I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in...
-
Upload
zoe-flowers -
Category
Documents
-
view
215 -
download
2
Transcript of I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in...
![Page 1: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/1.jpg)
I. Utility and use of zebrafish as model for understanding angiogenesis.
II. VEGF signaling in zebrafish during angiogenesis.
III. Mathematical modeling of angiogenesis
Cell signaling, endothelial migration, and zebrafish: a simplified model for angiogenesis
Khalid Boushaba, Jeffrey Essner, and Howard LevineIowa State University
![Page 2: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/2.jpg)
Cell signaling, endothelial migration, and zebrafish: a simplified model for angiogenesis
![Page 3: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/3.jpg)
Zebrafish as a High-throughput Model for Angiogenesis Research and Therapeutic Development
Large number of offspringOptically clear embryosShort generation timeSmall SizeForward Genetics:
ENU mutagenesisInsertional mutagenesis
Reverse Genetics:Transgenic fishTilling with ENUMorpholino injection
Genomics:Sequenced GenomecDNA projectsMicroarrays
Small Molecule Screens:Predictive of higher vertebratesDelivery by injection or soaking
Carcinogenesis: Aqueous deliverySimilar to human tumors
![Page 4: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/4.jpg)
Zebrafish embryos are optically clear and develop rapidly
QuickTime™ and aPhoto - JPEG decompressor
are needed to see this picture.
From Karlstrom and Kane, 1996
![Page 5: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/5.jpg)
From Yancopoulos et al., 2000
Model of Tumor Angiogenesis
Novel Angiogenic
Factors Candidate Anti-Tumor
Agents
![Page 6: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/6.jpg)
Advantages of Studying Angiogenesis in Zebrafish
Angiogenesis is a conserved vertebrate-specific function
Analysis in living embryos
2.7 dpf
QuickTime™ and aH.264 decompressor
are needed to see this picture.
![Page 7: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/7.jpg)
Transgenic zebrafish allow analysis of endothelial cells in living embryos
fli1-egfp transgenic embryo at 2 dpf
Dorsal AortaDorsal Aorta(DA)(DA)
Posterior Cardinal Vein(PCV)
Intersegmental VesselsIntersegmental Vessels(Se)(Se)
Dorsal Longitudinal Anastomotic VesselDorsal Longitudinal Anastomotic Vessel(DLAV)(DLAV)
Caudal Vein Caudal Vein Capillary PlexusCapillary Plexus
![Page 8: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/8.jpg)
Advantages of Studying Angiogenesis in Zebrafish
Microangiography: analysis of blood flow in living embryos
![Page 9: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/9.jpg)
The intersegmental vessels form by sprouting angiogenesis
QuickTime™ and aPhoto - JPEG decompressor
are needed to see this picture.
![Page 10: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/10.jpg)
ve-cadherin expression identifies primitive endothelial cells in the early zebrafish embryo
![Page 11: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/11.jpg)
Primary angiogenesis in the trunk and tail are apparent at 24 hpf
ve-cadherin in situ hybridization
![Page 12: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/12.jpg)
Each intersomitic vessel is composed of three endothelial cells
fli1-egfp transgenic embryo at 2 dpf
![Page 13: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/13.jpg)
QuickTime™ and aCinepak decompressor
are needed to see this picture.
QuickTime™ and aCinepak decompressor
are needed to see this picture.
fli1/gfp embryos allow the behavior of individual cells to be followed during primary angiogenesis
Movies from Brant Weinstein’s lab at the NIH
![Page 14: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/14.jpg)
Discovery Genomics, Inc.
Karl J. ClarkJon LarsonAidas NaseviciusShannon Wadman Perry B. Hackett
Iowa State University
Hsin-Kai LiaoYing WangDanhua ZhangKatie Lutz
University of Minnesota
Eleanor ChenStephen C. Ekker
Max-Planck Institute - Freiburg
Matthias Hammerschmidt
Angiogenetics, AB
Mats Hellstrom
![Page 15: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/15.jpg)
Mechanism of Morpholino Phosphoramidate Inhibition
60S60S40S AUGAUGACCGGUAUUAGUCCGGACCUAGUAG•••••••AAAAA40S
40S
60S
Inhibition of Translation
40S AUGAUGACCGGUAUUAGUCCGGACCUAGUAG•••••••AAAAA
40SMPO
Encoded Protein
BASEn
NP
N
O
O
O
N
OO BASEn+1
P
N
O
CH3
CH3
CH3CH3
Antisense oligonucleotidesDesigned as 25 mersBind tightly Resistant to digestionLow toxicityNot RNAseH mediated
![Page 16: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/16.jpg)
Microinjection : An Efficient MorpholioDelivery System
InjectionSite
Nasevicius andEkker (2000, 2001)
Easy to perform:can inject thousandsof embryos per day
0 hr
1.5 hrs 4 hrs
28 hrs
![Page 17: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/17.jpg)
Microarray Pre-selection vs. Random Selection
Discovery Genomics, Inc. /AngioGenetics AB Pilot Screen:
Targets were pre-selected basedon microarray data.
16% of genes (8/50) were identified as angiogenesis candidates.
Random ENU Mutagenesis screens:
Genes are mutated randomly with a chemical mutagen in a forward genetic screen (Habeck et al., 2002). Subsequent gene identification is difficult.
0.5% of genes (approximately 1/200) are estimated to affect angiogenesis.DGI/AG Screen
16%
SelectedCandidates
Random Screens SelectedCandidates
0.5%
![Page 18: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/18.jpg)
Syndecan-2 VEGF/VEGFR1&2
erm1
?
F-actin
?
?
erm1 may associate with Syndecan-2 during vascular formation to transmit VEGF-signaling
![Page 19: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/19.jpg)
Migration
VEGFR2 (flk1)
Hypothesis I: endothelial migration is dependent on the concentration of VEGF
VEGF
![Page 20: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/20.jpg)
The embryonic midline influences vasculogenesis and angiogenesis by inducing VEGF expression
Lawson et al., 2001
![Page 21: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/21.jpg)
VEGF is required for the correct number of endothelial cells
ve-cadherin expression
![Page 22: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/22.jpg)
Vasculogenesis is dependent on VEGF in zebrafish embryos
Wt VEGF MO
3 dpf
QuickTime™ and aH.264 decompressor
are needed to see this picture.
![Page 23: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/23.jpg)
VEGF-A is required for vasculogenesis in zebrafish
Microangiography allows high resolution mapping of mature vessels.
Nasevicius et al., 2000
![Page 24: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/24.jpg)
Migration of the intersegmental vessels is severely affected in VEGF-Aknockdown embryos at 2 dpf
Wt VEGF-A
![Page 25: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/25.jpg)
Migration
VEGFR2 (flk1)
Endothelial migration is dependent on the concentration of VEGF
VEGF
VEGFR2 (flk1)
VEGF
Wt VEGF MO
![Page 26: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/26.jpg)
Formation of the intersegmental vessels by sprouting angiogenesis requires VEGF
Zebrafish ve-cadherin expression at 48 hpf
![Page 27: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/27.jpg)
Planar transcytosis
Argosomes
Cytonemes
Restricted diffusion
Gradients can be set up and interpreted in many different ways
![Page 28: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/28.jpg)
Migration
VEGFR2 (flk1)
Endothelial migration is dependent on the concentration of VEGF
VEGF
VEGFR2 (flk1)
VEGF
Wt VEGF MO VEGF MO + hVEGF
VEGFR2 (flk1)
VEGF
Migration
![Page 29: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/29.jpg)
VEGF and VEGFR2/flk1
VEGF signaling is conserved during zebrafish vascular development
In zebrafish there are two flk1 genes: flk1a and flk1b.
Simultaneous knockdown of both flk1a and flk1b resembles VEGF-A knockdown embryos.
![Page 30: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/30.jpg)
Migration
VEGFR2 (flk1)
Endothelial migration is dependent on the concentration of VEGF and VEGFR2
VEGF
VEGFR2 (flk1)
VEGF
wt flk1a and flk1b MO
![Page 31: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/31.jpg)
Syndecan-2, a heparan sulfate-containing proteoglycan, is essential for angiogenic sprouting of blood vessels
Syn2 MO, fli-1WT fli-1
Chen et al., 2004
?
Syndecan-2 VEGF/VEGFR1&2
![Page 32: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/32.jpg)
VEGF 121
VEGF 145
VEGF 165
VEGF 183
VEGF 189
VEGF 206
Heparan Sulfate Binding Region
Vascular Endothelial Growth Factor A (VEGF-A)
Robinson & Stringer, 2001
![Page 33: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/33.jpg)
Migration
VEGFR2 (flk1)
Endothelial migration is dependent on the concentration of VEGF, VEGFR2, and Syndecan-2
VEGF Syndecan2 presenting cells
VEGFR2 (flk1)
VEGF
![Page 34: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/34.jpg)
Syndecan-2
Phosphoserine
Growth Factorand Receptor
A Cell-autonomous B Cell-autonomous Presentation model Complex model
C Cell-nonautonomous, inside-outside signaling model
Syndecan-2 may function in multiple ways
![Page 35: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/35.jpg)
Migration
VEGFR2 (flk1)
Endothelial migration is dependent on the concentration of VEGF
VEGF
VEGFR2 (flk1)
VEGF
wt VEGF +Syn2 MO VEGF MO + hVEGF
VEGFR2 (flk1)
VEGF
Migration
VEGFR2 (flk1)
Syndecan2 presenting cells
![Page 36: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/36.jpg)
Ectodomain
C1 V C2YRMRKKDEGSY DLGERKPSSAAYQKAPTK EFYA
EphB2 PKCEzrin Synbindin
Synectin Syntenin CASK
Phosphorylation sitesSerines and Tyrosines
HS Chains
A
Ezrin
Synectin
F-actin
B C-terminal cytoplasmic domains
![Page 37: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/37.jpg)
Migration
VEGFR2 (flk1)
Endothelial migration is dependent on the concentration of VEGF and VEGF requires Syndecan2 for signaling
VEGF Syndecan2 presenting cells
![Page 38: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/38.jpg)
Mass action law
![Page 39: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/39.jpg)
![Page 40: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/40.jpg)
Biochemical equations
![Page 41: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/41.jpg)
Role of cell cycle and cell movement equations
![Page 42: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/42.jpg)
Cell movement
![Page 43: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/43.jpg)
Full model equations
![Page 44: I.Utility and use of zebrafish as model for understanding angiogenesis. II.VEGF signaling in zebrafish during angiogenesis. III.Mathematical modeling of.](https://reader036.fdocuments.us/reader036/viewer/2022081520/56649e7f5503460f94b83376/html5/thumbnails/44.jpg)