Joanna Klein, Ph.D.Northwestern Scholarship Symposium

May 4, 2012

What are Bacteria?Single celled microorganism Friend or Foe?

Friend: health, environment, industryFoe: cause a variety of infectious diseases

Cellulophaga lyticaMarine bacteriumIsolated from beach mud

near Limon, Costa Rica in 1969

http://www.infoplease.com/atlas/centralamerica.html

http://travel.yahoo.com/p-travelguide-482616-limon_vacations-i

Cellulophaga lyticaGram negative FilamentousYellow pigmentationExhibits gliding motility

Gliding Motility

Cellulophaga lyticaMember of the Cytophaga-Flavobacterium-

Bacteroides (CFB) group of bacteriaPoorly characterized branch

Phylogenetic tree of Bacteria

ProteobacteriaE. coli,

Salmonella, Bordetella, Helicobacter, Vibrio

FirmicutesStaphylococcus,

Streptococcus, Lactobacillus, Clostridium

Cellulophaga lyticaTarget organism in the Genomic Encyclopedia of

Bacteria and Archaea (GEBA) Research Program of the Department of Energy/Joint Genome Institute

GEBA organisms 100 representative

organisms from each of the branches

Organisms with potential energy applications

Biofuel productionC. lytica produces a variety of

enzymes that may have applications in biotechnology and biofuel production

Deconstruction by C. lyticaC. lytica contains many polysaccharide degrading

enzymes Polysaccharides

Large molecules that store energy or provide structure Carbohydrates/starches Cellulose in plant cell walls

Enzymes break down polysaccharides into simple sugars that that can be fermented to produce energy

Polysaccharide degrading enzymes3 cellulases3 fucoidases1 xylosidase

Plant Cell Wall

Ethanol productionEthanol produced as a byproduct of starch

degradation and subsequent fermentationWell developed technologyEnzymes digest starch into simple sugars

which are readily fermented by known microorganisms to produce ethanol

Issues…

Cellulosic ethanol productionGoal is to use the cellulose biomass found in

plant cell walls of leaves and wood to produce ethanolProblems to overcome:

Lignin, also found in cell wall, hinders digestion of cellulose from wood

Enzymes that digest cellulose into simple sugars are poorly understood

Organisms that ferment these simple sugars to produce ethanol are poorly understood

Can C. lytic help achieve this goal?

Why study C. lytica?Model organism to understand the CFB

group betterContribute to biofuel research and

applications

Genome Annotation of Cellulophaga lyticaOne way to understand more about the life

processes of C. lytica is through a study of its genome.

GenomeAll of the genetic material, DNA, of an

organismDNA is made up 4 smaller molecules known as

the bases A,C,G &T

Sequencing genomesWe can easily determine the entire DNA

sequence of an organism – it’s genome.DNA sequencing technology has developed

rapidly since the human genome project, completed in 2003Took 13 years to complete, involved 100’s of

researchers around the globe, and cost a total of of $2.7 billion

Entire 3 billion base-pair sequence is available in a public database

Genome projectsCurrently, there are more than 3000

complete or nearly complete genome sequences of microbes available.

Over 1200 genome sequencing projects in higher organisms (plants, animals, fungi, protists)

The complete genome of Cellulophaga lytica was sequenced by the DOE and published in 20113,765,936 bases

Genome Projects

Computer annotation of C. lyticaNumber of genes and predicted function of

each gene product.

TATCAAAGAGATGATTGAGAACTGGTACGGAGGGAGTCGAGCCGGGCTCACTTAAGGGCTACGACTTAAC GGGCCGCGTCACTCAATGGCGCGGACACGCCTCTTTGCCCGGGCAGAGGCATGTACAGCGCATGCCCACA ACGGCGGAGGCCGCCGGGTTCCCTGACGTGCCAGTCAGGCCTTCTCCTTTTCCGCAGACCGTGTGTTTCT TTACCGCTCTCCCCCGAGACCTTTTAAGGGTTGTTTGGAGTGTAAGTGGAGGAATATACGTAGTGTTGTC TTAATGGTACCGTTAACTAAGTAAGGAAGCCACTTAATTTAAAATTATGTATGCAGAACATGCGAAGTTA AAAGATGTATAAAAGCTTAAGATGGGGAGAAAAACCTTTTTTCAGAGGGTACTGTGTTACTGTTTTCTTG CTTTTCATTCATTCCAGAAATCATCTGTTCACATCCAAAGGCACAATTCATTTTGAGTTTCTTTCAAAAC AAATCGTTTGTAGTTTTAGGACAGGCTGATGCACTTTGGGCTTGACTTCTGATTACCCTATTGTTAAATT AGTGACCCCTCTTAGTGTTTTCCTGTCCTTTATTTCGGAGGACGCACTTCGAAGATACCAGATTTTATGG GTCATCCTTGGATTTTGAAGCTTATAACTGTGACAAAAAATGTGAAGGGAAGAGATTTGAAACATGTGGA AGGAAAAGTGAGTGCAGACTATAAACTTCCAAAAAGACAAGCCCAAAATACACCTAAACGTTATGTCAGA TTATTTTGTTAAAATCAGTTGTTAGTGACGTCCGTACGTTAATAGAAAAAAGAATGCTTCAGTTTGGAGT GGTAGGTTTCTAGAGGGATTTATTGTGAAAGTATAAACTATTCAGGGCAATGGGACTGAGAGAACAGTGG GTAGAAAGGACCACTGAAGGAAAGGAAGAGAATTGGAAGGTAGATGAAAGAAGGAGCAAGAACCTGGGGTGTTTTTTCCTTTTCACTTGTAATAGTAGTAACAGAAGCAATGGCAGACTGGCTTTTGTTTCTACTGTGT TAGAATGAATTGACAGGACAACTGGGCCTATTATTGTACTGTGCCAGAATACTGTAAAACAAAACTAAAC ATACTAGCTTGGTGGCTTGTAATTAATTACTTAAGTGGAGATTTTTATTTTTTTTTTATTTTTTTTTTAG ACGGAGTCTCACTTTGTCACCCAGGCTGGAGTGCAGTGGCGCGATCTCAGCTGACTGCAACCTCCTCCTC

Cellulase

Process of annotationAutomatic annotation - done automatically

using computer software35% of computer generated annotations are wrong or

are missing information due to limitations of computer algorithms

Manual Annotation – humans analyze the information generated by computers and make corrections as necessary. Labor intensive and time consumingSolution: Train students to participate in the

process

• IMG-ACT is a toolkit of online gene and genome analysis programs.

• Using IMG-ACT, students annotate genomes• provide human expertise necessary for

accurate, up-to-date, reliable annotation• Students contribute to the scientific

community and learn biological concepts through participating in original research

JGI Genome Annotation Workshop Walnut Creek, CA January 2011

Genome annotation of C. lytica at NWC39 NWC students have participated in this

research endeavorScience Research Institute, Summer 2011Genetics, Fall 2011Microbiology, Spring 2012

15 genes have been fully annotated10 genes have been partially annotated

Restriction endonuclease type IWhat is the amino acid sequence of the

protein encoded by this gene?Used Integrated Microbial Genomes (IMG)

databaseAmy Knight and Allison Lothe

DNA topoisomerase IIIHow does this

protein compare to the sequence of other proteins?

Used BLAST program

Libby Nelson and Chelsey Fiecke

RNA polymerase sigma subunit 24What are key functional amino acid residues in the

protein?Web Logo ProgramSilas Baalke and Laura Torgerson

DNA Replication Protein AWhat enzymatic pathway is the protein involved in?Used KEEG Pathway databaseMarie Abeler and Gabe Jefferson

-galactosidaseWhat pathway is this enzyme found in?KEEG databaseDaniel Plack, Michael Lowry

Prolyl-tRNA synthaseWhat is the 3D

structure of similar proteins?

ProteinDataBank (PDB)

Sarah Ivanca and Victoria Hanson

NusA, B, G anti-termination factors

Where is the gene in relation to other genes?Used Gene neighborhood feature of IMGMatt Takata and Zach Fredman

RNase HWhat reaction does the enzyme catalyze?Used Metacyc databaseChelsey Fiecke

Elongation Factor TsHow closely related is this protein to proteins

in other bacteria?Used Phylogeny FR programEllen Chae, Holly Tomaz

Cytochrome C oxidase subunit 3Where is this protein located in the cell?TMHMM algorithmAlannah Pratt, Michael Lowry, SRI high school

students

MutSAre there paralogs of this gene?IMG database queryRyan Bradbury and Luke Delain

RNA polymerase sigma-70 factorWas this gene named properly?Multiple lines of evidence used to change

name to RNA Polymerase anti-sigma 70 factorCamaren Terrill and Ben Sorenson

Future work3,348 genes left to annotate!

Special interest in: Polysaccharide degrading enzymes Motility proteins Proteins with unknown function

Study the function of interesting genes in the lab

Genome Projects

AcknowledgementsNWC students who have participated in this

research.Genetics, Microbiology and SRI coursesResearch students Steven Erickson and Andy

Jaeger Northwestern College for providing the

opportunity and support for the sabbatical during which this project was initiated.

Additional funding received from a 2010-2011 Faculty Development Grant