Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

33
Joint work with many colleagues at FDA precision.fda.gov | [email protected] | @precisionFDA Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics Officer Director, FDA’s Office of Health Informatics David Litwack, PhD Policy Advisor FDA’s Center for Devices and Radiological Health Elaine R. Johanson Deputy, FDA Chief Health Informatics Officer Deputy Director, FDA’s Office of Health Informatics

description

Genetic test (upstream) Clinician orders test/services for patient, collects sample Sample preparation and sequencing Core processing (Mapping, Variation Calling) Special processing (Annotation, Filtering, Interpretation) + (downstream) Clinician discusses outcome with patient NGS-based Genetic Test (end-to-end product)

Transcript of Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

Page 1: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

Joint work with many colleagues at FDA

precision.fda.gov | [email protected] | @precisionFDA

Taha A. Kass-Hout, MD, MSFDA Chief Health Informatics OfficerDirector, FDA’s Office of Health Informatics

David Litwack, PhDPolicy AdvisorFDA’s Center for Devices and Radiological Health

Elaine R. JohansonDeputy, FDA Chief Health Informatics OfficerDeputy Director, FDA’s Office of Health Informatics

Page 2: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 3: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

Genetic test

(upstream)

Clinician orders test/services for patient,

collects sample

Sample preparation

and sequencing

Core processing(Mapping,

Variation Calling)

Special processing(Annotation, Filtering, Interpretation)

+

(downstream)

Clinician discusses outcomewith patient

NGS-based Genetic Test (end-to-end product)

Page 4: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

Initial Focus

Genotype

Location 9: C → G mutation...

File with variants (VCF)

" You are at risk for X outcome. "

Report

Predicted Outcome

Analytical Benchmark Clinical Benchmark

Page 5: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

Initial Focus – Analytic Benchmarking

•Assess reproducibility of a test

•Assess accuracy using reference samples

•Assess agreement with other methods

•Assess test performance on synthetic data

Page 6: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

Features

Private or community areas

Data

Apps

Comparisons

Notes

Page 7: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 8: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 9: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 10: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 11: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 12: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 13: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 14: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 15: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 16: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 17: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 18: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 19: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 20: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 21: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 22: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

https://github.com/FDA

https://github.com/FDA
Page 23: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 24: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

>930 members from >450 organizations

Page 25: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

precision.fda.gov

Page 26: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

Thank You!

precision.fda.gov | [email protected] | @precisionFDA

Page 27: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

Backup Slides

precision.fda.gov | [email protected] | @precisionFDA

Page 28: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

… AGCATCGATGCAGAAGATTACAAGACGATCCGCTC …

DNA

Gene

Page 29: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

We are all unique

… AGCATCGATGCAGAAGATTACAACATAAAAAGATTACACGCGATCCGCTC …

… AGCATCGATGCATAAGATTACAAGATAAAAAGATTACACGCGATCCGCTC …

… AGCATCGATGCATAAGATTACAACATAAAAAGATTACATGCGATCCGCTC …

… AGCATCGCTGCAGAAGATTACAACATAAAAAGATTACATGCGATCCGCTC …

reference

David

Taha

Elaine

Page 30: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.
Page 31: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

The Internet Cloud

Page 32: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

Community Assurance

Page 33: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics.

Add new Feature (Discussion)

New Feature


The Distribute Project Emergency Department Surveillance for Influenza-like Illness Taha A. Kass-Hout, MD, MS Deputy Director (Acting) for Information.

The Distribute Project Emergency Department Surveillance for Influenza-like Illness Taha A. Kass-Hout, MD, MS Deputy Director (Acting) for Information.

Richard Kass

Richard Kass

The 100 - Os Escolhidos - Kass Morgan

The 100 - Os Escolhidos - Kass Morgan

Judgment for the Plaintiff - Iowa State Bank vs. Donald C Hout and Jane Hout

Judgment for the Plaintiff - Iowa State Bank vs. Donald C Hout and Jane Hout

Patricia Kass

Patricia Kass

2002 AIPLA - Kass & Nitabach, A Roadmap For Biotechnology Patents, by Kass et al.

2002 AIPLA - Kass & Nitabach, A Roadmap For Biotechnology Patents, by Kass et al.

THE CORE - Neurology Newsletter_ February 2016.pdf · Vishal Jani, MD Tareq Kass-Hout, MD Cynthia L. Kenmuir, MD, PhD Priyank Khandelwal, MD Andrey Lima, MD Laura Markham, MD Suman

THE CORE - Neurology Newsletter_ February 2016.pdf · Vishal Jani, MD Tareq Kass-Hout, MD Cynthia L. Kenmuir, MD, PhD Priyank Khandelwal, MD Andrey Lima, MD Laura Markham, MD Suman

The 100 by Kass Morgan (SAMPLE)

The 100 by Kass Morgan (SAMPLE)

SEC Complaint: Ethan Kassdefendant Ethan Kass ("Kass" or "Defendant") alleges as follows: SUMMARY . 1, This action concerns a fraudulent unauthorized trading scheme by Kass who, at

SEC Complaint: Ethan Kassdefendant Ethan Kass ("Kass" or "Defendant") alleges as follows: SUMMARY . 1, This action concerns a fraudulent unauthorized trading scheme by Kass who, at

KASS IP exposé - April 2013

KASS IP exposé - April 2013

Taha A. Kass-Hout, MD, MS

Taha A. Kass-Hout, MD, MS

1 UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF ... · MR. KASS: Good morning, Your Honor. Zalman Kass for Dr. Wright. THE COURT: And Mr. Kass, good morning. So first of all,

1 UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF ... · MR. KASS: Good morning, Your Honor. Zalman Kass for Dr. Wright. THE COURT: And Mr. Kass, good morning. So first of all,

Taha Kass-Hout, MD, MS Director, Global Public Health and Informatics Innovative Support to Emergencies, Diseases, and Disasters ICT Developments in Mobile.

Taha Kass-Hout, MD, MS Director, Global Public Health and Informatics Innovative Support to Emergencies, Diseases, and Disasters ICT Developments in Mobile.

Maxgilchrist Felicitas & Van Hout, Tom

Maxgilchrist Felicitas & Van Hout, Tom

Biosurveillance: Machine Learning And Disease Surveillance by Kass-Hout Di Tada

Biosurveillance: Machine Learning And Disease Surveillance by Kass-Hout Di Tada

KASS IP exposé - April 2011

KASS IP exposé - April 2011

Hout cite harvard 2011

Hout cite harvard 2011

Hout paradigma alternatif pengembangan wilayah

Hout paradigma alternatif pengembangan wilayah

Homecoming(Series 3#) by Kass Morgan

Homecoming(Series 3#) by Kass Morgan

Torts Kass Outline

Torts Kass Outline