Isolation, Immunophenotyping and Lymphocyte Suppressive Properties of Equine

Cord Blood-Derived Mesenchymal Stromal Cells

by

Laurence Tessier

A Thesis

presented to

The University of Guelph

In partial fulfilment of requirements

for the degree of

Master of Science

in

Biomedical Sciences

Guelph, Ontario, Canada

© Laurence Tessier, September, 2013

ABSTRACT

Isolation, immunophenotyping and lymphocyte suppressive properties of equine cord blood-

derived mesenchymal stromal cells

Laurence Tessier Advisor:

University of Guelph, 2013 Professor T. G. Koch

Multipotent mesenchymal stromal cells (MSC) have attracted interest for their potential in allogeneic

cytotherapy, partly due to their ability to secrete immunosuppressive factors. However, development of

efficacious and reproducible therapies is hampered by a knowledge-gap in equine MSC characterization.

I hypothesized that equine MSC can be consistently isolated from cord blood, have unique and

reproducible marker expression, which includes cytoplasmic Toll-like receptor (TLR) 3 and TLR4, and

in vitro suppress lymphoproliferation. I aimed to establish the immunophenotype of cord blood-derived-

(CB)-MSC before and after cryopreservation and confirm their ability to suppress in vitro

lymphoproliferation. Cultured CB-MSC expressed CD29, CD44, CD90, and not MHC I, MHC II, CD4,

CD8, CD11a/18, and CD73 before and after cryopreservation. CB-MSC suppressed in vitro

lymphoproliferation and constitutively expressed TLR4. These findings suggest anti-inflammatory

properties of CB-MSC. Lack of MHC I expression suggests reduced risk of allorejection. The

relationship between TLR4 and lymphocyte function requires further investigation.

iii

TABLE OF CONTENTS

DECLARATION OF WORK PERFORMED ..................................................................................................... vii

LIST OF TABLES ................................................................................................................................................. viii

LIST OF FIGURES ................................................................................................................................................. ix

LIST OF ABBREVIATIONS .................................................................................................................................. x

INTRODUCTION .................................................................................................................................................... 1

LITERATURE REVIEW ........................................................................................................................................ 3

Characteristics and phenotype of multipotent mesenchymal stromal cells ..................................................... 3

General characteristics and phenotype ................................................................................................................ 3

Flow cytometry ................................................................................................................................................... 6

Antibody-based characterization of equine MSC ............................................................................................... 6

Antigen versus gene expression .......................................................................................................................... 7

Effects of cryopreservation on MSC phenotype ................................................................................................. 8

Temporal phenotype ........................................................................................................................................... 9

Influence of donor age: impact on adult tissue-derived MSC characteristics ..................................................... 9

Embryonic, perinatal and adult sources ............................................................................................................ 10

MSC immunomodulatory properties ................................................................................................................ 10

Selected examples of in vivo MSC immunomodulatory effects ....................................................................... 11

Osteoarthritis ..................................................................................................................................................... 11

Graft-versus-host disease .................................................................................................................................. 12

In vitro MSC properties ...................................................................................................................................... 13

MSC secreted soluble factors ........................................................................................................................... 13

MSC effect on different leukocyte subsets ....................................................................................................... 14

MSC polarization paradigm .............................................................................................................................. 16

Toll-like receptors ............................................................................................................................................. 16

TLR expression ................................................................................................................................................. 20

MSC pro-inflammatory and immunosuppressive phenotypes ......................................................................... 21

RATIONALE .......................................................................................................................................................... 25

HYPOTHESIS ........................................................................................................................................................ 25

iv

OBJECTIVES ......................................................................................................................................................... 25

MATERIALS AND METHODS ........................................................................................................................... 26

Experimental design ......................................................................................................................................... 26

Cord-blood collection and shipping .................................................................................................................. 26

CB-MSC isolation and culture .......................................................................................................................... 27

Colony counting, MSC progenitor frequency, population doubling time and cell morphology ...................... 28

Flow cytometric analysis .................................................................................................................................. 28

Real-time polymerase chain reaction relative quantification ............................................................................ 29

Lymphoproliferation ......................................................................................................................................... 32

Immunocytochemistry ...................................................................................................................................... 33

Statistical analysis ............................................................................................................................................. 34

RESULTS ................................................................................................................................................................ 36

MSC progenitor frequency population doubling time and cell morphology assessment ................................. 36

Expression of CD90 but loss of leukocyte markers after serial passage and cryopreservation of MSC .......... 36

CD29, CD44 and CD90 are highly and consistently expressed on CB-MSC at passage 5 .............................. 40

CB-MSC decrease lymphocyte proliferation in mixed lymphocyte reactions.................................................. 41

CB-MSC constitutively express TLR4 with minimal up-regulation after LPS stimulation ............................. 43

GENERAL DISCUSSION AND FUTURE EXPERIMENTS ............................................................................ 46

REFERENCES........................................................................................................................................................ 52

APPENDIX I - Immune markers and cytokine expression for MSC before and after IL-1B and IL-6

treatment ................................................................................................................................................................. 65

v

ACKNOWLEDGEMENTS

I would like to express my gratitude to the people who have contributed to my graduate experience and

without whom the completion of this program would not have been possible.

I would like to thank my supervisor Dr. Thomas G. Koch for giving me the great opportunity to come to

Guelph and work on such exciting research. Thank you for teaching me so much, for being committed

and for propelling me forward. I am very grateful for your patience, encouragements and understanding

during trying times. Your help and guidance of the last two years were always deeply appreciated.

Thank you to my advisory committee members, Drs. Allan King and Dorothee Bienzle, for their patience

and guidance throughout my Master’s program and for sharing with me their broad experience. Thank

you for your feedback and for providing me with help and resources whenever I needed it. Special

thanks to Dr. Bienzle for her generosity and availability at answering my countless interrogations

throughout the program.

Many thanks to Monica Antenos, Tamas Revay, Esther Semple, Helen Coates, Michelle Ross, Laura

Favetta, Liz St-john, Mary Ellen Clark and Betty-Anne McBey for teaching me and helping me through

laboratory techniques. Thank you to all the members of the Biomedical Sciences department for being

great resources. Special thanks to Monica and Tamas for also helping me with PCR data analysis and to

William Sears for his help with statistical analysis.

Special thanks to the current and former Koch lab members: Carmon, Midori, Sarah, Keith, Lynn, and

Crystal for your help, support and feedback. Special thanks to Carmon Co and Midori Buechli for their

friendship and encouragements and for making my time here so special.

vi

None of this would have been possible without the unconditional love and support of my family. Thank

you for always being there for me. Your support keeps pushing me forward and is deeply appreciated.

vii

DECLARATION OF WORK PERFORMED

I declare that all work submitted for assessment of this thesis is my own work with the exception of the

items indicated below.

Mixed lymphocyte reaction plate was stained by Lynn Williams.

viii

LIST OF TABLES

Introduction

Table 1. Studies of equine MSC surface marker expression.

Table 2. Findings on TLR expression in human MSC.

Materials and methods

Table 1. Nucleotide sequence of primers.

ix

LIST OF FIGURES

Introduction

Figure 1: Immunomodulatory effects of MSC secreted soluble factors on leukocyte subsets.

Figure 2: TLRs and their ligands.

Figure 3: Human TLR signalling.

Figure 4: TLR4 and TLR3 intracellular signalling.

Figure 5: MSC polarization paradigm.

Materials and methods

Figure 1: Experimental design.

Results

Figure 2: CB-MSC morphology.

Figure 3: Surface marker expression on leukocytes and CB-MSC.

Figure 4: Gene and protein expression of markers on leukocytes and CB-MSC.

Figure 5: High CD90 expression at passage 5.

Figure 6: CD29, CD44 and CD90 are highly and consistently expressed on CB-MSC at passage 5.

Figure 7: CB-MSC decrease lymphocyte proliferation in mixed lymphocyte reactions.

Figure 8: CB-MSC constitutively express TLR4 with minimal up-regulation after LPS stimulation.

x

LIST OF ABBREVIATIONS

AGGRECAN Cartilage-specific proteoglycan core protein

ANOVA Analysis of variance

APC Antigen presenting cell

AT-MSC Adipose tissue-derived MSC

B2M Beta-2-microglobulin

BLAST Basic local alignment search tool

BM-MSC Bone marrow-derived MSC

BrdU Bromodeoxyuridine

CB-MSC Cord blood-derived MSC

CCL Chemokine ligand

CD Cluster of differentiation

cDNA Complementary DNA

CFU-F Colony-forming-unit–fibroblast

CI Confidence interval

CIITA Class II major histocompatibility complex transactivator

c-Myc v-myc myelocytomatosis viral oncogene homolog

CXCL Chemokine (C-X-C motif) ligand

DAB 3,3'-diaminobenzidine

DMEM Dulbecco’s modified eagle medium

DMSO Dimethyl sulfoxide

EDTA Ethylenediaminetetraacetic acid

FBS Fetal bovine serum

FITC Fluorescein isothiocyanate

xi

HES Hydroxyethyl starch

HGF Hepatocyte growth factor

HLA Human leukocyte antigen

HO-1 Heme oxygenase-1

HPRT1 Hypoxanthine phosphoribosyltransferase 1

HRP Horseradish peroxidase

GVHD Graft-versus-host disease

ICC Immunocytochemistry

IDO Indoleamine-2,3-dioxygenase

IFN-γ Interferon gamma

IL Interleukin

IL1RA Interleukin-1 receptor antagonist

IκB Inhibitor of nuclear factor-kappa-light-chain-enhancer of activated B cells

IKK Inhibitor of nuclear factor-kappa-light-chain-enhancer of activated B cell kinase

iNOS Inducible nitric oxide synthase

IRAK Interleukin-1 receptor-associated kinase

LIF Leukemia inhibitory factor

LPS Lipopolysaccharide

MHC Major histocompatibility complex

MIQE Minimum information for publication of quantitative real-time polymerase chain

reaction experiments

MNC Mononuclear cells

mRNA Messenger RNA

MSC Multipotent mesenchymal stromal cell

MyD88 Myeloid differentiation primary-response protein 88

xii

NANOG Embryonic stem cell specific homeobox protein

NCBI National center for biotechnology information

NF-κB Nuclear factor kappa-light-chain-enhancer of activated B cells

OA Osteoarthritis

OCT4 Octamer-binding transcription factor 4

PAMP Pathogen-associated molecular pattern

PBS Phosphate buffered saline

PEQ PrepaCyte-EQ

PGE-2 Prostaglandin E2

Poly (I:C) Polyinosinic:polycytidylic acid

PRDM14 PR domain zinc finger protein 14

qPCR Quantitative real-time polymerase chain reaction

RPMI Roswell park memorial institute

SSEA Stage-specific embryonic antigen

STRO-1 Stromal cell surface marker-1

TAB Transforming growth factor- -activated kinase -1-binding protein

TAK Transforming growth factor- -activated kinase

TGF-β Transforming growth factor beta

TIR Toll/interleukin-1 receptor

TIRAP Toll/interleukin-1 receptor domain-containing adapter protein

TLR Toll-like receptor

TNAIP6 Tumor necrosis factor-alpha-induced protein 6

TNF-α Tumor necrosis factor alpha

TRAM Toll/interleukin-1 receptor-domain-containing adapter-inducing interferon-β-

related adaptor molecule

xiii

SAS Statistical Analysis System

TRIF Toll/interleukin-1 receptor -domain-containing adapter-inducing interferon-β

UBC Ubiquitin-conjugating enzyme

UEV1A Ubiquitin-conjugating enzyme E2 variant 1

1

INTRODUCTION

Osteoarthritis (OA) and post-traumatic OA (PTOA) are some of the most common causes of equine

lameness (Frisbie et al., 2005). Multipotent mesenchymal stromal cells (MSC) have been suggested as

potential therapeutic candidates for joint cartilage and OA in the horse (Frisbie et al., 2009). Stem cells

therapies in veterinary medicine are becoming increasingly popular for a variety of conditions

(Cyranoski, 2013). However, the stem cell area is unregulated and most therapies have almost no

research to justify their use, which has prompted oversight bodies in several countries to carefully follow

the application of veterinary cell-based therapies (Cyranoski, 2013). Investigation on the use of stem

cells in equine veterinary medicine is of particular importance as the horse industry contributes up to $19

billion to the Canadian economy every year. Horse racing by itself contributes up to $300 million in

provincial and federal taxes. In Canada 963,500 horses reside on 145,000 properties (Equine Canada,

2010). Further investigation of equine stem cell therapies to ensure safe and efficacious treatments is

therefore crucial.

MSC are plastic adherent multipotent cells possessing trilineage differentiation potency toward

adipogenic, chondrogenic and osteogenic cell fates (Dominici et al., 2006). In addition, undifferentiated

MSC are attractive cytotherapy candidates as they are capable of secreting immunosuppressive factors

(Caplan et al., 2006). For this reason MSC have been suggested as potential therapeutic candidates for

joint cartilage and OA in the horse (Frisbie et al., 2009). In support of this anti-inflammatory hypothesis,

MSC has convincingly demonstrated immunosuppressive properties in the treatment of human graft-

versus-host disease (GVHD) where the intravenous infusion of bone marrow-derived (BM) MSC is often

curative of steroid refractory GVHD (Ringden et al., 2006).

No complete and consistent phenotype has been reported for equine CB-MSC with regard to antigen and

gene expression. Although MSC immunosuppressive properties have attracted much interest, there is no

2

identified specific predictive MSC marker. MSC immunomodulation phenotype have recently been

associated with TLR expression, specifically TLR3 and TLR4 (Waterman et al., 2010). However, equine

CB-MSC characterization for these markers as well as their link to in vitro lymphocyte suppression and

in vivo immunosuppression has yet to be established.

Better characterization of equine CB-MSC may allow for more reproducible and effective therapies

through selection of cells with known properties. In this study, equine MSC were derived from cord

blood samples in a consistent manner, and cultured over multiple passages. MSC were cryopreserved

and recovered for additional phenotypic and functional studies. MSC were characterized by flow

cytometric interrogation with a panel of antibodies validated for binding specifically to equine antigens.

Furthermore, for each protein assessed flow cytometrically, a qPCR assay was designed and gene

expression was determined. The ability of MSC to suppress allogeneic lymphoproliferation was

determined, and expression of TLR3 and 4 was investigated by qPCR and ICC. Results suggest

consistent phenotype and function of equine CB-MSC, and expression of TLR4 but not TLR3. These

findings contribute to fundamental knowledge of equine stem cells, and will enable future therapeutic

applications.

3

LITERATURE REVIEW

Characteristics and phenotype of multipotent mesenchymal stromal cells

The first isolation of multipotent mesenchymal stromal cells (MSC) from bone marrow was published in

1968 and involved isolation of a hematopoietic precursor population with plastic adherence properties

and fibroblast-like morphology (Friedenstein et al., 1968). MSC have now been isolated from several

sources such as adipose tissue (Zuk et al., 2001), synovial membrane (De Bari et al., 2001), skeletal

muscle (Williams et al., 1999), dental pulp (d’Aquino et al., 2007), perinatal tissues and placenta (In 't

Anker et al., 2004), amniotic fluid (In 't Anker et al., 2003), umbilical cord blood (Rice et al., 2001),

liver, lung, spleen (in 't Anker et al., 2003) and several other organs (Young et al., 1995).

General characteristics and phenotype

Minimal criteria to define human MSC were established by the International Society for Cellular

Therapy (ISCT) in 2005 and 2006 (Dominici et al., 2006; Horwitz et al., 2005). These included

multipotency, plastic adherence and surface expression of CD73, CD90 and CD105 and absence of

expression of CD11b or CD14, CD45, CD34, CD79a or CD19, and human leukocyte antigen-DR (HLA-

DR) (Dominici et al., 2006). Most studies regarding animal MSC have only addressed the first two

criteria due to lack of antibodies with cross-reactivity to equine epitopes. No consistent surface marker

panel has been established yet for animal MSC. Investigations of equine MSC suggested high expression

of CD90, and low or absent expression of CD73 and CD105 (Iacono et al., 2012; Lange-Consiglio et al.,

2013; De Schauwer1 et al., 2012; De Mattos Carvalho et al., 2009; Ranera et al., 2011; Braun et al.,

2010; Ranera et al., 2012; Maia et al., 2013; Radtke et al., 2013; Pascucci et al., 2011; Raabe et al., 2011;

Guest et al., 2008; Carrade et al., 2012; Lovati et al., 2011; Arnhold et al., 2007). Discrepancy was

observed for CD44 and CD73 expression based on assessment of antigen or gene ( Ranera et al., 2011),

potentially explained by lack of cross-reactivity of antibodies, as also suggested by the authors. A

4

consistent surface marker phenotype for antigen and gene expression of equine MSC is still lacking.

Findings on equine MSC surface marker expression published to date are summarized in Table 1.

Table 1. Studies of equine MSC surface marker expression

Bone marrow Adipose tissue Cord blood

Marker

Surface

antigen

expression

Gene

expression

Surface

antigen

expression

Gene

expression

Surface

antigen

expression

Gene

expression

MHC I ++ to ++++

(14)(15)

+

(1)(13)

++ to ++++

(14)

+ to ++++

(14)(15)

+

(13)

MHC II

-

(14)(15)

Variable

(1)(13)

-

(14)

- to -/+

(2)(14)(15)

+

(2)(13)

CD13 +

(3)

+/- to +

(4)

+

(3)

CD14 -

(15)

+

(5)

+ (% not

specified)

(5)

-to +/-

(6)(15)

CD29 ++++

(3)(14)(15)

+

(1)(3)(13)

++++

(3)(14)

+

(3)

++++

(2)(14)(15)

+

(13)

CD31 -

(3)(7)

-

(3) (7)

CD34 +/-

(3)(8)(9)

-

(3)(5) (7)(10)

+/- to +

(3)(5)(9)

+

(3)(7)

+

(6)

-

(13)

CD44 ++ to ++++

(1)(3)(14)(15)

+

(3)(1)(13)

+ to ++++

(4)(11) (14)

+

(3)(9)

++++

(2)(6)(14)(15)

+

(13)

CD45 +/-

(3)(9)

-

(3)(7)(5)

-/+ to +

(3)(5)(9)

-

(3)(7)

-/+ to +

(2)(6)

CD49d

-

(3)

+

(3)

5

CD73 +

(3)(5)(7)

- (% not

specified)

(5)

+

(3)(7)

Variable

(2)(6)

CD79a -

(15)

-

(2)(15)

CD90 ++++

(3)(8)(9)(14)(15)(16)

+

(3)(5)(7)

++++

(3)(4)(5)(9)(11)(12)(14)

+

(3)(7)(12)

++++

(2)(6)(14)(15)

CD105 +

(1)(3)(5)(7)(13)

(% not

specified)

(5)

+

(3)(7)(12)

Variable

(2)(6)

+

(13)

CD106 +

(3)

+

(3)

CD140b +

(5)

CD146 +

(3)

+

(3)

CD164 +

(5)

(% not

specified)

(5)

CD166 +

(1)(3)(7)

+

(3)(7)

Stromal cell

surface

marker-1

(STRO-1)

+/++

(11)

Surface antigen expression: (-): negative, (+/-): <5%, (+): 5-25%, (++): 25-50%, (+++): 50-75%,

(++++): 75-100%

Gene expression: (-) transcript detected, (+) transcript not detected

References : (1)Lange-Consiglio et al., 2013; (2) De Schauwer1 et al., 2012; (3) Ranera et al., 2011; (4)

De Mattos Carvalho et al., 2009; (5) Braun et al., 2010; (6) Iacono et al., 2012; (7) Ranera et al., 2012;

(8) Maia et al., 2013; (9) Radtke et al., 2013; (10) Violini et al., 2009; (11) Pascucci et al., 2011; (12)

Raabe et al., 2011; (13) Lovati et al., 2011; (14) Carrade et al., 2012; (15) Guest et al., 2008; (16)

Arnhold et al. (2007).

6

Flow cytometry

Flow cytometry is a very powerful technique allowing single cell analysis of multiple parameters within

a heterogeneous cell population. However, it is prone to artefact from non-specific antibody binding, and

cells with high autofluorescence, as reported for human macrophages, may yield false positive signals

(Li et al., 2012). Rigorous controls and confirmation methods should be used, particularly when looking

at intra-cellular epitopes or weak fluorescence, or when using low-affinity antibodies (Li et al., 2012).

Quantitative flow cytometry data should be confirmed with other qualitative or quantitative assays such

as qPCR, Western blot (Li et al., 2012) or confocal microscopy (De Schauwer1 et al., 2012). A protocol

for equine cells phenotyping incorporating antibody-binding assessment on positive control cells and

equine cells by flow cytometry and confocal microscopy was recently reported (De Schauwer1 et al.,

2012). Proper assessment is becoming increasingly necessary, in particular with quantitative multi-color

flow cytometry, since manual compensation and precise population gating are major sources of

variability, even when working with standardized protocols (Maecker et al., 2005).

Antibody-based characterization of equine MSC

A major challenge for equine MSC characterization is the lack of cross-reactive antibodies (Ibrahim et

al., 2007), likely contributing to discrepancies across reports as a consequence of false-positive and

false-negative results. Ranera et al. (2012) found gene expression with qPCR for CD44, CD73 and

CD105, but no antigen expression based on flow cytometry on bone marrow (BM)- and adipose tissue-

(AT)- derived MSC. The authors attributed this discrepancy to lack of antibody cross-reactivity. In

addition, it is important to account for variability in reagents, such as use of directly or indirectly labelled

antibodies, different epitope specificity, and variable lots of antibody, as demonstrated by Radcliffe et al.

(2010). In that study, a CD45RB antibody, previously validated for equine species, yielded inconsistent

flow cytometry results and had non-specific reactivity on Western blot analysis. These results were

validated with gene expression.

7

The use of trypsin/ethylenediaminetetraacetic acid (EDTA) for cell detachment is common practice for

sub-culture of adherent cells. To allow for detachment, proteolytic activity of trypsin causes the cleavage

of surface proteins. This was reported to potentially affect surface expression as detected by flow

cytometry (Corver et al., 1995), inducing additional false-negative results. Generalized proteome

disruption was also reported following sub-culture with 0.05% trypsin-EDTA (Huang1 et al., 2010).

Alternatives to trypsin such as StemPro® Accutase® and Accumax®, marine-origin enzymes with

proteolytic and collagenolytic activity, were reported as more suitable for analysis of surface expression

of CD133 on central nervous system (CNS) cells as compared to trypsin (Panchision et al., 2007; Singh

et al., 2004). Accutase and Accumax were reported to be gentler than trypsin, but the exact composition

of this enzyme mixture is proprietary.

Antigen versus gene expression

Ranera et al. (2012) suggested the lack of antibody-based characterization of equine MSC could be

circumvented by assessing gene expression alone. Gene expression analysis is a very useful tool, but use

as a proxy for protein expression with no additional validation might be inappropriate as many

regulatory processes are involved in the production of a protein from the initial gene transcript. In some

cases, only 40% of protein abundance was accounted for by messenger RNA (mRNA) analysis, while

the remaining 60% were considered due to post-transcriptional regulatory processes (Maier et al., 2009;

Vogel et al., 2013). Estimation of protein levels from mRNA expression, based on the assumption that

mRNA abundance is the main determinant of protein concentration, might therefore be unreliable (Vogel

et al., 2013). In addition, the importance of validating quantitative gene expression assays is still

underestimated (Bar et al., 2012). This review does not cover detailed description of PCR, however

inaccurate estimation of enzyme kinetics, efficiency (Bar et al., 2012; Rutledge et al., 2008) and

thresholds (Ruijter et al., 2009) can profoundly affect robustness of qPCR data.

8

Effects of cryopreservation on MSC phenotype

Cryopreservation allows long-term storage and is a critical step as cryopreserved cells are often used as a

proxy for in vivo experiments. Cell viability and attachment are proposed criteria for indicating

successful cryopreservation of human MSC (Xu et al., 2012). Loss of ability to suppress in vitro

lymphoproliferation immediately after thawing has been reported (François1 et al., 2012). Ability,

however, recovered following a seven-day culture period, suggesting that modifications induced in the

cryopreservation process might be reversible. Conserved CD expression pattern, morphology,

differentiation abilities, alkaline phosphatase activity, telomerase activity, karyotype profile and

proliferation rate, were also reported after cryopreservation (Martinello et al., 2010). A freezing rate of

1°C/min was suggested to preserve spindle shape morphology, in contrast to 5°C/min and 10°C/min

freezing rates (Xu et al., 2012). Cells cryopreserved at a cooling rate of 10°C/min had a more acidic

intra-cellular pH and aggregated mitochondria immediately after cryopreservation (Xu et al., 2012).

Cryo-protectants can be separated into two categories: penetrating cryo-protectants such as dimethyl

sulfoxide (DMSO), and non-penetrating cryo-protectants, such as hydroxyethyl starch (HES). DMSO

enters the cell removing molecules of water, while HES binds to extracellular molecules of water,

creating a gradient during which intra-cellular water will leave the cell (Stolzing et al., 2012). DMSO is

known to have some toxicity depending on exposure time, temperature, and concentration (Wang et al.,

2007). A concentration of 10% DMSO as compared to 15% and 20% yielded maximum viability post-

cryopreservation for dermal fibroblasts (Wang et al., 2007). HES used alone yielded lower viability post-

thawing as compared to DMSO (Naaldijk et al., 2012). Combination of DMSO and HES up to 10%

concentration resulted in reduced viability when DMSO concentrations were below 4%. Therefore, even

in combination with HES, the DMSO concentration should not be less than 5% of a total of 10% cryo-

protectant volume (Naaldijk et al., 2012).

9

Temporal phenotype

The Hayflick model describes cellular senescence as the number of cell doublings occurring before cell

death by senescence (Hayflick, 1965). This applies to MSC similarly as to other somatic cells. However,

specific mechanisms involved are still poorly understood. In vitro expansion of MSC to increase cell

number is common practice, inducing dynamic changes with time and cell doubling number (Wagner et

al., 2008), ultimately leading to cellular senescence (Hayflick, 1965). Phenotypic drift over time in vitro

was reported (Wagner et al., 2008; Otte et al., 2013; Bonab et al., 2006; Vacanti et al., 2005). Radcliffe

et al. (2010) reported that adherent equine bone marrow-derived MSC after 2 hour in culture were

CD44hi

, CD29hi

, CD90lo

, CD11a/CD18hi

, and CD45RBlo

. Over time, phenotypic drift was noted and at

day 14 the cells were CD44hi

, CD29hi

, and CD90hi

, CD11a/CD18neg

, and CD45RBneg

. While CD29 and

CD44 expression remained homogeneous, CD90 varied in expression and heterogeneity. This is

potentially explained by MSC up-regulation of CD90 or selection for CD90+ cells in culture. MSC were

also suggested to undergo maturation once plated onto plastic with up-regulation of several markers

(Radcliffe et al., 2010). Further cell expansion was not associated with phenotypic changes.

Influence of donor age: impact on adult tissue-derived MSC characteristics

Specifically, aging characteristics of adult tissue-derived MSC, when isolated from donors of different

ages, are not well characterized. Morphological changes were reported after long-term cultures reaching

the maximal lifespan (Stenderup et al., 2003; Baxter et al., 2004) but not for shorter term cultures (Lund

et al., 2010). No differences were observed after 21-28 days of hypoxic culture regarding differentiation

potential, surface marker expression, ability to handle oxidative stress, migratory ability, telomere

length, expression of inducible nitric oxide synthase (iNOS) and production of prostaglandin-E2 (PGE-

2) (Lund et al., 2010). When assessed immediately following isolation, or after one passage in vitro, no

differences were reported relative to donor age for expression of octamer-binding transcription factor 4

(OCT4), PR domain zinc finger protein 14 (PRDM14) and embryonic stem cell specific homeobox

10

protein (NANOG), or for differentiation abilities of BM-MSC, suggesting similar differentiation

potency. Similarly, in a mouse model, expression of pluripotency markers such as v-myc

myelocytomatosis viral oncogene homolog (c-Myc) and NANOG was observed for every donor

independently of age (Katsara et al., 2011). Doubling time and colony-forming unit-fibroblast (CFU-F)

were, however, reported to vary significantly according to donor age (Siegel et al., 2013). Molecular

changes related to donor age remain to be characterized. Attempts to establish a gene expression profile

for aging in MSC found no correlation in association with cellular senescence (Alves et al., 2012).

Changes following in vitro expansion will require further characterization.

Embryonic, perinatal and adult sources

MSC variability according to cell source is incompletely characterized. First-trimester fetal MSC from

blood, liver, and bone marrow were found to express pluripotency markers such as OCT4, NANOG, and

stage-specific embryonic antigen (SSEA)-3 and -4 in contrast to adult bone marrow MSC (Guillot et al.,

2007). Additionally, fetal MSC demonstrated more rapid growth, longer telomeres, higher telomerase

activity and myogenic differentiation ability (Chan et al., 2006). Rhesus monkey fetal-derived MSC

demonstrated higher trilineage potential (adipo-, chondro-, and osteo-genesis) and higher growth rates

(Lee et al., 2006). Perinatal tissues were also suggested to contain cell populations expressing embryonic

markers as reported in human cord blood (Baal et al., 2004; McGuckin et al., 2005). In terms of

immunoreactivity, fetal tissue-derived MSC were reported to have greater ability to suppress

lymphoproliferation in vitro as compared to adult-derived MSC (Chan et al., 2012). Contrasting results

have been reported in horses (Koch et al., unpublished results; Carrade et al., 2012; Yoo et al., 2009).

MSC immunomodulatory properties

MSC are receiving intense investigation because of their possible immunomodulatory properties. MSC

are hypothesized to act in two different ways once injected or grafted in vivo. They may directly

11

integrate into functional tissue or secrete trophic and immunomodulating factors which lead to tissue

regeneration (Caplan et al., 2006). The publications concerning the cytokine secretory profile of BM-

MSC by Haynesworth et al. (1996) and one of the first reports on the ability of MSC to suppress

lymphocyte proliferation in vitro in 2002 by Di Nicola et al. laid the basis for use of MSC in various

conditions.

Selected examples of in vivo MSC immunomodulatory effects

Osteoarthritis

Osteoarthritis (OA) is a multifactorial condition that often is subdivided into idiopathic OA or

degenerative joint disease (in older individuals), post-traumatic OA (occurring secondary to a joint

injury) and rheumatoid arthritis (Anderson et al., 2011; Nesic et al., 2006; Carrington et al., 2006;

Sacitharan, 2012). Inflammation or inflammatory cytokines such as of IL-1β and tumor necrosis factor-

alpha (TNF-α) (Kapoor et al., 2011; Lawrence et al., 2011) are central agents in the pathogenesis of

idiopathic OA as well as PTOA. Corticosteroids as OA treatments have been reported as beneficial

(Leung et al., 2011) suggesting inflammation as target for treatment and evidences for therapeutic

targeting of IL-1β and TNF-α for idiopathic OA and PTOA are accumulating (Pelletier et al., 1997;

Kobayashi et al., 2005; Westacott et al., 2000). In a dog study, treatment of OA with AT-MSC improved

lameness (Black et al., 2007). In horses, OA arthroscopically treated with BM-MSC had decreased

concentration of PGE-2 in synovial fluid as compared to the control group. However, no other

significant improvement was noted (Frisbie et al., 2009). In another study of horses, the effect of

autologous BM-MSC together with micro-fracture or microfracture along was evaluated in

arthroscopically created joint defects (McIlwraith et al., 2011). Increased accumulation of cartilage-

associated proteoglycan core protein (AGGRECAN) (Kiani et al., 2002) and greater cartilage firmness

were observed in the joint treated with BM-MSC (McIlwraith et al., 2011). A recent pilot study looked at

the effect of intra-articular injection of autologous BM-MSC in 12 human patients with radiologic

12

evidence of OA (Orozco et al., 2013). The authors reported reduced pain and a decrease in the

percentage of poor cartilage for 11 out of 12 patients after 12 months of follow-up (Orozco et al., 2013).

These findings support continued investigations into the overall therapeutic effects, dosage and route of

administration of MSC for the treatment of OA.

Graft-versus-host disease

The first clinical trial using autologous MSC in vivo was reported in 1995 by Lazarus et al. (1995) and

the first report on the use of third party haploidentical MSC for treatment of graft-versus-host disease

(GVHD) was report in 2004 by Le Blanc et al. In the latter study, a 9 year old boy with severe treatment-

resistant grade IV acute GVHD of the gut and liver received MSC. The striking benefit from MSC

treatment suggested high immunosuppressive potency in vivo, and established MSC as potential

treatment for GVHD (Le Blanc et al., 2004). This finding also introduced the use of MSC to treat

steroid-resistant GVHD, and several successful attempts have been reported so far (reviewed in McGuirk

et al., 2011). As this treatment has become more used, observation of failed treatment and differential

response according to different patient cohorts has been reported (Galipeau, 2013). Even though most

reports used BM-MSC, adipose tissue-derived MSC were also applied with similar results. As well,

similar results have been reported for fresh and cryopreserved MSC (McGuirk et al., 2011). As discussed

earlier, perinatal sources offer great advantages, but more studies are required regarding their use in vivo.

MSC offer promising alternatives for treatment of immune-related diseases. However, incomplete

characterization in humans and animal models remains a big problem for application. MSC are

heterogeneous and characterized as a cell population rather than as individual cells, meaning that the

characteristics applied to the population cannot be assumed to apply to each individual cell. Differences

in cell source, donor species and culture conditions also contribute to variation.

13

In vitro MSC properties

MSC secreted soluble factors

MSC secrete a broad range of soluble factors such as hepatocyte growth factor (HGF), PGE-2,

indoleamine-2,3-dioxygenase (IDO), nitric oxide (NO), heme oxygenase-1 (HO-1), IL-10, IL-6, HLA-

G5, leukemia inhibitory factor (LIF) and several chemokines such as chemokine ligands (CCL) 2 and 5

(reviewed in Bassi et al., 2012). These factors act on several leukocyte subsets to promote and/or

suppress inflammation. A summary of current knowledge on immunosuppressive cytokines is shown in

Figure 1.

Figure 1. Immunomodulatory effects of MSC secreted soluble factors on leukocyte subsets. (Bassi et al.,

2012).

14

MSC effect on different leukocyte subsets

Lymphocytes

Subsets of lymphocytes affected by MSC include CD8+ cytotoxic T-lymphocytes (CTL) and CD4+

helper T-cells (Th), B lymphocytes, regulatory T-cells (Treg), gamma delta T-cells and natural killer

(NK) cells (Wang et al., 2012). The ability of MSC to suppress lymphocyte proliferation in vitro has

been observed consistently (Le Blanc et al., 2007; Ripoll et al., 2011; Le Blanc et al., 2003; Ennis et al.,

2008), and is thought to involve soluble factors such as HGF, IDO, transforming growth factor (TGF)-β,

PGE-2, IL-10, and NO (Kim et al., 2013; Ringden et al.,2011).

T-cells, B-cells, Tregs

Th lymphocyte phenotypes can be divided in two major groups: Th1 pro-inflammatory phenotype and

Th2 anti-inflammatory phenotype with their respective secretion of pro-inflammatory and anti-

inflammatory cytokines (Berger, 2000). MSC are suggested to induce differentiation of naive T cells into

a Th2 rather than Th1 phenotype, as demonstrated by Aggarwal et al. (2005). When co-cultured with

MSC, significant increase in IL-4 secretion along with significant decrease of IFN-γ was observed

(Aggarwal et al., 2005) suggesting a T-cell phenotypic switch from Th1 to Th2 (Mosmann et al., 1989).

MSC were also reported to inhibit lymphocyte differentiation into a CD8+ cytotoxic phenotype

(Rasmusson et al., 2003) to induce T cell differentiation into Treg as demonstrated by Maccario et al.

(2005) and Aggarwal et al. (2005). Treg are a distinct CD4+ T-cell subset, expressing IL-2 receptor α-

chain (CD25) and promoting immunosuppression. MSC also affect Th17 T-cells characterized by IL-17

cytokine secretion (Ghannam et al., 2012). IL-17 was suggested to play a major role in auto-immune

diseases while its deficiency reduced the incidence of joint inflammation and bone erosion in

experimental arthritis, and destructive synovitis (Koender et al., 2005; Lubberts et al., 2005). MSC

inhibited T-cell differentiation into Th17 phenotype in vitro, but also inhibited pro-inflammatory

15

cytokine production of differentiated Th17 T-cells when co-cultured, as demonstrated by down-

regulation of IL-17 and IL-22 along with up-regulation of IL-10 (Ghannam et al., 2010).

MSC arrest B lymphocytes in the G0/G1 phase of the cell cycle (Tabera et al., 2008). This was supported

by the observation that co-culture with MSC did not decrease B cell viability but down-regulated

expression of the proliferation marker Ki67. Proliferation inhibition, increased immunoglobulin

production and increased chemokine receptor expression were also observed in a transwell system,

suggesting soluble factor-mediated interactions (Corcione et al., 2006).

Natural killer cells

The immune system is thought to have evolved around the idea of recognition of “self” as opposed to

“non-self” with associated immune response. The main molecules involved in this mechanism are the

MHC I and II molecules (reviewed in Yin et al., 2012). Cells that do not express surface MHC I were

expected to be ignored by the immune system, even in an allogeneic context. This concept was

challenged regarding NK cell interactions. NK cells are effector lymphocytes of the innate immune

system expressing a broad range of surface markers that control activation, function and proliferation

(reviewed in Lanier et al., 2009). The “Missing Self” theory proposed by Ljunggren et al. (1990)

suggested that NK cells protect the organism by lysing cells lacking MHC I expression as they are not

identified as part of self. Cells with low or absent MHC I expression are then more likely to be targeted

for NK-mediated cell lysis. MHC I expression is typical of MSC. Interestingly, an in vitro study showed

that interferon-gamma (IFN-γ) stimulation of MSC spared them from NK-mediated cell lysis through

increased MHC I expression (Spaggiari et al., 2006). Further studies are required to understand the

interactions between MSC and NK cells in vivo and the potential consequences.

Dendritic cells

16

Dendritic cells (DCs) are derived from CD34+ hematopoietic progenitor cells (Frelinger et al., 1979) and

act as antigen presenting cells (APC). They play a crucial role in antigen specific T-cell activation

(reviewed by Villadangos et al., 2005 and Spaggiari et al., 2013). MSC interactions with DC result in

indirect suppression of T-cells. The mechanisms of suppression of DCs by MSC are controversial, but it

is thought to involve suppression of precursor maturation, impairment of antigen presenting functions

and decrease of inflammatory abilities.

MSC polarization paradigm

In 2006, a study of human macrophages suggested that there are also two distinct phenotypes: pro-

inflammatory and anti-inflammatory (Verreck et al., 2006). MSC have been widely recognized as

demonstrating an immunosuppressive behavior when exposed to inflammatory environment, but the idea

of a single phenotype was recently challenged by a study which suggested that MSC, similarly to

macrophages, might be classified into a MSC-1-like phenotype with pro-inflammatory features, and a

MSC-2-like phenotype with anti-inflammatory properties (Waterman et al., 2010). TLR3 and TLR4

were suggested to characterize MSC-1 pro-inflammatory and MSC-2 anti-inflammatory phenotypes,

respectively, with each phenotype demonstrating specific cytokine secretion patterns.

Toll-like receptors

TLR are type I transmembrane proteins that play a major role in immunity by recognition of pathogen-

associated molecular patterns (PAMPs) through ectodomains containing leucine-rich repeats (Kawai et

al., 2010). PAMPs include microbe-derived lipids, lipoproteins, proteins and nucleic acids (Kawai et al.,

2010; Akira et al., 2006).

17

Figure 2. TLRs and their ligands. (Takeda et al., 2005).

Each TLR has been associated with a specific ligand (Figure 2). TLR2 is known to recognize

lipoproteins or lipopeptides when forming heterodimers with TLR1 or TLR6. TLR3 recognizes viral

double-stranded RNA, TLR4 recognizes lipopolysaccharide (LPS) and TLR5 recognizes flagellin. TLR7

and TLR8 recognize single stranded RNA, and TLR9 recognizes microbial DNA (reviewed in Uematsu

et al., 2008). While TLR1, 2, 4, 5, 6 and 11 are expressed on the cell surface, TLR3, 7, 8 and 9 are intra-

cellular and bind mostly to nucleic acids (Figure 3, Kawai et al., 2010; Akira et al., 2006; Takeda et al.,

2005).

Once bound to a ligand, TLRs dimerize and recruit adaptor proteins, which activate downstream

signalling. There are several intra-cellular adaptor proteins. The best known are myeloid differentiation

primary-response protein 88 (MyD88), Toll/interleukin-1 receptor-domain-containing adapter-inducing

interferon-β (TRIF), TRIF-related adaptor molecule (TRAM) and the TIR domain-containing adapter

protein (TIRAP). MyD88 was the first identified adaptor protein and is involved in signalling for 9 of 10

TLRs. MyD88 signalling (Figure 3) activates the well characterized nuclear factor kappa-light-chain-

18

enhancer of activated B cells (NF-κB) pathway. MyD88 primarily binds to the intracellular domain of

TLRs, triggering downstream molecule signalling, leading to NF-κB translocation to the nucleus where

it acts as a transcription factor. The MyD88-NF-kB signalling pathway is further summarized in Figure 3

(reviewed by Akira et al., 2004).

Figure 3. Human TLR signalling. (1) Stimulated TLR bind to MyD88 adaptor protein. MyD88 then

recruits IL-1R-associated kinase-(IRAK)-4, creating a complex with IRAK1 and tumor-necrosis-factor

receptor-associated factor-(TRAF)-6. (2) Formation of a protein complex with IRAK1, TRAF6,

transforming growth factor--activated kinase-(TAK)-1, TAK1-binding protein (TAB)-1 and TAB2.

IRAK1 is subsequently degraded and the complex associates with the ubiquitin ligases ubiquitin

conjugating enzyme-(UBC)-13 and ubiquitin-conjugating enzyme E2 variant 1 (UEV1A). This leads to

the ubiquitylation of TRAF6, which induces the activation of TAK1. (3) TAK1 then phosphorylates the

19

mitogen-activated protein (MAP) kinases (4) and the inhibitor of nuclear factor-κB (IκB)-kinase (IKK)

complex. (5) IKK complexe then phosphorylates IκB leading to its degradation, (6) allowing the NF-κB

to translocate to the nucleus and act as a transcription factor (Modified from: Akira et al., 2004).

MyD88-dependent and independent pathways

MyD88 was first identified as an adaptor protein in TLR signalling pathways (Wesche et al., 1997) and

suggested as mandatory for activation of NF-κB (Adachi et al., 1998). However, this was later proven

incorrect as MyD88-deficient mice were still responsive to LPS (Kaisho et al., 2001) and

Polyinosinic:polycytidylic acid (poly (I:C)) (Alexopoulou et al., 2001). An alternative pathway, known

as MyD88-independent pathway, exists for TLR3 and TLR4 and involves TRIF and TRAM adaptor

proteins (Figure 4). In 2001, a study with MyD88-deficient mice demonstrated that LPS-induced IFN

regulatory factor (IRF)-3 and IFN-inducible genes in a MyD88-independent manner, which was

abrogated when inactivating TRIF (Kawai et al., 2001). This suggested signalling of TLR4 through two

specific pathways: MyD88-dependent and independent pathways, the latter being also TRIF-dependent

(Figure 4). MyD88-independent pathway downstream signalling is summarized in Figure 4 for TLR3

and TLR4.

20

Figure 4. TLR4 (A) and TLR3 (B) intra-cellular signalling. Stimulation of TLR4 leads to activation of

two pathways: 1) MyD88-dependant pathway leading to inflammatory cytokines activation through NF-

κB early phase response, and 2) MyD88-independent pathway leading to IFN- production and IFN-

inducible gene expression through NF-κB late phase response. (Akira et al., 2004).

TLR expression

MSC from different sources were reported to express different TLRs at gene and antigen levels, and

expression of these TLRs was suggested to be correlated with their immunomodulatory properties,

particularly TLR3 and TLR4 (Waterman et al., 2010). TLRs expression in human cells is summarized in

Table 2.

Table 2. Findings on TLR expression in human MSC.

Bone marrow Adipose tissue Cord blood Wharton’s jelly

Marker Antigen Gene

expression

Antigen Gene

expression

Antigen Gene

expression

Antigen Gene

expression

TLR1 +

(1) (2) (5)(6)(8)

+

(5) (8)

+

(9)

+

(8)

TLR2 +

(1) (6)

+

(1) (2) (5) (6)(8)

+

(5)

+

(5) (8)

-

(9)

+

(8)

TLR3 +

(1) (6) (8)

+

(1) (2) (5) (6)(8)

+

(5) (8)

+

(5) (8)

+

(9)

+

(8)

+

(8)

TLR4 +

(1) (6) (8)

+

(1)(2)(5)(6)(8)

+

(5) (8)

+

(5) (8)

+

(9)

+

(9)

-

(8)

-

(8)

TLR5 -

(1)

+

(1)(2)(5)(6)(8)

+

(5) (8)

+

(9)

+

(9)

+

(8)

TLR6 + + + +

21

(1)(2)(5)(6)(8) (5) (8) (9)

(8)

TLR7 +

(6)

-

(1) (2) (5)(8)

-

(8)

-

(9)

-

(8)

TLR8 -

(1) (2) (5)(8)

-

(8)

-

(9)

-

(8)

TLR9 +

(6)

- (1)(2)(5)(6)

+ (8)

+

(5)

+

(5) (8)

+

(9)

+

(8)

TLR10 –

(1) (2)(8)

-

(8)

-

(9)

-

(8)

TLR11 -

(1) (2)

Antigen expression level: (-) = antigen expression not detected, (+) = antigen detected. mRNA expression level: (-) = transcript not detected, (+) = transcript detected. References: (1) Raicevic et al., 2010; (2) Liotta et al., 2008; (3) Pevsner-Fischer et al., 2007; (4)

Lombardo et al., 2009; (5) Hwa Cho et al., 2006; (6) Tomchuck et al., 2007; (7) Mastri et al., 2012; (8)

Raicevic et al., 2011; (9) Van den Berk et al., 2009.

MSC pro-inflammatory and immunosuppressive phenotypes

Pro-inflammatory (MSC1-like) and immunosuppressive (MSC2-like) phenotypes are thought be

correlated respectively with TLR4 and TLR3 expression (Figure 5).

22

Figure 5. MSC polarization paradigm. MSC are suggested to present two distinct immunomodulatory

phenotypes: pro-inflammatory (MSC1) driven by TLR4 expression and primed in vitro by LPS, and

immunosuppressive (MSC2) driven by TLR3 expression and primed in vitro by poly(I:C). (Modified

from Bunnell et al., 2010).

This hypothesis was further supported by findings of Waterman et al. (2010) where poly (I:C)-treated

cells demonstrated higher ability to suppress in vitro lymphoproliferation as compared to untreated and

LPS-treated cells. Similarly, LPS-treated cells had reduced ability to suppress in vitro proliferation as

compared to untreated and poly (I:C) treated cells.

In a recent review it was attempted to classify cytokines expressed by MSC according to their

immunosuppressive or pro-inflammatory role: pro-inflammatory cytokines included IL-1β, IL-6, IL-8,

IL-12, type I IFNs and TNF-α while immunosuppressive cytokines included IDO, iNOS, PGE-2, TGF-

β1, HLA-G, HGF, LIF, IL-1 receptor antagonist (IL1RA), CCL2, galectin-3, galectin-1 and semaphorin-

3A and TNF-α-induced protein 6 (TNAIP6) (Bunnell et al., 2010).

In an attempt to characterize each phenotype according to secretion pattern, Waterman et al (2010) used

LPS and poly (I:C) to prime TLR4 and TLR3 expression, respectively. As a result, “TLR3-primed cells”

had increased gene expression of chemokine (C-X-C motif) ligand-(CXCL)-10, CCL5, and IL10 as

compared to untreated and LPS-treated cells. This is in accordance with another study where MSC

treatment with poly (I:C) caused up-regulation of gene expression for CCL2 and CXCL10, but also of

IL-6, IL-8 and IFN1β (Tomchuck et al., 2008). In that study levels of IDO and PGE-2 were more

elevated in TLR3-primed cells than TLR4-primed cells. Tomchuck al. (2010) reported that LPS

stimulation to induce TLR4 expression up-regulated gene expression of CXCL10 (IP10), IL-6, IL-8,

IFN1β and NF-κB. Cytokine antibody arrays were subsequently used to test for presence of proteins,

which detected the up-regulation of CXCL10 (IP10), IL-6, IL-8 and TNF-α.

23

There are discrepancies between studies regarding TLR expression patterns, which may, in part, be due

to inconsistent validation of the methods applied. One of the first reports to thoroughly characterize MSC

for TLR expression, and the effect of specific ligand binding, was published in 2008 (Tomchuck et al.,

2008). One finding was the inhibited migration following anti-TLR3 neutralizing antibody treatment.

This suggested involvement of TLR3 in MSC effector functions, as in vivo danger signals are a known

trigger of human MSC migration, invasion, and engraftment into damaged and inflamed tissues

(Tomchuck et al., 2008). However, this report also illustrated the complexity of TLR expression.

Authors reported up-regulation of several TLRs and downstream pathway molecules following

incubation with individual ligand, including LPS and poly (I:C), as assessed by qPCR, as well as a

dynamic pattern of protein localization on immunocytochemical analysis. Donor-donor variation,

referring to variation between individual donors, in response to TLR ligands was also reported

(Tomchuck et al., 2008).

Based on Tomchuck et al. (2008), Waterman et al. (2010) attempted to characterize two distinct MSC

phenotypes following incubation with poly (I:C) and LPS as ligands for TLR3 and 4 respectively. The

two cell phenotypes, designed as “TLR3-primed” and “TLR4-primed”, were suggested to respectively

demonstrate immunosuppressive and pro-inflammatory abilities along with a specific pattern of cytokine

expression. The authors based their induction protocol on the Tomchuck et al. (2008) study, with no

further validation of TLR gene or protein expression, despite reported donor-donor variation. However,

to validate the findings, the study included dominant-negative TLR3 and 4 expression vectors

(Waterman et al., 2010). Therefore, changes regarding CXCL10, CCL5, and IL10 following poly (I:C)

treatment could be attributed to TLR3 (Waterman et al., 2010), which further supported the role of TLR3

in immunosuppression by MSC.

However, considering the complex changes occurring following incubation with ligands, it seems

incorrect to attribute any change of function to a specific TLR, unless it is specifically inhibited. In

24

addition, designating each group as “TLR3-primed” and “TLR4-primed” when TLRs expression was not

determined seems inappropriate. Mastri et al. (2012) reported that the activation of TLR3 resulted in

enhanced cardiac repair. Different concentrations of poly (I:C) at different time points were used, but a

single “representative” qPCR result for TLR3 expression was shown due to presumed similar expression

throughout the experiment. Such consistent expression would be surprising considering the reported

transient changes following poly (I:C) incubation (Tomchuck et al., 2008) as well as donor-related

variation (Tomchuck et al., 2008; Waterman et al., 2010). Furthermore, validation of other TLRs was not

performed. It therefore seems erroneous to attribute the observed functions to TLR3 without further

exploratory experiments such as TLR3-knock-down, and similarly evaluating the role of other TLRs.

Hence, available data on MSC immunomodulatory properties should be carefully analyzed to avoid

misinterpretation.

25

RATIONALE

Osteoarthritis (OA) and post-traumatic OA (PTOA) are some of the most common causes of equine

lameness (Frisbie et al., 2005). Undifferentiated MSC are attractive cytotherapy candidates as they are

capable of secreting immunosuppressive factors (Caplan et al., 2006). For this reason MSC have been

suggested as potential therapeutic candidates for OA in the horse (Frisbie et al., 2009). Advantages of

MSC from cord blood include a non-invasive collection method, high proliferation potential and

differentiation potency, and long-term cryogenic storage (Kern et al., 2006; Kogler et al., 2006; Koch et

al., 2007). Previous inconsistent MSC isolation success from cord blood caused bone marrow and

adipose tissue to be the favoured equine MSC sources. However, an improved CB-MSC protocol was

recently described reporting 100% isolation success for 5 samples (Koch et al., 2009). No consistent

surface marker panel has been established for equine MSC. Better MSC characterization may allow for

more reproducible and effective therapies. Suppressed lymphoproliferation by MSC in vitro is thought to

occur through modulation of T-cell, B-cell, dendritic cell, and NK cell (Le Blanc et al., 2005) function

by secretion of immunosuppressive factors and cell-to-cell contact (Caplan et al., 2006; Caplan, 2009;

Ghannam et al., 2008). It was recently suggested that the human MSC anti-inflammatory phenotype

might be correlated with expression of TLR3 and the pro-inflammatory phenotype with TLR4

(Waterman et al., 2010).

HYPOTHESIS

Equine MSC can be consistently isolated from cord blood, have unique and reproducible marker

expression, which includes cytoplasmic TLR3 and TLR4, and in vitro suppress lymphoproliferation.

OBJECTIVES

1) To establish the immunophenotype of CB-MSC before and after cryopreservation.

2) To determine the in vitro effect on lymphoproliferation of CB-MSC.

3) To determine TLR3 and TLR4 expression of CB-MSC.

26

MATERIALS AND METHODS

Experimental design

Figure 1. Experimental design. CB-MSC cultures were established from nine individual samples and

analyzed for phenotype, gene expression and functional properties as outlined.

Cord-blood collection and shipping

Umbilical cord blood was collected from nine foals immediately after foaling, as previously described

(Koch et al., 2007). Venipuncture of the umbilical vein was performed with a 16G hypodermic needle

attached to a 450 mL blood transfusion collection bag (Fenwal, Baxter, Deerfield, IL) containing citrate

phosphate dextrose adenine as the anticoagulant solution. The blood was stored and transported

overnight by courier at 4-8°C until processed. A Greenbox system (Greenbox system Ltd., ThermoSafe

27

Brands; Arlington Heights, VA) was used for shipping and efficient temperature control for up to 48

hours.

CB-MSC isolation and culture

CB-MSC isolation and culture methods were adapted from a previously described protocol (Koch et al.,

2009) In brief, the NC fraction was isolated using PrepaCyte-EQ (PEQ) medium (BioE Inc., St Paul,

MN). Whole cord-blood was mixed 1:1 with PEQ medium in 50 mL BD Falcon™ conical tubes (BD

Biosciences, Mississauga, ON), mixed for 5 minutes and incubated for 25 minutes at room temperature

(RT). Supernatant was collected, pooled and spun at 400g for 10 minutes at RT. Pellets were suspended

in isolation medium (IM) consisting of Dulbecco’s modified eagle medium (DMEM)-low glucose (1

g/L; Lonza, Wakersville, MD), fetal bovine serum (FBS, 30%; Invitrogen, Burlington, ON), penicillin

(100 IU/mL; Invitrogen), streptomycin (0.1 mg/mL; Invitrogen), L-glutamine (2 mM; Sigma-Aldrich, St.

Louis, MO ) and dexamethasone (10-7

M; Sigma-Aldrich) and incubated at 5% CO2 at 38C in a

humidified atmosphere as previously described (Koch et al., 2009). Live and dead cell counts were

determined using an automated cell counter (NucleoCounter NC-100, Mandel Scientific, Guelph, ON)

and plated at 1x106 live cells/cm

2 in 75 cm² polystyrene cell culture flasks (Corning® Flask, Sigma-

Aldrich) The primary colonies were detached using trypsin/ EDTA (0.04%/0.03%; Sigma-Aldrich) and

hereafter expanded in the same culture medium without dexamethasone (expansion medium, EM).

During expansion, cells were seeded at 5,000/cm2. Cells were cryopreserved in EM with 10% DMSO

(Sigma-Aldrich) using a slow cooling device (Invitrogen) for controlled rate freezing at -80°C for 24

hours, prior to long-term storage in liquid nitrogen. Cell concentration was 1 to 2x10

6/mL.

28

Colony counting, MSC progenitor frequency, population doubling time and cell morphology

After eight days of incubation, cultures were inspected daily for presence of colonies. Confluent colonies

were detached using trypsin/ EDTA (0.04%/0.03%; Sigma-Aldrich) and seeded in one T175 culture

flask. To document cell morphology, digital images were obtained prior to detachment at passage 1, 3, 4

and post-thawing passage 5 using phase-contrast microscopy and Q-Capture software (Q-Imaging,

Surrey, BC). MSC progenitor frequency (PF) was calculated as:

Progenitor frequency (PF)= Colony number x100

Number of initial nucleated cells

Population doubling times were calculated according to:

1) Cell-doubling number (CD) = ln(Nf/Ni)

Ln2

Ln = natural logarithm

Nf = final cell count

Ni = initial cell count

2) Cell-doubling time (DT) = CT/CD

CT = cell culture time

Flow cytometric analysis

Leukocytes (NC fraction) and CB-MSC cultures at passage 2, 3 and 5 were analyzed with flow

cytometry in a FACScan flow cytometer (Becton Dickinson, Mississauga, ON) for the following

antigens: CD4 (clone: CVS4, abdSerotec, Raleigh, NC), CD8 (clone: HTI4A, abdSerotec), CD11a/18

(clone: 116.2D11B10, abdSerotec), CD24 (clone: 4B4- Fluorescein isothiocyanate (FITC), Beckman

Coulter Canada, LP, Mississauga, ON), CD44 (clone: CVS18, abdSerotec, Raleigh, NC), CD45 clone:

DH16A; VMRD), CD73 (clone: 10f1; Abcam), CD90 (clone: DH24A; VMRD, Pullman, WA), MHC I

(clone: 117.1B12C11, abdSerotec) and MHC II (clone: 130.8E8C4, abdSerotec). Incubations were at

4°C in the dark for 15 minutes, followed by a wash and secondary antibody incubation at 4°C for 15

minutes in the dark. Rat anti-mouse IgM-FITC or goat anti-mouse IgG1-FITC (both Abcam, Toronto,

29

ON) for CD90 or remaining unconjugated primary antibodies respectively were used as secondary

antibodies. Prior to staining, ammonium chloride (Sigma-Aldrich) red blood cell lysis was performed on

peripheral and cord blood for leukocyte isolation followed by a wash with flow buffer (phosphate buffer

saline (PBS; Sigma Aldrich), 5mM EDTA, 1% horse serum (HS), and 0,1% sodium azide. Similarly,

prior to staining, cultured CB-MSC were chemically detached with Accumax (STEMCELL

Technologies Inc., Vancouver, BC) and washed with flow buffer (PBS, 5mM EDTA, 1% HS, and 0,1%

sodium azide). Leukocytes and MSC at passage 2, 3 and 5 were stained for CD4, CD8, CD11a/18,

CD45, CD90, MHC I and MHC II surface expression. MSC at passage 5 were additionally assessed for

CD24, CD44 and CD73. Cells incubated with only secondary antibodies were included in each

experiment. Cells incubated with isotype-matched non-binding primary antibody and fluorescent

secondary antibody was included in each experiment for IgM and at passage 2, 3 and 5 for IgG isotype.

CD45 and MHC II were respectively used as IgM and IgG isotype-matched non-binding primary

antibody. A minimum of 10,000 events were acquired for each antibody with CellQuest software

(Becton Dickinson) and data were analyzed with FlowJo software (Tree Star Inc., Ashland, OR, USA).

Gates to identify leukocytes or MSC populations were maintained consistent throughout all experiments.

Monoclonal antibody for CD73, previously suggested to cross-react with equine cells (De Schauwer1 et

al., 2012), was initially tested by flow cytometry using human leukocytes as positive control. This was

followed by analysis of equine leukocytes. Samples from humans were collected under University of

Guelph Research Ethics Board (REB; protocol #12FE008). All samples collected from horses were

approved by the University of Guelph Animal Care Committee (protocol #11R034).

Real-time polymerase chain reaction relative quantification

Table 1. Nucleotide sequence of primers.

30

Genes Primers

CD4 5′ CCAGACTGACCAGACTGCAA 3′

5′ TTGGATTCCAGCAGGACTTT 3′

CD8 5′ AGTGGCTGGACTTCGACTGT 3′

5′ CAAACACGTCTTCGGTTCCT 3′

CD11a/18 5′ TTCAGCCAGCAACAAGAAGA 3′

5′ GACAGCTGTGTTCCCACTGA 3′

CD29 5′ CCCTTGCACAAGTGAACAGA 3′

5′ ATTCCTCCAGCCAATCAATG 3′

CD44 5′ ATCCTCACGTCCAACACCTC 3′

5′ CTCGCCTTTCTTGGTGTAGC 3′

CD73 5′ TGATCTTTCCCGAAAACCTG 3′

5′ GGAATCCATCTCCACCATTG 3′

CD90 5′ TGCCTGAGCACACATACCGCTC 3′

5′ GCTTATGCCCTCGCACTTGACC 3′

B2M* 5′ TCGGGCTACTCTCCCTGACT 3′

5′ ATTTCAATCTCAGGCGGATG 3′

CIITA** 5′ GGTGCTACTTCGAGCTTTCG 3′

5′ CCAACGTAGAGTCCGGTGAG 3′

TLR4 5′ CCCACATCAACCAAGGAACT 3′

5′ ATGGTTGAGGCCCTGATATG 3′

TLR3*** 5′ CAAACCCTGGTGGTCCTGTT 3′

5′ GAAGGCCTCTGCTGGGATCT 3′

-actin 5′ TGGGCCAGAAGGACTCATAC 3′

5′ GGGGTGTTGAAGGTCTCAAA 3′

S18 5′ ACTGAGGATGAGGTGGAACG 3′

5′ GCCCGTATCTTCTTCAGTCG 3′

*B2M sequence was used for gene expression detection of MHC I

**CIITA sequence was used for gene expression detection of MHC II

** Previously published sequence in: Figueiredo et al. (2009).

Total RNA was extracted from leukocytes and CB-MSC at passage 3, 4, and 5 using the mirVana

miRNA Isolation Kit (Ambion, Life Technologies, Burlington, ON) following the manufacturer’s

instructions. RNA was quantified using NanoDrop ND-1000 (Thermo Fisher Scientific, Waltham, MA)

spectrophotometer, aliquoted and stored at -80°C for subsequent reverse transcription. For

complementary DNA (cDNA) synthesis, RNA was thawed and any potential residual genomic DNA was

31

digested using DNase I amplification grade treatment (Invitrogen), directly followed by reverse

transcription using the SuperScript II Reverse Transcriptase kit (Invitrogen) and random priming of a

constant amount of RNA throughout the experiment. RNA degradation from freezing or thawing was

tested with Agilent 2100 Bioanalyzer (Agilent Technologies, Mississauga, ON). RNA integrity numbers

(RIN) were consistently > 9/10 in samples tested.

Relative quantification was performed in a CFX Real-Time PCR Detection System (Bio-Rad, Kitchener,

ON) by two-step real-time qPCR. Primers (Table 1) were designed using Invitrogen OligoPerfect

Designer or the national center for biotechnology information (NCBI) primer-BLAST software or

adapted from previously published sequence (Figueiredo et al, 2009). Beta-2-microglobulin (B2M) and

class II MHC transactivator (CIITA) sequences were used for gene expression detection of MHC I and

II, respectively. For all genes, amplicons were separated by 2% agarose gel electrophoresis, extracted

and purified using the QIAquick Gel Extraction kit (Qiagen, Hilden, Germany). DNA was sequenced

and sequences analyzed using the NCBI basic local alignment search tool (BLAST) tool against equine

sequence. Minimal identity cut-off was set at 96%. CD4 and CD73 primers did not include an intron-

exon spanning junction due to amplification difficulties. Otherwise, all primers were designed to span at

least one intron-exon junction to reduce the likelihood of amplifying genomic DNA. To ensure

specificity of all primers, a sample without reverse transcription (RT-control) and a sample with buffer

but without template (NT-control) was included in each run. PCR assays were performed in triplicate in

a 10 µL total volume consisting of 5 µL of PCR SsoFast EvaGreen Supermix; (Bio-Rad), 0.2 µM of

primer mix, and cDNA template. After an initial incubation at 95 °C for 3 min, reactions were cycled 40

times with denaturation at 95 °C for 5 s, annealing for 5 s at temperatures specific for each primer pair,

and extension at 72 °C for 15 s. Amplification specificity was determined with melting-curve analysis

whereby each amplicon was heated from 65 to 95 °C. Efficiency for each primer pair was determined

from a standard curve generated from peripheral blood leukocytes or cDNA of target samples. qPCR

32

data were analyzed by the delta-delta Ct method (∆∆Ct) (Livak et al., 2001) using two endogenous

reference genes chosen following the minimum information for publication of quantitative real-time

PCR experiment (MIQE) guidelines (Bustin et al., 2009). Expression stability analysis of the reference

genes was performed with GeNorm software. Initial selection of housekeeping genes was based on

review of current literature (Radcliffe et al., 2010; Ranera et al., 2012) and availability of equine

sequence data and thus comprised of, β-actin, S18, B2M, and hypoxanthine phosphoribosyltransferase 1

(HPRT1). Based on GeNorm analysis, only two housekeeping genes were selected based on the lowest

variability in expression across samples. Assessment of variability in expression for the different genes

was based on the M-value calculated as the average pairwise variation of a gene compared to the other

control genes (Nailis et al., 2006). The initial cut-off M-value was < 1.5, and S18 and β-actin were

selected to be used together as reference genes for subsequent relative quantification.

Lymphoproliferation

Blood was obtained from the jugular vein of five adult horses of variable breeds and sex with an 18G

hypodermic needle attached to a 500 to 1000 mL blood transfusion collection bag (Fenwal, Baxter,

Deerfield, IL). Mononuclear cells (MNC) were isolated a using Ficoll-density gradient. At RT 15 mL of

Ficoll-Paque Plus (density 1.078 g/mL, STEMCELL Technologies) was loaded in a 50 mL tube with 35

mL of whole blood. Gradients was centrifuged at 300g for 30 min at RT with no brake. Interphases

containing the MNC fraction was carefully removed, pooled and washed with PBS. Supernatant was

then removed and pellets were washed again with 10 mL of PBS. Pellets were then resuspended in 10

mL of RMPI 1640 medium supplemented with penicillin (100 IU/mL; Invitrogen), streptomycin (0.1

mg/mL; Invitrogen) and 10% FBS (Invitrogen), and a live cell count was performed with an automatic

cell counter (NC-100, Chemometec). Cells were resuspended in freshly prepared cryomedium consisting

of Roswell park memorial institute (RPMI) 1640 media supplemented with penicillin (100 IU/mL)

(Invitrogen), streptomycin (0.1 mg/mL; Invitrogen), 10% FBS (Invitrogen) and 10% DMSO (Sigma-

33

Aldrich) at a concentration of 6x106 cells/mL. One mL of cell suspension was placed in a 2 mL cryovial

(Corning® Flask, Sigma-Aldrich) on ice for 30 minutes before gradual freezing over 12-18 hours, and

storage in liquid nitrogen.

For assessing lymphocyte suppression, triplicate cultures of 1x105 responder MNC were incubated with

either 10,000 irradiated autologous MNC or 10,000 irradiated allogeneic MNC (pooled from three

horses), yielding 10:1 responder:stimulator cell ratios. These cultures served, as negative and positive

controls, respectively. The test wells were comprised of 1x105 MNC unrelated to MSC cultures, 10,000

irradiated pooled allogeneic MNC and 10,000 irradiated MSC. Cells were cultured in RPMI 1640 media

supplemented as above. Reactions were incubated for five days in round-bottom 96 well plates in 250-

300 µL volume. Bromodeoxyuridine (BrdU) staining was performed with a FITC BrdU Flow Kit (BD

Biosciences). Parameters for flow cytometry were set according to the manufacturer’s instructions. One

mM of BrdU was added to MNC cultures on day five and cells were incubated for 24 hours. Cells were

then fixed and permeabilized according to the manufacturer’s instructions. FITC-conjugated antibody to

BrdU was incubated with cells for 20 minutes at RT. Subsequently, 7-AAD was added for 5 minutes,

and cells were analyzed. All data were analyzed using the same settings as above with 5,000 events

acquired per triplicate sample. Appropriate negative samples were included in each experiment.

Immunocytochemistry

For ICC staining, 5,000 MSC were cultured in 250 µL of EM in 8-well permanox chamber slides

(Thermo Fisher Scientific) until 60-80% confluency. Cells were exposed to 1 µg/mL of poly (I:C)

(Sigma-Aldrich) and 10 ng/mL of LPS (Sigma-Aldrich) for TLR3 and TLR4 induction for one hour. For

ICC, cells were first washed thrice with PBS and fixed in situ for 5 minutes with 4% paraformaldehyde

(PFA; Invitrogen), washed thrice with PBS and permeabilized with 0.1% Triton for 15 minutes. Cells

were then washed again and treated with 3% hydrogen peroxide for 15 minutes. Non-specific antibody

34

binding was blocked by incubation with 5% FBS for 10 minutes followed by a one hour exposure to

polyclonal primary antibody for TLR3 or TLR4 (both IMGENEX, San Diego, CA). Cells were then

washed three times with PBS and incubated for one hour with goat anti-rabbit secondary antibody

(Abcam). Bound antibody linked to horseradish peroxidase (HRP) was detected using 3,3'-

diaminobenzidine (DAB) chromogen (DAKO, Burlington, ON). Cells were counterstained with Harris

hematoxylin to visualize nuclei and images were acquired on a phase contrast microscope.

Statistical analysis

All data were analysed with SAS software (SAS Institute, Cary, NC). Effects were considered significant

at P ≤ 0.05. Because flow cytometry data were recorded as percentage values, a logit transform with a

bias correction term was applied (logit = log[(r+k)/(n–r+k)] where r cells, out of n cells counted, were

positive and k is the bias correction term, 0.25). The MSC marker panel of MHC I, MHC II, CD4, CD8,

CD11a/18, CD90 and the mixed lymphocyte reaction data were analyzed using a three-factor factorial

analysis of variance (ANOVA) without replication with covariate (negative control). The MSC marker

panel of CD29, CD44, CD73 and CD90 was analyzed as single assays using a two-factor factorial

ANOVA and Pmax as a covariate. Data were back-transformed and plotted as percentage of positive

staining with 95% confidence intervals (CI); back-transforms of the differences are odds ratios, with

appropriate CIs. All possible two-way interactions among factors were assessed as well as factor by

covariate interactions and the covariate quadratics. All non-significant terms were removed. Relative

quantification of all qPCR data were analyzed using a two-factor factorial in a randomized block with

sub-sampling, accommodating unequal variances amongst targets to meet ANOVA assumption. Multiple

comparisons were subsequently adjusted using Tukey’s HSD method. For CD8 and CIITA, transcripts

were detected only once precluding statistical analysis. Analysis of residuals was performed to assess the

ANOVA assumption. Residuals were plotted against the predicted values and explanatory variables used

in the model. The residuals were tested for normality using the four tests offered by SAS: Shapiro-Wilk,

35

Kolmogorov-Smirnov, Cramer-von Mises, and Anderson-Darling. Residual analyses may identify

potential outliers, bimodal distributions, unequal variances, the need for data transformations or other

problems that need addressing.

36

RESULTS

MSC progenitor frequency population doubling time and cell morphology assessment

Nine out of nine cord blood samples yielded colonies with classic spindle-shaped fibroblast-like

morphology (not shown) giving an isolation success rate of a 100%. The number of colonies for each

sample varied between 1 and 14, with a progenitor frequency between 4.44 x10-7

% to 6.22 x10-6

%, e.g.

one MSC per 1.61x105

- 2.25x106

NC. All the CB-MSC cultures were expandable to the point of

cryopreservation in the range of 1.1x106 – 13.8x10

6 at the end of passage 2. The cell-doubling times

(DT) were as follows: passage 2 to 3 (n=9): 1.67 ± 0.15, passage 3 to 4 (n=9): 1.68± 0.15, passage 4 to 5

(n=5): 1.89 ± 0. 58.

Cells also demonstrated spindle-shaped fibroblast-like morphology at passage 1 (Fig. 2A), 3 (Fig. 2B), 4

(Fig. 2C) and post-cryopreservation passage 5 (Fig. 2D).

Morphology was preserved through passaging.

Figure 2. CB-MSC morphology. CB-MSC have

fibroblast-like morphology which is preserved

throughout passage 1 to 5 (A-D); a = 40x, b = 100x.

Images were adjusted for black and white balance,

brightness and contrast.

Expression of CD90 but loss of leukocyte markers after

serial passage and cryopreservation of MSC

Following red blood cell lysis, leukocyte population was

MHC I +, MHC II

+, CD4

+, CD8

+, CD11a/18

+ and

CD90+ at antigen (Fig. 3, 4B) and gene expression level (Fig. 4A). Flow cytometry histograms (Fig. 3)

demonstrate decreased expression for all markers at passage 2 except for CD90. For the leukocyte

A

B

A

C

D

37

population, CD90 staining appears as two distinct peaks, which progressively became the single peak

observed at passage 5, suggesting increased homogeneity of CD90 expression with time in culture.

Expression of other markers remained similar for subsequent passages.

Figure 3. Surface marker expression on leukocytes and CB-MSC. Histograms represent leukocytes, and

CB-MSC at passage 2, 3 and 5 in gate 1: cells incubated with antibody (blue line) compared to control

antibody (black line) for a representative sample. Results were similar for samples from 5 animals.

Numbers in each plot represent the mean percent positive cells for each marker, and the confidence

interval.

MHC I MHC II CD4 CD8 CD11a/18 CD90

Passage 2

Passage 3

Cel

l co

un

t

FL1-H

Leukocyte

99.13 %

[98.32-99.55]95.78 %

[92.11-

97.79]

25.09 %

[14.69-39.44]

30.32 %

[18.28 -45.84]

91.40 %

[84.52-95.38]

47.41 %

[27.68-67.97]

1.46 %

[0.68-3.09]

1.93 %

[0.90-4.07]

0.53%

[0.22-1.24]1.03%

[0.47-2.27]

1.57 %

[0.66 - 3.66]

95.09 %

[89.75-97.71]

3.41 %

[1.79- 6.39]

2.28 %

[1.19-4.32]

1.72 %

[0.89-3.27]

3.23 %

[1.70-6.05]

4.93 %

[2.61-9.10]

93.19 %

[87.55 -

96.38]

G1

G1

G1

4.57 %

[2.14-9.46]

2.56 %

[1.19-5.42]

2.67 %

[1.24-5.64]

2.39 %

[1.11-5.07]

4.40 %

[2.07-9.12]

94.68 %

[89.67 -97.33]Passage 5

G1

38

Surface antigen expression presented in Fig. 3 is also reported in Fig. 4B in combination with gene

expression (Fig. 4A). Antigen (Fig. 4B) and gene expression (Fig. 4A) significantly decreased for all

markers after culture except for CD90, for which expression

significantly increased. Between passage 2 and 3, no

significant change was observed for CD90, MHC I and MHC

II expression. Slight but significant increases in protein

expression was observed for CD8 and CD11a/18 and a

significant increase of gene and protein expression was noted

for CD4. Transcripts for CIITA and CD8 were detectable

only for the leukocyte population.

Figure 4. Gene and protein expression of markers on

leukocytes and CB-MSC. Gene (A) and protein (B)

expression were assessed with qPCR and flow cytometry,

respectively, on leukocytes, and on CB-MSC at passage 2

and 3. A. Gene expression was normalized to S18 and -

actin, and is shown relative to the lowest average CT. B.

Surface protein expression presented as percentage of

positive cells. Bars represent CI. Significance set at p<0.05

and different letters indicate significant differences between

groups. Protein and gene expression of all markers except

CD90 was significantly down-regulated in culture. There was

significant up-regulation of CD90 surface expression at passage 2, slight but significant increase of CD8

and CD11a/18 surface expression at passage 2 and 3, and significant up-regulation of CD4 gene and

-1

4

9

14MHC I

a

-5

45

95

MHC I

b b

-0.001

0.002

0.005

0.008

MHC II

-5

45

95

MHC II

-0.02

0.08

0.18CD4

-5

45

95

CD4

-0.001

0.004

0.009CD8

-5

45

95CD8

-0.1

0.4

0.9

1.4CD11a/18

-5

45

95

CD11a/18

-0.5

0.5

1.5

2.5

3.5CD90

-5

35

75

115CD90

b b

a

b c

a

b b

a

a

a

a

a

b b

a

b c

a

b c

a

b c

a

b b

Rel

ativ

e gen

e ex

pre

ssio

n

Posi

tive

cell

s (%

)

A B

Rel

ativ

e m

RN

A e

xpre

ssio

n

39

surface expression at passage 2 and 3. Transcripts for MHC II and CD8 were detected only in the

leukocyte samples.

CD29, CD44 and CD90 are highly and consistently expressed on CB-MSC at passage 5

At passage 5 following cryopreservation (Fig. 5), MHC I, MHC II, CD4, CD8, CD11a/18 demonstrated

low antigen (Fig. 5A) and gene (Fig. 5B) expression as compared to high expression for CD90.

However, due to the lack of a reliable inter-run calibrator, it is impossible to compare expression levels

before and after cryopreservation.

Figure 5. High CD90 expression at passage 5. Protein (A) and gene (B) expression were assessed with

qPCR and flow cytometry, respectively, for CB-MSC at passage 5. A. The percent positive cells. B.

0

20

40

60

80

100

120

Posi

tive

cell

s (%

)

-0.2

0

0.2

0.4

0.6

0.8

1

1.2

Rel

ativ

e m

RN

A e

xpre

ssio

n

B

A

40

Gene expression normalized to S18 and -actin and relative to the lowest average CT. Error bars

represent CI. Protein and gene expression for all markers except CD90 was significantly down-

regulation in culture. There was high CD90 protein and gene expression for CB-MSC at passage 5

compared to MHC I, MHC II, CD4, CD8 and CD11a/18.

CD29, CD44 and CD90 are highly and consistently expressed on CB-MSC at passage 5

CB-MSC were assessed post-cryopreservation at passage 5. Flow cytometry histograms demonstrated a

single peak (Fig.6A), suggesting homogeneity in expression. Antigen expression is also reported in Fig.

6B in combination with gene expression (Fig. 6C). Fig. 6B demonstrates similar high expression of

CD29, CD44, and CD90, but significantly lower expression of CD73 for antigen expression. For gene

expression (Fig. 6C), high expression of MSC markers CD29, CD44 was observed, with significantly

lower expression of CD90 as compared to CD29 and CD44.

0

20

40

60

80

100

po

siti

ve

cell

s (%

)

a a

b

c

0

0.5

1

1.5

2

2.5

Rel

ativ

e m

RN

A e

xp

ress

ion

aa

a

b

CD29 CD44 CD73 CD90

Cel

l co

unt

Passage 5 91,73 %

[87.16 -94.77]

1,97 %

[1.27-3.06]

99,56 %

[99.30-99.72] 99,55 %

[99.29-99.71]

A

B C

41

Figure 6. CD29, CD44 and CD90 are highly and consistently expressed on CB-MSC at passage 5. A.

Histograms represent the percent of stained (blue line) CB-MSC at passage 5 in gate 1 relative to

negative control (black line). Results are representative of 5 experiments. Numbers in each plot represent

the mean percent positive cells for each marker, and the confidence interval. B. Graphical representation

of flow cytometry results from 5 experiments. C. Relative gene expression, error bars represent CI.

Significance set at p<0.05 and different letters indicate significant differences between groups. CB-MSC

at passage 5 had consistently high expression of CD29, CD44 and CD90 relative to CD73. CD29 and

CD44 had significantly higher protein expression than CD90.

CB-MSC decrease lymphocyte proliferation in mixed lymphocyte reactions

All CB-MSC cultures tested demonstrated significant suppression of lymphocyte proliferation and 3 out

of 4 groups showed proliferation significantly lower than the negative control (autologous) group (Fig.

7).

0

1

2

3

4

5

6

7

8

% B

rdU

posi

tive

cell

s

c b b

a

a

a,b

A

42

0

2

4

6

8

10

12

14

16

18

20%

Brd

U p

osi

tive

cell

s

a

b

a

c c c

0

2

4

6

8

10

12

14

% B

rdU

posi

tive

cell

s

a

b

aa

a a

43

Figure 7. CB-MSC decrease lymphocyte proliferation in mixed lymphocyte reactions. Four CB-MSC

cultures each suppressed in vitro lymphocyte proliferation (A). Means of all cultures are shown in (B).

Proliferation was detected by BrdU incorporation and flow cytometry. Negative control: autologous

responder and stimulator lymphocytes. Positive control: allogeneic responder and stimulator

lymphocytes. Different letters indicate significant differences (P<0.05) between groups, bars indicate CI.

CB-MSC constitutively express TLR4 with minimal up-regulation after LPS stimulation

TLR3 and TLR4 were assessed for gene expression with qPCR (Fig. 8A, B) and protein expression with

ICC (Fig. 8C, D) before and after incubation with poly (I:C) for and LPS respectively. TLR4 was

constitutively expressed at antigen (Fig. 8D) and gene expression (8B) levels and expression was not

significantly changed after treatment with LPS. TLR3 gene expression was low (<35 Ct) (Fig. 8A) and

correlated with low protein expression (Fig. 8C). Statistical analysis suggested significant up-regulation

following treatment with poly (I:C), however, expression remained over 35 Ct.

0

1

2

3

4

5

6

7

8

9%

Brd

U p

osi

tiv

e ce

lls

a

b

a,c

c c c

B

44

00.20.40.60.8

11.21.41.61.8

2

Rel

ativ

e gen

e ex

pre

ssio

nTLR3

Ct˃35a

Ct˃35b

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

Rel

ativ

e m

RN

A e

xpre

ssio

n

TLR4

aaCt<35

Ct<35

B

A

45

Figure 8. CB-MSC constitutively express TLR4 with minimal up-regulation after LPS stimulation. Gene

expression of TLR3 (A) and TLR4 (B) was normalized to S18 and -actin and expressed relative to

untreated samples. Bars indicate CI. Significance set at p<0.05 and different letters indicate significant

differences between groups. B. ICC for TLR3 (C) and TLR4 (D). Negative secondary antibody control

for (a), staining of untreated CB-MSC (b), and staining of CB-MSC after treatment with poly (I:C) or

LPS (c). TLR4 antigen and gene expression was detected in CB-MSC, and showed minimal response to

LPS stimulation. There was significant TLR3 gene up-regulation after poly (I:C) stimulation, but

expression remained very low and inconsistently detectable by ICC.

C D

46

GENERAL DISCUSSION AND FUTURE EXPERIMENTS

I report a 100% success rate of MSC isolation from equine cord blood. MSC isolation success of 100%

from cord blood was first reported in the horse (Koch et al., 2009), and confirmed in this study with a

greater number of samples. This is an important finding since it confirms that this method is robust for

the isolation of equine CB-MSC and not operator-dependent. A major advantage of CB-MSC compared

to adult MSC from bone marrow and adipose tissue is that a highly differentiation potent population of

MSC can be obtained non-invasively and be cryopreserved for later use (Kern et al., 2006; Kogler et al.,

2006; Koch et al., 2007). However, the number of human cord blood samples successfully yielding MSC

was generally reported to be low as no MSC progenitor could be isolated in a number of samples

(Bieback et al., 2004). In equine medicine the use of autologous CB-MSC is now only challenged by the

risk of cord blood collection failure at the time of foaling. Once cord blood is collected CB-MSC can be

reliably isolated.

I report, for the first time, a consistent constellation of antigens expressed on CB-MSC consisting of

CD29, CD44, CD90, along with lack of surface MHC I, MHC II, CD4, CD8, CD11a/18, and CD73.

Consistent with my results, De Schauwer2 et al.

(2012) found no major differences in phenotype before

and after cryopreservation, except for CD73, which demonstrated less variation (De Schauwer2 et al.,

2012). Findings regarding presence of transcripts detection for CD29, CD44 and MHC I (B2M) and

absence of transcripts for MHC II (CIITA in my study) after culture and cryopreservation are in

agreement with a previous report by Lovati et al. (2011). As expected, following the initial leukocyte

isolation, surface antigen expression was; MHC Ihigh

, MHC IIhigh

, CD4high

, CD8high

, CD11a/18high

and

CD90high

. Monolayer culture expansion subsequently negatively selected for these antigens with the

exception of CD90 which expression up-regulated significantly. Phenotype as of passage 2 was then

MHC Ilow/neg

, MHC IIlow/neg

, CD4low/neg

, CD8low/neg

, CD11a/18low/neg

and CD90high

. Between passage 2 and

47

3, antigen and gene expression for CD4, and antigen expression for CD8 and CD11a/18 significantly

increased. However, it was only a slight increase and expression remained very low. As reviewed earlier,

CD90 was expected to be highly expressed as it is known as positive on equine MSC. This result is also

in accordance with a previous study looking at temporal phenotype of equine BM-MSC reported CD44hi

,

CD29hi

, CD90low

, CD11a/CD18hi

, and CD45RBlow

expression 2 hours after culture, which became

CD44hi

, CD29hi

, and CD90hi

, CD11a/CD18neg

, and CD45RBneg

after 14 days in culture (Radcliffe et al.,

2010). My results showed a similar pattern of expression. Expression of the lymphocyte markers CD4

and CD8 has not previously been reported in equine MSC, but my results are consistent with the

observation that CD4 and CD8 positive lymphocytes do not adhere to plastic. These cells were therefore

likely removed through media changes and sub-culturing.

The consistently low CB-MSC MHC I antigen expression following culture contrasts the findings of a

previous study on equine CB-MSC that found surface expression of MHC I (49-95%) (Carrade et al.,

2012). In the same study, similar expression was also reported for equine BM-, AT- and CB-MSC

(Carrade et al., 2012). In this thesis, all surface antigens detected were also interrogated with qPCR-

assays for gene expression, hence, MHC I expression can be regarded as a robust finding. Differences in

surface expression between two independent studies can be influenced by several factors such as culture

conditions and variability in reagents. Variation can occur between different antibody sources, clones or

lot numbers. However, even if the antibody I used was different than the one used by Carrade et al., it

does not explain the observed discrepancy, since I also found consistent low B2M gene expression.

Since B2M expression is required for surface expression of MHC I molecules (Otten et al., 1992), this

supports the MHC I result and suggests the low MHC I expression is real. A notable difference between

my culture method and that of Carrade et al. (2012) is the presence of dexamethasone in my isolation

medium. The possible influence of dexamethasone on MHC I expression was not investigated. However,

48

unrestricted somatic stem cells (USSC), pluripotent cells present in cord blood, are also isolated in

presence of dexamethasone and express surface MHC I (Kögler et al., 2004).

An immunoprivileged phenotype of these equine CB-MSC is suggested by the low MHC I expression

(Hass et al., 2011). Neural stem cells negative for MHC I were reported to not be recognized by

cytotoxic T lymphocytes and NK cell in vitro in a mouse model (Mammolenti et al., 2004). However,

more work is needed to determine if MHC I high or low expression is related to different culture

conditions, and whether this phenotype is stable in time. The immunoprivileged phenotype has been

suggested to be unstable and equine CB-MSC MHC I expression has been found to be up-regulated

following inflammation (Carrade et al., 2012). In addition, MSC differentiation has been associated with

increased immunoreactivity, which may be due to altered MHC expression. For example, adipo-, osteo-

and chondro-genic differentiation of human MSC increased MHC I expression, but not MHC II in vitro

(Le Blanc et al., 2003). However, the same report suggests efficient in vitro suppression of

lymphoproliferation by MSC even after 2 weeks in differentiation medium (Le Blanc et al., 2003).

Transition from an immunoprivileged to an immunoreactive phenotype is suggested to occur gradually.

Injection of allogeneic MSC into rat infarcted myocardium did not elicit an immune response after 1

week, but did after 5 weeks as evaluated by cytokine expression in the heart and presence of alloantibody

in the recipient circulation. Allogeneic, but not syngeneic, MSC failed to restore cardiac function 6

months after induced myocardium infarct (Huang2 et al., 2010), suggesting involvement of MHC I and II

in the reported failure. Thus, long-term transition of MSC to an alloreactive phenotype remains an

important area of research in order to determine the key factors that limit or facilitate successful MSC

allogeneic treatments.

In addition, I report consistent ability of equine MSC to suppress lymphocyte proliferation in vitro,

consistent with similar report on equine cord blood-derived MSC (Carrade et al., 2012). I also report

49

constitutive TLR4 expression and low/absent TLR3 expression. This is in contrast with my hypothesis

based on human reports. This is the first report regarding TLR3 and TLR4 expression on equine CB-

MSC, and suggests potential inter-species differences. In vitro suppression of lymphoproliferation is

used as a proxy for possible anti-inflammatory effect of MSC in vivo. The mechanisms by which MSC

exert their immunomodulation abilities is still largely unknown, but it was recently suggested that

expression of TLRs might be important determinants. TLR3 has been suggested as involved in the MSC

immunomodulation abilities, while TLR4 associated with a pro-inflammatory phenotype (Tomchuck et

al., 2008; Waterman et al., 2010). Interestingly, I observed constitutive expression of TLR4 at both

antigen and gene expression level as well as very low and inconsistent TLR3 mRNA expression along

with lack of consistent ICC staining. Similar to my results, constitutive TLR4 expression has been

reported in human BM-, AT-, and CB-MSC as well as in mouse BM-derived MSC. However, contrary to

my results, some reports also demonstrated constitutive expression of TLR3 (Raicevic et al., 2010; Liotta

et al., 2008; Hwa Cho et al., 2006; Tomchuck et al., 2007; Pevsner-Fischer et al., 2007; Raicevic et al.,

2011; van den Berk et al., 2009). More investigation into the relation of TLR3 and TLR4 expression

with MSC immunomodulation properties are required. Knock-down of TLR3 and TLR4 separately with

subsequent assessment in mixed lymphocyte reaction is suggested to test TLR3 and 4 involvements in

equine CB-MSC ability to suppress in vitro lymphoproliferation. TLR3- and TLR4-knocked-out cells

reactivity to IFN- treatment should also be tested. Similar assessment could be performed with MyD88-

and TRIF-knocked-out cells to test whether or not MyD88 involvement is more decisive of immune

abilities than an individual TLR.

In addition, based on previous reports, it was unexpected that TLR4 and TLR3 mRNA and protein

expression was not upregulated following stimulation with LPS and poly (I:C), respectively. Only one

concentration and assessment time point was used. Dose titration and temporal assessment may reveal

50

differences. At this point in time, no consensus protocol exists for TLR up-regulation using specific

ligands, as reports on the responses are conflicting. It appears to depend on several factors, such as cell

source and species as reported by Waterman et al. (2010). Both TLR3 and TLR4 are also specifically

known to exert inter-species differences (Lundberg et al., 2007; Ferwerda et al., 2008).

From a clinical point of view, identification of a specific cell population by detection of a surface marker

would be desirable, since it might allow cell sorting. However, no constitutively expressed markers have

been correlated with immunosuppressive abilities of MSC. Responsiveness to IFN- would currently not

allow single cell analysis and marker-based cell isolation, but would be very useful to assess the general

immune abilities of MSC-derived from a particular donor. MSC from individuals yielding higher

immunosuppressive abilities could then be used in priority for allogeneic cytotherapy, as suggested by

Galipeau (2013) regarding human donors. Human MSC abilities to suppress lymphocyte proliferation

were suggested to correlate to IDO responsiveness after IFN- treatment (François2 et al., 2012).

However, this possible surrogate marker to quantify the response seems variable across species, as

indicated by variability between humans and mice (Ren et al., 2008). In horses, no report specifically

answered this question. However, a report by Carrade et al. (2012) suggests IL-6 and PGE-2 as potential

candidates rather than IDO or iNOS. I also report up-regulation of IL-6 gene expression in response to

IL-1 (Appendix III). Measurement of IDO, iNOS, IL-6 and PGE-2 quantitative expression following

incubation with IFN- in vitro with qPCR and western blots is suggested. Subsequently, each cytokine

could be separately knocked-down and knocked-out CB-MSC assessed in a mixed lymphocyte reaction

to assess potential lost of immunomodulatory abilities.

In conclusion, CB-MSC can consistently be isolated and possess specific surface phenotype post-

cryopreservation. The CB-MSC phenotype of CD90high

, and MHC I low/absent

, MHC II low/absent

, CD4

51

low/absent, CD8

low/absent and CD11a/18

low/absent was unaffected by cryopreservation. In addition, CB-MSC at

passage 5 post-cryopreservation highly expressed CD29 and CD44 with low/absent expression of CD73.

In contrast to my hypothesis, I found constitutive expression of TLR4 on equine CB-MSC along with

lack of TLR3 expression. Further studies are required to characterize TLR expression on CB-MSC as

well as their functional abilities, and involvement in immunomodulatory phenotype. Low MHC I

expression suggests a reduced risk of CB-MSC being immediately rejected in vivo. Further

characterization of mechanisms by which MSC exert their immunomodulatory properties is required.

The work presented is an important step toward clinical use of CB-MSC and further investigation of the

role of TLR3 and TLR4 in equine MSC immunomodulatory mechanism.

52

REFERENCES

Adachi O, Kawai T, Takeda K, Matsumoto M, Tsutsui H, Sakagami M, Nakanishi K, Akira S: Targeted

disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function. Immunity 1998,

9(1):143-150.

Aggarwal S, Pittenger MF: Human mesenchymal stem cells modulate allogeneic immune cell responses.

Blood 2005, 105(4):1815-1822.

Akira S, Uematsu S, Takeuchi O: Pathogen recognition and innate immunity. Cell 2006, 124(4):783-801.

Alexopoulou L, Holt AC, Medzhitov R, Flavell RA: Recognition of double-stranded RNA and activation

of NF-kappaB by Toll-like receptor 3. Nature 2001, 413(6857):732-738.

Alves H, van Ginkel J, Groen N, Hulsman M, Mentink A, Reinders M, van Blitterswijk C, de Boer J: A

mesenchymal stromal cell gene signature for donor age. PLoS One 2012, 7(8):e42908.

Anderson DD, Chubinskaya S, Guilak F, Martin JA, Oegema TR, Olson SA, Buckwalter JA: Post-

traumatic osteoarthritis: improved understanding and opportunities for early intervention. J Orthop Res

2011, 29(6):802-809.

Arnhold SJ, Goletz I, Klein H, Stumpf G, Beluche LA, Rohde C, Addicks K, Litzke LF: Isolation and

characterization of bone marrow-derived equine mesenchymal stem cells. Am J Vet Res 2007,

68(10):1095-1105.

Baal N, Reisinger K, Jahr H, Bohle RM, Liang O, Munstedt K, Rao CV, Preissner KT, Zygmunt MT:

Expression of transcription factor Oct-4 and other embryonic genes in CD133 positive cells from human

umbilical cord blood. Thromb Haemost 2004, 92(4):767-775.

Bar T, Kubista M, Tichopad A: Validation of kinetics similarity in qPCR. Nucleic Acids Res 2012,

40(4):1395-1406.

Bassi EJ, de Almeida DC, Moraes-Vieira PM, Camara NO: Exploring the role of soluble factors

associated with immune regulatory properties of mesenchymal stem cells. Stem Cell Rev 2012,

8(2):329-342.

Baxter MA, Wynn RF, Jowitt SN, Wraith JE, Fairbairn LJ, Bellantuono I: Study of telomere length

reveals rapid aging of human marrow stromal cells following in vitro expansion. Stem Cells 2004,

22(5):675-682.

Berger A: Th1 and Th2 responses: what are they? BMJ 2000, 321(7258):424.

Bieback K, Kern S, Kluter H, Eichler H: Critical parameters for the isolation of mesenchymal stem cells

from umbilical cord blood. Stem Cells 2004, 22(4):625-634.

Black LL, Gaynor J, Gahring D, Adams C, Aron D, Harman S, Gingerich DA, Harman R: Effect of

adipose-derived mesenchymal stem and regenerative cells on lameness in dogs with chronic

53

osteoarthritis of the coxofemoral joints: a randomized, double-blinded, multicenter, controlled trial. Vet

Ther 2007, 8(4):272-284.

Bonab MM, Alimoghaddam K, Talebian F, Ghaffari SH, Ghavamzadeh A, Nikbin B: Aging of

mesenchymal stem cell in vitro. BMC Cell Biol 2006, 7:14.

Braun J, Hack A, Weis-Klemm M, Conrad S, Treml S, Kohler K, Walliser U, Skutella T, Aicher WK:

Evaluation of the osteogenic and chondrogenic differentiation capacities of equine adipose tissue-derived

mesenchymal stem cells. Am J Vet Res 2010, 71(10):1228-1236.

Bunnell BA, Betancourt AM, Sullivan DE: New concepts on the immune modulation mediated by

mesenchymal stem cells. Stem Cell Res Ther 2010, 1(5):34.

Caplan AI: Why are MSCs therapeutic? New data: new insight. J Pathol 2009, 217(2):318-324.

Caplan AI, Dennis JE: Mesenchymal stem cells as trophic mediators. J Cell Biochem 2006, 98(5):1076-

1084.

Carrade DD, Lame MW, Kent MS, Clark KC, Walker NJ, Borjesson DL: Comparative Analysis of the

Immunomodulatory Properties of Equine Adult-Derived Mesenchymal Stem Cells(). Cell Med 2012,

4(1):1-11.

Carrington JL: Aging bone and cartilage: cross-cutting issues. Biochem Biophys Res Commun 2005,

328(3):700-708.

Cassatella MA, Mosna F, Micheletti A, Lisi V, Tamassia N, Cont C, Calzetti F, Pelletier M, Pizzolo G,

Krampera M: Toll-like receptor-3-activated human mesenchymal stromal cells significantly prolong the

survival and function of neutrophils. Stem Cells 2011, 29(6):1001-1011.

Chan CK, Wu KH, Lee YS, Hwang SM, Lee MS, Liao SK, Cheng EH, See LC, Tsai CN, Kuo ML,

Huang JL: The comparison of interleukin 6-associated immunosuppressive effects of human ESCs, fetal-

type MSCs, and adult-type MSCs. Transplantation 2012, 94(2):132-138.

Chan J, O'Donoghue K, Gavina M, Torrente Y, Kennea N, Mehmet H, Stewart H, Watt DJ, Morgan JE,

Fisk NM: Galectin-1 induces skeletal muscle differentiation in human fetal mesenchymal stem cells and

increases muscle regeneration. Stem Cells 2006, 24(8):1879-1891.

Corcione A, Benvenuto F, Ferretti E, Giunti D, Cappiello V, Cazzanti F, Risso M, Gualandi F, Mancardi

GL, Pistoia V, Uccelli A: Human mesenchymal stem cells modulate B-cell functions. Blood 2006,

107(1):367-372.

Corver WE, Cornelisse CJ, Hermans J, Fleuren GJ: Limited loss of nine tumor-associated surface

antigenic determinants after tryptic cell dissociation. Cytometry 1995, 19(3):267-272.

Cyranoski D: Stem cells boom in vet clinics. Nature 2013, 496(7444):148-149.

d'Aquino R, Graziano A, Sampaolesi M, Laino G, Pirozzi G, De Rosa A, Papaccio G: Human postnatal

dental pulp cells co-differentiate into osteoblasts and endotheliocytes: a pivotal synergy leading to adult

bone tissue formation. Cell Death Differ 2007, 14(6):1162-1171.

54

De Bari C, Dell'Accio F, Tylzanowski P, Luyten FP: Multipotent mesenchymal stem cells from adult

human synovial membrane. Arthritis Rheum 2001, 44(8):1928-1942.

DelaRosa O, Lombardo E, Beraza A, Mancheno-Corvo P, Ramirez C, Menta R, Rico L, Camarillo E,

Garcia L, Abad JL, Trigueros C, Delgado M, Buscher D: Requirement of IFN-gamma-mediated

indoleamine 2,3-dioxygenase expression in the modulation of lymphocyte proliferation by human

adipose-derived stem cells. Tissue Eng Part A 2009, 15(10):2795-2806.

de Mattos Carvalho A, Alves AL, Golim MA, Moroz A, Hussni CA, de Oliveira PG, Deffune E:

Isolation and immunophenotypic characterization of mesenchymal stem cells derived from equine

species adipose tissue. Vet Immunol Immunopathol 2009, 132(2-4):303-306.

De Schauwer1 C, Piepers S, Van de Walle GR, Demeyere K, Hoogewijs MK, Govaere JL, Braeckmans

K, Van Soom A, Meyer E: In search for cross-reactivity to immunophenotype equine mesenchymal

stromal cells by multicolor flow cytometry. Cytometry A 2012, 81(4):312-323.

De Schauwer2 C, van de Walle GR, Piepers S, Hoogewijs MK, Govaere JL, Meyer E, van Soom A:

Successful isolation of equine mesenchymal stromal cells from cryopreserved umbilical cord blood-

derived mononuclear cell fractions. Equine Vet J 2013, 45(4):518-522.

Di Nicola M, Carlo-Stella C, Magni M, Milanesi M, Longoni PD, Matteucci P, Grisanti S, Gianni AM:

Human bone marrow stromal cells suppress T-lymphocyte proliferation induced by cellular or

nonspecific mitogenic stimuli. Blood 2002, 99(10):3838-3843.

Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A,

Prockop D, Horwitz E: Minimal criteria for defining multipotent mesenchymal stromal cells. The

International Society for Cellular Therapy position statement. Cytotherapy 2006, 8(4):315-317.

Ennis J, Gotherstrom C, Le Blanc K, Davies JE: In vitro immunologic properties of human umbilical

cord perivascular cells. Cytotherapy 2008, 10(2):174-181.

Equine Canada: 2010 Canadian Equine Industry Profile Study. Retrieved from:

http://www.equinecanada.ca/industry/index.php?option=com_content&view=section&id=103&Itemid=5

59&lang=en; august 26 2013, 9pm.

Ferwerda B, McCall MB, Verheijen K, Kullberg BJ, van der Ven AJ, Van der Meer JW, Netea MG:

Functional consequences of toll-like receptor 4 polymorphisms. Mol Med 2008, 14(5-6):346-352.

Figueiredo MD, Salter CE, Andrietti AL, Vandenplas ML, Hurley DJ, Moore JN: Validation of a reliable

set of primer pairs for measuring gene expression by real-time quantitative RT-PCR in equine

leukocytes. Vet Immunol Immunopathol 2009, 131(1-2):65-72.

Fortier LA, Nixon AJ, Williams J, Cable CS: Isolation and chondrocytic differentiation of equine bone

marrow-derived mesenchymal stem cells. Am J Vet Res 1998, 59(9):1182-1187.

Francois1 M, Copland IB, Yuan S, Romieu-Mourez R, Waller EK, Galipeau J: Cryopreserved

mesenchymal stromal cells display impaired immunosuppressive properties as a result of heat-shock

response and impaired interferon-gamma licensing. Cytotherapy 2012, 14(2):147-152.

55

Francois2 M, Romieu-Mourez R, Li M, Galipeau J: Human MSC suppression correlates with cytokine

induction of indoleamine 2,3-dioxygenase and bystander M2 macrophage differentiation. Mol Ther

2012, 20(1):187-195.

Frelinger JG, Hood L, Hill S, Frelinger JA: Mouse epidermal Ia molecules have a bone marrow origin.

Nature 1979, 282(5736):321-323.

Friedenstein AJ, Petrakova KV, Kurolesova AI, Frolova GP: Heterotopic of bone marrow. Analysis of

precursor cells for osteogenic and hematopoietic tissues. Transplantation 1968, 6(2):230-247.

Frisbie DD: Future directions in treatment of joint disease in horses. Vet Clin North Am Equine Pract

2005, 21(3):713-24, viii.

Frisbie DD, Kisiday JD, Kawcak CE, Werpy NM, McIlwraith CW: Evaluation of adipose-derived

stromal vascular fraction or bone marrow-derived mesenchymal stem cells for treatment of osteoarthritis.

J Orthop Res 2009, 27(12):1675-1680.

Galipeau J: The mesenchymal stromal cells dilemma--does a negative phase III trial of random donor

mesenchymal stromal cells in steroid-resistant graft-versus-host disease represent a death knell or a

bump in the road? Cytotherapy 2013, 15(1):2-8.

Ghannam S, Pene J, Torcy-Moquet G, Jorgensen C, Yssel H: Mesenchymal stem cells inhibit human

Th17 cell differentiation and function and induce a T regulatory cell phenotype. J Immunol 2010,

185(1):302-312.

Guest DJ, Smith MR, Allen WR: Monitoring the fate of autologous and allogeneic mesenchymal

progenitor cells injected into the superficial digital flexor tendon of horses: preliminary study. Equine

Vet J 2008, 40(2):178-181.

Guillot PV, Gotherstrom C, Chan J, Kurata H, Fisk NM: Human first-trimester fetal MSC express

pluripotency markers and grow faster and have longer telomeres than adult MSC. Stem Cells 2007,

25(3):646-654.

Guo B, Slevin M, Li C, Parameshwar S, Liu D, Kumar P, Bernabeu C, Kumar S: CD105 inhibits

transforming growth factor-beta-Smad3 signalling. Anticancer Res 2004, 24(3a):1337-1345.

Hass R, Kasper C, Bohm S, Jacobs R: Different populations and sources of human mesenchymal stem

cells (MSC): A comparison of adult and neonatal tissue-derived MSC. Cell Commun Signal 2011, 9:12-

811X-9-12.

Hayflick L: The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res 1965, 37:614-

636.

Haynesworth SE, Baber MA, Caplan AI: Cytokine expression by human marrow-derived mesenchymal

progenitor cells in vitro: effects of dexamethasone and IL-1 alpha. J Cell Physiol 1996, 166(3):585-592.

56

Horwitz EM, Le Blanc K, Dominici M, Mueller I, Slaper-Cortenbach I, Marini FC, Deans RJ, Krause

DS, Keating A, International Society for Cellular Therapy: Clarification of the nomenclature for MSC:

The International Society for Cellular Therapy position statement. Cytotherapy 2005, 7(5):393-395.

Huang1 HL, Hsing HW, Lai TC, Chen YW, Lee TR, Chan HT, Lyu PC, Wu CL, Lu YC, Lin ST, Lin

CW, Lai CH, Chang HT, Chou HC, Chan HL: Trypsin-induced proteome alteration during cell

subculture in mammalian cells. J Biomed Sci 2010, 17:36-0127-17-36.

Huang2 XP, Sun Z, Miyagi Y, McDonald Kinkaid H, Zhang L, Weisel RD, Li RK: Differentiation of

allogeneic mesenchymal stem cells induces immunogenicity and limits their long-term benefits for

myocardial repair. Circulation 2010, 122(23):2419-2429.

Hwa Cho H, Bae YC, Jung JS: Role of toll-like receptors on human adipose-derived stromal cells. Stem

Cells 2006, 24(12):2744-2752.

Ibrahim S, Saunders K, Kydd JH, Lunn DP, Steinbach F: Screening of anti-human leukocyte monoclonal

antibodies for reactivity with equine leukocytes. Vet Immunol Immunopathol 2007, 119(1-2):63-80.

in 't Anker PS, Noort WA, Scherjon SA, Kleijburg-van der Keur C, Kruisselbrink AB, van Bezooijen

RL, Beekhuizen W, Willemze R, Kanhai HH, Fibbe WE: Mesenchymal stem cells in human second-

trimester bone marrow, liver, lung, and spleen exhibit a similar immunophenotype but a heterogeneous

multilineage differentiation potential. Haematologica 2003, 88(8):845-852.

Kaisho T, Takeuchi O, Kawai T, Hoshino K, Akira S: Endotoxin-induced maturation of MyD88-

deficient dendritic cells. J Immunol 2001, 166(9):5688-5694.

Kapoor M, Martel-Pelletier J, Lajeunesse D, Pelletier JP, Fahmi H: Role of proinflammatory cytokines

in the pathophysiology of osteoarthritis. Nat Rev Rheumatol 2011, 7(1):33-42.

Katsara O, Mahaira LG, Iliopoulou EG, Moustaki A, Antsaklis A, Loutradis D, Stefanidis K, Baxevanis

CN, Papamichail M, Perez SA: Effects of donor age, gender, and in vitro cellular aging on the

phenotypic, functional, and molecular characteristics of mouse bone marrow-derived mesenchymal stem

cells. Stem Cells Dev 2011, 20(9):1549-1561.

Kawai T, Akira S: The role of pattern-recognition receptors in innate immunity: update on Toll-like

receptors. Nat Immunol 2010, 11(5):373-384.

Kern S, Eichler H, Stoeve J, Kluter H, Bieback K: Comparative analysis of mesenchymal stem cells

from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells 2006, 24(5):1294-1301.

Kiani C, Chen L, Wu YJ, Yee AJ, Yang BB: Structure and function of aggrecan. Cell Res 2002,

12(1):19-32.

Kim N, Im KI, Lim JY, Jeon EJ, Nam YS, Kim EJ, Cho SG: Mesenchymal stem cells for the treatment

and prevention of graft-versus-host disease: experiments and practice. Ann Hematol 2013.

Kobayashi M, Squires GR, Mousa A, Tanzer M, Zukor DJ, Antoniou J, Feige U, Poole AR: Role of

interleukin-1 and tumor necrosis factor alpha in matrix degradation of human osteoarthritic cartilage.

Arthritis Rheum 2005, 52(1):128-135.

57

Koch TG, Heerkens T, Thomsen PD, Betts DH: Isolation of mesenchymal stem cells from equine

umbilical cord blood. BMC Biotechnol 2007, 7:26.

Koch TG, Thomsen PD, Betts DH: Improved isolation protocol for equine cord blood-derived

mesenchymal stromal cells. Cytotherapy 2009, 11(4):443-447.

Koenders MI, Lubberts E, Oppers-Walgreen B, van den Bersselaar L, Helsen MM, Di Padova FE, Boots

AM, Gram H, Joosten LA, van den Berg WB: Blocking of interleukin-17 during reactivation of

experimental arthritis prevents joint inflammation and bone erosion by decreasing RANKL and

interleukin-1. Am J Pathol 2005, 167(1):141-149.

Kogler G, Sensken S, Airey JA, Trapp T, Muschen M, Feldhahn N, Liedtke S, Sorg RV, Fischer J,

Rosenbaum C, Greschat S, Knipper A, Bender J, Degistirici O, Gao J, Caplan AI, Colletti EJ, Almeida-

Porada G, Muller HW, Zanjani E, Wernet P: A new human somatic stem cell from placental cord blood

with intrinsic pluripotent differentiation potential. J Exp Med 2004, 200(2):123-135.

Kogler G, Sensken S, Wernet P: Comparative generation and characterization of pluripotent unrestricted

somatic stem cells with mesenchymal stem cells from human cord blood. Exp Hematol 2006,

34(11):1589-1595.

Krampera M, Cosmi L, Angeli R, Pasini A, Liotta F, Andreini A, Santarlasci V, Mazzinghi B, Pizzolo G,

Vinante F, Romagnani P, Maggi E, Romagnani S, Annunziato F: Role for interferon-gamma in the

immunomodulatory activity of human bone marrow mesenchymal stem cells. Stem Cells 2006,

24(2):386-398.

Krampera M, Glennie S, Dyson J, Scott D, Laylor R, Simpson E, Dazzi F: Bone marrow mesenchymal

stem cells inhibit the response of naive and memory antigen-specific T cells to their cognate peptide.

Blood 2003, 101(9):3722-3729.

Lange-Consiglio A, Corradetti B, Meucci A, Perego R, Bizzaro D, Cremonesi F: Characteristics of

equine mesenchymal stem cells derived from amnion and bone marrow: in vitro proliferative and

multilineage potential assessment. Equine Vet J 2013.

Lanier LL: NK cell recognition. Annu Rev Immunol 2005, 23:225-274.

Lawrence JT, Birmingham J, Toth AP: Emerging ideas: prevention of posttraumatic arthritis through

interleukin-1 and tumor necrosis factor-alpha inhibition. Clin Orthop Relat Res 2011, 469(12):3522-

3526.

Lazarus HM, Haynesworth SE, Gerson SL, Rosenthal NS, Caplan AI: Ex vivo expansion and subsequent

infusion of human bone marrow-derived stromal progenitor cells (mesenchymal progenitor cells):

implications for therapeutic use. Bone Marrow Transplant 1995, 16(4):557-564.

Le Blanc K, Pittenger M: Mesenchymal stem cells: progress toward promise. Cytotherapy 2005, 7(1):36-

45.

58

Le Blanc K, Rasmusson I, Sundberg B, Gotherstrom C, Hassan M, Uzunel M, Ringden O: Treatment of

severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet

2004, 363(9419):1439-1441.

Le Blanc K, Ringden O: Immunomodulation by mesenchymal stem cells and clinical experience. J Intern

Med 2007, 262(5):509-525.

Le Blanc K, Tammik C, Rosendahl K, Zetterberg E, Ringden O: HLA expression and immunologic

properties of differentiated and undifferentiated mesenchymal stem cells. Exp Hematol 2003,

31(10):890-896.

Lee CC, Ye F, Tarantal AF: Comparison of growth and differentiation of fetal and adult rhesus monkey

mesenchymal stem cells. Stem Cells Dev 2006, 15(2):209-220.

Leung A, Liew D, Lim J, Page C, Boukris-Sayag V, Mundae M, Wong M, Choong P, Dowsey M,

Clemens L, Lim K: The effect of joint aspiration and corticosteroid injections in osteoarthritis of the

knee. Int J Rheum Dis 2011, 14(4):384-389.

Li F, Yang M, Wang L, Williamson I, Tian F, Qin M, Shah PK, Sharifi BG: Autofluorescence

contributes to false-positive intracellular Foxp3 staining in macrophages: a lesson learned from flow

cytometry. J Immunol Methods 2012, 386(1-2):101-107.

Liotta F, Angeli R, Cosmi L, Fili L, Manuelli C, Frosali F, Mazzinghi B, Maggi L, Pasini A, Lisi V,

Santarlasci V, Consoloni L, Angelotti ML, Romagnani P, Parronchi P, Krampera M, Maggi E,

Romagnani S, Annunziato F: Toll-like receptors 3 and 4 are expressed by human bone marrow-derived

mesenchymal stem cells and can inhibit their T-cell modulatory activity by impairing Notch signaling.

Stem Cells 2008, 26(1):279-289.

Ljunggren HG, Karre K: In search of the 'missing self': MHC molecules and NK cell recognition.

Immunol Today 1990, 11(7):237-244.

Lombardo E, DelaRosa O, Mancheno-Corvo P, Menta R, Ramirez C, Buscher D: Toll-like receptor-

mediated signaling in human adipose-derived stem cells: implications for immunogenicity and

immunosuppressive potential. Tissue Eng Part A 2009, 15(7):1579-1589.

Lovati AB, Corradetti B, Lange Consiglio A, Recordati C, Bonacina E, Bizzaro D, Cremonesi F:

Comparison of equine bone marrow-, umbilical cord matrix and amniotic fluid-derived progenitor cells.

Vet Res Commun 2011, 35(2):103-121.

Lubberts E, Schwarzenberger P, Huang W, Schurr JR, Peschon JJ, van den Berg WB, Kolls JK:

Requirement of IL-17 receptor signaling in radiation-resistant cells in the joint for full progression of

destructive synovitis. J Immunol 2005, 175(5):3360-3368.

Lund TC, Kobs A, Blazar BR, Tolar J: Mesenchymal stromal cells from donors varying widely in age

are of equal cellular fitness after in vitro expansion under hypoxic conditions. Cytotherapy 2010,

12(8):971-981.

59

Lundberg AM, Drexler SK, Monaco C, Williams LM, Sacre SM, Feldmann M, Foxwell BM: Key

differences in TLR3/poly I:C signaling and cytokine induction by human primary cells: a phenomenon

absent from murine cell systems. Blood 2007, 110(9):3245-3252.

Maccario R, Podesta M, Moretta A, Cometa A, Comoli P, Montagna D, Daudt L, Ibatici A, Piaggio G,

Pozzi S, Frassoni F, Locatelli F: Interaction of human mesenchymal stem cells with cells involved in

alloantigen-specific immune response favors the differentiation of CD4+ T-cell subsets expressing a

regulatory/suppressive phenotype. Haematologica 2005, 90(4):516-525.

Maecker HT, Rinfret A, D'Souza P, Darden J, Roig E, Landry C, Hayes P, Birungi J, Anzala O, Garcia

M, Harari A, Frank I, Baydo R, Baker M, Holbrook J, Ottinger J, Lamoreaux L, Epling CL, Sinclair E,

Suni MA, Punt K, Calarota S, El-Bahi S, Alter G, Maila H, Kuta E, Cox J, Gray C, Altfeld M,

Nougarede N, Boyer J, Tussey L, Tobery T, Bredt B, Roederer M, Koup R, Maino VC, Weinhold K,

Pantaleo G, Gilmour J, Horton H, Sekaly RP: Standardization of cytokine flow cytometry assays. BMC

Immunol 2005, 6:13.

Maia L, Landim-Alvarenga FC, Da Mota LS, De Assis Golim M, Laufer-Amorim R, De Vita B,

Barberini DJ, Listoni AJ, De Moraes CN, Heckler MC, Amorim RM: Immunophenotypic,

immunocytochemistry, ultrastructural, and cytogenetic characterization of mesenchymal stem cells from

equine bone marrow. Microsc Res Tech 2013, 76(6):618-624.

Maier T, Guell M, Serrano L: Correlation of mRNA and protein in complex biological samples. FEBS

Lett 2009, 583(24):3966-3973.

Mammolenti M, Gajavelli S, Tsoulfas P, Levy R: Absence of major histocompatibility complex class I

on neural stem cells does not permit natural killer cell killing and prevents recognition by alloreactive

cytotoxic T lymphocytes in vitro. Stem Cells 2004, 22(6):1101-1110.

Martinello T, Bronzini I, Maccatrozzo L, Iacopetti I, Sampaolesi M, Mascarello F, Patruno M:

Cryopreservation does not affect the stem characteristics of multipotent cells isolated from equine

peripheral blood. Tissue Eng Part C Methods 2010, 16(4):771-781.

Mastri M, Shah Z, McLaughlin T, Greene CJ, Baum L, Suzuki G, Lee T: Activation of Toll-like receptor

3 amplifies mesenchymal stem cell trophic factors and enhances therapeutic potency. Am J Physiol Cell

Physiol 2012, 303(10):C1021-33.

McGuckin CP, Forraz N, Baradez MO, Navran S, Zhao J, Urban R, Tilton R, Denner L: Production of

stem cells with embryonic characteristics from human umbilical cord blood. Cell Prolif 2005, 38(4):245-

255.

McGuirk JP, Weiss ML: Promising cellular therapeutics for prevention or management of graft-versus-

host disease (a review). Placenta 2011, 32 Suppl 4:S304-10.

McIlwraith CW, Frisbie DD, Rodkey WG, Kisiday JD, Werpy NM, Kawcak CE, Steadman JR:

Evaluation of intra-articular mesenchymal stem cells to augment healing of microfractured chondral

defects. Arthroscopy 2011, 27(11):1552-1561.

Mosmann TR, Coffman RL: TH1 and TH2 cells: different patterns of lymphokine secretion lead to

different functional properties. Annu Rev Immunol 1989, 7:145-173.

60

Naaldijk Y, Staude M, Fedorova V, Stolzing A: Effect of different freezing rates during cryopreservation

of rat mesenchymal stem cells using combinations of hydroxyethyl starch and dimethylsulfoxide. BMC

Biotechnol 2012, 12:49-6750-12-49.

Nailis H, Coenye T, Van Nieuwerburgh F, Deforce D, Nelis HJ: Development and evaluation of

different normalization strategies for gene expression studies in Candida albicans biofilms by real-time

PCR. BMC Mol Biol 2006, 7:25.

Nesic D, Whiteside R, Brittberg M, Wendt D, Martin I, Mainil-Varlet P: Cartilage tissue engineering for

degenerative joint disease. Adv Drug Deliv Rev 2006, 58(2):300-322.

Orozco L, Munar A, Soler R, Alberca M, Soler F, Huguet M, Sentis J, Sanchez A, Garcia-Sancho J:

Treatment of knee osteoarthritis with autologous mesenchymal stem cells: a pilot study. Transplantation

2013, 95(12):1535-1541.

Otte A, Bucan V, Reimers K, Hass R: Mesenchymal Stem Cells Maintain Long-Term In Vitro Stemness

During Explant Culture. Tissue Eng Part C Methods 2013.

Otten GR, Bikoff E, Ribaudo RK, Kozlowski S, Margulies DH, Germain RN: Peptide and beta 2-

microglobulin regulation of cell surface MHC class I conformation and expression. J Immunol 1992,

148(12):3723-3732.

Panchision DM, Chen HL, Pistollato F, Papini D, Ni HT, Hawley TS: Optimized flow cytometric

analysis of central nervous system tissue reveals novel functional relationships among cells expressing

CD133, CD15, and CD24. Stem Cells 2007, 25(6):1560-1570.

Pascucci L, Curina G, Mercati F, Marini C, Dall'Aglio C, Paternesi B, Ceccarelli P: Flow cytometric

characterization of culture expanded multipotent mesenchymal stromal cells (MSCs) from horse adipose

tissue: towards the definition of minimal stemness criteria. Vet Immunol Immunopathol 2011, 144(3-

4):499-506.

Pelletier JP, Caron JP, Evans C, Robbins PD, Georgescu HI, Jovanovic D, Fernandes JC, Martel-

Pelletier J: In vivo suppression of early experimental osteoarthritis by interleukin-1 receptor antagonist

using gene therapy. Arthritis Rheum 1997, 40(6):1012-1019.

Pevsner-Fischer M, Morad V, Cohen-Sfady M, Rousso-Noori L, Zanin-Zhorov A, Cohen S, Cohen IR,

Zipori D: Toll-like receptors and their ligands control mesenchymal stem cell functions. Blood 2007,

109(4):1422-1432.

Raabe O, Shell K, Wurtz A, Reich CM, Wenisch S, Arnhold S: Further insights into the characterization

of equine adipose tissue-derived mesenchymal stem cells. Vet Res Commun 2011, 35(6):355-365.

Radcliffe CH, Flaminio MJ, Fortier LA: Temporal analysis of equine bone marrow aspirate during

establishment of putative mesenchymal progenitor cell populations. Stem Cells Dev 2010, 19(2):269-

282.

Radtke CL, Nino-Fong R, Esparza Gonzalez BP, Stryhn H, McDuffee LA: Characterization and

osteogenic potential of equine muscle tissue- and periosteal tissue-derived mesenchymal stem cells in

61

comparison with bone marrow- and adipose tissue-derived mesenchymal stem cells. Am J Vet Res 2013,

74(5):790-800.

Raicevic G, Najar M, Stamatopoulos B, De Bruyn C, Meuleman N, Bron D, Toungouz M, Lagneaux L:

The source of human mesenchymal stromal cells influences their TLR profile as well as their functional

properties. Cell Immunol 2011, 270(2):207-216.

Raicevic G, Rouas R, Najar M, Stordeur P, Boufker HI, Bron D, Martiat P, Goldman M, Nevessignsky

MT, Lagneaux L: Inflammation modifies the pattern and the function of Toll-like receptors expressed by

human mesenchymal stromal cells. Hum Immunol 2010, 71(3):235-244.

Ranera B, Lyahyai J, Romero A, Vazquez FJ, Remacha AR, Bernal ML, Zaragoza P, Rodellar C,

Martin-Burriel I: Immunophenotype and gene expression profiles of cell surface markers of

mesenchymal stem cells derived from equine bone marrow and adipose tissue. Vet Immunol

Immunopathol 2011, 144(1-2):147-154.

Ranera B, Ordovas L, Lyahyai J, Bernal ML, Fernandes F, Remacha AR, Romero A, Vazquez FJ, Osta

R, Cons C, Varona L, Zaragoza P, Martin-Burriel I, Rodellar C: Comparative study of equine bone

marrow and adipose tissue-derived mesenchymal stromal cells. Equine Vet J 2012, 44(1):33-42.

Rasmusson I, Ringden O, Sundberg B, Le Blanc K: Mesenchymal stem cells inhibit the formation of

cytotoxic T lymphocytes, but not activated cytotoxic T lymphocytes or natural killer cells.

Transplantation 2003, 76(8):1208-1213.

Ren G, Zhang L, Zhao X, Xu G, Zhang Y, Roberts AI, Zhao RC, Shi Y: Mesenchymal stem cell-

mediated immunosuppression occurs via concerted action of chemokines and nitric oxide. Cell Stem Cell

2008, 2(2):141-150.

Rice AM, Wood JA, Milross CG, Collins CJ, Case J, Vowels MR, Nordon RE: Prolonged ex vivo

culture of cord blood CD34(+) cells facilitates myeloid and megakaryocytic engraftment in the non-

obese diabetic severe combined immunodeficient mouse model. Br J Haematol 2001, 114(2):433-443.

Ringden O, Uzunel M, Rasmusson I, Remberger M, Sundberg B, Lonnies H, Marschall HU, Dlugosz A,

Szakos A, Hassan Z, Omazic B, Aschan J, Barkholt L, Le Blanc K: Mesenchymal stem cells for

treatment of therapy-resistant graft-versus-host disease. Transplantation 2006, 81(10):1390-1397.

Ripoll CB, Flaat M, Klopf-Eiermann J, Fisher-Perkins JM, Trygg CB, Scruggs BA, McCants ML,

Leonard HP, Lin AF, Zhang S, Eagle ME, Alvarez X, Li YT, Li SC, Gimble JM, Bunnell BA:

Mesenchymal lineage have pronounced anti-inflammatory effects in the twitcher mouse model of

Krabbe's disease. Stem Cells 2011, 29(1):67-77.

Ruijter JM, Ramakers C, Hoogaars WM, Karlen Y, Bakker O, van den Hoff MJ, Moorman AF:

Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic

Acids Res 2009, 37(6):e45.

Rutledge RG, Stewart D: Critical evaluation of methods used to determine amplification efficiency

refutes the exponential character of real-time PCR. BMC Mol Biol 2008, 9:96-2199-9-96.

62

Sabapathy V, Ravi S, Srivastava V, Srivastava A, Kumar S: Long-term cultured human term placenta-

derived mesenchymal stem cells of maternal origin displays plasticity. Stem Cells Int 2012,

2012:174328.

Sacitharan PK, Snelling SJ, Edwards JR: Aging mechanisms in arthritic disease. Discov Med 2012,

14(78):345-352.

Sakkas LI, Scanzello C, Johanson N, Burkholder J, Mitra A, Salgame P, Katsetos CD, Platsoucas CD: T

cells and T-cell cytokine transcripts in the synovial membrane in patients with osteoarthritis. Clin Diagn

Lab Immunol 1998, 5(4):430-437.

Salcedo M, Andersson M, Lemieux S, Van Kaer L, Chambers BJ, Ljunggren HG: Fine tuning of natural

killer cell specificity and maintenance of self tolerance in MHC class I-deficient mice. Eur J Immunol

1998, 28(4):1315-1321.

Siegel G, Kluba T, Hermanutz-Klein U, Bieback K, Northoff H, Schafer R: Phenotype, donor age and

gender affect function of human bone marrow-derived mesenchymal stromal cells. BMC Med 2013,

11:146-7015-11-146.

Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, Henkelman RM, Cusimano MD, Dirks

PB: Identification of human brain tumour initiating cells. Nature 2004, 432(7015):396-401.

Spaggiari GM, Capobianco A, Becchetti S, Mingari MC, Moretta L: Mesenchymal stem cell-natural

killer cell interactions: evidence that activated NK cells are capable of killing MSCs, whereas MSCs can

inhibit IL-2-induced NK-cell proliferation. Blood 2006, 107(4):1484-1490.

Stenderup K, Justesen J, Clausen C, Kassem M: Aging is associated with decreased maximal life span

and accelerated senescence of bone marrow stromal cells. Bone 2003, 33(6):919-926.

Stolzing A, Naaldijk Y, Fedorova V, Sethe S: Hydroxyethylstarch in cryopreservation - mechanisms,

benefits and problems. Transfus Apher Sci 2012, 46(2):137-147.

Tabera S, Perez-Simon JA, Diez-Campelo M, Sanchez-Abarca LI, Blanco B, Lopez A, Benito A, Ocio

E, Sanchez-Guijo FM, Canizo C, San Miguel JF: The effect of mesenchymal on the viability,

proliferation and differentiation of B-lymphocytes. Haematologica 2008, 93(9):1301-1309.

Takeda K, Akira S: Toll-like receptors in innate immunity. Int Immunol 2005, 17(1):1-14.

Tarnok A: A focus on automated recognition. Cytometry A 2007, 71(10):769-770.

Tomchuck SL, Zwezdaryk KJ, Coffelt SB, Waterman RS, Danka ES, Scandurro AB: Toll-like receptors

on human mesenchymal stem cells drive their migration and immunomodulating responses. Stem Cells

2008, 26(1):99-107.

Uematsu S, Akira S: Toll-Like receptors (TLRs) and their ligands. Handb Exp Pharmacol 2008,

(183)(183):1-20.

63

Vacanti V, Kong E, Suzuki G, Sato K, Canty JM, Lee T: Phenotypic changes of adult porcine

mesenchymal stem cells induced by prolonged passaging in culture. J Cell Physiol 2005, 205(2):194-

201.

Van den Berk LC, Jansen BJ, Siebers-Vermeulen KG, Netea MG, Latuhihin T, Bergevoet S, Raymakers

RA, Kogler G, Figdor CC, Adema GJ, Torensma R: Toll-like receptor triggering in cord blood

mesenchymal stem cells. J Cell Mol Med 2009, 13(9B):3415-3426.

Verreck FA, de Boer T, Langenberg DM, van der Zanden L, Ottenhoff TH: Phenotypic and functional

profiling of human proinflammatory type-1 and anti-inflammatory type-2 macrophages in response to

microbial antigens and IFN-gamma- and CD40L-mediated costimulation. J Leukoc Biol 2006,

79(2):285-293.

Villadangos JA, Schnorrer P, Wilson NS: Control of MHC class II antigen presentation in dendritic

cells: a balance between creative and destructive forces. Immunol Rev 2005, 207:191-205.

Violini S, Ramelli P, Pisani LF, Gorni C, Mariani P: Horse bone marrow mesenchymal stem cells

express embryo stem cell markers and show the ability for tenogenic differentiation by in vitro exposure

to BMP-12. BMC Cell Biol 2009, 10:29-2121-10-29.

Vogel C, Marcotte EM: Insights into the regulation of protein abundance from proteomic and

transcriptomic analyses. Nat Rev Genet 2012, 13(4):227-232.

Wagner W, Horn P, Castoldi M, Diehlmann A, Bork S, Saffrich R, Benes V, Blake J, Pfister S, Eckstein

V, Ho AD: Replicative senescence of mesenchymal stem cells: a continuous and organized process.

PLoS One 2008, 3(5):e2213.

Wang L, Zhao Y, Shi S: Interplay between mesenchymal stem cells and lymphocytes: implications for

immunotherapy and tissue regeneration. J Dent Res 2012, 91(11):1003-1010.

Wang X, Hua TC, Sun DW, Liu B, Yang G, Cao Y: Cryopreservation of tissue-engineered dermal

replacement in Me2SO: Toxicity study and effects of concentration and cooling rates on cell viability.

Cryobiology 2007, 55(1):60-65.

Waterman RS, Tomchuck SL, Henkle SL, Betancourt AM: A new mesenchymal stem cell (MSC)

paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.

PLoS One 2010, 5(4):e10088.

Wesche H, Henzel WJ, Shillinglaw W, Li S, Cao Z: MyD88: an adapter that recruits IRAK to the IL-1

receptor complex. Immunity 1997, 7(6):837-847.

Westacott CI, Barakat AF, Wood L, Perry MJ, Neison P, Bisbinas I, Armstrong L, Millar AB, Elson CJ:

Tumor necrosis factor alpha can contribute to focal loss of cartilage in osteoarthritis. Osteoarthritis

Cartilage 2000, 8(3):213-221.

Wilke MM, Nydam DV, Nixon AJ: Enhanced early chondrogenesis in articular defects following

arthroscopic mesenchymal stem cell implantation in an equine model. J Orthop Res 2007, 25(7):913-

925.

64

Williams JT, Southerland SS, Souza J, Calcutt AF, Cartledge RG: Cells isolated from adult human

skeletal muscle capable of differentiating into multiple mesodermal phenotypes. Am Surg 1999,

65(1):22-26.

Xu X, Liu Y, Cui Z, Wei Y, Zhang L: Effects of osmotic and cold shock on adherent human

mesenchymal stem cells during cryopreservation. J Biotechnol 2012, 162(2-3):224-231.

Yin Y, Li Y, Mariuzza RA: Structural basis for self-recognition by autoimmune T-cell receptors.

Immunol Rev 2012, 250(1):32-48.

Yoo KH, Jang IK, Lee MW, Kim HE, Yang MS, Eom Y, Lee JE, Kim YJ, Yang SK, Jung HL, Sung

KW, Kim CW, Koo HH: Comparison of immunomodulatory properties of mesenchymal stem cells

derived from adult human tissues. Cell Immunol 2009, 259(2):150-156.

Young HE, Mancini ML, Wright RP, Smith JC, Black AC,Jr, Reagan CR, Lucas PA: Mesenchymal stem

cells reside within the connective tissues of many organs. Dev Dyn 1995, 202(2):137-144.

Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, Benhaim P, Lorenz HP, Hedrick MH:

Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 2001,

7(2):211-2.

65

APPENDIX I - Immune markers and cytokine expression for MSC before and after IL-1B and IL-

6 treatment

CB-MSC were assessed for gene expression of markers potentially correlated with immunomodulation

abilities. Expression was measured before and after incubation with IL-1B or IL-6.

MSC markers and cytokines gene expression (n = 1)

Gene Untreated MSC IL-1B treatment IL-6 treatment

B2M + + +

TAP1 + + +

CIITA - - +/-

TLR3 +/- +/- -

TLR4 + + +

MyD88 + + +

TRIF + + +

TRAM + + +

IL-1B - - -

IL-6 +/- ++ +/-

TGFB1 ++ + +

HO-1 + + +

CXCL10 +/- + -

Fe-H ++ ++ +

TFR1 + + +/-

Gene expression:

(-): transcript not detected

+/-: transcript detected >35 Ct

+: transcript detected 25 >Ct < 35

++: transcript detected < 25 Ct

CB-MSC were separated in three groups and assessed separately: untreated cells, IL-1B treated cells and

IL-6 treated cells. CB-MSC were cultured in EM until 60-70% confluency and subsequently incubated

for 24h in: EM, EM supplemented with 10ng/mL of recombinant equine IL-1B or 20ng/ml of

recombinant equine IL-6. Gene expression was analyzed with qPCR. Potential changes in expression

were observed for IL-6, TGFB1, Fe-H, CXCL10.