MutSbeta promotes GAA•TTC expansion

1

DNA mismatch repair complex MutSbeta promotes GAA•TTC repeat expansion in human cells*

Anasheh Halabi1, Scott Ditch1#, Jeffrey Wang1 and Ed Grabczyk1

1From the Department of Genetics, Louisiana State University Health Sciences Center, 533 Bolivar St,New Orleans, LA 70112

*Running title: MutSbeta promotes GAA•TTC expansion

To whom correspondence should be addressed: Ed Grabczyk, Department of Genetics, LSU HealthSciences Center, 533 Bolivar St, New Orleans, LA, USA, Tel.: (504) 568-6154; Fax: (504)-568-8500; E-mail: egrabc@lsuhsc.edu

Keywords: trinucleotide repeat; DNA instability; mismatch repair; Friedreich ataxia

Background: Friedreich Ataxia (FRDA) is aprogressive, debilitating and lethal disease causedby GAA•TTC repeat expansion.Results: Expression of mismatch repair complexMutSbeta, particularly the MSH3 subunit, isnecessary for GAA•TTC repeat expansion inmodel cells and FRDA patient fibroblasts.Conclusion: MutSbeta promotes GAA•TTCexpansion in FRDA.S i g n i f i c a n c e : MSH3 may be a potentialtherapeutic target for slowing GAA•TTCexpansion.

SUMMARYWhile DNA repair has been implicated in

CAG•CTG repeat expansion, its role in theGAA•TTC expansion of Friedreich ataxia(FRDA) is less clear. We have developed ahuman cellular model that recapitulates theDNA repeat expansion found in FRDA patienttissues. In this model, GAA•TTC repeatsexpand incrementally and continuously. Wehave previously shown that the expansion rateis linked to transcription within the repeats.Our working hypothesis is that structuresformed within the GAA•TTC repeat duringtranscription attract DNA repair enzymes thatthen facilitate the expansion process.MutSbeta, a heterodimer of MSH2 and MSH3,is known to have a role in CAG•CTG repeatexpansion. We now show that shRNAknockdown of either MSH2 or MSH3 slowedGAA•TTC expansion in our system. Wefurther characterized the role of MutSbeta inGAA•TTC expansion using a functional assayin primary FRDA patient-derived fibroblasts.

These fibroblasts have no known propensity forinstability in their native state. Ectopicexpression of MSH2 and MSH3 inducedGAA•TTC repeat expansion in the native FXNgene. MSH2 is central to mismatch repair andits absence or reduction causes a predispositionto cancer. Thus, despite its essential role inGAA•TTC expansion, MSH2 is not anattractive therapeutic target. The absence orreduction of MSH3 is not strongly associatedwith cancer predisposition. Accordingly,MSH3 has been suggested as a therapeutictarget for CAG•CTG repeat expansiondisorders. Our results suggest that MSH3 mayalso serve as a therapeutic target to slow theexpansion of GAA•TTC repeats in the future.

Friedreich Ataxia (FRDA) is a progressive,neurodegenerative disease caused by expansion ofa GAA·TTC trinucleotide repeat (TNR) in the firstintron of the frataxin (FXN) gene (1). TNRexpansion is the causal agent in a growing numberof diseases (2,3). The largest known class of TNRexpansion disorders are dominant diseases, such asHuntington's disease, that are caused by aCAG•CTG repeat expansion within a codingregion. However, recessive DNA repeatexpansion disorders like FRDA are a rapidlygrowing subclass. In the FXN gene, the normalrange of GAA•TTC repeats is from 6 to 36triplets, while those in FRDA patients typicallyrange from 600 to 900 (4-6). The GAA•TTCexpansion in FXN does not alter the proteinsequence. Although the precise mechanismremains unclear, expansion ultimately leads tofrataxin insufficiency in a repeat length-dependentfashion (1,7-11). Regardless of how the repeats

http://www.jbc.org/cgi/doi/10.1074/jbc.M112.356758The latest version is at JBC Papers in Press. Published on July 11, 2012 as Manuscript M112.356758

Copyright 2012 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

2

repress FXN transcription, understanding themechanism through which repeat expansionoccurs may reveal a means to slow FRDAprogression.

While a contribution by the mismatch repair(MMR) pathway has been established in mousemodels of several CAG•CTG repeat expansiondiseases (12-16), our understanding of a role forDNA repair in GAA•TTC expansion is limited.MMR involvement in CAG•CTG repeat expansionhas been explained in part, by the ability of theindividual strands of the repeat to form CNGhairpin structures with mismatched central bases(17-20). DNA mismatches in human cells arerecognized by the MutS protein heterodimersMutSalpha and MutSbeta (21). MutSalpha, aheterodimer of MSH2 (MutS Homologue 2) andMSH6, is the dominant MutS complex thatrecognizes base-base mismatches and shortinsertion/deletion loops (22). MutSbeta, acomplex of MSH2 and MSH3, is less abundantthan MutSalpha in most cell types. For the mostpart, although it may better recognize and bind tolarger insertion/deletion loops, MutSbeta appearsto be functionally redundant to MutSalpha (23,24).Unlike the CNG motif, GAA•TTC sequences donot form hairpins with mismatches. WhileMutSbeta was found to contribute to GAA•TTCmediated chromosomal breaks and rearrangementsin a yeast model (25), MMR has not traditionallybeen considered an active agent in GAA•TTCexpansion. Recently however, it was determinedthat knockdown of MSH2 in FRDA patient-derived induced pluripotent stem cells (iPSCs)caused a slower rate of GAA•TTC expansion (26).Furthermore, it has also been reported that theMMR system plays a role in intergenerationalGAA•TTC repeat dynamics in an FRDA mousemodel (27). Thus it appears that regardless of theability of a particular trinucleotide sequence toform hairpin structures, the contribution of DNAmismatch repair may be a common denominator inTNR expansion disorders.

Tissue-specific somatic instability leads toGAA•TTC allele size mosaicism in FRDApatients (6); in general, a contraction bias occursduring aging (28). Significantly, a somaticexpansion bias is evident in small pool PCRstudies of FRDA disease relevant tissues such asthe dorsal root ganglia (DRG) (29). While there

are several excellent models available to studyTNR contraction (30,31), the lack of highereukaryotic cellular or animal models that exhibitrobust TNR expansion has limited ourunderstanding of this phenomenon. To fill thisgap, our lab has developed a human cellular modelof GAA•TTC expansion that recapitulates thepropensity for expansion seen in affected tissuesof FRDA patients (32). Our model has several keyadvantages over using authentic FRDA patientcells or their derivatives to study GAA•TTC repeatexpansion. For example expansion is rapid; arepeat starting at 176 triplets can double in size intwo months through incremental and continuousexpansion (32). Furthermore, expansion does nothave lethal consequences because the repeats arenot linked to an essential gene. Thus we are able toavoid the well-known problems associated withselection against frataxin knockdown cells inculture (33). A deficit of our model is that it is notthe endogenous FXN locus. Therefore,experiments in this study were performed usingboth these cells and primary FRDA patientfibroblasts. Each experimental system revealedthe same essential role for MutSbeta in GAA•TTCexpansion, further substantiating the validity ofour cellular model.

Frataxin is an essential protein (1) and istranscribed to some degree in all cells; therefore,we surmise that the tissue-specific expansion seenin FRDA patients likely reflects the expression ofone or more DNA repair pathways that contributeto expansion in these tissues. Our workinghypothesis is that during transcription within theGAA•TTC repeat, a structure forms attractingDNA repair enzymes that then facilitate theexpansion process.

In this work we study the contribution of DNArepair to the rate of GAA•TTC expansion. Weused shRNA to reduce expression of mismatchrepair proteins in cells and monitored theexpansion rate. Knockdown of MSH2 and MSH3expression in our cellular model slowedGAA•TTC expansion; knockdown of MSH6 hadlittle effect on expansion rate. Furthermore,ectopic expression of MSH3 triggered repeatexpansion in primary fibroblasts from threedifferent FRDA patients. These cells have shownno previous propensity for repeat instability intheir native form.

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

3

EXPERIMENTAL PROCEDURESCell lines—The production of HEK 293 cells

with single copy constructs bearing definedGAA•TTC repeats integrated into the samegenomic location via Flp recombinase has beendescribed previously (32). The capped in vitroligation strategy used to create the uninterrupted(GAA•TTC)n repeat inserts has also beenpreviously described (34). Cell lines weremaintained in Dulbecco’s modified Eagle’smedium (DMEM) high glucose (Invitrogen) with5% fetal bovine serum (Sigma) at 37° C in anatmosphere containing 5% CO2. Primary FRDAfibroblasts GM03665, GM0816 and GM04078(Coriell Cell Repository) were maintained in thesame conditions, with the exception that 10% FBSwas used.

PCR analysis of GAA•TTC repeats—GenomicDNA was isolated from HEK293 cells bearingrepeat inserts as described in Ditch et al. (32).DNA was extracted using the DNAzol Reagent(Invitrogen) following the manufacturers protocol.Typically, 50 µl reactions were performed with100 ng of template, 200 nM primers, 250 µM eachdNTP (Stratagene) and 2.5 U Paq5000 DNApolymerase (Stratagene). Primer pairs for modelGAA•TTC expansions in HEK293 cells wereTAN2767 (GAGGACGCTGTCTGAAGTCC) andMGR3537(TGAGCAACTGACTGAAATGCCTCAA)annealed at 64°C for 32 cycles. Primer pairs forFRDA primary fibroblasts were GAA517F(GGCTTGAACTTCCCACACGTGTT) andGAA629R (AGGACCATCATGGCCACACTT)annealed at 62°C for 34 cycles. Amplifiedproducts were resolved by electrophoresis on 1%agarose gels with the 1 Kb Plus DNA Ladder(Invitrogen) as a marker. DNA was visualized bystaining with ethidium bromide and images wereacquired with a Kodak Gel Logic 440 ImagingSystem. Images were analyzed with CarestreamMolecular Imaging Software (5.0.2.26 for MacOS). Bar graphs were created using KaleidaGraph4.1 for Mac OS. Student’s t-test for unpaired datawith unequal variance was used for statisticalanalyses of GAA•TTC expansion.

Knockdown plasmids—The pLKO.1 vectorsystem (Open Biosystems), which conferspuromycin resistance and drives shRNAexpression from a human U6 promoter was used

as our base construct. Most shRNA sequenceswere chosen from The RNAi Consortium (TRC)TRC-Hs1.0 (human) shRNA library (BroadInstitute). MSH2-1 (TRCN0000010385), MSH2-2( T R C N 0 0 0 0 0 3 9 6 6 9 ) , M S H 3 - 1( T R C N 0 0 0 0 0 8 4 0 5 9 ) , M S H 3 - 2(TRCN0000084061) , MSH3-3 ( target :NM_002439.3 1235-1255, designed using Sfold(35)), MSH3-4 (TRCN0000084060), MSH3-5( T R C N 0 0 0 0 0 8 4 0 5 8 ) , M S H 6 - 1( T R C N 0 0 0 0 0 7 8 5 4 5 ) a n d M S H 6 - 2(TRCN0000078543), XPA-1 (TRCN0000083193)a n d X P A - 2 ( T R C N 0 0 0 0 0 8 3 1 9 7 ) .Oligodeoxyribonucleotides were used to assemblethe shRNA which were cloned downstream of thehuman U6 promoter between restriction sites AgeIand EcoRI in pLKO.1.

Express ion p lasmids—The plasmidpIRES2EGFP (Clontech) that expressed onlyEnhanced Green Fluorescent Protein (EGFP) froman Internal Ribosomal Entry Site (IRES) was usedas a control. Human MSH2 cDNA was cut fromplasmid pOTB7 (Open Biosystems) withrestriction enzymes BamH1 and XhoI and clonedbetween the compatible BglII and Sal1 sites inpIRES2EGFP to make pMSH2IRES2EGFP(expresses both MSH2 and EGFP). The IRES andEGFP were cut out from pIRES2EGFP withrestriction enzymes NheI and BsrGI and werecloned into the polylinker region of pNL-EGFP/CMV/WPREdU3 (36) that had beenlinearized with NheI and BsrGI to make PNL-IRES2EGFP. PNL-MSH2-IRES2EGFP, whichexpresses both MSH2 and EGFP, was made in thesame way. The human MSH3 cDNA was excisedfrom pFAST-BacI-MSH3 (generous gift of MinnaNystrom) from restriction site SpeI to XmaI andinserted into PNL-IRES2EGFP linearized withNheI and XmaI to make PNL-MSH3-IRES2EGFP, which expresses both MSH3 andEGFP.

Cell Transfections—Transient transfections ofplasmids were carried out using Lipofectamine2000™ (Invitrogen) as per the manufacturer'ssuggestions. Transfection with the empty pLKO.1or pIRES2EGFP vector served as a control.Following transfection, to select for successfultransfection and integration, the cells receivingpLKO.1-derived vectors were passaged in mediacontaining 2µg/ml puromycin. In specific cases,

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

4

cells containing expression vectors co-expressingEGFP were sorted for expression via FACS.

Lent iv i ra l Produc t ion and Ce l lTransductions—Lentiviral particles were producedfrom vectors derived from the pLKO.1 vector(Open B iosys t ems) o r t he pNL-EGFP/CMV/WPREdU3 vector (36). Viralparticles were made via a three-plasmid expressionsystem as described in Marino et al. (37) andReiser et al. (36) except that the HEK293T cellswere transfected using Lipofectamine 2000(Invitrogen). Transductions were performed withHEK293 cells containing (GAA·TTC)176 tandemreporter constructs in the presence of 8 µg/ml ofPolybrene (Sigma). Knockdowns were selectedfor with 1µg/ml of puromycin.

Protein Isolation and Western blotanalysis—Cell extracts were lysed in 4x LaemmliBuffer (20% glycerol, 4% SDS, 100 mM Tris (pH6.8), fresh 1mM DTT). Samples were boiled at100°C for 10 minutes. 10 µg of each cell lysatewas separated on pre-cast 4-20% Tris-Glycine gels(Bio-Rad Mini-PROTEAN TGX System) at 20mAconstant current. MagicMark XP (Invitrogen) wasused as a size ladder and SeeBlue Plus2 PrestainedStandard (Invitrogen) was used to establishtransfer efficiency. Protein was transferred fromthe gel to an Immobilon-P membrane (Millipore)for 40 minutes at 20V using a Bio-Rad semi-drytransfer apparatus. Membranes were blocked for45 minutes using 10% evaporated Carnation Milkand 90% phosphate-buffered saline with 0.1%Tween (PBST). The membranes were rotated withprimary antibodies MSH2 (Calbiochem), MSH3(BD Transduction Labs), MSH6 (BD TransductionLabs), and beta-actin (Sigma) diluted in 10%evaporated Carnation Milk and 90% PBST for 90minutes at room temperature or overnight at 4°C.Simultaneous Western blotting of multiple MMRproteins has also been done by others (38,39).After several washes with PBST the membraneswere incubated for 45 minutes with horseradishperoxidase-conjugated goat anti-mouse (or goatanti-rabbit) secondary antibody (Pierce) in 10%evaporated Carnation Milk and 90% PBST. Afterseveral PBST washes, the ECL Advancechemiluminescence kit (Amersham) was used toproduce a signal captured by a Kodak Gel Logic440 Imaging System. Image analysis was donewith Carestream Molecular Imaging Software

version 5.0.2.26 for Mac OS. Statistical analysiswas done using the Student’s t-test for unpaireddata with unequal variance.

RESULTSMismatch repair has a major role in

GAA•TTC repeat expansion. To determine thecontribution of DNA repair to the expansion ofGAA•TTC repeats in our human cellular modelwe used shRNA to knockdown components ofGlobal Genome Repair (GGNER), TranscriptionCoupled Repair (TCNER) and Mismatch Repair(MMR). Knockdown of either MSH2 or MSH3slowed GAA•TTC repeat expansion substantially,whereas knockdown of MSH6 had little effect onGAA•TTC repeat expansion (Fig. 1A). Proteinexpression levels were evaluated by westernanalysis of biological triplicates. The averageresidual expression of the MSH2, MSH3 andMSH6 knockdowns were determined to be 35%,24%, and 38% of normal expression.Representative expression of each MSH subunitknockdown is shown in Fig. 1B. Knockdown ofthe DNA repair protein XPA, which is central toboth the GGNER and TCNER pathways, did notreduce GAA•TTC repeat expansion in our system(Fig. 1A) when reduced to 61% of its endogenousprotein expression level (Fig. 1B). That MSH2knockdown can slow GAA•TTC expansion inFRDA patient-derived induced pluripotent stemcells (iPSCs) has recently been reported (26),lending validity to our model. Based on thesefindings, we used lentiviral shRNA delivery toknockdown MSH2 and MSH3. Lentiviraltransduction was more efficient at producingstable, long-term knockdowns necessary for ourtime-course studies than the plasmid-basedshRNA delivery system. Importantly, the resultsof both plasmid- and lentiviral-mediatedknockdown experiments were in agreement. Inaddition to technical replicates, all experimentswere performed using multiple, independentisolates of the target clonal cells to ensurebiological reproducibility. For example, plasmid-mediated shRNA knockdowns of MSH2 in threedifferent clonal lines containing (GAA•TTC)352inserts are shown in Fig. 2. Although the DNAprofiles of the clones have different appearances(Fig. 2A), the repeats gained in the absence orpresence of the MSH2 knockdown are tightlyclustered (Fig. 2B). In the plasmid-mediated

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

5

system, a modest reduction of MSH2 proteinexpression, averaging 65% of its normal level,(Fig. 2C) resulted in statistically significantchanges in the repeat expansion rate of threedifferent clonal isolates (Fig. 2B). Figures willhenceforth be presented as single, representativeexamples of experiments performed in at leasttriplicate.

In all cases, irrespective of the method used,GAA•TTC repeats in MSH2- or MSH3-knockdown cells expanded more slowly than thosetransduced with the empty vector control (see Fig.3A and 3B). At the protein level, a 60% decreaseof MSH2 expression caused a 75% reduction inMSH3 and an 89% reduction of MSH6 (Fig. 3C,lane 3). Thus, because all MSH subunits werereduced, changes in expansion rate of MSH2-knockdown cells could not be solely attributed toreduction of MSH2. These results are consistentwith observations that stability of individual MSHproteins is dependent upon hetero-dimerization(40,41) and that, as in cancer cell lines, reducedlevels of MSH2 decrease the levels of both MSH3and MSH6 (24,42).

The initial shRNA sequences used toknockdown MSH3 (MSH3-1 and MSH3-2) inearly experiments (such as those shown in Fig. 1)were moderately effective, either in combinationor individually. To achieve a more robustknockdown we used the RNA folding programMfold (43) and the siRNA design program Sfold(35) to model MSH3 mRNA structures and targetaccessible loops. MSH3 mRNA (NM_002439.3)is over 4.5 kilobases long and Mfold analysisrevealed many predicted folded structures. Wepicked three loop regions predicted to exist in non-overlapping subsets of structures. We targetedthese three accessible loops with shRNAsequences MSH3-3, MSH3-4 and MSH3-5. Whenthese constructs were tested individually, nonewere particularly effective (not shown), however,when these three shRNA were co-expressed in thecell, the knockdown of MSH3 was robust (Fig. 3,lanes marked MSH3sh), causing a 66% reductionof its protein expression level.

MSH3 knockdown reduces GAA•TTCexpansion rate without affecting other MSHproteins. When MSH3 was knocked down inHEK293 cells bearing (GAA•TTC)176 inserts, therate of repeat expansion decreased in a manner

similar to that seen with the MSH2 knockdown(Fig. 3A). In contrast to what we found for MSH2however, MSH3-targeted shRNA did notsubstantially affect the protein levels of MSH2 orMSH6 (Fig. 3C, compare lanes MSH2sh withMSH3sh), which were expressed at 84% and 73%of normal, respectively. These data suggest that acomplex containing MSH3 could be the real basisof expansion. While MSH2 knockdown cells hada greater decrease in the rate of expansion thanMSH3 knockdown cells (Fig. 3A and 3B), MSH2-knockdown cells were indirectly diminished forthe expression of MSH3 and MSH6 (Fig. 3C).Due to the effects observed with both the MSH2-and MSH3 knockdowns and because reduction ofMSH6 to 38% of its endogenous levels did notsignificantly affect the rate of expansion (Fig. 1Aand 1B), we conclude that the major activeexpansion agent in our system is MutSbeta(complex of MSH2 and MSH3) rather thanMutSalpha (MSH2 and MSH6).

The specificities of both the MSH2- andMSH3-targeted knockdowns were confirmed viarescue of the expansion phenotype. Rescue wasaccomplished with transduction of MSH2 orMSH3 cDNA-bearing lentiviral constructs that co-expressed EGFP (Fig. 4). Supplementation ofMSH2-knockdown cells with lentiviral-mediatedMSH2 cDNA expression rescued the rapidexpansion phenotype. This led to an increase inthe number of repeats gained after three weeks(Fig. 4A and 4G, lane +M2). Quantified repeatgains are shown in Fig. 4G and 4H. Furthermore,lentiviral delivery of ectopic MSH3 cDNA fullyrestored rapid expansion to the MSH3 knockdowncells (Fig. 4C and 4H, lanes +M3). Interestingly,lentiviral-mediated expression of MSH3 (Fig. 4Aand quantified in 4G, lane +M3) did not rescue theexpansion phenotype of MSH2-knockdown cells,and vice versa, ectopic MSH2 expression did notrestore rapid expansion to MSH3-knockdowncells.

Western blot analyses of rescue experimentsdemonstrate both the importance of the MutSbetacomplex to the expansion process and thespecificity of our knockdowns (Fig. 4B and 4D).Rescue of MSH2 knockdowns by ectopic MSH2expression not only restored the rapid expansionphenotype, but also restored the expression ofMSH3 and MSH6 (Fig 4B, lane +M2). Therefore,

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

6

the reduction in protein levels of MSH3 andMSH6 seen with the MSH2 shRNA knockdownswere likely due to the lack of MSH2 protein toform stable dimers with MSH3 or MSH6, not off-target activity of the shRNA. The competitivenature of MSH2 binding to its subunits is reflectedin the reduction of endogenous MSH6 protein inthe presence of ectopic expression of MSH3 (Fig.4D, lane +M3). The high accumulation of bothMutSbeta subunits in MSH3-supplemented cellscorrelates with the highest expansion rate in thesesets of experiments (Fig. 4C and 4H, lane +M3).In the presence of an empty vector control, ectopicexpression of MSH2 and MSH3 yielded anincrease of protein expression of 2-fold and 8.2-fold, respectively, (mock knockdown Fig. 4E and4F). This demonstrates that the effects ofMutSbeta subunits can be saturated and that therate of expansion is not increased by anoverabundance of MutS subunits.

Ectopic expression of MSH3 is sufficient toinduce GAA•TTC repeat expansion in FRDApatient fibroblasts. Primary fibroblasts fromFRDA patients (GM04078, GM03816 andGM03665; NIGMS Coriell Cell Repository)homozygous for expansions in both FXN allelesdo not ordinarily undergo additional expansionwhen carried in tissue culture. However, therepeats in some of these cells (GM04078 andGM03816) can expand when the cells areconverted to induced pluripotent stem cells (26).We reasoned that GAA•TTC repeats do notexpand in primary fibroblasts either because: 1)the FXN gene is not transcribed as highly as it isin affected FRDA tissues such as neurons, or 2)because a factor needed for expansion wasmissing. We tested the second part of thishypothesis by ectopically expressing MutSbetasubunits in primary FRDA fibroblasts eitherindividually, or in combination. We transducedFRDA fibroblasts with lentivirus expressing EGFPalone, MSH2 plus EGFP, MSH3 plus EGFP orMSH2, MSH3 and EGFP. We cultured the cellsfor six weeks, prepared DNA, and monitored theGAA•TTC repeat lengths of both alleles of theendogenous FXN loci. Expression of MSH3 wassufficient to cause the GAA•TTC repeat toexpand. Representative examples shown in Fig. 5indicate that MSH3 might be a limiting factor forGAA•TTC expansion in FRDA patient fibroblasts.

We have previously found that replication ratedoes not alter expansion rate in our HEK293-based GAA•TTC expansion model (32).However, a somatic expansion bias exists withinpost-mitotic neurons of the spinal cord in FRDApatients (29) and mouse models (44,45). Toinvestigate whether a lack of replicationcontributed to this bias, we performed parallelexperiments with both dividing and non-dividingprimary FRDA patient fibroblasts. So that contactinhibition would block replication, cells in thenon-dividing group were seeded at a high densityand were not split for the duration of the 6-weektime course of the experiment. A representativeprofile of the repeats from non-dividing cells isshown in Fig. 5A. Cells in the second, dividingexperimental group were passaged normally andthe profile of the repeats is shown in Fig. 5B. Theexpansion pattern of GAA•TTC repeats at eitherFXN allele, in both dividing and non-dividingpopulations of primary fibroblasts, were the same(Fig. 5A and 5B). Thus, although changes inrepeat stability correlated with MSH3 expression,they were not associated with the rates of celldivision.

Analysis of protein expression of primarypatient fibroblasts illustrated that MMR proteinsare in low abundance; at best, only endogenousMSH2 was detectable (Fig. 5C lane GFP).Consequently, quantification of absolute levels ofendogenous protein expression relative to over-expression of MutS subunits was not possible.Ectopic expression of MSH2 did not visiblyinduce expression of MSH3 (Fig. 5C lane +M2),nor did it produce expansion of the endogenousFXN GAA•TTC repeats to as great a degree asectopic expression of MSH3 alone (lane +M2 in5A and 5B). Ectopic expression of MSH3 induceda statistically significant increase in the rate ofrepeat expansion. Western analysis revealed thepresence of detectable amounts of both MSH2 andMSH3 following ectopic expression of MSH3(Fig. 5C lane +M3).

The effect of MutSbeta expression on the rateof expansion can be saturated. When both MSH2and MSH3 were ectopically expressed together,the two subunits accumulated to a greater degreethan when either subunit was expressedindependently (Fig. 5C +M2+M3). However, co-expression of MSH2 and MSH3 did not increase

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

7

the rate of expansion to a greater degree thanectopic expression of MSH3 alone (compare lanes+M2+M3 with +M3 in Fig. 5A and 5B).Quantitative analysis of the GM04078 linerevealed a statistically significant increase in therate of expansion in both the large and small alleleunder both conditions. However, changes in therate of expansion for GM04078 cells co-expressing MSH2 and MSH3 were not as robust asin cells with ectopic expression of MSH3 alone(1.37 triplet/week vs 0.82 for large alleles, 1.34triplet/week vs 0.9 for small alleles). In FRDAfibroblast line GM03665, the change in the rate ofexpansion in cells with co-expression of MSH2and MSH3 did not reach statistical significance.The variability of expansion rates seen inf ibroblasts expressing both subuni tssimultaneously may be partly attributable todeleterious effects of over expressing MSH2.Primary cells transduced with virus expressingMSH2, either alone or in combination with MSH3,did not divide as rapidly as controls or those cellstransduced with virus expressing MSH3 alone.Furthermore, cells expressing MSH2 in fibroblastcultures that were passaged during the six-weektime course were slow to reach confluency.Effects on checkpoint activation and enhancedapoptosis have been previously described inconnection with MSH2 over expression (46-48).These reasons might contribute to the results seenwith co-expression of MSH2 and MSH3.

DISCUSSIONThis study establishes that the mismatch repair

complex MutSbeta is a major contributor toGAA•TTC repeat expansion in human cells.MSH2 and MSH3 form a hetero-multimer calledMutSbeta (23,49). While MutSBeta has beenshown to be essential for CAG•CTG expansion inmice (12-16), there is little understanding of itsrole in GAA•TTC expansion. Our resultsdemonstrate that knocking down either MSH2 orMSH3 using shRNA in our FRDA expansionmodel reduces the rate of GAA•TTC expansion.

MSH2 is central to DNA mismatch repair andits knockdown causes a marked reduction of bothMSH3 and MSH6 protein expression levels.Thus, while MSH2 knockdown is associated withthe greatest reduction of GAA•TTC expansionrate, the change in rate cannot be separated fromthe reduction of its binding partners, MSH3 and

MSH6. In contrast, MSH3 knockdown reducesthe rate of GAA•TTC expansion and does notcause obvious changes in the expression of MSH2.

In contrast to MutSbeta, neither MSH6, acomponent of MutSalpha, nor XPA, a proteincentral to both GGNER and TCNER, appeared tocontribute to expansion in our system. It might benecessary to completely deplete or severely reducethe amount of XPA to observe a phenotypic effect.Our XPA knockdown was not robust, therefore wecannot rule out a role for nucleotide excisionrepair. One might also argue that partialknockdown of MSH6 (as in Fig. 1) was notsufficient to reach a physiological tipping point.However, it should be noted that even a partialknockdown of MSH2 or MSH3 clearly andsignificantly reduced GAA•TTC expansion rates.Furthermore, ectopic expression of MSH3 incontrol cells (no knockdown) caused a reductionin MSH6 (Fig. 4F, lane +M3) with no change therate of repeat expansion (Fig. 4E, lane +M3).Similarly, primary patient fibroblasts do notexpress detectable levels of MSH6 eitherendogenously or with ectopic expression of MSH2(Fig. 5C, compare GFP control to +M2). It hasbeen suggested that effects of MSH6 onCAG•CTG repeat dynamics in mice are likely tobe mediated through competition with MSH3 forMSH2 rather than direct enzymatic processes(13,15). While our data suggest that similardynamics may operate in the context of GAA•TTCexpansion in cultured human cells, we cannotformally exclude a role for MSH6.

To extend our observations, we studied theeffects of ectopic expression of MutSbeta subunitsat the endogenous FXN gene in primary FRDApatient fibroblasts. FRDA patient fibroblasts haveno known propensity for instability in their nativestate. Previously, these same primary cellsshowed instability at the FXN locus after beingtransformed into iPS cells (26). In our case,FRDA fibroblasts were maintained in their nativestate and transduced with lentiviral delivery ofMSH2, MSH3, or both. Western blot analysisindicated that ectopic expression of MSH3increased the amount of endogenous MSH2 in thefibroblasts (Fig. 5C, compare lane GFP to +M3).This can likely be attributed to formation of stableMutSbeta protein heterodimers.

Compared to the rapid expansion model

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

8

developed in our lab, the expansion rates in FRDApatient fibroblasts were much slower. Forexample, ectopic MSH3 expression caused a gainof about one repeat a week in both dividing andnon-dividing fibroblasts. The slower expansion infibroblasts may reflect: 1) the need for additionalfactors that affect expansion rate or 2) the lowlevel of FXN transcription in fibroblasts.Nonetheless a gain of one repeat a week is roughly50 repeats a year or 500 repeats in a decade. Thereproducibility of the slow rate of expansion inthree separate FRDA patient cell lines suggeststhat these fibroblasts may represent a remarkableparadigm for the somatic expansion that couldunderlie FRDA disease onset and progression.Furthermore, induced expansion by ectopicexpression suggests that environmental insultscapable of inducing the DNA repair complexMutSbeta may stimulate GAA•TTC repeatexpansion in otherwise non-expanding tissues.

While we had expected to see synergy withco-expression of MSH2 and MSH3 in primaryFRDA fibroblasts, it actually resulted in a lowerrate of expansion than ectopic expression ofMSH3 alone. We attribute this outcome to thedeleterious effects of MSH2 over expression.Previous reports indicate that MSH2 overexpression may lead to a block in replication orenhanced apoptosis (46-48). These findings areconsistent with the poor growth we noted in ourMSH2-transduced fibroblasts. Our hypothesis isthat effects on cell growth combined with thepotential toxicity of MSH2 over expression mayhave preferentially reduced or eliminated thepopulation of cells expressing MSH2 at highlevels. This may have diluted the potential impactof MSH2 and MSH3 co-expression on the rate ofexpansion in these cells.

That higher expression of both subunits didnot lead to more rapid expansion might alsosuggest that ectopic expression of MSH3 alonewas able to combine with endogenous MSH2 toprovide all the MutSbeta necessary for expansionin the fibroblasts. In such a circumstance, someother factor(s) became limiting to the expansion.In previous work, we, and others, have found thattranscription is one factor involved in repeatexpansion (32,50). We suggest that the low levelof FXN expression in fibroblasts may have alsocontributed to the slower rate of expansion. Post-

mitotic neurons in the DRG are characteristic sitesof GAA•TTC repeat expansion (29) andneurodegeneration (51) in FRDA patients. Theseneurons are also particularly high in FXN geneexpression (1), in contrast to the low level oftranscription in native FRDA fibroblasts.

Interestingly, MSH3 is expressed to a higherdegree in neuronal cells when compared to othersomatic tissues; this may contribute to theneuronal bias for TNR expansion (16,52).HEK293 cells, upon which our system is built,have been shown to be positive for a large numberof proteins expressed only, or preferentially, inneuronal cells. For example, rather thanexpressing filament proteins typical of kidney suchas desmin or high molecular weight keratins,HEK293 cells express neurofilaments (53). Thepreferential transformation of neuronal cells byadenovirus 5 and cells of neuronal lineage inembryonic kidney are thought to be the reasonHEK293 is most likely of neuronal origin (53,54).Thus, our ability to study the role of DNA repairon TNR expansion with an accelerated time courseis aided by the neuronal nature of HEK293 cells.

The mechanisms that drive expansion inmammalian cells are still unclear; however,transcription and DNA repair might provide aunifying theme in TNR expansion. The instabilityof disease-associated repeat sequences is generallyattributed to the ability of these sequences to adoptnon-B DNA structures: GAA•TTC repeats havebeen shown to adopt triplex and triplex-associatedstructures (7-10,55,56) and hairpin structures areformed by CAG•CTG (57-59) or CCG•GCC (60)trinucleotide repeats.

In Fig. 6, we present a model for small,incremental increases in GAA•TTC that areinitiated by transcription and mediated byMutSbeta. The model may be applicable to allTNR expansions. Fig. 6A shows part of anexpanded GAA•TTC repeat at rest, each GAA isbase-paired in register to its corresponding TTCpartner. In vivo, these pairs are only likely to beseparated during replication or transcription.Because most somatic expansion occurs in non-dividing cells, in this particular case, transcriptionis likely the pertinent strand-separating process. Infact, we have shown that transcription is linked toGAA•TTC expansion (32), and others have shownthat transcription increases CAG•CTG expansion

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

9

(50) or contraction (31,50).Because we have evidence that transcription

through the repeat can lead to polymerase stallingand RNA•DNA hybrid formation both in vitro(10,56) and in bacteria (56), Fig. 6B illustrates ourtheory that structures formed during transcriptioninitiate the expansion process. Further evidencethat this structure might attract DNA mismatchrepair enzymes was illustrated by Ku et al. (26) inshowing enriched binding of MSH2 and MSH3(but not MSH6) at the promoter distal end of therepeat in an iPS derivative of FRDA fibroblasts.Finally, our finding that GAA•TTC expansionpreferentially occurs in the promoter distal end ofa repeat in human cells (32) also supports thismodel. In the CNG repeat model, other structuresmay form that might include but are not limited toRNA•DNA hybrids (61,62). Regardless of thestructure formed during transcription, the next stepin our hypothesis is that a misalignment occursduring structure resolution. This misalignmentmight loop out one or a few triplets (as shown inFig. 6C). Although most early models haveassumed a replication-based mechanism andrelatively large jumps, such slipped strandstructures have long been suspected to play a rolein repeat expansion (63,64). Recently, theseearlier models have evolved to include small loop-outs of CAG•CTG repeat units that are targeted byMutSbeta (39), in close agreement with our dataand model for GAA•TTC expansion (see below).

Our data indicate that somatic expansion ofGAA•TTC repeats occurs in very smallincrements such as the gain of one repeat per weekin MSH3-supplemented FRDA patient fibroblasts(Fig. 5); these small gains point to a specific roleof very small loops in GAA•TTC repeatexpansion. Furthermore, functional tests andstructural modeling have indicated that smallinsertions (<5) occupy a unique niche in thespectrum of mismatches that MutSbeta works with(65). Insertions of this size might be moredifficult for the MutSbeta protein to accommodate(65). It is possible that discrimination can occurwith respect to binding short loops of differingflexibility. A recent report on the crystalstructures of MutSbeta bound to small DNA loopsshowed that it bound three phosphates in the loop(66). This finding suggests that a three-base loopis the minimal substrate for MutSbeta and on a

broader level might also explain the seemingpreferential instability of trinucleotide repeats. Itis possible that MutSbeta repairs small loops lesseffectively or asymmetrically, and this leads to again of DNA (Fig. 6D) thus mediating theexpansion process.

We suggest that errant DNA mismatch repairmay be a common denominator amongst the arrayof diseases caused by DNA repeat expansion. Ourresults in combination with findings from Ku et al.(26) and Ezzatizadeh et al. (27) strongly implicateMMR as a critical component of GAA•TTCexpansion. Although formal proof that somaticexpansion contributes to FRDA progression hasyet to be established, from the perspective ofidentifying therapeutic targets, it may eventuallyprove to be a way to address disease progression.For instance, histone deacetylase (HDAC)inhibitors have been an area of intense focus aspotential FRDA therapeutics (67-69). Recently, ithas been reported that histone deacetylasecomplexes promote instability in threshold size(CAG•CTG)20 repeats in budding yeast and humanastrocytes. HDAC inhibitors targeting thosecomplexes strongly reduced the propensity of the(CAG•CTG)20 repeats to expand (70). If thiseffect translates to the longer GAA•TTC repeats inFRDA, then the HDAC inhibitors currently beingstudied as potential FRDA therapeutics may servedouble duty by: 1) increasing transcription throughthe repeat and 2) suppressing further expansion.MutSbeta is key to GAA•TTC expansion; ifsomatic expansion is confirmed to contribute toFRDA progression, then MutSbeta should betargeted therapeutically. Notably however, thetranslational potential of MSH2, an essentialcomponent of MutSbeta, is limited because MSH2inactivation is strongly associated with hereditarynonpolyposis colorectal cancer (HNPCC) (71,72).MSH3 however, has limited association withcancer pathology. Multiple studies have shownthat MSH3 both contributes and is rate-limiting toCAG•CTG repeat expansion (12-16). MSH3 hasbeen considered a potential therapeutic target inthe context of CAG•CTG repeat expansions(3,16,52). Accordingly, because we havedemonstrated that MSH3 expression is requiredfor GAA•TTC expansion in primary FRDApatient cells, it is possible to extend thisconsideration to FRDA.

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

10

REFERENCES1. Campuzano, V., Montermini, L., Molto, M. D., Pianese, L., Cossee, M., Cavalcanti, F., Monros, E., Rodius, F.,

Duclos, F., Monticelli, A., Zara, F., Canizares, J., Koutnikova, H., Bidichandani, S. I., Gellera, C., Brice, A.,Trouillas, P., De Michele, G., Filla, A., De Frutos, R., Palau, F., Patel, P. I., Di Donato, S., Mandel, J. L.,Cocozza, S., Koenig, M., and Pandolfo, M. (1996) Science 271, 1423-1427

2. Gatchel, J. R., and Zoghbi, H. Y. (2005) Nat Rev Genet 6, 743-7553. Lopez Castel, A., Cleary, J. D., and Pearson, C. E. (2010) Nat Rev Mol Cell Biol 11, 165-1704. Durr, A., Cossee, M., Agid, Y., Campuzano, V., Mignard, C., Penet, C., Mandel, J. L., Brice, A., and Koenig,

M. (1996) N Engl J Med 335, 1169-11755. Cossee, M., Schmitt, M., Campuzano, V., Reutenauer, L., Moutou, C., Mandel, J. L., and Koenig, M. (1997)

Proc Natl Acad Sci U S A 94, 7452-74576. Montermini, L., Kish, S. J., Jiralerspong, S., Lamarche, J. B., and Pandolfo, M. (1997) Neurology 49, 606-6107. Bidichandani, S. I., Ashizawa, T., and Patel, P. I. (1998) Am J Hum Genet 62, 111-1218. Ohshima, K., Montermini, L., Wells, R. D., and Pandolfo, M. (1998) J Biol Chem 273, 14588-145959. Sakamoto, N., Chastain, P. D., Parniewski, P., Ohshima, K., Pandolfo, M., Griffith, J. D., and Wells, R. D.

(1999) Mol Cell 3, 465-47510. Grabczyk, E., and Usdin, K. (2000) Nucleic Acids Res 28, 2815-282211. Saveliev, A., Everett, C., Sharpe, T., Webster, Z., and Festenstein, R. (2003) Nature 422, 909-91312. Manley, K., Shirley, T. L., Flaherty, L., and Messer, A. (1999) Nat Genet 23, 471-47313. van den Broek, W. J., Nelen, M. R., Wansink, D. G., Coerwinkel, M. M., te Riele, H., Groenen, P. J., and

Wieringa, B. (2002) Hum Mol Genet 11, 191-19814. Gomes-Pereira, M., Fortune, M. T., Ingram, L., McAbney, J. P., and Monckton, D. G. (2004) Hum Mol Genet

13, 1815-182515. Foiry, L., Dong, L., Savouret, C., Hubert, L., te Riele, H., Junien, C., and Gourdon, G. (2006) Hum Genet 119,

520-52616. Gonitel, R., Moffitt, H., Sathasivam, K., Woodman, B., Detloff, P. J., Faull, R. L., and Bates, G. P. (2008) Proc

Natl Acad Sci U S A 105, 3467-347217. Pearson, C. E., Ewel, A., Acharya, S., Fishel, R. A., and Sinden, R. R. (1997) Hum Mol Genet 6, 1117-112318. Moore, H., Greenwell, P. W., Liu, C. P., Arnheim, N., and Petes, T. D. (1999) Proc Natl Acad Sci U S A 96,

1504-150919. Kovtun, I. V., and McMurray, C. T. (2001) Nat Genet 27, 407-41120. Owen, B. A., Yang, Z., Lai, M., Gajec, M., Badger, J. D., 2nd, Hayes, J. J., Edelmann, W., Kucherlapati, R.,

Wilson, T. M., and McMurray, C. T. (2005) Nat Struct Mol Biol 12, 663-67021. Kolodner, R. D., Hall, N. R., Lipford, J., Kane, M. F., Rao, M. R., Morrison, P., Wirth, L., Finan, P. J., Burn, J.,

Chapman, P., and et al. (1994) Cold Spring Harb Symp Quant Biol 59, 331-33822. Jiricny, J. (2006) Nat Rev Mol Cell Biol 7, 335-34623. Palombo, F., Iaccarino, I., Nakajima, E., Ikejima, M., Shimada, T., and Jiricny, J. (1996) Curr Biol 6, 1181-

118424. Genschel, J., Littman, S. J., Drummond, J. T., and Modrich, P. (1998) J Biol Chem 273, 19895-1990125. Kim, H. M., Narayanan, V., Mieczkowski, P. A., Petes, T. D., Krasilnikova, M. M., Mirkin, S. M., and

Lobachev, K. S. (2008) EMBO J 27, 2896-290626. Ku, S., Soragni, E., Campau, E., Thomas, E. A., Altun, G., Laurent, L. C., Loring, J. F., Napierala, M., and

Gottesfeld, J. M. (2010) Cell Stem Cell 7, 631-63727. Ezzatizadeh, V., Pinto, R. M., Sandi, C., Sandi, M., Al-Mahdawi, S., Te Riele, H., and Pook, M. A. (2012)

Neurobiol Dis28. De Biase, I., Rasmussen, A., Monticelli, A., Al-Mahdawi, S., Pook, M., Cocozza, S., and Bidichandani, S. I.

(2007) Genomics 90, 1-529. De Biase, I., Rasmussen, A., Endres, D., Al-Mahdawi, S., Monticelli, A., Cocozza, S., Pook, M., and

Bidichandani, S. I. (2007) Ann Neurol 61, 55-6030. Pelletier, R., Farrell, B. T., Miret, J. J., and Lahue, R. S. (2005) Nucleic Acids Res 33, 5667-567631. Lin, Y., Dion, V., and Wilson, J. H. (2006) Nat Struct Mol Biol 13, 179-18032. Ditch, S., Sammarco, M. C., Banerjee, A., and Grabczyk, E. (2009) PLoS Genet 5, e100070433. Calmels, N., Seznec, H., Villa, P., Reutenauer, L., Hibert, M., Haiech, J., Rustin, P., Koenig, M., and Puccio, H.

(2009) BMC Neurol 9, 4634. Grabczyk, E., and Usdin, K. (1999) Anal Biochem 267, 241-243

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

11

35. Ding, Y., Chan, C. Y., and Lawrence, C. E. (2004) Nucleic Acids Res 32, W135-14136. Reiser, J., Lai, Z., Zhang, X. Y., and Brady, R. O. (2000) J Virol 74, 10589-1059937. Marino, M. P., Luce, M. J., and Reiser, J. (2003) Methods Mol Biol 229, 43-5538. Plotz, G., Raedle, J., Brieger, A., Trojan, J., and Zeuzem, S. (2002) Nucleic Acids Res 30, 711-71839. Panigrahi, G. B., Slean, M. M., Simard, J. P., Gileadi, O., and Pearson, C. E. (2010) Proc Natl Acad Sci U S A

107, 12593-1259840. Chang, D. K., Ricciardiello, L., Goel, A., Chang, C. L., and Boland, C. R. (2000) J Biol Chem 275, 2917841. Tome, S., Holt, I., Edelmann, W., Morris, G. E., Munnich, A., Pearson, C. E., and Gourdon, G. (2009) PLoS

Genet 5, e100048242. Drummond, J. T., Genschel, J., Wolf, E., and Modrich, P. (1997) Proc Natl Acad Sci U S A 94, 10144-1014943. Zuker, M. (2003) Nucleic Acids Res 31, 3406-341544. Al-Mahdawi, S., Pinto, R. M., Ruddle, P., Carroll, C., Webster, Z., and Pook, M. (2004) Genomics 84, 301-31045. Clark, R. M., De Biase, I., Malykhina, A. P., Al-Mahdawi, S., Pook, M., and Bidichandani, S. I. (2007) Hum

Genet 120, 633-64046. Zhang, H., Richards, B., Wilson, T., Lloyd, M., Cranston, A., Thorburn, A., Fishel, R., and Meuth, M. (1999)

Cancer Res 59, 3021-302747. Brown, K. D., Rathi, A., Kamath, R., Beardsley, D. I., Zhan, Q., Mannino, J. L., and Baskaran, R. (2003) Nat

Genet 33, 80-8448. Pabla, N., Ma, Z., McIlhatton, M. A., Fishel, R., and Dong, Z. (2011) J Biol Chem 286, 10411-1041849. Acharya, S., Wilson, T., Gradia, S., Kane, M. F., Guerrette, S., Marsischky, G. T., Kolodner, R., and Fishel, R.

(1996) Proc Natl Acad Sci U S A 93, 13629-1363450. Nakamori, M., Pearson, C. E., and Thornton, C. A. (2011) Hum Mol Genet 20, 580-58851. Koeppen, A. H. (2011) J Neurol Sci 303, 1-1252. Dragileva, E., Hendricks, A., Teed, A., Gillis, T., Lopez, E. T., Friedberg, E. C., Kucherlapati, R., Edelmann,

W., Lunetta, K. L., MacDonald, M. E., and Wheeler, V. C. (2009) Neurobiol Dis 33, 37-4753. Shaw, G., Morse, S., Ararat, M., and Graham, F. L. (2002) FASEB J 16, 869-87154. Graham, F. L., Smiley, J., Russell, W. C., and Nairn, R. (1977) J Gen Virol 36, 59-7455. Ohshima, K., Kang, S., Larson, J. E., and Wells, R. D. (1996) J Biol Chem 271, 16773-1678356. Grabczyk, E., Mancuso, M., and Sammarco, M. C. (2007) Nucleic Acids Res 35, 5351-535957. Yu, A., Dill, J., and Mitas, M. (1995) Nucleic Acids Res 23, 4055-405758. Smith, G. K., Jie, J., Fox, G. E., and Gao, X. (1995) Nucleic Acids Res 23, 4303-431159. Gacy, A. M., Goellner, G., Juranic, N., Macura, S., and McMurray, C. T. (1995) Cell 81, 533-54060. Darlow, J. M., and Leach, D. R. (1998) J Mol Biol 275, 17-2361. Lin, Y., Dent, S. Y., Wilson, J. H., Wells, R. D., and Napierala, M. (2010) Proc Natl Acad Sci U S A 107, 692-

69762. Reddy, K., Tam, M., Bowater, R. P., Barber, M., Tomlinson, M., Nichol Edamura, K., Wang, Y. H., and

Pearson, C. E. (2011) Nucleic Acids Res 39, 1749-176263. Pearson, C. E., and Sinden, R. R. (1996) Biochemistry 35, 5041-505364. Coggins, L. W., and O'Prey, M. (1989) Nucleic Acids Res 17, 7417-742665. Dowen, J. M., Putnam, C. D., and Kolodner, R. D. (2010) Mol Cell Biol 30, 3321-332866. Gupta, S., Gellert, M., and Yang, W. (2012) Nat Struct Mol Biol 19, 72-7867. Herman, D., Jenssen, K., Burnett, R., Soragni, E., Perlman, S. L., and Gottesfeld, J. M. (2006) Nat Chem Biol 2,

551-55868. Rai, M., Soragni, E., Chou, C. J., Barnes, G., Jones, S., Rusche, J. R., Gottesfeld, J. M., and Pandolfo, M.

(2010) PLoS One 5, e882569. Soragni, E., Xu, C., Cooper, A., Plasterer, H. L., Rusche, J. R., and Gottesfeld, J. M. (2011) Methods Mol Biol

793, 495-50870. Debacker, K., Frizzell, A., Gleeson, O., Kirkham-McCarthy, L., Mertz, T., and Lahue, R. S. (2012) PLoS Biol

10, e100125771. Leach, F. S., Nicolaides, N. C., Papadopoulos, N., Liu, B., Jen, J., Parsons, R., Peltomaki, P., Sistonen, P.,

Aaltonen, L. A., Nystrom-Lahti, M., and et al. (1993) Cell 75, 1215-122572. Fishel, R., Lescoe, M. K., Rao, M. R., Copeland, N. G., Jenkins, N. A., Garber, J., Kane, M., and Kolodner, R.

(1993) Cell 75, 1027-1038

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

12

Acknowledgements—We thank Minna Nystrom for generously sharing an hMsh3 cDNA clone and PatrickDoring for technical assistance with shRNA cloning during a laboratory rotation.

FOOTNOTES*This work was supported by grants from the National Institutes of Health (R01NS046567), theFriedreich's Ataxia Research Alliance (http://www.curefa.org/), the LSUHSC Research EnhancementFund to EG and by National Institutes of Health (F30AG042263) to AH.1To whom correspondence should be addressed: Ed Grabczyk, Department of Genetics, LSU HealthSciences Center, 533 Bolivar St, New Orleans, LA, USA, Tel.: (504) 568-6154; Fax: (504)-568-8500; E-mail: egrabc@lsuhsc.edu1#Current address: Department of Molecular Genetics & Microbiology, University of Texas, Austin TX787122The abbreviations used are: FRDA, Friedreich ataxia; TNR, trinucleotide repeat; FXN, frataxin; MMR,mismatch repair; MSH, MutS Homologue.

FIGURE LEGENDS

FIGURE 1. DNA repair knockdown experiments indicate a role for mismatch repair in GAA•TTCexpansion. Partial knockdown of MSH2 or MSH3 but not MSH6 slows GAA•TTC repeat expansion inhuman cells. A. PCR analysis of (GAA•TTC)176 inserts at week 3 as compared to day 0 (T0). Plasmidconstructs express the indicated shRNA; pLKO is the empty vector control. Knockdowns wereperformed for each gene using two shRNA sequences chosen from The RNAi Consortium (TRC) shRNALibrary. The pLKO vector conferred puromycin resistance and all knockdown cells were selected andmaintained in media containing puromycin. Marker lane (M): 1Kb plus size standard showing 2kb, 1650bp, 1kb and 850 bp. Primers used add 655 bp to length of the repeat. B. Western blot analysis illustratesprotein expression levels for MSH2, MSH3, MSH6 and XPA in each respective knockdown. Proteinexpression was quantified in biological triplicate for each targeted knockdown. Average residualexpression was: 35% for MSH2, 24% for MSH3, 38% for MSH6 and 61% for XPA. Beta Actin (ACTB)served as a loading control.

FIGURE 2. Biological and technical reproducibility of reduction in expansion rate of a (GAA•TTC)352repeat with transfection of a plasmid expressing MSH2 shRNA. A. PCR analysis of the (GAA•TTC)352insert at day 0 (T0) and 4 weeks post-transfection (W4) with empty pLKO construct (C) and an MSH2shRNA construct. The left, middle and right panels are experiments performed on separate clonal isolatesof cells bearing the (GAA•TTC)352 constructs. This is intended to show the range of starting sizes,appearance of repeats in different isolates, and the reproducibility of time course experiments. M: 1 Kbplus size standard showing 3 kb, 2 kb, 1650 bp, and 1kb. Primers used add 655 bp to length of the repeat.B. Mean gain in repeat number relative to time 0 for cells transfected with the no shRNA control (lanepLKO) or the MSH2 shRNA expression plasmid (lane MSH2). Error bars represent the SEM for n = 3(p<0.05). The mean number of repeats gained is shown next to the error bars in each column. C. Westernblot analysis for MSH2 knockdown of each clone. Average residual expression was: 65% for MSH2,62% for MSH3 and 29% for MSH6. Beta Actin (ACTB) was used as a loading control.

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

13

FIGURE 3. Lentiviral-mediated knockdown of MSH2 or MSH3 reduces expansion rate of a(GAA•TTC)176 tract. A. DNA mobility indicates the size of GAA•TTC repeats in model cells at time 0(Control), a non-targeted lentivirus (pLKO) after four weeks of culture, an shRNA lentivirus targetingMSH2 (MSH2sh), or a pool of three lentiviral vectors targeting MSH3 (MSH3sh). Lane M contains the 1Kb plus size standard showing 2 kb and 1650 bp. Primers used add 655 bp to length of the repeat. B.The repeat expansion rate was reduced 4-fold and 2-fold by MSH2- and MSH3-knockdown, respectively.The mean number of repeats gained is shown next to the error bars in each column. Both weresignificantly slower than the pLKO control (p<0.05). Error bars represent SEM for n=4. C. Western blotanalysis of MSH2, MSH3 and MSH6 levels from extracts of the same cells as in panel A. Knockdown ofMSH2 caused reduction in expression of MSH3 and MSH6 while MSH2 and MSH6 protein expressionlevels were not severely reduced with MSH3 knockdown. MSH protein levels were quantified based onn=4 samples. When MSH2 was targeted expression of MutS subunits averaged 40%, 25% and 11% forMSH2, MSH3 and MSH6, respectively. Similar analysis of MSH3 targeted by shRNA revealed proteinexpression levels of 84%, 34% and 73% for MSH2, MSH3 and MSH6, respectively.

FIGURE 4. MutSbeta is essential to expansion of GAA•TTC repeat tracts. Figure illustrates specificrescue of MSH2 and MSH3 knockdowns by cDNA expression of the targeted MutSbeta subunit. Cellswith MSH2 knockdown (A and B), MSH3 knockdown (C and D) or no shRNA control (E and F) weretransduced with lentiviral vectors expressing EGFP (lane GFP), EGFP plus MSH2 cDNA (lane +M2) orEGFP plus MSH3 cDNA (lane +M3). DNA was extracted from cells that had been in culture for 3weeks. GAA•TTC repeats were subsequently sized using PCR analysis. DNA gels (seen in A, C, and E)are flanked with the 1 Kb plus size standard showing 2 kb, 1650 bp, and 1 kb. Primers used add 655 bpto length of repeats. Beta-actin (ACTB) was used as a loading control in western blots. A. DNA profilesof MSH2-knockdown cells. B. Western blot, corresponding to samples in A, probed for MutS subunits.Control (lane C) is HEK293 extract with no shRNA. C. DNA profiles of MSH3-knockdown cells. D.Western blot corresponding to samples in panel C, probed for MutS subunits (as in B). E. DNA profilesof no shRNA control (mock knockdown) cells transduced with GFP and cDNA for MSH2 and MSH3. F.Western blot corresponding to samples in E that were probed for MutS subunits (as in B and D). G.Quantitative analysis of experiments in panel A, n=2. H. Quantitative analysis of experiments in C. Errorbars represent the SEM for n=12 (p<0.05).

FIGURE 5. Ectopic expression of MSH3 induces GAA•TTC expansion in both FXN alleles of an FRDApatient fibroblast (GM04078). Primary FRDA patient fibroblasts (GM04078, GM03816, and GM03655)were transduced with lentiviral vectors expressing EGFP alone (GFP), EGFP plus MSH2 cDNA (+M2),EGFP plus MSH3 cDNA (+M3) or EGFP plus MSH2 and MSH3 cDNA (+M2, +M3). RepresentativeDNA and protein expression profiles from GM04078 are illustrated. Experiments were performed inbiological triplicate and in technical replicates of at least n=4. DNA was extracted from cells that hadbeen in culture for 6 weeks. A. DNA profiles of non-dividing cells (n=4) and B. DNA profiles ofdividing cells (n=4). The double-sided arrow between A and B marked "L" indicates the large allele and“S” demarcates the small allele. Note that faintly visible background bands at top and bottom of gel inpanel A do not show altered mobility. Gels are flanked by the 1 Kb plus size standard showing 2kb and1650 base pairs. The primers used add 498 bp to the size of the GAA•TTC repeat. C. Western blotprobed for MSH2, MSH3 and MSH6 illustrating low endogenous expression levels of MutSbeta subunitsand the effective lentiviral-mediated supplementation of MSH2 and MSH3. Beta-actin (ACTB) was usedas a loading control.

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

MutSbeta promotes GAA•TTC expansion

14

FIGURE 6. Transcription leads to small loop targets for MutSbeta in model of GAA•TTC repeatexpansion. A. Part of a GAA•TTC repeat is depicted with the purine (or R) strand in red, and thepyrimidine (or Y) strand in yellow. The numbers associated with the bases indicate that the bases areregistered in alignment. B. During transcription the two strands may be separated by formation of avariety of structures, one example is depicted here (56). C. Resolution of a structure can lead to an out-of-register re-annealing within the repeat. The slipped annealing leads to a small GAA bubble at triplet86. This small loop becomes a substrate for MutSbeta. A compensatory bubble in the TTC strandelsewhere in the molecule may provide an alternative target for MutSbeta (not shown). D. Shows TNRexpansion has occurred with the addition of a single trinucleotide (*) after repair initiated by MutSbeta.

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

pLKOMSH2 MSH3 MSH6 XPA pLKO T0T0 MM3 Weeks with shRNA

A

B

pLKO MSH2 MSH3 MSH6 XPAshRNA Target

MSH6MSH3MSH2

XPA

ACTB

MutSbeta promotes GAA•TTC expansion

15

Figure 1

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

C1T0

pLKOW4

MSH2W4 MM

C2T0

pLKOW4

MSH2W4

C3T0

pLKOW4

MSH2W4

3000

2000

1650

1000

120

80

0pLKO MSH2sh

40

112.0

27.3

B

A

C

MSH6MSH3MSH2

ACTB

LKO1

2sh1

LKO2

2sh2

LKO3

2sh3

MutSbeta promotes GAA•TTC expansion

16

Figure 2

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

ControlT0

MSH2shW4

MSH3shW4

pLKOW4

A

MSH6MSH3MSH2

ACTB

Control MSH2sh MSH3shpLKOC

B

0

20

40

52.1

13

24.7

pLKO MSH2sh MSH3sh

M

MutSbeta promotes GAA•TTC expansion

17

Figure 3

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

T0+M2 +M3GFP

A

C

C

MSH6MSH3MSH2

ACTB

MSH6MSH3MSH2

ACTB

MSH2 knockdownWeek 3

MSH2knockdown

+M2 +M3GFPWeek 3T0

+M2 +M3GFP

B

DMSH3 knockdown

C

MSH3knockdown

+M2 +M3GFP

E F

0

20

40

60

80

G H

0

20

40

60

80

+M2 +M3GFP

MSH2 knockdown MSH3 knockdown

+M2 +M3GFP

MSH6MSH3MSH2

ACTB

+M2 +M3GFPWeek 3T0

Mock knockdown (pLKO)

C

Mock (pLKO)knockdown

+M2 +M3GFP

MutSbeta promotes GAA•TTC expansion

18

Figure 4

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

GFP +M2 +M3+M2+M3 GFP +M2 +M3

+M2+M3

MSH2

A BNON-DIVIDING Cells DIVIDING Cells

CWestern blots

GFP +M2 +M3+M2+M3

ACTB

MSH3

"L"

"S"

MutSbeta promotes GAA•TTC expansion

19

Figure 5

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

••••••••••••••••••••••••••••••

A

B

C

D

••••••••••••••••••••••••••••••

•••••••••••••••••••••••••••••••••

*

MutSbeta promotes GAA•TTC expansion

20

Figure 6

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from

Anasheh Halabi, Scott Ditch, Jeffrey Wang and Ed Grabczykhuman cells

DNA mismatch repair complex MutSbeta promotes GAA·TTC repeat expansion in

published online July 11, 2012J. Biol. Chem. 

  10.1074/jbc.M112.356758Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on Decem

ber 27, 2019http://w

ww

.jbc.org/D

ownloaded from