta, H.M., Talwar, G.P., Raghupathy, R., 1991. Carrier-inducedsuppression of the antibody response to a ‘self’ hapten. Immunology 74,223–227.

Shrestha, A., Srichandan, S., Minhas, V., Panda, A.K., Gupta, S.K., 2015. Canine zonapellucida glycoprotein-3: up-scaled production, immunization strategy and itsoutcome on fertility. Vaccine 33, 133–140.

Shrestha, A., Wadhwa, N., Gupta, S.K., 2014. Evaluation of recombinant fusionprotein comprising dog zona pellucida glycoprotein-3 and Izumo andindividual fragments as immunogens for contraception. Vaccine 32, 564–571.

Sivapurapu, N., Hasegawa, A., Gahlay, G.K., Koyama, K., Gupta, S.K., 2005. Efficacy ofantibodies against a chimeric synthetic peptide encompassing epitopes ofbonnet monkey (Macaca radiata) zona pellucida-1 and zona pellucida-3glycoproteins to inhibit in vitro human sperm-egg binding. Mol. Reprod. Dev.70, 247–254.

Sudarshan, M.K., Madhusudana, S.N., Mahendra, B.J., Rao, N.S., Ashwath Narayana,D.H., Abdul Rahman, S., et al., 2007. Assessing the burden of human rabies inIndia: result of a national multi-center epidemiological survey. Int. J. Infect.Dis. 11, 29–35.

Takahashi, M., Ford, J.J., Yoshinaga, K., Greep, R.O., 1978. Active immunization offemale rats with luteinizing hormone releasing hormone (LHRH). Biol. Reprod.18, 754–761.

Talwar, G.P., Gupta, S.K., Singh, V., Sahal, D., Iyer, K.S., Singh, O., 1985. Bioeffectivemonoclonal antibody against the decapeptide gonadotropin-releasinghormone: reacting determinant and action on ovulation and estrussuppression. Proc. Natl. Acad. Sci. U. S. A. 82, 1228–1231.

Torrealday, S., Laloti, M.D., Guzeloglu-Kayisli, O., Seli, E., 2013. Characterization ofthe gonadotropin releasing hormone receptor (GnRHR) expression and activityin female mouse ovary. Endocrinology 154, 3877–3887.

Turzillo, A.M., Juengel, J.L., Nett, T.M., 1995. Pulsatile gonadotropin-releasinghormone (GnRH) increases concentrations of GnRH receptor messengerribonucleic acid and numbers of GnRH receptors during luteolysis in the ewe.Biol. Reprod. 53, 418–423.

Walker, J., Ghosh, S., Pagnon, J., Colantoni, C., Newbold, A., Zeng, W., et al., 2007.Totally synthetic peptide-based immunocontraceptive vaccines show activityin dogs of different breeds. Vaccine 25, 7111–7119.

Williams, Z., Litscher, E.S., Jovine, L., Wassarman, P.M., 2006. Polypeptide encodedby mouse ZP3 exon-7 is necessary and sufficient for binding of mouse sperm invitro. J. Cell. Physiol. 207, 30–39.

levels for GnRH receptors in sheep. Endocrinology 134, 1846–1850.Yoder, C.A., Miller, L.A., 2010. Effect of GonaConTM vaccine on black-tailed prairie

dogs: immune response and health effects. Vaccine 29, 233–239.