Isaac Prah Examination of Human Skin Surfaces for the ...
Transcript of Isaac Prah Examination of Human Skin Surfaces for the ...
![Page 1: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/1.jpg)
UNIVERSITY OF GHANA
COLLEGE OF BASIC AND APPLIED SCIENCES
EXAMINATION OF HUMAN SKIN SURFACES FOR THE
DETECTION OF MYCOBACTERIUM ULCERANS
ISAAC PRAH
(10443210)
THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA,
LEGON IN PARTIAL FULFILMENT OF THE REQUIREMENT FOR
THE AWARD OF THE MASTER OF PHILOSOPHY DEGREE IN
BIOCHEMISTRY
JULY, 2015
University of Ghana http://ugspace.ug.edu.gh
![Page 2: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/2.jpg)
i
DECLARATION
I, Isaac Prah, do hereby declare that with the exception of the references cited to other
people‟s work which has been duly acknowledged, this work is the result of my own
research work, done under supervision and has neither in part or whole been presented
elsewhere for another degree.
Signature…………………………… ………………………………………
Isaac Prah Date
(Student)
Signature…………………………… ……………………………………..
Dr. Anthony Ablordey Date
(Supervisor)
University of Ghana http://ugspace.ug.edu.gh
![Page 3: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/3.jpg)
ii
ABSTRACT
Mycobacterium ulcerans, causes Buruli ulcer (BU), a necrotizing skin disease
endemic in 33 countries globally. Its environmental reservoir and mode of
transmission are unknown. Portaels hypothesized that prior skin contamination
followed by penetration through existing skin abrasion or trauma may be a possible
route through which M. ulcerans is transmitted to humans. Comparative
epidemiological and case control studies have outlined some risk activities associated
with BU that could result in contamination of human skin with M. ulcerans. In this
study, skin surfaces of inhabitants involved in specific risk activities in eight selected
communities either BU endemic or non-endemic were examined for the presence of
M. ulcerans. Skin swabs were taken from exposed limbs of 50 individuals from each
community for the detection and isolation of M. ulcerans. Two DNA extraction
methods were compared in extracting M. ulcerans DNA from pooled skin
suspensions. The presence of M. ulcerans DNA from the extracts was first detected
using Taqman real time IS2404 PCR multiplex with internal positive control and then
IS2606 multiplex with KR for all IS2404 positives. None of the DNA extracts using
modified Boom DNA extraction method was positive for IS2404 target sequence
while three of the extracts using power soil DNA isolation kit were IS2404 positive.
Only one of the IS2404 pooled positives was positive for both IS2606 and KR. Five
individual samples within these three pools accounted for the pools positivity for
IS2404, IS2606 and KR results. The difference in Ct value between IS2606 and
IS2404 for one out of the five samples that was positive for all the targets was 2.34,
an indication of M. ulcerans DNA. This was detected on an individual who was
returning from the farm without protective clothing in a non-endemic community. No
M. ulcerans was isolated from the LJ culture after 15 weeks of cultivation. Detection
University of Ghana http://ugspace.ug.edu.gh
![Page 4: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/4.jpg)
iii
of M. ulcerans DNA on the skin surface of a farmer shows that the skin can be
contaminated with M. ulcerans and supports Portaels‟ hypothesis about skin surface
contamination with M. ulcerans. The findings also support the case control studies
establishing association between BU with absence of protective clothing during
farming.
University of Ghana http://ugspace.ug.edu.gh
![Page 5: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/5.jpg)
iv
DEDICATION
I dedicate this work to the Almighty God for accomplishing what He began in my life
University of Ghana http://ugspace.ug.edu.gh
![Page 6: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/6.jpg)
v
ACKNOWLEDGMENTS
I wish to express my sincere gratitude to my academic supervisor, Dr Anthony
Ablordey at Noguchi Memorial Institute for Medical Research for his superb
supervision and guidance. I also wish to thank my lecturers and the entire staff at the
Department of Biochemistry, Cell and Molecular Biology who in one way or the other
prepared me to this end. My sincerest appreciation goes to Prof. Tim Stinear for the
financial support which made it possible to complete my post graduate education. I
also want to express my sincere thanks to the head and the entire staff of the
Department of Bacteriology, Noguchi Memorial Institute for Medical Research.
Special thanks to Mr. Samuel Aboagye, and Mr. Evans K Ahortor for unwavering
support which saw the successful completion of this work. I also appreciate the efforts
of Nana Ama Amissah, Mrs. Wiafe Kwakye, Ms. Shirley Simpson, Ms. Samira
Mahazu, Ms Ivy Amanor, Mr. Isaac Doku and Master Seidu for their invaluable
support. Lastly but by no means least, I wish to acknowledge my family, for the
support and concern that has brought me this far. May God richly bless you all.
University of Ghana http://ugspace.ug.edu.gh
![Page 7: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/7.jpg)
vi
TABLE OF CONTENTS
DECLARATION ............................................................................................................. i
ABSTRACT .................................................................................................................... ii
DEDICATION ............................................................................................................... iv
ACKNOWLEDGMENTS .............................................................................................. v
TABLE OF CONTENTS ............................................................................................... vi
LIST OF FIGURES ....................................................................................................... ix
LIST OF TABLE ............................................................................................................ x
LIST OF ABBREVIATIONS ........................................................................................ xi
CHAPTER ONE ............................................................................................................. 1
INTRODUCTION .......................................................................................................... 1
1.0 Introduction ..................................................................................................................................... 1
1.1 Statement of Problem ...................................................................................................................... 2
1.2 Justification ..................................................................................................................................... 3
1.3 Aim ................................................................................................................................................. 4
1.4 Specific Objectives ......................................................................................................................... 4
CHAPTER TWO ............................................................................................................ 6
LITERATURE REVIEW ............................................................................................... 6
2.1 The genus Mycobacterium .............................................................................................................. 6
2.1.1 Environmental Mycobacteria ................................................................................................... 7
2.1.2 Mycobacterium ulcerans ......................................................................................................... 8
2.1.2.1 Genome of Mycobacterium ulcerans ............................................................................... 9
2.1.2.1.1 Plasmid pMUM001 ................................................................................................. 10
2.1.2.2 Evolution of Mycobacterium ulcerans ........................................................................... 12
2.2 Buruli ulcer ................................................................................................................................... 13
2.2.1 Diagnosis of Buruli ulcer ....................................................................................................... 14
2.2.2 Treatment of Buruli ulcer ...................................................................................................... 15
2.2.3 Pathogenesis of Buruli ulcer .................................................................................................. 17
2.2.3.1 Mycolactone ................................................................................................................... 17
2.2.4 History of Buruli ulcer ........................................................................................................... 21
2.2.5 Epidemiology of Buruli ulcer ................................................................................................ 21
2.2.5.1 Buruli ulcer Prevalence in Ghana ................................................................................... 23
2.2.6 Transmission of Buruli ulcer ................................................................................................. 24
2.2.6.1 Role of insects in transmission of M. ulcerans ............................................................... 24
2.2.6.2 Transmission of M. ulcerans upon exposure to contaminated environment .................. 25
University of Ghana http://ugspace.ug.edu.gh
![Page 8: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/8.jpg)
vii
2.2.7 Risk factors associated with Buruli ulcer ............................................................................... 26
CHAPTER THREE ...................................................................................................... 28
MATERIALS AND METHODS .................................................................................. 28
3.1 Materials ....................................................................................................................................... 28
3.1.1Instrument ................................................................................................................................... 28
3.2 Methods ........................................................................................................................................ 28
3.2.1 Location and demography of study areas .............................................................................. 28
3.2.2 Nsawam-Adoagyiri Municipality .......................................................................................... 29
3.2.2.1 Oparekrom ...................................................................................................................... 29
3.2.3 Akwapim South Municipality ................................................................................................ 30
3.2.3.1 Pakro .............................................................................................................................. 31
3.2.3.2 Dago ............................................................................................................................... 31
3.2.3.3 Obotweri ......................................................................................................................... 31
3.2.3.4 Obosono ......................................................................................................................... 32
3.2.3.5 Okomfo .......................................................................................................................... 32
3.2.3.5 Boahenakrom ................................................................................................................. 32
3.2.4 Akwapim North Municipality ................................................................................................ 33
3.2.4.1 Mangoase ....................................................................................................................... 34
3.3 Study Design ................................................................................................................................. 34
3.3.1 Study population .................................................................................................................... 34
3.3.2 Exclusion Criteria .................................................................................................................. 34
3.3.3 Sample size ............................................................................................................................ 35
3.4 Organization of Field work ........................................................................................................... 35
3.4.1 Community Entry .................................................................................................................. 35
3.4.2 Field Operations .................................................................................................................... 35
3.4.3 Data and Sample Collections ................................................................................................. 35
3.5 Laboratory analyses ...................................................................................................................... 39
3.5.1 Sample processing and pooling strategy ................................................................................ 39
3.5.2 DNA extraction procedures ................................................................................................... 39
3.5.2.1 Genomic DNA extraction using modified Boom protocol ............................................. 39
3.5.2.2 Genomic DNA extraction using power soil DNA isolation kit ...................................... 40
3.5.3 Detection of M. ulcerans DNA by qPCR targeting IS2404 multiplexed with IPC ................ 42
3.5.4 Detection of M. ulcerans DNA by qPCR targeting IS2606 and KR...................................... 43
3.5.5 Cultivation of skin suspensions on Löwenstein Jensen (LJ) media ....................................... 43
CHAPTER FOUR ......................................................................................................... 45
RESULTS ..................................................................................................................... 45
University of Ghana http://ugspace.ug.edu.gh
![Page 9: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/9.jpg)
viii
4.1 Demographic Characteristics ........................................................................................................ 45
4.1.1 Age characteristic of recruits within the selected communities ............................................. 46
4.2 Statistics on the type of risk activities engaged by participants .................................................... 47
4. 3 Pools composition ........................................................................................................................ 48
4.4 Detection of M. ulcerans ............................................................................................................... 50
4.4.1 Detection of IS2404 target from pooled DNA extracts ......................................................... 50
4.4.1.1 Analysis of individual component samples within IS2404 pools positive ..................... 50
4.4.2 Detection of IS2606 and KR targets from pooled DNA extracts ........................................... 51
4.4.2.1 Analysis of individual component samples within IS2606 and KR pools positive ........ 51
4.5 Specific activities resulting in M. ulcerans DNA skin contamination .......................................... 51
4.6 Mycobacteria species cultivated from pooled skin suspensions ................................................... 52
CHAPTER FIVE .......................................................................................................... 54
DISCUSSION AND CONCLUSION .......................................................................... 54
5.0 Discussion ..................................................................................................................................... 54
5.1 Conclusion .................................................................................................................................... 60
REFERENCES ............................................................................................................. 61
APPENDICES .............................................................................................................. 70
University of Ghana http://ugspace.ug.edu.gh
![Page 10: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/10.jpg)
ix
LIST OF FIGURES
Figure 2.1 Circular representation of the M. ulcerans Agy99 replicons. .................... 10
Figure 2.2 Domain and module organization of the mycolactone PKS genes. ........... 11
Figure 2.3 Laboratory tests for Buruli ulcer diagnosis. ............................................... 15
Figure 2.4 Structures of naturally occurring mycolactones and their geographical
origin. ........................................................................................................................... 20
Figure 2.5 Global distribution of Buruli ulcer cases reported in 2012. ....................... 22
Figure 3.1 District map of Nsawam-Adoagyiri Municipality. ..................................... 30
Figure 3.2 District map of Akwapim South Municipality. .......................................... 33
Figure 3.3 Specific activities engaged by recruits ; ..................................................... 37
Figure 3.4 Sampling, sample storage and transportation. ............................................ 38
Figure 4.1 Age characteristics of participants within the eight selected communities.
...................................................................................................................................... 47
Figure 4.2 Percentages of participants engaged in specific risk activities. .................. 48
Figure 4.3 Mycobacteria colonies harvested after 11 weeks of cultivation. ................ 53
University of Ghana http://ugspace.ug.edu.gh
![Page 11: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/11.jpg)
x
LIST OF TABLE
Table 4.1 Comparison of age and sex characteristics of participants in endemic and
non- endemic communities. ......................................................................................... 45
University of Ghana http://ugspace.ug.edu.gh
![Page 12: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/12.jpg)
xi
LIST OF ABBREVIATIONS
AFB Acid-fast bacilli
BU Buruli ulcer
Ct Cycle threshold
FNA Fine needle aspirate
IS2404 Insertion sequence 2404
IS2606 Insertion sequence 2606
KR Ketoreductase
LJ LÖwenstein Jensen
MPM Mycolactone Producing Mycobacteria
WHO World Health Organization
ZN Zeihl-Neelson
University of Ghana http://ugspace.ug.edu.gh
![Page 13: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/13.jpg)
1
CHAPTER ONE
INTRODUCTION
1.0 Introduction
Buruli ulcer (BU) is an indolent, necrotizing disease of the skin, soft tissue and bone
caused by a slow-growing environmental bacterium, Mycobacterium ulcerans.
Incidence of BU is gradually increasing (WHO, 2015). Fifteen out of the 33 BU
endemic countries report an estimate of 6000 cases annually, with higher frequencies
occurring within rural populations of sub-Saharan African countries (WHO, 2014).
Early clinical manifestations include papules, nodules, edema, and plaques, these pre-
ulcerative lesions when left untreated eventually form characteristic ulcers with
undermined edges.
Despite remarkable achievement attained in treatment of the disease, efforts toward
BU prevention have severely been undermined by limited information on how M.
ulcerans is transmitted from its ecological niche to humans. Although the exact
mechanism by which humans become infected with M. ulcerans still remains
unknown, case control studies have outlined some risk factors associated with
contracting BU. These include residing or working near a slow flowing water body,
wading and swimming in contaminated water bodies (Merritt et al., 2010) as well as
bites from mosquitoes probably infected with M. ulcerans (Quek et al., 2007).
Critically reviewing these potential risk factors have led to the suggestion that
transmission of the etiological agent of BU might occur through direct inoculation of
the bacteria into the skin by way of either contact with contaminated environmental
University of Ghana http://ugspace.ug.edu.gh
![Page 14: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/14.jpg)
2
source (Portaels et al., 2001) where trauma may facilitate the introduction of the
microbe into the skin or through insect bites (Portaels et al., 1999).
The potential role of biting insects in transmission of BU at the moment seems limited
to some foci where infection occurs. This was made evident when after an outbreak of
BU at Point Lonsdale in Australia, M. ulcerans DNA was detected from some species
of mosquitoes within that region (Johnson et al., 2007). Contrary to some studies in
West Africa, where DNA was detected in non hematophagous insects (Williamson et
al., 2014) making the role of insect as vector in transmission of BU uncertain (Marion
et al., 2015; Merritt et al., 2010).
Portaels in 2001, hypothesized that M. ulcerans could enter the human host through
trauma after introduction from an overlying contaminated skin surface (Debacker et
al., 2003). Human activities that increase direct skin contact with environments where
traces of M .ulcerans DNA have been documented (Merritt et al., 2010) could result
in contamination of the human skin. This appears to be a contributory factor for the
transmission of M. ulcerans in some endemic foci especially in Africa where there is
constant and direct interaction with such environments.
1.1 Statement of Problem
Buruli ulcer disease (BUD) is a rapidly re-emerging neglected tropical disease
(WHO, 2007) which is poorly understood but associated with rapid environmental
changes (Ravensway et al., 2012). Though mortality is low, morbidity is extremely
high and has associated economic implications not only on the individual but on the
family as well (Peeters et al., 2008; Asiedu and Etuaful, 1998). Epidemiological
evidence reveals the spatial clustering of BU cases often around a particular water
University of Ghana http://ugspace.ug.edu.gh
![Page 15: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/15.jpg)
3
body and its focal distribution where endemic and non-endemic communities are
usually separated by only a few kilometres (WHO, 2008). Transmission route for BU
still remains unknown, although it is known to be linked to contaminated water
(Merritt et al, 2010; Veitch et al, 1997). In Africa, the major risk factor for BU is
proximity to stagnant or slow flowing water (Merritt et al, 2010). Other risk factors
for contracting BU as revealed through case control studies include the use of
unprotected water from swamps (Debacker et al., 2006) and agricultural lands
(Wagner et al., 2008).
Despite the identification of these risk factors, precisely how M. ulcerans gets into its
human host still remains unclear. It has been hypothesized that M. ulcerans is
transmitted through skin abrasions or skin injuries after contact with contaminated
water, vegetation or soil. This implies that, the individuals‟ skin surfaces must first be
contaminated with M. ulcerans, before invading the human host. A key factor in the
development of wound infections is the human – microbe interface and as M. ulcerans
is not part of the normal skin flora, detailed studies need to be conducted to examine
the skin surfaces of individuals in endemic areas for the presence of M. ulcerans, in
an effort to understand how M. ulcerans is transmitted.
1.2 Justification
Poor understanding of BU transmission processes despite description of the
mycobacterium about 60 years ago has severely hindered the prevention and control
of the disease. Absence of a proven strategy for preventing the infection has serious
public health implications for the health system in endemic countries like Ghana.
Ghana‟ national BU prevalence in 1998 was 20.7/100,000 and currently over 426
communities mainly in the Ashanti, Brong -Ahafo, Eastern, Greater Accra and
University of Ghana http://ugspace.ug.edu.gh
![Page 16: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/16.jpg)
4
Western region have reported cases of BU (Kenu et al, 2014). Akwapim South
municipality of the Eastern region of Ghana is endemic with BU with prevalence rate
of 151.4 per 100,000 populations and currently is the hottest BU district spot in Ghana
(Kenu et al, 2014). How the indigenous contract the disease still remains enigmatic.
Case control studies conducted by Kenu and his colleagues recently in the district
highlighted washing in the Densu river, use of adhesive when injured, the presence of
wetlands, insect bites in water and not covering limbs during farming as some risk
factors for BU in the locality (Kenu et al, 2014).
Prevention and control activities are based on existing knowledge of the risk factors.
Establishing the presence of M. ulcerans on the skin surface of these risk groups
would enormously support the hypothesis that transmission of M. ulcerans from the
environment to humans could occur through direct contact with a contaminated
environmental source. This would ultimately help in tailoring targeted preventive
measures, as well as the provision of information to be used in public health
education.
1.3 Aim
To examine the skin surfaces of inhabitants of BU endemic communities for the
presence of M. ulcerans.
1.4 Specific Objectives
The following objectives were taken to help address the question posed above
1. To detect the presence of M. ulcerans on the skin surface of individuals
involved in specific risk activities.
University of Ghana http://ugspace.ug.edu.gh
![Page 17: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/17.jpg)
5
2. To compare the detection rate of M. ulcerans on skin surfaces of inhabitants
from endemic and non-endemic communities.
3. To compare two DNA extraction protocols for the detection of M. ulcerans
from skin swabs.
4. To isolate M. ulcerans from skin surfaces of inhabitants of the study
communities.
University of Ghana http://ugspace.ug.edu.gh
![Page 18: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/18.jpg)
6
CHAPTER TWO
LITERATURE REVIEW
2.1 The genus Mycobacterium
Mycobacterium belongs to the order Actinomycetales, family Mycobacteriaceae and
genus Mycobacterium. They are aerobic, non-motile, non-capsulated and
asporogenous that replicate by binary fission (Grange, 1996). Mycobacteria are
significantly smaller in size than other type of bacteria and the cell shape varies from
cocco –bacilli to elongated rods but pleomorphic morphology is common. The
genome of mycobacteria is estimated to be in equivalent range of 4.6 - 8.4 Mb (Baess
and Mansa, 1978) and like other prokaryotes is arranged as closed circle. The
nucleotide composition of mycobacterial DNA is extraordinarily rich in guanine and
cytosine with a G-C ratio of 61-71% (Levy –Frebault and Portaels, 1992).
Another unique characteristic of mycobacterium is their cell wall. Mycobacterial cell
wall is highly complex and has a lipid content that approximates 60% of the structure
(Brennan and Nikaido, 1995). This high mycolic acid content confers alcohol and
acid-fast staining properties on mycobacteria distinguishing them from most bacteria.
This cell wall characteristic allows the mycobacterial species to survive in different
environments such as in biofilms, in water habitats or particulate matter in soils.
Mycobacteria are classified as either slowly or rapidly growing. This distinction is
based on whether isolated colonies are observed after more than 7 days or less than 7
days on solid medium (Levy–Frebault and Portaels, 1992). Solid media commonly
used to culture mycobacterium is the Lowenstein-Jensen (L-J) medium though other
media such as Ogawa egg yolk medium and Middlebrook 7H10 or 7Hll agar could as
University of Ghana http://ugspace.ug.edu.gh
![Page 19: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/19.jpg)
7
well be used. Mycobacteria may synthesize carotenoid pigments which confer a
yellow to red pigmentation to colonies. Carotenogenesis can be achieved in the
absence of light by scotochromogenic mycobacteria. Photochromogenic mycobacteria
require exposure to light and oxygen for carotenogenesis to occur (Levy –Frebault
and Portaels, 1992).
The genus Mycobacterium comprises over 150 parasitic and free living acid-fast
species of bacteria (Dai et al., 2011). Majority of the species are non- pathogenic
environmental bacteria. However, only a few species are highly successful pathogens,
and include Mycobacterium tuberculosis complex, Mycobacterium leprae, and
Mycobacterium ulcerans, the causative agents of tuberculosis, leprosy, and Buruli
ulcers, respectively.
2.1.1 Environmental Mycobacteria
Environmental mycobacteria also referred to as atypical mycobacteria or non
tuberculous mycobacteria (NTM) are fascinating group of human, animal, and bird
pathogens (Dawson, 2000). They have significant impacts on the morbidity and
mortality of humans and have important economic impacts on agriculture.
Environmental opportunistic mycobacteria are distinguished from the members of the
Mycobacterium tuberculosis complex and Mycobacterium leprae by the fact that they
are not obligate pathogens but are true inhabitants of the environment. They are
normal inhabitants of a wide variety of environmental reservoirs, including natural
and municipal water, soil, aerosols, protozoans, animals, and humans. They can be
found as saprophytes, commensals and symbionts (Primm et al., 2004).
University of Ghana http://ugspace.ug.edu.gh
![Page 20: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/20.jpg)
8
Environmental mycobacteria have extraordinary starvation survival (Smeulders et al.,
1999), persisting despite low nutrient levels (Primm et al., 2004). Some are also
tolerant to temperature extremes (Schulze-Robbecke and Buchholtz, 1992).
The most common environmental mycobacterial pathogens can be divided into two
groups based on growth rate; the slowly growing species include M. avium, M.
intracellulare, M. kansasii, M. marinum, M. xenopi, M. malmoense and M. ulcerans
(Falkinham, 2009). Rapidly growing species include M. abscessus, M. chelonae and
M. fortuitum (Falkinham, 2009). Pathogenic environmental mycobacteria are more
likely transmitted from environmental sources to their host by ingestion, inhalation or
through inoculation of mycobacterium bacilli. These environmental sources may
include aerosols, water, soil, dust, food products and contaminated medical equipment
(Gangadharam and Jenkins, 1998).
2.1.2 Mycobacterium ulcerans
Mycobacterium ulcerans is a slow-growing environmental mycobacterium and the
causative agent of BU, a skin infection characterized by extensive ulceration with
scarring. It is a strong acid fast rod, non-motile and non-sporing. It has limited range
of distribution and is found in communities associated with rivers, swamps, wetlands,
and human-linked changes in the aquatic environment, particularly those created as a
result of environmental disturbance such as deforestation, dam construction, and
agriculture (Merritt et al. 2010). Environmental reservoir of M. ulcerans is yet to be
identified despite its linkage to aquatic habitats. Molecular epidemiological studies
reveal clustering of M. ulcerans according to the geographical origin of isolates
(Chemlal et. al., 2001).
University of Ghana http://ugspace.ug.edu.gh
![Page 21: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/21.jpg)
9
Successful cultivation of M. ulcerans from primary cultures depends on several
parameters, including cultivation conditions and decontamination methods (Palomino
and Portaels, 1998). M. ulcerans grows best at temperatures of 30 to 33oC, reduced
oxygen tension (pO2< 2.5Kpa) and a pH range of 5.4 - 7.4 (Palomino et al., 1998).
Visible colonies are seen in culture within 6-8 weeks after inoculation producing
yellow or cream colonies. Although cultivation of M. ulcerans from clinical
specimens have successfully been documented, attempts to cultivate the
mycobacterium from the environment have been greatly unsuccessful except for work
by Portaels and colleagues in 2008 where they isolated M. ulcerans from aquatic
Hemiptera on Lowenstein-Jensen medium (LJ) after several passages in mouse
footpads (Portaels et al., 2008). Failure to cultivate this organism from nature may be
attributable to conditions of transport, decontamination method and its scarcity in the
environment.
2.1.2.1 Genome of Mycobacterium ulcerans
Whole genome sequence of M. ulcerans was determined by Stinear and colleagues
from a clinical isolate called Agy99, isolated in 1999 from a Ghanaian patient (Stinear
et al., 2007). The Agy99 genome comprises two circular replicons (Fig. 2.1), a
chromosome of 5,631,606 bp with a 174,155 bp virulence plasmid referred to as
pMUM001. The chromosome harbors 4,160 protein-coding genes, 771 pseudogenes,
two prophages phiMU01 (18 kb, 18CDS) and phiMU02 (24 kb, 17CDS) as well as
several copies of insertion sequences (IS) elements, IS2404 (209 copies) and IS2606
(83 copies) (Stinear et al., 2007). The virulence plasmid also harbors 81 protein
coding DNA sequences, 4 copies of IS2404 and 8 copies of IS2606. The G+C content
of the chromosome (65%) is slightly higher than that of the plasmid which is 62.5%
University of Ghana http://ugspace.ug.edu.gh
![Page 22: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/22.jpg)
10
(Stinear et al., 2007). IS2404 sequences account for 6% of the genome of M.
ulcerans. Insertion sequence elements are mobile genetic entities encoding
transposases which catalyse DNA copying or movement. IS2404 is 1,368 bp long,
containing 41 bp perfect inverted repeats and producing 10 bp target-site duplications
whereas IS2606 is 1,438 bp long, with 31 bp imperfect inverted repeats and producing
target site duplications of 7 bp (Stinear et al., 2005).
Figure 2.1 Circular representation of the M. ulcerans Agy99 replicons.
The outer black circle shows the scale in bases. The next two inner circles illustrate the forward and
reverse strand CDS in blue and red, respectively. IS element regions are displayed in the next inner
circle in black. The innermost circles show GC plot and GC skew. (A) 5632 kb chromosome (B) 174
kb virulence plasmid (Picture adapted from Röltgen et al., 2012).
2.1.2.1.1 Plasmid pMUM001
Primary function of pMUM001 of M. ulcerans is seemingly for toxin production. It
carries a cluster of genes encoding giant polyketide synthases (PKSs), and polyketide-
modifying enzymes that are necessary for synthesis of the lipid toxin, mycolactone
(Fig. 2.2). Polyketide synthase responsible for producing the mycolactone core
structure are encoded by the genes mlsAl and mlsA2 with respective sizes of 50,973
B A
University of Ghana http://ugspace.ug.edu.gh
![Page 23: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/23.jpg)
11
bp and 7,233 bp. Enzyme responsible for synthesizing side chain is encoded by mlsB
gene having size of 42,393 bp. (Stinear et al., 2004). All three PKS genes are highly
related, with nucleotide sequence similarity of 99.7%. The polyketide-modifying
enzymes including a P450 monooxygenase, type III ketosynthases (KS) and type II
thioesterase (TE) are encoded by the respective genes mup053, mup045 and mup037.
P450 monooxygenase is responsible for hydroxylation at carbon 12 of the side chain,
KS catalyzes ester bond formation between the mycolactone core and side chain
whereas TE is required for removal of short acyl chains from the PKS loading
modules, arising by aberrant decarboxylation (Heathcote et al., 2001).
Figure 2.2 Domain and module organization of the mycolactone PKS genes.
Within each of the three genes (mlsA1, mlsA2, and mlsB), different domains are represented by a
colored block. The domain designation is described in the key. White blocks represent interdomain
regions of 100% identity. Module arrangements are depicted below each gene, and the modules are
color-coded to indicate identity both in function and sequence (98%). The structure of mycolactone has
also been color-coded to match the module responsible for a particular chain extension. (Picture
adapted from Stinear et al., 2004).
University of Ghana http://ugspace.ug.edu.gh
![Page 24: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/24.jpg)
12
2.1.2.2 Evolution of Mycobacterium ulcerans
Availability of the genome sequence of M. ulcerans strain Agy99 has afforded
comparative mycobacterial genomics analysis which has provided insight to the
evolutionary scenes of M. ulcerans. M. ulcerans and M. marinum are genetically
related species that cause quite different human skin diseases.
M. ulcerans causes BU whereas M. marinum causes relatively minor granulomatous
skin lesions, often referred to as “fish tank granulomas”. M. ulcerans is not
photochromogenic contrary to that of M. marinum which produces bright yellow
pigments when exposed to light. They both seem to occupy the aquatic environments
(Stinear et al., 2000b). In spite of apparent phenotypic difference, phylogenetic
analysis has revealed a clear delineation between strains of M. ulcerans and M.
marinum indicating that all M. ulcerans strains have evolved from a common M.
marinum progenitor.
This evolutionary process is also reinforced by genomic comparison between the two
species revealing sharing of more than 4,000 orthologous and syntenic protein-coding
DNA sequences and having an average sequence identity of 98.3%. This genomic
analysis has also revealed the loss of over 1.1Mb of DNA owing to deletions by that
of M. ulcerans and acquisition of 168kb by M. marinum mainly in the form of
prophages and chromosome rearrangements resulting in disruption of some genes
facilitated at least in part by the high number IS2404 and IS2606.
The fact that there is high mutual sequence identity between M. ulcerans and M.
marinum suggests that M. ulcerans is probably derived from a M. marinum progenitor
after acquisition of the plasmid through horizontal gene transfer and has evolved
through reductive evolution, massive expansion of IS2404 and IS2606, extensive
University of Ghana http://ugspace.ug.edu.gh
![Page 25: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/25.jpg)
13
pseudogene formation, genome rearrangements and gene deletion. The divergence
event has been estimated to have occurred between 470,000 and 1,200,000 years ago,
as evidenced by the acquisition of the 174 kb virulence plasmid pMUM001 by M.
ulcerans (Stinear et al., 2000b).
2.2 Buruli ulcer
The human necrotizing skin disease that results from infection with M. ulcerans is
commonly known as BU. It takes its name from a series of cases described earlier in
the Ugandan region of Buruli, near the river Nile. BU is one of the 17 neglected
tropical diseases identified by the WHO and is the second most prevalent
mycobacteriosis in Ghana after tuberculosis and third globally, after tuberculosis and
leprosy (Asiedu et al., 2000). This atypical mycobacteriosis has been reported in at
least 33 countries worldwide and remains an emerging infection primarily in riverine
rural regions of West and Central Africa where it is recognized as a serious health
problem (Reynaud et al., 2015).
Non-endemic areas such as North America and Europe have reported cases of BU as a
result of international travel (Semret et al., 1999; Ezzedine et al., 2009). BU can
affect all age group although in West Africa, children are disproportionately affected
with a peak age group of 5 to 15 years (Debacker et al., 2004). There is no important
difference among sex group susceptible for BU infection (WHO, 2015) although
Barker (1973) reported prevalence to be higher among women than men and among
boys than girls. Fatality associated with the disease is low compared to its high
morbidity.
In 1998, the World Health Organization (WHO) established the Global Buruli Ulcer
Initiative to focus on prevention, awareness, and improving treatment options for
University of Ghana http://ugspace.ug.edu.gh
![Page 26: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/26.jpg)
14
those suffering from this disease (WHO, 1998). To date, public health effort toward
BU control has been undermined by poor understanding of how humans acquire M.
ulcerans from the environment which still remains an enigma in BU research (Merritt
et al., 2010).
2.2.1 Diagnosis of Buruli ulcer
BU is diagnosed on the basis of clinical examination of lesions on suspected patients
as well as laboratory testing of clinical samples. Specimens obtained by swabs are
taken from the undermined edges of ulcers. Fine-needle aspiration (FNA) is mainly
used to obtain samples from clinically-diagnosed non-ulcerative lesions (nodule,
plaque and oedema). Punch biopsy is preferable when larger diagnostic specimens are
required for histopthological analyses. Four laboratory tests are recommended for the
diagnosis of BU. These include microscopic examination, culture, histopathology and
PCR (Fig. 2.3), all having varied levels of specificity and sensitivity (Herbinger et al.,
2009). Microscopic examination is the most rapid and least expensive method of
diagnostic that detects acid-fast bacilli (AFB) in smears after employing staining
techniques such as the Zeihl Neelson (ZN). The method has low sensitivity (29-78%)
(Ablordey et al., 2012). Histopathologic features for the diagnosis of BU include
necrosis of subcutaneous tissues and dermal collagen accompanied by minimal
inflammation and presence of AFB (Guarner et al., 2003). Cultivation takes
approximately 6-8 weeks to see visible yellow to cream colonies of M. ulcerans in
pure cultures. Owing to the long-time taken to obtain culture results, this method is
not considered as an alternative to rapidly confirm BU. The most commonly used
target sequence in PCR assays for molecular detection of M. ulcerans is IS2404
University of Ghana http://ugspace.ug.edu.gh
![Page 27: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/27.jpg)
15
(Stinear et al., 1999). Both real time PCR and conventional PCR targeting the IS2404
sequence have been used for prompt and accurate diagnosis of M. ulcerans infection.
Figure 2.3 Laboratory tests for Buruli ulcer diagnosis.
(A) Ziehl -Neelsen staining technique showing acid fast bacilli (AFB) of M .ulcerans (B) Yellow
colonies of M. ulcerans cultivated on Lowenstein-Jensen (LJ) media (C) clumps of AFB in necrotic
tissues in histological analysis (D) Gel picture showing the amplified products of IS2404 PCR, L =
molecular weight marker, N= negative PCR control, S1-S5 = are clinical samples ; S1 was negative for
M . ulcerans DNA, S2-S5 were positive for M . ulcerans as depicted by the band sizes (approximately
200bp) , P = PCR positive control. (Picture (C) adapted from Guarner et al., 2003).
2.2.2 Treatment of Buruli ulcer
Before 2004, antibiotics were believed to be ineffective for the treatment of BU as
surgical excision and repair was the main regimen. Challenges associated with the use
of this regimen such as the high recurrence rates (Kibadi et al., 2009), high cost as
A B
C D
University of Ghana http://ugspace.ug.edu.gh
![Page 28: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/28.jpg)
16
well as difficulties in accessing treatment especially in endemic rural areas and also
the significant cosmetic morbidity, paved way for the use of antibiotics for treatment
of BU, after empirical evidence from animal and human studies.
The latest WHO recommendations are eight weeks combination antibiotic therapy of
intra-muscular streptomycin 15 mg/kg and oral rifampicin 10 mg/kg. Surgical
intervention is recommended only to hasten healing of more extensive ulcers if
antibiotics are contraindicated or not tolerated, or at a patient‟s request. In addition, if
surgery is required, an initial four weeks of antibiotics prior to surgery is
recommended (Cowan et al., 2015).
The efficacy of rifampicin combined with streptomycin in humans was first
established by a small case series of patients with early lesions in Ghana. Since its
introduction, there have been little reports on its side effects though attempts are
geared toward the use of all-oral regimens to avoid the toxicity associated with the use
of aminoglycoside such as streptomycin. Published and observational data have
confirmed the effectiveness of all oral regimens of rifampicin-based drug
combinations with a second oral agent such as clarithromycin, moxifloxacin or
ciprofloxacin (O‟Brien et al., 2007). Report indicates that only few patients after
treatment with antibiotic develop worsening appearance of their lesion referred to as
paradoxical reaction or an immune reconstitution inflammatory reaction. This
presents as deterioration in the clinical appearance of the lesion after initial
improvement, with increasing induration, pain, wound discharge and occasionally
new ulceration (O‟Brien et al., 2013).
University of Ghana http://ugspace.ug.edu.gh
![Page 29: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/29.jpg)
17
Aside the use of antibiotics for the treatment of BU, Bertolotti and colleagues reported
for the first time use of ozone therapy for the treatment of BU. This could provide a
cheaper and simple alternative for the management of BU (Bertolotti et al., 2013).
2.2.3 Pathogenesis of Buruli ulcer
M. ulcerans is considered an intracellular parasite despite the predominance of free
bacilli in necrotic acellular areas of tissues from BU lesions (Torrado et al., 2007).
This postulate is based on the fact that M. ulcerans infections are associated with cell
mediated immunity (CMI) and delayed-type hypersensitivity (DTH) responses
characteristic of an intracellular parasite. Its cycle within host cell encompasses
phases of intra-macrophage and extracellular multiplication (Silva et al., 2009).
After transmission of the bacterium into the subcutaneous fat of exposed parts of the
body, there is approximately 4 to 10 weeks of dormant phase followed by progressive
coagulative necrosis of the dermis and subcutis resulting in the varied forms of BU
lesions (Sizaire et al., 2006). Extensive necrosis is the hallmark of BU histopathology
and has been associated with the high toxigenicity of the exotoxin, mycolactone,
secreted by M. ulcerans. Other features relevant for M. ulcerans pathogenicity are the
low optimum growth temperature that makes the skin its almost exclusive territory
and its slow growth rate that translates into slowly progressing lesions (Silva et al.,
2009).
2.2.3.1 Mycolactone
Mycolactone is a polyketide macrolide lipid-like secondary metabolite synthesized by
M. ulcerans (Hall and Simmond, 2014) as well as other mycolactone producing
mycobacteria (MPM). It is a highly diffusible heat-stable exotoxin that causes
extensive, chronic, and necrotizing damage to the papillary dermis, subcutaneous fat,
University of Ghana http://ugspace.ug.edu.gh
![Page 30: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/30.jpg)
18
bones and muscles (Boleira et al., 2010). Mycolactone is the only virulence factor
identified for M. ulcerans to date. It consists of a 12-membered lactone core and two
polyketide side chains produced by enzymes encoded by the giant 174 kb plasmid,
pMUM (Stinear et al., 2004) present in all MPM.
Strains of M. ulcerans produce a range of mycolactones, each containing the lactone
ring and varied length of the side chain, location of the hydroxy groups and double
bonds within the side chain. Variation in the structure of polyketide side chains is
responsible for differences in virulence among the family of mycolactones. At least
five structurally distinct mycolactones are produced by the different strains of M.
ulcerans and that of the close relatives from fish and frogs (Fig. 2.4). These are
mycolactone A/B, C, D, E and F. Strains of M. ulcerans from Africa, Malaysia and
Japan produce mycolactone A/B, Australian strains produce mycolactone C, Chinese
strains produce mycolactone D and Mycobacterium liflandii and Mycobacterium
Pseudoshottsii produce the unique mycolactones E and F (Hong et al., 2008). The
alphabetical grading denotes the potency of the mycolactone thus mycolactone A/B is
the most potent and mycolactone F is the least potent (Hong et al., 2007).
Mycolactone is believed to play a central role in determining the extracellular
localization of the bacteria and modulation of immunological responses to M.
ulcerans (Adusumilli et al., 2005). Purified mycolactone has cytotoxic, apoptotic, and
immunosuppressive properties. These unique properties of mycolactone appear to be
of crucial importance to the pathogenesis of the disease (Mve-Obiang et al., 2003).
Studies using L929 murine fibroblasts revealed that mycolactone induced cell-cycle
arrest at the G1/G0-phase, cytoskeletal rearrangements and the cells became apoptotic
(George et al., 1999). Susceptibilities of cells to mycolactone appear to differ.
University of Ghana http://ugspace.ug.edu.gh
![Page 31: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/31.jpg)
19
Whereas immature DCs (dendritic cells) are relatively more sensitive to mycolactone
after 48 h, (Coutanceau et al., 2007) purified human monocytes show no significant
reduction in viability after 24 h (Simmonds et al., 2009).
The mechanism underlining mycolactone induced cell death has recently been
elucidated by Guenin-Mace et al. (2013). Their studies revealed how low doses of
mycolactone cause cells to rapidly form filopodia, clusters of actin bundles associated
with wound healing and cell–cell interactions. These resulted from mycolactone-
dependent enhancement of actin polymerization following its binding to the GTPase
domain of the WASP (Wiskott–Aldrich syndrome protein) family of proteins.
Activation of WASP and relocalization of the actin-nucleating complex Arp2/3 (actin-
related protein 2/3) are believed to explain the cytoskeletal rearrangement in
mycolactone-treated cells. These were associated with a loss of cell adhesion and E-
cadherin (epithelial cadherin) thus in vitro, cell death is related to anoikis, an
apoptosis owing to detachment.
Mycolactone can suppress both innate and adaptive immune responses in patients and
in experimentally infected mice. Mycolactone suppresses the innate responses by
restricting the functions of resident tissue macrophages. At the early stage of M.
ulcerans infections, M. ulcerans are phagocytosed by macrophages (Coutanceau et
al., 2005) and presumably escaping digestion by preventing phagolysosome
formation. Over short time periods it proliferates inside macrophages until
mycolactone causes the apoptosis/necrosis of the macrophages and the release of the
bacilli into the intercellular space (Torrado et al., 2007).
A key event that normally occurs upon phagocytosis of a microbe is the activation by
PAMPs (pathogen-associated molecular patterns) resulting in intracellular signalling
University of Ghana http://ugspace.ug.edu.gh
![Page 32: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/32.jpg)
20
cascades that end in a rapid, profound and controlled inflammatory response,
including the production of cytokines and chemokines to recruit other inflammatory
cells to the site of infection. These have been shown to be interfered by mycolactone.
Failure to produce cytokines and chemokines at the site of infection is considered a
probable explanation for the lack of an inflammatory infiltrate close to bacilli, with
the peripheral infiltrate indicating the limit of biologically active doses of
mycolactone (Silva et al., 2009).
Figure 2.4 Structures of naturally occurring mycolactones and their geographical origin.
The complete structure of mycolactone A/B is shown, which exists as 3:2 ratio of Z-/E- isomers of the
C-4 – C-5 bond in the long polyketide side chains. Variation in the structure of polyketide side chains
responsible for structural differences in the family of mycolactone is shown for mycolactone C- F. The
species of mycobacterium secreting the mycolactone as well as it origin indicated. (Figure adapted
from Hall and Simmonds, 2014)
University of Ghana http://ugspace.ug.edu.gh
![Page 33: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/33.jpg)
21
2.2.4 History of Buruli ulcer
First description of cutaneous ulcers probably caused by M. ulcerans was in 1897 by
Sir Albert Cook, in Uganda but it was in 1948 when MacCallum and his colleagues
isolated M. ulcerans from some patients in Australia. The most common name for the
M. ulcerans infection originated from Buruli district near Lake Kyoga in Uganda
(now called Nakasongola District) after the district recorded high cases in 1950.
Depending on the geographical origin, the name of the infection could vary. For
instance in southern Australia, it is still called Bairnsdale ulcer following the detection
of the disease from Bairnsdale area near Melbourne by a team lead by Professor Peter
MacCallum.
BU has emerged rapidly to other parts of the world and in the last decade, there have
been consistent and increased cases of M. ulcreans infection particularly in West
Africa (Amofah et al., 2002). The disease has been recorded in at least 33 countries
spanning across the globe from tropical and subtropical regions of Asia, Latin
America, Western Pacific region, Africa as well as temperate region in southern
Australia (Merritt et al., 2010; Walsh et al., 2008; Duker et al., 2006; Horsburgh and
Meyers, 1997).
2.2.5 Epidemiology of Buruli ulcer
Epidemiological pattern for establishment of M. ulcerans infection is determined by
the presence or absence of Buruli ulcer foci (Pouillot et al., 2007). BU occurs in
discrete foci in endemic areas and unevenly distributed within an endemic country.
BU endemic areas are usually near human disturbed aquatic habitats (Johnson et al.,
2005) and rare in drier and savanna regions (Merritt et al., 2010). Increased
incidences have been reported to be linked to deforestation practices, construction of
University of Ghana http://ugspace.ug.edu.gh
![Page 34: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/34.jpg)
22
agricultural irrigation systems, resettlement and migration closer to water bodies,
unprecedented flooding of lakes and rivers during heavy rainfall (Merritt et al., 2010).
Globally, the burden of BU is increasing and WHO estimates an annual case
confirmation of 6000 from at least 15 of the 33 countries affected with BU (WHO,
2015). Actively reporting countries for BU are Benin, Cameroon, Côte d'Ivoire,
Congo, Democratic Republic of the Congo, Gabon, Ghana, Guinea, Liberia, Nigeria,
Sierra Leone, Togo ( all in Africa) , French Guiana ( Americas), Australia , Japan, and
Papua New Guinea ( in Western Pacific) (WHO, 2015).
Figure 2.5 Global distribution of Buruli ulcer cases reported in 2012.
Picture adapted from WHO, 2013 control of neglected tropical disease.
University of Ghana http://ugspace.ug.edu.gh
![Page 35: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/35.jpg)
23
2.2.5.1 Buruli ulcer Prevalence in Ghana
The first probable case of Buruli ulcer in Ghana was in 1971 recorded in the Greater
Accra region in a child from Nsawam in the Eastern region. Within the same year
some probable cases were also identified along the tributaries of the Densu River
(Bayley, 1971). van der Werf and colleagues in 1989, also described the disease in
some patients in the Asante Akim North district in the Ashanti region (van der Werf
et al., 1989) and later on in the same region, a major endemic foci was described in
Amansie West district by Amofah et al. (1993). Since then isolated cases have been
found in scattered communities in many parts of the country warranting the need for a
national surveillance study.
National case search conducted in 1999 revealed that there were about 5,600 people
with suspected BU lesions at various stages of development (Amofah et al., 2002) and
cases were distributed across all the ten regions with Central region having the
highest prevalence followed by the Ashanti region. The overall national prevalence
then was estimated to be 20.7/100,000 and Amansie West district had the highest
prevalence with 150.8/100,000. This data made BU the second most common
mycobacteriosis in Ghana after tuberculosis (Amofah et al., 2002). Kenu and
colleagues recently reported that over 426 communities mainly in the Ashanti, Brong
-Ahafo, Eastern, Greater Accra and Western region are endemic for BU (Kenu et al.,
2014). Ghana currently reports an average of 1000 cases annually (Ackumey et al.,
2011). Akwapim South district of the Eastern region of Ghana at the moment is the
hottest BU spot in Ghana with a prevalence rate of 151.4 per 100,000 populations
(Kenu et al., 2014).
University of Ghana http://ugspace.ug.edu.gh
![Page 36: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/36.jpg)
24
2.2.6 Transmission of Buruli ulcer
In contrast to tuberculosis where definite mode of transmission is ascertained same
cannot be said for BU. The former is characterized by person-to-person transmission
while the latter hypothesized to be acquired through environmental exposure.
Exposure to M. ulcerans is thought to occur from a yet unknown, but persistent,
environmental niche. Molecular studies have detected M. ulcerans DNA in water,
detritus (Stinear et al., 2000a; Ross et al., 1997), aquatic insects (Portaels et al.,
1999), plants (Marsollier et al., 2004a), snails (Marsollier et al., 2004b) and small fish
(Eddyani et al., 2004). Recently Portaels and colleagues described isolation of M.
ulcerans in pure culture from an insect which further sheds more light on M. ulcerans
as an environmental pathogen (Portaels et al., 2008). However, regardless of
identifying M. ulcerans DNA from these environmental factors, exactly how M.
ulcerans gets into human host still remains elusive. This has led to generation of
hypotheses explaining how this could occur.
2.2.6.1 Role of insects in transmission of M. ulcerans
Portaels and her colleagues were first to propose the role of insecst as vectors in
transmission of M. ulcerans. They used PCR detection of the insertion sequence
IS2404 to document M. ulcerans association with predaceous insects (Naucoridae and
Belostomatidae) and led to the hypothesis that insects may be involved in the
transmission of M. ulcerans (Portaels et al., 1999).
Naucorids and belostomatids are aquatic hemiptera that exploit a wide range of prey,
including snails, fish, anuran larvae, and other terrestrial and aquatic insects (Swart et
al., 2006). They do not feed on humans but can bite if they are disturbed. This
hypothesis links the occurrence of M. ulcernas infection to an aquatic niche as it
University of Ghana http://ugspace.ug.edu.gh
![Page 37: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/37.jpg)
25
maintains that M. ulcerans found in biofilms of aquatic habitats are first concentrated
by grazing or filter-feeding invertebrates which are then consumed by predators
known to bite humans. Marsollier and colleagues later reinforced this hypothesis on
the basis that in an experimental setting, the salivary glands of Naucoris cimicoides
were colonised with M. ulcerans and transmitted it to laboratory mice (Marsollier et
al., 2005). Thus through biting the infected Naucoris cimicoides inoculated the bacilli
that had accumulated in their salivary glands to the mice (Marsollier et al., 2005).
The quest to isolate M. ulcerans from the environment after nearly six decades had a
major breakthrough when Portaels and colleagues isolated M. ulcerans from water
strider an aquatic Hemiptera collected in Benin (Portaels et al., 2008). This further
strengthens the range of hypothetical hemipteran transmitters of M. ulcerans. None of
the predaceous hempitera implicated in transmission of M. ulcerans in Africa are
hematophagous and as suggested by Portaels and colleagues they may be only
passive, incidental and transient reservoirs of M. ulcerans without an obvious role in
the transmission of BU to humans (Portaels et al., 2008).
Mosquitoes are also suspected to participate in transmission of BU to humans in
Australia after an outbreak of the disease coincided with the detection of M. ulcerans
DNA in mosquitoes (Johnson et al., 2007). Detection of PCR positive M. ulcerans
DNA in mosquitoes does not link mosquitoes to transmission but probably an
indicator of cohabitation of both organisms resulting in surface contamination of
mosquitoes with M. ulcerans.
2.2.6.2 Transmission of M. ulcerans upon exposure to contaminated environment
There are two basic hypotheses about the portal of M. ulcerans into human body
(Duker et al., 2006). First when the skin is traumatized it provides a site for
introduction of M. ulcerans into the body. Second is through existing abrasion or
University of Ghana http://ugspace.ug.edu.gh
![Page 38: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/38.jpg)
26
laceration (Jacobsen and Padgett, 2010). When susceptible body parts come into
contact with contaminated water, soil, aquatic plants or biofilm on aquatic plants
where traces of M. uclerans DNA have been documented, direct transmission of M.
ulcerans into the skin from the overlying M. ulcerans contaminated surface could
occur following entry of the pathogen through the described portals above (Portaels et
al., 2001).
The likelihood of M. ulcerans transmission through direct inoculation in abrasion was
recently shown to be a less favourable route of entry. Studies by Williamson and
colleagues revealed how BU failed to develop after inoculation of M. ulcerans in
abrasions on skin surfaces of guinea pigs. Rather ulcers were present at intra- dermal
injection sites in all infected mice and lent support to the hypothesis that M. ulcerans
infection occurs through injection of bacteria rather than through entrance of pre-
existing, superficial skin abrasion (Williamson et al., 2014). Their work further
strengthened what Debacker and colleagues described on how through slight trauma
as in the case of hypodermic injection or severe trauma for example, mine wound,
snake or human bites, M. ulcerans could be introduced from an overlying
contaminated skin surface into the human host (Debacker et al., 2003).
2.2.7 Risk factors associated with Buruli ulcer
Most case control and cross sectional studies have determined an association between
age and the occurrence of BU. Children and adolescents have higher infection rate
than adult. Specifically children less than 15 years are severely affected which have
drawn the attention of some researchers to investigate the behaviour of this age group
to possibly ascertain the transmission mode (Jacobsen and Padgett, 2010; Sopoh et
al., 2007; Debacker et al., 2006 ; Phanzu et al., 2006).
University of Ghana http://ugspace.ug.edu.gh
![Page 39: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/39.jpg)
27
Comparative studies that evaluated sex as a risk factor in all cases reported no
association between sex and Buruli ulcer (Pouillot et al., 2007; Quek et al., 2007;
Debacker et al. 2006; Raghunathan et al., 2005; Stienstra et al., 2004).
Epidemiological evidence mostly links the occurrence of BU to swampy and riverine
environment. Infection with M. ulcerans has not been found to be associated with the
source of water used for cooking or bathing in endemic communities (Aiga et al.,
2004). Some studies have found an increased risk of infection associated with wading
and washing in water (Raghunathan et al., 2005; Kenu et al., 2014). While other
studies found no association between BU and swimming, Aiga and colleagues
reported such an association (Aiga et al., 2004). Wearing of certain types of clothing
has been evaluated extensively. Wearing long legged trousers (long pants) has been
found to reduce the risk of Buruli ulcer (Pouillot et al., 2007; Raghunathan et al.,
2005) but not wearing protective clothing increases the risk of infection (Pouillot et
al., 2007; Quek et al., 2007; Raghunathan et al., 2005; Marston et al., 1995). Critical
evaluation and examination of these potential risk factors for BU as spelt out in
comparative epidemiological studies for the presence of M. ulcerans could likely lead
to a better understanding of M. ulcerans transmission.
University of Ghana http://ugspace.ug.edu.gh
![Page 40: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/40.jpg)
28
CHAPTER THREE
MATERIALS AND METHODS
3.1 Materials
DifcoTM
Middlebrook 7H9 broth (Becton, Dickinson and Company, USA), 4mm
diameter glass beads (Fisher Scientific UK limited), Heat treated Diatomaceous Earth
(Supelco Park, Belleforte, PA, USA), Power soil DNA isolation kit (MO BIO
Laboratories, Inc), TaqMan Universal PCR Master Mix (Applied Biosystem), Primers
for real time PCR (Metabion), Probes (Applied Biosystem)
3.1.1Instrument
Rotor Gene Q real time PCR machine (Qiagen), MP Fast Prep- 24TM
bench top
homogenizer (MP Biomedicals), Microfuge 22R Centrifuge (Beckman Coulter),
Vortex – GenieR 2 (Scientific Industries, Inc.), Incubator (Ikemoto Rikakogyo
Companny Limited, Tokyo, Japan)
3.2 Methods
3.2.1 Location and demography of study areas
The study was conducted in eight selected communities within the districts of
Akwapim South, Akwapim North and Nsawam-Adoagyiri Municipalities of Eastern
region of Ghana. It comprised of four BU endemic communities which were Pakro,
Oparekrom, Mangoase and Dago. The remaining four non- endemic communities
were Boahenakrom, Obosono, Obotweri and Okomfo. Definition for endemic or non-
endemic community used in the study was a community with or without reported case
of BU within the community for the last three years. These communities were
University of Ghana http://ugspace.ug.edu.gh
![Page 41: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/41.jpg)
29
selected based on their prevalence data obtained from the BU register available at the
BU clinic of the Pakro Health Centre.
3.2.2 Nsawam-Adoagyiri Municipality
Nsawam-Adoagyiri municipality is a peri-urban area approximately 23km from Accra
the national capital and situated in the south eastern part of the Eastern region
between latitude 5.45o
N and 5.58o
N and longitude 0.07o
W and 0.27o
W. It is
bordered to the south by the Ga and Tema municipalities of the Greater Accra region,
to the north by Akwapim North municipality, to the west by Suhum municipality and
Upper West Akim District. Nsawam is the municipality capital and administratively
the municipality is divided into four zonal councils namely Nsawam, Adogyiri,
Nkyenenkyene and Fotobi zonal councils. The municipality has twenty-six electoral
areas and one constituency. From the 2010 census, the municipality has a population
of 86,000 comprising of 49.7% males and 50.3% females. The major ethnic group
found in Naswam Adogyiri municipality is the Akan and the municipality is
considered as an endemic area for BU disease.
3.2.2.1 Oparekrom
Oparekrom is a town located within Nsawam-Adoagyiri municipality. It falls under
Gyankrom sub-municipal and have an estimated population of 5,482. The main
occupations of the people are farming and trading. It lies in the Densu river basin.
Water from this source is used for domestic chores such as washing and bathing. The
community is endemic with BU. The Pakro health centre has recorded four confirmed
BU cases from this town between 2012 to 2014.
University of Ghana http://ugspace.ug.edu.gh
![Page 42: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/42.jpg)
30
Figure 3.1 District map of Nsawam-Adoagyiri Municipality.
Black arrow indicating the position of Oparekrom. Picture adapted from 2010 population and house
census for Nsawam-Adoagyiri Municipality.
3.2.3 Akwapim South Municipality
The Akwapim South District is one of the recently created districts in the Eastern
region of Ghana. It was carved out from the old Akwapim South municipality. The
district is located at the south eastern part of the Eastern region of Ghana between
latitudes 5.45o
N and 5.58o
N, and Longitudes 0.0o
W and covers a land area of about
224.13 kilometres square. It lies in the Densu River basin. It is bordered to the west
by the Nsawam-Adoagyiri municipality, to the south-east by the Kpone-Katamanso
District, to the south by the Ga East District and to the North-East by the Akwapim
North municipality. The district has Aburi as the capital. The population of Akwapim
South District, according to the 2010 Population and Housing Census, is 37,501
University of Ghana http://ugspace.ug.edu.gh
![Page 43: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/43.jpg)
31
representing 1.4% of the region‟s total population. Males constitute 48.5% and
females represent 51.5%. Almost 73.4% of the District‟s population lives in the rural
areas and more than one third of the labour force are employed in the agricultural
sector. The district is predominantly made up of Akwapims, who are part of the Akan
ethnic group. There are other ethnic groups who have migrated to settle in the district
and these include Ewes, Gas and Hausas. The district is considered most endemic for
BU in the region and currently the district is the hottest Buruli ulcer spot in Ghana
with prevalence rate of 151.4 per 100,000 populations (Kenu et al., 2014).
3.2.3.1 Pakro
Pakro is a town within Akwapim South municipal district with an estimated
population of 4,376. The main occupation is farming. It lies in the Densu river basin
where residents depend on the river for some domestic activities like washing and
bathing. Pakro is known to be endemic for BU within the Akwapim South municipal
district. The community has recorded 15 confirmed cases of BU out of 25 suspected
cases recorded at the Pakro health centre from 2013 – May 2015.
3.2.3.2 Dago
Dago is a community within the Akwapim South municipal district having an
estimated population of 1,421. The inhabitants are mainly engaged in farming. As
revealed by the records from Pakro Health centre, the community has started
recording isolated case of BU. From January to May 2015, 3 cases of BU have been
confirmed from the community out of 4 suspected cases reported at the centre.
3.2.3.3 Obotweri
Obotweri is within Akwapim South municipal district having an estimated population
of 1,241. Farming is the main occupation of the residents. The community has not
University of Ghana http://ugspace.ug.edu.gh
![Page 44: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/44.jpg)
32
recorded any BU case from 2012 to May 2015 as revealed by the BU records from
Pakro health centre.
3.2.3.4 Obosono
Obosono falls under Pakro sub- district within the Akwapim South municipal.
Estimated population of the community is 1,527. Residents are mostly engaged in
farming as the main occupation. The community has also not recorded any BU case
from 2012 to May 2015 as revealed by the BU records from Pakro health centre.
3.2.3.5 Okomfo
Okomfo is also under Pakro sub –district having an estimated population of 983. The
main occupation of the natives is farming. The community is known to be non-
endemic for BU
3.2.3.5 Boahenakrom
Boahenkrom is a community within Akwapim South municipal and has an estimated
population of 587. Residents within this community are mainly engaged in farming.
The community is also known to be non- endemic for BU.
University of Ghana http://ugspace.ug.edu.gh
![Page 45: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/45.jpg)
33
Figure 3.2 District map of Akwapim South Municipality.
Picture adapted from 2010 population and house census for Akwapim South district
3.2.4 Akwapim North Municipality
Akwapim North District is located in the south - eastern part of the Eastern region and
is about 58km from Accra. The district covers a land area of about 450km2,
representing 2.3% of the total area of Eastern region. It has an estimated population of
122,063 and 3.1% growth rate. The district comprises nineteen towns, with Akropong
as the district capital. According to the Eastern regional Health Directorate report in
2011, the district recorded isolated cases of BU in that year under review.
University of Ghana http://ugspace.ug.edu.gh
![Page 46: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/46.jpg)
34
3.2.4.1 Mangoase
Mangoase is a town within Akwapim North municipality with an estimated
population of 8,465. Farming and trading are the main occupations engaged by the
residents. It lies within the Densu river basin. In 2014, the town recorded 7 cases of
BU as disclosed by the records at the Pakro health centre.
3.3 Study Design
The study‟s design was a cross sectional study conducted from December 2014 – July
2015.
3.3.1 Study population
The targeted population of residents within the eight communities for the study were
people engaged in specific risk activities such as farming without protective clothing,
children playing with the soil, wading, swimming, or fetching water from a slow
flowing water body or stagnant water in pursuing their normal activities that might
result in contamination of their skin surfaces with M. ulcerans. Other activities like
the usage of mud by individuals for construction, toddlers crawling in soil or
individuals with visible soil contamination on their skin were also considered. All
individuals who met the study‟ eligibility criteria were recruited after they consented.
3.3.2 Exclusion Criteria
Individuals diagnosed of BU by WHO guidelines as well as individuals who at the
time of sampling did not appear to be engaged in any of the above mentioned specific
risk activities.
University of Ghana http://ugspace.ug.edu.gh
![Page 47: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/47.jpg)
35
3.3.3 Sample size
A total of 50 participants were recruited from each of the eight communities making a
total of 400 participants.
3.4 Organization of Field work
3.4.1 Community Entry
The first point of call at the study communities were the premises of community
elders, assembly men or the opinion leaders where meetings were held to explain the
purpose, the scope, eligibility and exclusion criteria of the study to them.
3.4.2 Field Operations
A team comprising the Principal investigator (PI), a disease control officer from
Pakro Health Centre and a community volunteer visited the eight communities to
recruit, and sample participants.
3.4.3 Data and Sample Collections
A structured questionnaire (Appendix 2) was designed by the PI containing questions
to solicit answers about the participant‟s demographics and the type of risk activity
engaged with. Types of risk activities were classified into two groups based on the
outlined risk factors for BU revealed by some case control studies. These groups were
classified as either contact with slow flowing water body or having direct contact with
the soil. Participants who were swimming, fetching or wading through slow flowing
water bodies in the respective communities were captured under the first group and
the activity engaged with indicated. In the other group, participants who were playing
or crawling in the soil or farming without protective clothes and had visible soil
University of Ghana http://ugspace.ug.edu.gh
![Page 48: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/48.jpg)
36
contamination on the skin surface were captured in this group as having direct contact
with the soil and the respective activity engaged recorded.
Sterile cotton swabs were used to swab the exposed limbs (upper and lower) of
participants after engagement with their respective activities and stored in sterile
universal bottles containing Middle Brook 7H9 medium (5ml) to preserve the
viability of any mycobacterium. Individual bottles were labelled with participant ID
and the date of sample collection. The samples were transported on the same day on
ice to the laboratories of Noguchi Memorial Institute for Medical Research (NMIMR)
for analyses.
University of Ghana http://ugspace.ug.edu.gh
![Page 49: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/49.jpg)
37
Figure 3.3 Specific activities engaged by recruits ;
(A.) Children swimming in the Densu River at Pakro. (B.) children fishing in a stagnant water at Pakro
(C) children playing with the soil at Pakro
B A
C
University of Ghana http://ugspace.ug.edu.gh
![Page 50: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/50.jpg)
38
Figure 3.4 Sampling, sample storage and transportation.
(A) Skin swabs taken from exposed upper limb of a farmer (B) Skin swab taken from exposed lower
limb of a farmer (C) Swabs in universal bottle containing 7H9 media ( D) Cold box containing
individual universal bottles for easy transportation to the laboratory.
A B
C D
University of Ghana http://ugspace.ug.edu.gh
![Page 51: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/51.jpg)
39
3.5 Laboratory analyses
3.5.1 Sample processing and pooling strategy
Ten sterile glass beads were added to the content of each universal bottle containing
the swabs and vortexed vigorously for two minutes to obtain suspensions. A portion
(2 ml) from five samples was pooled into a 50 ml falcon tube. Samples were mostly
pooled based on similarity of their risk activities and location (Appendix 3). A total of
80 pools were obtained from the 400 samples. The pooled samples were used for the
DNA extractions as well as culture. PCR positive pooled samples were traced to the
individual level to identify the type of activity engaged by the subject.
3.5.2 DNA extraction procedures
DNA was extracted from all the pooled samples as well as some individual samples
using the modified Boom method (Durnez et al., 2009) and the power soil DNA
isolation kit, a commercial DNA isolation kit.
3.5.2.1 Genomic DNA extraction using modified Boom protocol
Skin suspensions (500 µl) were added to 250 µl of lysis buffer (1.6 M GuHCl, 60mM
Tris at pH of 7.4, 1% Triton X-100, 60 mM EDTA, 10% Tween-20), 50 µl of
Proteinase K at concentration of 20 mg/ml and 500 µl glass beads in sterile 1.5 ml
cryovial tubes. The tubes were secured in styrofoam box and incubated horizontally in
an orbital shaker (200 rpm) at 60⁰C for 12 hours. A combination of chemical and
mechanical lysing steps employed in this protocol was to facilitate effective lysis of
the mycobacterium cell.
University of Ghana http://ugspace.ug.edu.gh
![Page 52: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/52.jpg)
40
Diatomaceous earth solution (40 µl) was added to the lysates to capture the released
DNA and incubated at 37⁰C for 1 hour. The mixtures were centrifuged at 14,000 rpm
for 1 min, supernatants discarded and pellets washed twice with 900 µl of ice cold
70% alcohol and 900 µl of absolute acetone, pulsed vortexed and centrifuged at
14,000 rpm for 1min. The supernatants were discarded and the pellets containing
DNA bound to diatomaceous earth were dried at 50⁰C for 20 min using a heat block
to evaporate any acetone residues.
The DNA was resuspended in 100 µl of nuclease free water after incubating at 68 ⁰C
for 20 min on a heat block with intermittent vortexing. The mixtures were centrifuged
at 14,000 rpm for 1 min and 50 µl of the supernatants containing the extracted DNA
were pipetted into sterile tubes and stored at -20⁰C until used. Controls (negative and
positive controls) were also run alongside the samples. The negative extraction
control included all the reagents for DNA extraction with exception of the sample.
Instead of the skin suspension, suspension containing M. ulcerans isolate was used in
the positive control test.
3.5.2.2 Genomic DNA extraction using power soil DNA isolation kit
DNA extraction was performed with the use of the power soil DNA isolation kit with
slight modification to the manufacturer instructions. Briefly, skin suspensions (500
µl) were added to the power bead tubes provided and followed by 60 µl of solution
C1 and the tubes vortexed for 5 seconds. C1contains sodium dodecyl sulphate (SDS)
and other disruption agents required for cell lysis. The power beads tubes were
secured vertically on MP Fast Prep- 24TM
bench top homogenizer and run at
maximum speed for five minutes. The MP Fast Prep- 24TM
uses unique optimized
motion to disrupt cells through multidirectional, simultaneous beating of specialized
University of Ghana http://ugspace.ug.edu.gh
![Page 53: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/53.jpg)
41
Lysing Matrix beads in the power beads tube on the sample material. A combination
of this mechanical step as well as the chemical lysing step helps to effectively lyse the
mycobacterium cell.
The power beads tubes were then centrifuged at 10,000 g for 30 seconds at room
temperature. The supernatants were transferred into clean 2 ml collection tubes
provided and 250 µl of solution C2 (Solution C2 is a patented inhibitor removal
containing reagent to precipitate non-DNA organic and inorganic material including
humic acid substances, cell debris and proteins) were added to the respective tubes.
The mixtures were vortexed for 5 seconds, incubated for 5 minutes at 4oC and
centrifuged at10,000 g for 60 seconds at room temperature.
Avoiding the pellet and any precipitation, 800 µl of the supernatants were transferred
into another clean 2 ml collection tubes provided and 200 µl of solution C3 added
(Solution C3 is another patented inhibitor removal containing reagent to precipitate
additional non-DNA organic and inorganic material including humic acid substances,
cell debris and proteins). The mixtures were vortexed for another 5 seconds and
incubated at same condition of 4oC for 5 minutes and centrifuged at room temperature
for 1 minute at 10,000 g. Into another clean 2 ml collection tubes, 750 µl the
supernatants were transferred and 1.2 ml of solution C4 (Solution C4 is a high salt
concentration that helps DNA to bind tightly to the silica spin filter) added to the
individual tubes.
Tubes were vortexed for 2 seconds and 675 µl of the mixtures transferred to another
collecting tubes containing spin filters. The tubes were centrifuged at room
temperature for 1 munite at 10,000 g and the flow beneath the spin filter discarded.
These steps were repeated three times till the whole volume in the 2ml collection
University of Ghana http://ugspace.ug.edu.gh
![Page 54: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/54.jpg)
42
tubes were finished. Solution C5 which was an ethanol based washing solution
required to further clean the DNA bound to the silica filter membrane in the spin filter
were added (500 µl) to tubes containing the spin filters and centrifuged at 10,000 g for
1 minute at room temperature. The flow beneath the spin filters were discarded and
the tubes centrifuged again to remove all traces of the washing solution as ethanol in
Solution C5 can interfere with downstream application like PCR.
The spin filters were carefully transferred into another clean 2 ml collection tubes and
100 µl of solution C6 containing 10mM Tris solution were added at the centre of filter
membrane to elute the bound DNA. The tubes were centrifuged at room temperature
at 10,000 g for 30 seconds and the spin filter discarded. The tubes containing the
DNA extract were kept at -20⁰C until used. Controls (negative and positive control)
were also run alongside the samples. The negative extraction control included all the
reagents for DNA extraction with exception of the sample. Instead of the skin
suspension, suspension containing M. ulcerans isolate was used in the positive control
test.
3.5.3 Detection of M. ulcerans DNA by qPCR targeting IS2404 multiplexed with
IPC
Quantitative real time PCR targeting IS2404 multiplexed with an internal positive
control (IPC) to monitor inhibition was performed on all the DNA extracts in
duplicate. The qPCR mixture contained 1.25 µl of each primer (18 µM), 1.25 µl of the
probe (5 µM), 0.5 µl of Exo IPC DNA (50X), 2.5 µl Exo IPC Mix, 12.5 µl TaqMan®
Universal PCR Master Mix (2X), 4.75 µl Nuclease Free Water and 1 µl of template
DNA (samples) or 1 µl no template control (NTC) or 2.5 µl Exo IPC Block (10X) in a
total volume of 25 µl.
University of Ghana http://ugspace.ug.edu.gh
![Page 55: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/55.jpg)
43
Amplification and detection was performed using Rotor Gene Q thermal cycler using
the following program: 1 cycle of 50°C for 2 min, 1 cycle of 95°C for 10 min and 40
cycles of 95°C for 15 s and 60°C for 1 min. The results were analysed with Rotor
Gene Q series software version 1.7. Negative results are indicated as negative,
positive results by the respective Ct (cycle threshold) value and inhibition indicated as
blank.
3.5.4 Detection of M. ulcerans DNA by qPCR targeting IS2606 and KR
Another multiplex TaqMan® assay targeting IS2606 and ketoreductase-B domain
(KR) designed to augment the specificity of the first IS2404/IPC PCR was performed
on all IS2404 PCR positive samples in duplicate. The qPCR mixture contained 1.25
µl of each primer (18 µM), 1.25 µl of the probes (2 µM), 12.5 µl TaqMan® Universal
PCR Master Mix (2X), 4 µl Nuclease Free Water and 1 µl of template DNA (samples)
or 1µl no template control (NTC).
Amplification and detection was performed with the Rotor Gene Q thermal cycler
using the following program: 1 cycle of 50°C for 2 min, 1 cycle of 95°C for 10 min
and 40 cycles of 95°C for 15 s and 60°C for 1 min. The results were analysed with
Rotor Gene Q series software version 1.7. Negative results are indicated as negative,
positive results by the respective Ct (cycle threshold) value and inhibition indicated as
blank.
3.5.5 Cultivation of skin suspensions on Löwenstein Jensen (LJ) media
Pooled skin suspensions (2 ml) were transferred into 2 ml cryovials and centrifuged at
14,000 rpm for 5 min. The supernatants were discarded and the pellets
decontaminated using the method by Portael et al. (1988) with sight modification.
University of Ghana http://ugspace.ug.edu.gh
![Page 56: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/56.jpg)
44
Briefly to the pellets, 500 µl NaOH (1M), 100 µl of 0.8% cycloheximide and 500 µl
of 0.2% malachite green were added. The content of the tubes were mixed and
incubated at room temperature for 30min.
The mixtures were centrifuged at 14,000 rpm for 5 min and neutralized with 1 ml of
oxalic acid and incubated for 20 min at room temperature. And again, centrifuged at
14,000 rpm for 5 min and washed twice with 1ml sterile distilled water followed by
another round of centrifugation at 14,000 rpm for 5 min. Pellets were resuspended in
100 μl phosphate buffered-saline (PBS) and 100 μl volume of the decontaminated
sample was inoculated onto Löwenstein Jensen (LJ) slopes and incubated at 31°C.
Cultures were observed weekly for growth of mycobacterial colonies.
University of Ghana http://ugspace.ug.edu.gh
![Page 57: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/57.jpg)
45
CHAPTER FOUR
RESULTS
4.1 Demographic Characteristics
A total of 400 participants were enrolled in the study and out of these 224 (56%) were
males and 176 (44%) females. The sex ratio of participants was balanced between
endemic and non-endemic communities, p = 0.009. Median age of the participants
was 18 years (range of 1 to 85 years). Participants from endemic and non-endemic
communities had median ages of 14 years (range of 1 to 84 years) and 25 years (1 to
85 years) respectively. Age was disproportionately represented, p= 0.075, with
participants less than 16 years being predominant from both endemic and non-
endemic communities. Their corresponding percentages were 52% and 41.5%
respectively. Percentages of participants with age ranges of 16-45 and 45-85 were
31.5 and 16.5 for endemic communities and 35 and 23.5 for non-endemic
communities (Table 4.1).
Table 4.1 Comparison of age and sex characteristics of participants in endemic and non- endemic
communities.
Characteristcs Endemic
communities
Non- endemic
communities
p - value
Sex
Male n(%) 125 (62.5%) 99 (49.5%) 0.009
Female n(%) 75 (37.5%) 101 (50.5%)
Age Median (range) year 14 ( 1-84) 25 (1-85)
< 16 n(%) 104 (52%) 83 (41.5%) 0.075
16-45 n(%) 63 (31.5%) 70 (35%)
> 45 n (%) 33 (16.5%) 47 (23.5%)
n = number of participants (%) = percentage of participants
University of Ghana http://ugspace.ug.edu.gh
![Page 58: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/58.jpg)
46
4.1.1 Age characteristic of recruits within the selected communities
Participants from Oparekrom had the lowest median age of 13 years (range of 1 to 48
years) whereas the highest median age of 32.5 years (range of 2 to 48 years) was
recorded by participants from Dago. The age characteristics from the other two
selected endemic communities Pakro and Mangoase had respective median ages of 14
years (range of 3 to 80 years) and 18 years (4 to 80 years). Among the non- endemic
communities, recruits from Boahenekrom had the lowest median age of 14.5 years
(range of 1 to 70 years) and that of Obosono had the highest of 32 years (1 to 80
years). Recruits from Okomfo and Obotweri had respective median ages of 20 years
(range of 1 to 85 years) and 25 years (range of 1 to 75 years).
The highest percentage of participants with ages less than 16 years was 68% recorded
by recruits from Oparekrom whereas the least of 28% was recorded by recruits form
Obosono. Recruits from Obosono had the highest percentage of 44% for the age
category 16 – 45 years and the least of 18% recorded by recruits from Okomfo. Dago
had majority of the participants with ages above 45 years with a percentage of 34%
whereas Oparekrom recorded the least percentage of 0.2% for the same age category
(Fig. 4.1).
University of Ghana http://ugspace.ug.edu.gh
![Page 59: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/59.jpg)
47
Figure 4.1 Age characteristics of participants within the eight selected communities.
Blue bars represent recruits with ages less than 16years. Red and green bars represents ages of recruits
with ages 16 – 45 years and greater than 45 years respectively.
4.2 Statistics on the type of risk activities engaged by participants
The highest percentage of recruits (36%) was engaged in activities involving playing,
closely followed by farming without protective clothing (29%). Participants that were
crawling and those using mud for construction together formed 2%. In total,
participants whose activities involved direct contact with soil were found to be 67%.
Participants who had direct contact with slow flowing water or stagnant water in
pursuing their normal activity formed 14 %, with those swimming having the highest
0
10
20
30
40
50
60
70
Per
cen
tage
of
re
cru
ited
par
tici
pan
ts
Age range (years)
<16
16-45
>45
Endemic communities Non endemic communities
University of Ghana http://ugspace.ug.edu.gh
![Page 60: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/60.jpg)
48
percentage of 7%. Participants who had visible soil contamination on the skin surface
formed 19% and were captured as others (Fig. 4.2).
Figure 4.2 Percentages of participants engaged in specific risk activities.
4. 3 Pools composition
A total of ten pools (five different skin suspensions were pooled into a group) were
generated from each of the sampled communities. Five out of the total pools from
Dago (A1, A2, A3, A6 and A10) were those involved in the same activities. Pool A1
was made of samples from participants who were playing in the soil. Pools (A2, A3
and A6) were from participants who farmed without protective clothing, while A10
consisted of those classified as others as explained in Fig 4.2. The rest of the pools
(A4, A5, A7, A8 and A9) comprised a mix of samples from participants engaged in
different risk activities (playing, farming and others). Only three of the pools (B1, B2
and B8) from Mangoase were engaged in similar activities. Pools B1 and B2 were
involved in playing while pool B8 encompassed those engaged in farming without
Playing 36%
Swimming 7% Farming
29%
Crawling 1%
Fetching 1%
Wading 6%
Pottery 1% others
19%
University of Ghana http://ugspace.ug.edu.gh
![Page 61: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/61.jpg)
49
protective clothing. Pools B6 and B7 predominantly constituted samples from
participants wading through portions of the Densu river within the town. The rest of
the pools (B3, B4, B5, B9 and B10) were composed of samples from participants
involved in different activities (playing, farming and others).
The first four pools (C1- C4) generated from the samples collected from Pakro
consisted of individuals swimming, fetching or wading through the portion of the
Densu river within that town. Pool C5 was from participants wading through a
stagnant water body while pool C8 was from participants who farmed without
protective clothing. The rest of the pools (C6, C7, C9 and C10) comprised samples
from participants involved in different risk activities (playing and farming).
Pools D1 to D4 from Oparekrom were samples from participants swimming in the
Densu river streaming through that town. D6 pool was mostly from participants
wading through a stagnant water body believed to be the source of BU by section of
the inhabitants whereas D5 pool was involved in playing. Pools D7 to D10 composed
of samples from participants engaged in different activities (playing, farming and
others).
The pools pattern (1A to 1J) generated from Boahenekrom‟ samples were composed
of samples from participants engaged in different activities (playing, farming and
others) except for pools IF and 1J. Pool 1F was composed of samples from
participants who were involved in playing whereas 1J pool was also composed of
samples from participants that were using mud in constructions (pottery). Pools (2A-
2J), (3A- 3J) and (4A -4J) generated from samples from Okomfo, Obosono and
Obotweri respectively mainly consisted of samples from participants engaged in
different risk activities (playing, farming and others) except for pool 2H composed of
University of Ghana http://ugspace.ug.edu.gh
![Page 62: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/62.jpg)
50
samples from participants who were involved in playing. Pool 3G also composed of
samples from participants who were classified as others as explained from Fig. 4.2
above.
4.4 Detection of M. ulcerans
Detection of M. ulcerans DNA was assessed by detecting the presence of the multiple
insertion sequence elements IS2404 and IS2606 as well as the gene that codes for the
enzyme involved in synthesis of mycolactone, ketoreductase.
4.4.1 Detection of IS2404 target from pooled DNA extracts
IS2404 RT PCR revealed a higher positivity with DNA extracts obtained from the
power soil DNA isolation kits than those from the modified Boom method. Out of the
80 pooled samples, 3 pools were positive for IS2404 target sequence using extract
from power soil DNA isolation kits while DNA extracted using the modified Boom
methods were all negative.
The positive pooled samples were 2E (Okomfo), 3C and 3D (Obosono) Their
respective mean Ct (cycle threshold) values were 31.44, 38.85, and 37.3 (Appendix 5;
Table 1).
4.4.1.1 Analysis of individual component samples within IS2404 pools positive
Individual DNA extracts from all three pooled IS2404 positives were also tested for
the presence of IS2404. The mean IS2404 Ct value of the individual sample within 3C
pool was 36.27. This value was slightly lower than the group mean Ct value of 38.85.
Mean IS2404 Ct value of the individual sample within pool 3D was 37.77. Three out
of five samples within 2E pool were all positive for the target sequence and had mean
Ct values of 38.63, 38.11 and 38.42 (Appendix 5; Table 1).
University of Ghana http://ugspace.ug.edu.gh
![Page 63: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/63.jpg)
51
4.4.2 Detection of IS2606 and KR targets from pooled DNA extracts
Pooled samples positive for the IS2404 were tested for the additional targets IS2606
and ketoreductase-B domain sequence (KR) in another multiplex TaqMan real time
assay. All three IS2404 positive pooled samples were also positive for KR target
sequence but only one (pool) 2E was positive for IS2606. The mean KR Ct value
recorded by Pool 3C and 3D were 35.85 and 39.35 and both had IS2606 assay
inhibited. Mean KR Ct and IS2606 Ct value for pool 2E were 31.1 and 34.42
respectively (Appendix 5; Table 2).
4.4.2.1 Analysis of individual component samples within IS2606 and KR pools
positive
Individual DNA extracts constituting the IS2606 and KR positive pools (2E, 3C and
3D) were also tested for the presence of these targets. Corresponding mean Ct values
for KR and IS2606 recorded by the only IS2404 positive within 3C pool were 35.52
and 38.61 while that from pool 3D were 39.31 and 39.35. Only one out of the three
IS2404 positives within pool 2E was positive for the both KR and IS2606 target with
mean Ct of 38.26 and 39.63 respectively. The other two IS2404 positive samples
within pool 2E had their IS2606 inhibited assays while their corresponding mean Ct
values for KR were 93.38 and 37.18 (Appendix 5; Table 3).
4.5 Specific activities resulting in M. ulcerans DNA skin contamination
Five samples from participants were positive for IS2404 target sequence. Two out of
the five (40%) positive samples were from participants involved in farming without
protective clothing while the other two (40%) were from toddlers crawling in the soil.
The fifth IS2404 positive sample was from a child playing with the soil. All IS2404
positive samples obtained from participants involved in farming without protective
University of Ghana http://ugspace.ug.edu.gh
![Page 64: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/64.jpg)
52
clothing also tested positive for IS2606 and KR. Only one of the toddlers‟ positive for
IS2404 target sequence was positive for both targets while the other was positive for
only KR. The only participant involved in playing and positive for IS2404 target
sequence also had IS2606 assay inhibited. None of the DNA extracts from
participants engaged in activities like wading, fetching, swimming and pottery were
positive for IS2404 target sequence or the other targets sequence.
4.6 Mycobacteria species cultivated from pooled skin suspensions
Out of 80 cultures from the pooled samples, 27 (34%) were heavily contaminated
with fungi growth and were discarded after the 11th week of cultivations. A total of
32 (40%) cultures had no visible growth on Löwenstein Jensen (LJ) whereas 15
(19%) of the cultures were slightly contaminated after 15 weeks of cultivations. Only
six (7%) cultures exhibited buff to yellow or red colonies after 11 weeks of
cultivation. These cultures were observed from pooled suspensions from two
endemic (Pakro and Dago) and non-endemic communities (Obosono and
Boahenekrom).
One out of the ten pooled samples (C2) had the observed growth from Pakro whereas
from Dago, two out of the ten pooled samples (A1 and A4) observed the recorded
growth. Obosono also had two of its pooled samples (3B and 3G) recording yellow
colonies after 11 weeks of cultivations. A pooled sample (1B) from Boahenekrom
recorded the observed red colonies and was seen in culture as early as the third week
of cultivation. Pooled sample (2E) from Okomfo also recorded a small yellow colony
at the fourth week of cultivation but was lost to contamination.
University of Ghana http://ugspace.ug.edu.gh
![Page 65: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/65.jpg)
53
All the six cultures exhibiting colonies were acid fast bacilli but negative for TaqMan
real time PCR targeting IS2404 multiplex with internal positive control and the other
TaqMan assays targeting IS2606 and KR.
Figure 4.3 Mycobacteria colonies harvested after 11 weeks of cultivation.
The Black arrow indicates the position of the mycobacteria colonies on Löwenstein Jensen media. (A)
Yellow colony of mycobacteria from pool C2 (B) Yellow colony of mycobacteria from pool 3G. (C)
Yellow colony of mycobacteria from pool 3B (D) red colonies of mycobacteria from pool 1B.
A B
C D
University of Ghana http://ugspace.ug.edu.gh
![Page 66: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/66.jpg)
54
CHAPTER FIVE
DISCUSSION AND CONCLUSION
5.0 Discussion
Despite the outlined risk factors for contracting BU as revealed in some case control
studies, precisely how M. ulcerans is transmitted from the environment to human
hosts still remains enigmatic. Portaels and colleagues hypothesized direct
transmission of M. ulcerans into human skin from overlying M. ulcerans
contaminated skin surface following entry of the pathogen through an abrasion or
trauma (Portaels et al., 2001). Possible sources of M. ulcerans skin contamination
could occur when there is contact with contaminated water, soil, aquatic plants or
biofilm on aquatic plants where traces of M. uclerans DNA have been documented.
The use of contaminated water such as those from swamps and slow flowing water
(Debacker et al., 2006) or contaminated soil for agricultural purposes have been
considered as risk factors for BU. Examining the skin surfaces of individuals who are
considered at risk for BU for the presence of M. ulcerans would help shed more light
on the hypothesis by Portaels and colleagues and could ultimately contribute towards
efforts to understand the transmission route for M. ulcerans.
Skin swabs were taken from participants from four BU endemic and non- endemic
communities within Akwapim South, Akwapim North and Nsawam/Adoagyiri
municipalities. DNA was extracted from skin suspensions from participants using two
different DNA extraction methods. While none of the DNA extracted from the pooled
skin suspensions using Modified Boom method was positive for the TaqMan
IS2404/IPC multiplex real time PCR assay targeting IS2404, three pools (3/80) were
University of Ghana http://ugspace.ug.edu.gh
![Page 67: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/67.jpg)
55
positive for that target sequence using DNA extracts from power soil DNA isolation
kit. Incorporation of the internal positive control (IPC) in the multiplex assay was to
monitor the presence of inhibitors that could be present in the sample and inhibits the
activity of the DNA polymerase. None of the pooled DNA extracts from both
methods were inhibited in TaqMan IS2404/IPC multiplex real time PCR assay thus
the low number of IS2404 target sequence detected from the pooled samples was a
true reflection from the samples and not as a result of presence of inhibitors in the
samples. Though the discrepancy from the two extraction methods in detecting the
target DNA was not exploited in this study, it could be attributed to the elaborate cell
lysis as well as stringent purification steps incorporated in the kit‟ protocol. All the
three pooled IS2404 positives were from Okomfo and Obosono which were classified
as BU non- endemic communities.
Unlike clinical samples where detection of IS2404 positive in PCR assays is
confirmatory for the presence of M. ulcerans DNA (Phillips et al., 2005), detecting
the multi copy IS2404 of M. ulcerans DNA from environmental samples is not
confirmatory as this target is not specific to M. ulcerans DNA alone (Yip et al.,
2007). The use of additional targets and internal probes are steps taken to increase the
confidence in the interpretation of PCR positive tests for environmental samples (Fyfe
et al., 2007). Pools positive for IS2404 target sequence were further tested with the
TaqMan real time multiplex PCR assay targeting IS2606 and KR.
All pools negative for IS2404 target were not tested for the presence of these targets.
The three pools were positive for KR but only one (2E) was positive for IS2606 target
sequence as well. There were inhibitions in the assays targeting IS2606 sequence for
the other two pools. The same DNA extracts from pool 3C and 3D used for the first
University of Ghana http://ugspace.ug.edu.gh
![Page 68: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/68.jpg)
56
TaqMan IS2404/IPC multiplex real time PCR assay were as well used for the second
TaqMan multiplex assay. None of these pools were initially inhibited in TaqMan
IS2404/IPC assay indicating that the inhibition observed for the assay targeting
IS2606 could not be the presence of inhibitors but could explain the less sensitive
nature of that assay (Fyfe et al., 2007). The presence of these targets in the pooled
DNA extracts is only indicative of genetic material from mycolactone producing
mycobacteria (MPM) which also includes M. ulcerans (Fyfe et al., 2007). These
targets have different copy numbers in both genomes of M. ulcerans and other MPM.
This difference has been exploited in real time PCR assays to distinguish the
occurrence of M. ulcerans genetic element from the other MPM which is as a result of
the inherent ability of real time PCR assay to detect the relative differences in the
copy numbers of IS2404, IS2606, and KR in any given sample. Estimated copy
number ratio of IS2404-to-IS2606 from the M. ulcerans reference strain Agy99
sequence is 2.3:1 (Stinear et al., 2007). A comparable value of 2.37 (2.17 to 2.79) for
the median change in Ct values between IS2606 and IS2404 (∆Ct, IS2606- IS2404)
was achieved by Fyfe and colleagues after detecting these targets from DNA extracts
using clinical and environmental samples spiked with M. ulcerans isolate (Fyfe et al.,
2007). Similar work using DNA extracts spiked with other MPM isolates revealed
higher value of 7.60 (6.94 to 8.07) for the median Ct values between IS2606 and
IS2404 (Fyfe et al., 2007). This difference in ∆Ct for IS2606 and IS2404 has served
as a discriminatory tool in real time PCR assays to differentiate the occurrence of
genetic elements of M. ulcerans from other MPM. The difference in median ∆Ct
values for the presence of M. ulcerans genetic element and other MPM is as result of
fewer copies of IS2606 relative to IS2404 for the other members of MPM (Fyfe et al.,
2007). The change in mean Ct values between IS2606 and IS2404 (∆Ct, IS2606-
University of Ghana http://ugspace.ug.edu.gh
![Page 69: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/69.jpg)
57
IS2404) for 2E pool was 2.98 (34. 42-31.44) which could indicate the presence of M.
ulcerans DNA rather than from other MPM. The mean Ct values for the other two
pools (3C and 3D) were not calculated as results of the inhibition observed in their
IS2606 assay.
Corresponding culture results for the pools that were positive for any of the three
targets sequence exhibited no mycobacteria colonies after 15 weeks of cultivation.
The culture for pool 2E which had tiny yellow colonies growing after the fourth week
of incubation was lost to contamination. Only six cultures (6/80) from pools from
Dago (A1 and A4), Pakro (C2), Boahenekrom (1B) and Obosono (3B and 3G)
exhibited buff to yellow or red colonies after 11 weeks of cultivation. None of the
DNA extracts from these isolates were positive for any of the targets tested. This
implies that these isolates do not contain the genetic elements IS2404, IS2606 and
ketoreductase-B domain (KR) which are present in the genome of all MPM.
Therefore, these isolates could not be from M. ulcerans or other MPM. The results
further strengthen the specificity of the TaqMan real time multiplex PCR assays used.
Pools (2E, 3C and 3D) that were positive for any of the three targets were traced to
the individual level. Individual sample within pool 3C positive for IS2404 target
sequence had a mean Ct value of 36.27 which was slightly lower than the group Ct of
38.85. This could indicate that the pooling had little effect in the detection of the
target sequence, thus pools that were negative for the targets sequence were not as a
result of the pooling, rather due to the absence of the target sequence. The difference
in mean Ct value between IS2606 and IS2404 for that sample was 2.34 (38.61-36.27)
(Appendix 5; Table 4) which is an indication of the presence of M. ulcerans DNA.
University of Ghana http://ugspace.ug.edu.gh
![Page 70: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/70.jpg)
58
Individual samples within pool 2E and 3D positive for all three targets had difference
in mean Ct values between IS2606 and IS2404 to be 1.52 ( 39.63-38.11) and 1.58 (
39.35- 37.77) respectively. These values are less than the range values (2.17 to 2.79)
to indicate the presence of M. ulceans DNA (Fyfe et al., 2007). Therefore, only one
out of the total skin suspensions (n= 400) from individuals considered at risk for BU
was positive for the presence of M. ulcerans DNA. This was from a participant from
Obosono, a non- endemic BU community.
Kenu and colleagues recently used Geographic Information System (GIS) to map BU
cases along entire stretch of the Densu river and found an association between BU
cases and wading in the Densu river (Kenu et al., 2014). This finding could imply that
the Densu river, especially where it is heavily contaminated could play a role in the
transmission of BU. About 50% of the recruits from Pakro and Oparekrom had direct
contact with some section of the Densu river in the form of swimming, wading or
fetching from it. Analyses on skin suspensions from these people for the targets
sequences were all negative. Results on skin suspensions from some recruits that were
using some stagnant waters in the communities of Pakro and Oparekrom, were as well
negative for the target sequences. This study did not detect M. ulcerans from the skin
suspensions from all individuals engaged with the Densu river within the selected
three communities of Pakro, Oparekrom and Mangoase.
Majority of the participants in this study were captured under two risk activity
headings: farming and playing. These were recruits returning from farm not wearing
protective cloths (long sleeve and trouser) and shoe or were playing in the soil in their
respective community and had visible soil contamination on their skin surface.
Analyses on the skin suspensions from these groups of people within the selected
University of Ghana http://ugspace.ug.edu.gh
![Page 71: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/71.jpg)
59
endemic communities and non-endemic communities except for Okomfo and
Obosono were all negative for the targeted sequences. Two individuals from Okomfo
and Obosono who were farming without protective clothing were positive for all three
targets but only one had difference in Ct value between IS2606 and IS2404 to be
indicative of the presence of M. ulerans DNA. This links the occurrence of the only
M. ulcerans DNA detected to the risk factor “farming without protective clothes and
shoe”. This could emphasize the protective effect of wearing long sleeves to farm
against contraction of BU (Kenu et al., 2014).
Skin suspension from a toddler at Obosono captured under crawling was positive for
all the targets but had difference in Ct value between IS2606 and IS2404 not
indicative of presence of M. ulcerans DNA. Another toddler and a child from Okomfo
captured under crawling and playing respectively were only positive for IS2404 and
KR target sequences.
Several case control studies have established an association between M. ulcerans
infection and age. Children less than 15 years are disproportionately affected
(Jacobsen and Padgett, 2010; Sopoh et al., 2007; Debacker et al., 2006; Phanzu et al.,
2006). Majority of the participants were less than 16 years of age (46.8%, Table 4.1).
However the participant whose sample turned positive for M. ulcerans DNA was 32
years.
University of Ghana http://ugspace.ug.edu.gh
![Page 72: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/72.jpg)
60
5.1 Conclusion
M. ulcerans DNA was detected on the skin surface of a farmer supporting the
hypothesis that skin contamination may be important in BU transmission. It further
supports the case control studies establishing association between BU with absence of
protective clothing during farming. Detection of M. ulcerans in a non-endemic area
also supports the findings of Williamson et al. (2008), that M. ulcerans is present in
the environment of endemic and non -endemic areas.
University of Ghana http://ugspace.ug.edu.gh
![Page 73: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/73.jpg)
61
REFERENCES
Ablordey, A., Amissah, D. A., Aboagye, I. F., Hatano, B., Sata, T., Ishikawa, K. and
Katano, H. (2012). Detection of Mycobacterium ulcerans by the loop mediated
isothermal amplification method. Public Library of Science Neglected Tropical
Diseases 6(4), e1590. doi:10.1371/journal.pntd.0001590.
Ackumey, M. M., Kwakye-Maclean, C., Ampadu, E. O., de Savigny, D., and Weiss,
M. G. (2011). Health services for Buruli ulcer control: lessons from a field study in
Ghana. Public Library of Science Neglected Tropical Diseases, 5(6), e1187. doi:
10.1371/journal.pntd.0001187.
Adusumilli, S., Mve-Obiang, A., Sparer, T., Meyers, W., Hayman, J. and Small, P. L.
(2005). Mycobacterium ulcerans toxic macrolide, mycolactone modulates the host
immune response and cellular location of M. ulcerans in vitro and in vivo. Cellular
Microbiology, l7, 1295–304.
Aiga, H., Amano, T., Cairncross, S., Adomako, J., Nanas, O. K. and Coleman, S.
(2004). Assessing water-related risk factors for Buruli ulcer: a case–control study in
Ghana. American Journal of Tropical Medicine and Hygiene, 71, 387-92.
Amofah, G. K., Sagoe-Moses, C., Adjei-Acquah, C., and Frimpong, E. H. (1993).
Epidemiology of Buruli ulcer in Amansie West district, Ghana. Transactions of the
Royal Society of Tropical Medicine and Hygiene, 87(6), 644-645.
Amofah, G., Bonsu, F., Tetteh, C., Okrah, J., Asamoa, K., Asiedu, K., and Addy, J.
(2002). Buruli ulcer in Ghana: results of a national case search. Emerging Infectious
Diseases, 8(2), 167-170.
Asiedu K., Sherpbier, R. and Raviglione, M. C. (2000). Buruli Ulcer: Mycobacterium
ulcerans infection. W.H.O. Global Buruli Ulcer initiative Report.
Asiedu, K. and Etuaful, S. (1998). Socioeconomic implications of Buruli ulcer in
Ghana: a three-year review. American Journal of Tropical Medicine and Hygiene, 59,
1015-1022.
Baess, I. and Mansa, B. (1978). Determination of genome size and base ratio on
deoxyribonucleic acid from mycobacteria. Acta pathologica, microbiologica, et
immunologica Scandinavica. Section B, 86:309-312.
Barker, D. J. (1973). Epidemiology of Mycobacterium ulcerans infection.
Transactions of the Royal Society of Tropical Medicine and Hygiene, 67(1), 43-50.
Bayley, A. C. (1971). Buruli ulcer in Ghana. British Medical Journal, 2(5758), 401-
402.
Bertolotti, A., Izzo, A., Grigolato, P.G. and Iabichella, M. L. (2013). The use of ozone
therapy in Buruli ulcer had an excellent outcome. British Medical Journal Case
report.
University of Ghana http://ugspace.ug.edu.gh
![Page 74: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/74.jpg)
62
Boleira , M., Lupi, O., Lehman, L., Asiedu, K.B. and Kiszewski, A. E. (2010). Buruli
ulcer. An Bras Dermatol, 85(3), 281-301.
Brennan, P.J. and Nikaido, H. (1995). The envelope of mycobacteria. Annual Review
of Biochemistry, 64, 29-63.
Chemlal K, Huys G, Fonteyne, P.A, Vincent, V., Lopez, A.G., Rigouts, L., Swings, J.,
Meyers, W.M. and Portaels, F. (2001). Evaluation of PCR-restriction profile analysis
and IS2404 restriction fragment length polymorphism and amplified fragment length
polymorphism finger printing for identification and typing of Mycobacterium
ulcerans and Mycobacterium marinum. Journal of Clinical Microbiology, 39, 3272-
3278.
Coutanceau, E., Decalf, J., Martino, A., Babon, A., Winter, N., Cole, S.T., Albert,
M.L. and Demangel, C. (2007). Selective suppression of dendritic cell functions by
Mycobacterium ulcerans toxin mycolactone. Journal of Experimental Medicine, 204,
1395–1403.
Coutanceau, E., Marsollier, L., Brosch, R., Perret, E., Goossens, P., Tanguy, M., Cole,
S.T., Small, P.L. and Demangel, C. (2005). Modulation of the host immune response
by a transient intracellular stage of Mycobacterium ulcerans: the contribution of
endogenous mycolactone toxin. Cellular Microbiology, 7, 1187–1196.
Cowan, R., Athan, E., Friedman, N. D., Hughes, A. J., McDonald, A., Callan, P.,
Fyfe, J., and O‟Brien, D. P. (2015). Mycobacterium ulcerans Treatment –Can
Antibiotic Duration Be Reduced in Selected Patients?. PLOS Neglected Tropical
Diseases 9(2), e0003503. doi:10.1371/journal. pntd.0003503.
Dai, J., Chen, Y. and Lauzardo, M. (2011). Web-accessible database of hsp65
sequences from Mycobacterium reference strains. Journal of Clinical Microbiology,
49, 2296-2303.
Dawson, D. J. (2000). Mycobacterial terminology. Journal of Clinical Microbiology,
38, 3913.
Debacker M., Aguiar J., Steunou C., Zinsou C., Meyers, W. M. , Scott, J. T.,
Dramaix, M. and Portaels, F. (2004). Mycobacterium ulcerans disease: role of age
and gender in incidence and morbidity. Tropical Medicine and International Health,
9(12), 129.
Debacker, M., Portaels, F., Aguiar, J., Steunou, C., Zinsou, C., Meyers, W. and
Dramaix, M. (2006). Risk Factors for Buruli Ulcer, Benin. Emerging Infectious
Diseases Journal 12(9), 1325-31.
Debacker, M., Zinsou, C., Aguiar, J., Meyers, W. M. and Portaels, F. (2003). First
case of Mycobacterium ulcerans disease (Buruli Ulcer) that followed a human bite.
Clinical Infectious Diseases, 36, e67-8.
Duker, A. A., Portaels, F. and Hale, M. (2006). Pathways of Mycobacterium ulcerans
infection: a review. Environment International, 32, 567–73.
University of Ghana http://ugspace.ug.edu.gh
![Page 75: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/75.jpg)
63
Durnez, L., Stragier, P., Roebben, K., Ablordey, A., Leirs, H. and Portaels, F. (2009).
A comparison of DNA extraction procedures for the detection of Mycobacterium
ulcerans, the causative agent of Buruli ulcer, in clinical and environmental specimens.
Journal of Microbiological Methods, 76, 152-158.
Eddyani, M., Ofori-Adjei, D., Teugels, G., De Weirdt, D., Boakye, D., Meyers, W.
and Portaels, F. (2004). Potential role for fish in transmission of Mycobacterium
ulcerans disease (Buruli ulcer): an environmental study. Applied and Environmental
Microbiology, 70, 5679–5681.
Ezzedine, K., Pistone, T., Cottin, J., Marsollier, L., Guir, V. and Malvy, D. (2009).
Buruli ulcer in long-term traveler to Senegal. Emerging Infectious Diseases, 15, 118.
Falkinham, O. J. (2009). The biology of environmental mycobacteria. Environmental
Microbiology Reports, 1(6), 477–487.
Fyfe, J. A. M., Lavender, C. J., Johnson, P. D. R., Globan, M., Sievers, A., Azuolas,
J., and Stinear, T. P. (2007). Development and Application of Two Multiplex Real-
Time PCR Assays for the Detection of Mycobacterium ulcerans in Clinical and
Environmental Samples. Journal of Applied and Environmental microbiology, 4733–
4740.
Gangadharam, P. R. J. and Jenkins, P. A. (1998). Mycobacteria. I. Basic Aspects.
New York, NY: Chapman & Hall.
George, K. M., Chatterjee, D., Gunawardana, G., Welty, D., Hayman, J., Lee, R. and
Small, P. L. (1999). Mycolactone: a polyketide toxin from Mycobacterium ulcerans
required for virulence. Science, 283, 854–857.
Grange, J. M. (1996). The biology of the genus Mycobacterium. Society for Applied
Bacteriology Symposium Series Journal, 25, 1S-9S.
Guarner, J., Bartlett, J., Whitney, E. A. S., Raghunathan , P. L., Stienstra, Y.,
Asamoa, K., Etuaful, S., Klutse, E., Quarshie, E., van der Werf, S.T., van der Graaf,
W. A. T., Harold King, C. and. Ashford, D. A. (2003). Histopathologic Features of
Mycobacterium ulcerans Infection. Emerging Infectious Diseases, 9(6), 651-656.
Guenin-Mace, L., Veyron-Churlet, R., Thoulouze, M.I., Romet-Lemonne, G., Hong,
H., Leadlay, P. F., Danckaert, A., Ruf, M.T., Mostowy, S., Zurzolo, C., Bousso, P.,
Chrétien, F., Marie-France, C. and Demangel, C. (2013). Mycolactone activation of
Wiskott–Aldrich syndrome proteins underpins Buruli ulcer formation. Journal of
Clinical Investigation, 123, 1501–151.
Hall, B and Simmonds, R. (2014). Pleiotropic molecular effects of the Mycobacterium
ulcerans virulence factor mycolactone underlying the cell death and
immunosuppression seen in Buruli ulcer. Biochemical Society Transactions, 42, 177–
183.
Heathcote, M. L., Staunton, J. and Leadlay, P. F. (2001). Chemical Biology, 8, 207–
220.
University of Ghana http://ugspace.ug.edu.gh
![Page 76: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/76.jpg)
64
Herbinger, K. H., Adjei, O., Awua-Boateng. N. Y., Nienhuis, W. A., and Kunaa,. L.
(2009). Comparative study of the sensitivity of different diagnostic methods for the
laboratory diagnosis of Buruli ulcer disease. Clinical Infection Disease., 48, 1055–
1064.
Hong, H., Demangel, C., Pidot, S. J., Leadlay, P. F., and Stinear, T. (2008).
Mycolactones: immunosuppressive and cytotoxic polyketides produced by aquatic
mycobacteria. Natural Product Reports, 25, 447–454.
Hong, H., Stinear, T., Porter, J., Demangel, C. and Leadlay, P. F. (2007). A novel
mycolactone toxin obtained by biosynthetic engineering. Journal of Chemical
Biology, Synthetic Biology, and Bio-Nanotechnology, 8, 2043–2047.
Horsburgh, C. R .Jr., and Meyers, W. M. (1997). Buruli Ulcer. In:Horsburgh CR
Jr.,Nelson AM, eds. Pathology of Emerging Infections. Washington, D.C. American
Society for Microbiology, 119–126.
Jacobsen, K. H. and Padgett, J. J (2010). Risk factors for Mycobacterium ulcerans
infection. International Journal of Infectious Diseases 14, e677–e681.
Johnson, P. D. R., Azuolas, J., Lavender, C. J., Wishart, E. and Stinear, T. P. (2007).
Mycobacterium ulcerans in mosquitoes captured during an outbreak of Buruli ulcer,
southeastern Australia. Emerging Infectious Diseases Journal, 13, 1653–1660.
Johnson, P. D. R., Stinear, T. P, Small, P. L. C, Pluschke, G., Merritt, R. W., Portaels,
F., Huygen, K., Hayman, J. A. and Asiedu, K. (2005). Buruli ulcer (M. ulcerans
Infection): new insights, new hope for disease control. Public Library of Science
Medicine 2(4), e108.
Kenu, E., Ganu, V., Calys-Tagoe, N. L. B., Yiran, A. B. G., Lartey, M. and Richard,
A. (2014). Application of geographical information system (GIS) technology in the
control of Buruli ulcer in Ghana. BioMed Central Public Health, 14, 724.
Kibadi K., Mputu-Yamba, J. B., Mokassa, B., Panda, M., and Muyembe-Tamfum, J.
J. (2009). [Relapse after surgical treatment of Mycobacterium ulcerans infection
(buruli ulcer): study of risk factors in 84 patients in the Democratic Republic of the
Congo]. Medecine Tropicale (Mars) 69, 471–474.
Levy-Frebault, V. V. and Portael, F. (1992). Proposed Minimal Standards for the
Genus Mycobacterium and for Description of New Slowly Growing Mycobacterium
Species. International Journal of Systematic Bacteriology, 42(2), 315-323.
Marion E., Carolan, K., Adeye, A., Kemp, M. and Chauty, A. (2015). Buruli Ulcer in
South Western Nigeria: A Retrospective Cohort Study of Patients Treated in Benin.
Public Library of Science Neglected Tropical Diseases, 9(1), 3443.
Marsollier, L., Aubry, J., Coutanceau, E., Andre, J. P. S., Small, P. L., Milon, G.,
Legras, P., Guadagnini, S., Carbonnelle, S. and Cole, S. T. (2005). Colonization of the
salivary glands of Naucoris cimicoides by Mycobacterium ulcerans requires host
University of Ghana http://ugspace.ug.edu.gh
![Page 77: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/77.jpg)
65
plasmatocytes and a macrolide toxin, mycolactone. Cellular Microbiology 7, 935–
943.
Marsollier, L., Severin, T., Aubry, J., Merritt, R., Saint Andre, J., Legras, P.,
Manceau, A., Chauty, A., Carbonnelle, B. and Cole, S. (2004b). Aquatic snails,
passive hosts of Mycobacterium ulcerans. Applied and Environmental Microbiology,
70, 6296– 6298.
Marsollier, L., Stinear, T. Aubry, J., Saint Andre, J., Robert, R., Legras, P., Manceau,
A., Audrain, C., Bourdon, S., Kouakou, H. and Carbonnelle, B. (2004a). Aquatic
plants stimulate the growth of and biofilm formation by Mycobacterium ulcerans in
axenic culture and harbor these bacteria in the environment. Applied and
Environmental Microbiology, 70, 1097–1103.
Marston B. J., Diallo MO, Horsburgh, C. R. Jr., Diomande, I, Saki, M. Z., Kanga, J.
M., Patrice, G., Lipman, H. B., Ostroff, S. M. and Good, R. C. (1995). Emergence of
Buruli ulcer disease in the Daloa region of Cote D‟ivoire. American Journal of
Tropical Medicine and Hygiene, 52, 219–224.
Merritt, R. W., Walker, E. D., Small, P. L. C., Wallace, J. R., Johnson, P. D. R.,
Benbow, M. E. and Boakye, D. (2010). Ecology and Transmission of Buruli Ulcer
Disease: A Systematic Review. Public Library of Science Neglected Tropical
Diseases, 4(12), e911. doi:10.1371/journal.pntd.0000911.
Mve-Obiang, A., Lee, R. E,Portaels, F and Small P. L. C. (2003). Heterogeneity of
Mycolactones Produced by Clinical Isolates of Mycobacterium ulcerans: Implications
for Virulence. Infection and Immunity, 71 (2) : 774–783.
O‟Brien, D. P., Hughes, A. J., Cheng, A. C., Henry, M. J., Callan, P., McDonald, A.,
Holten, I., Birrell, M., Sowerby, J. M., Johnson, P. D. R. and Athan, E. (2007).
Outcomes for Mycobacterium ulcerans infection with combined surgery and
antibiotic therapy: findings from a south-eastern Australian case series. Medical
Journal of Australia, 186, 58-61.
O‟Brien, D. P., Robson, M., Friedman, N. D., Walton, A., McDonald, A., Callan, P.,
Hughes, A., Rahdon, R., and Athan, E. (2013). Incidence, clinical spectrum,
diagnostic features, treatment and predictors of paradoxical reactions during antibiotic
treatment of Mycobacterium ulcerans infections. BioMed Central Infectious Diseases,
13: 416.
Palomino, J. C. and Portaels, F. (1998). Effects of Decontamination Methods and
Culture Conditions on Viability of Mycobacterium ulcerans in the BACTEC System.
Journal of Clinical Microbiology, 36(2), 402–408.
Palomino, J. C., Obiang, A. M., Realini, L., Meyers, W. M., and Portaels, F. (1998).
Effect of oxygen on growth of Mycobacterium ulcerans in the BACTEC system.
Journal of Clinical Microbiology, 36, 3420–3422.
Peeters Grietens, K., Boock, A., Peeters, H., Hausmann-Muela, S., Toomer, E., and
Muela Ribera, J. (2008). „„It Is Me Who Endures but My Family That Suffers‟‟:
University of Ghana http://ugspace.ug.edu.gh
![Page 78: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/78.jpg)
66
Social Isolation as a Consequence of the Household Cost Burden of Buruli Ulcer Free
of Charge Hospital Treatment. Public Library of Science Neglected Tropical Diseases
2, e321.doi: 10.1371/ journal.pntd.0000321.
Phanzu, D. M., Bafende, E. A., Dunda, B. K., Imposo, D. B., Kibadi, A. K.,
Nsiangana, S., Singa, J., Meyers, W. M., Suykerbuyk, P.and Portaels, F. (2006)
Mycobacterium ulcerans disease (Buruli Ulcer) in a rural hospital in Bas-
Congo,Democratic Republic of Congo, 2002-2004. American Journal Tropical
Medicine and Hygiene, 75, 311–314.
Phillips, R.., Horsfield, C., Kuijper, S., Lartey, A., Tetteh, I., Etuaful, S., Nyamekye,
B,. Awuah, P., Nyarko, K. M., Osei-Sarpong, F., Lucas, S., Kolk, A. H. and
Wansbrough-Jones, M. (2005). Sensitivity of PCR targeting the IS2404 insertion
sequence of Mycobacterium ulcerans in an assay using punch biopsy specimens for
diagnosis of Buruli ulcer. Journal of Clinical Microbiology, 43, 3650–3656.
Portaels, F., Chemlal, K., Elsen, P., Johnson, J.A., Hayman, J., Hibble, R., Kirkwood
R. and Meyers, W. M. (2001). Mycobacterium ulcerans in wild animals. Revue
scientifique et technique, 20(1), 252–64.
Portaels, F., De Muynck, L. A. and Sylla, M. P. (1988). Selective Isolation of
Mycobacteria from Soil: a Statistical Analysis Approach. Journal of General
Microbiology, 134, 849-855.
Portaels, F., Elsen, A., Guimaraes-Peres, P., Fonteyne, P. and Meyers, W. (1999).
Insects in the transmission of Mycobacterium ulcerans infection. Lancet, 353, 986.
Portaels, F., Meyers, W. M., Ablordey, A., Castro, A. G., Chemlal, K., de Rijk, P. and
Pedrosa, J. (2008). First cultivation and characterization of Mycobacterium ulcerans
from the environment. Public Library of Science Neglected Tropical Diseases, 2(3),
e178. doi: 10.1371/journal.pntd.0000178.
Pouillot, R., Matias, G., Wondje, C. M., Portaels, F., Valin, N., Ngos, F. and
Eyangoh, S. (2007). Risk factors for buruli ulcer: a case control study in Cameroon.
Public Library of Science Neglected Tropical Diseases (3), e101. doi:
10.1371/journal.pntd.0000101.
Primm, T. P., Lucero, C. A and Falkinham, J. O. (2004). Health Impacts of
Environmental Mycobacteria. Clinical Microbiology Reviews, 98–106.
Quek, T. Y .J., Athan, E., Henry, M. J., Pasco, J. A., Redden-Hoare, J., Hughes, A.,
and Johnson, P. D. (2007). Risk factors for Mycobacterium ulcerans infection,
Southeastern Australia. Emerging Infectious Diseases Journal 13, 1661–1666.
Raghunathan, P. L., Whitney, E. A., Asamoa, K., Stienstra, Y., Taylor, Jr T. H.,
Amofah, G. K., Ofori-Adjei, D., Dobos, K., Guarner, J., Martin, S., Pathak, S., Klutse,
E., Etuaful, S., van der Graaf, W. T., van der Werf, T. S., King, C. H., Tappero, J. W.
and Ashford D. A. (2005). Risk factors for Buruli ulcer disease (Mycobacterium
ulcerans infection): results from a case–control study in Ghana. Clinical Infectious
Diseases, 40, 1445–53.
University of Ghana http://ugspace.ug.edu.gh
![Page 79: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/79.jpg)
67
Ravensway, J. V., Benbow, M. E., Tsonis, A. A., Pierce, S. J., Campbell, L. P.,
Fyfe, J. A., Hayman, J. A., Johnson, P. D., Wallace, J. R., and Qi, J. (2012). “Climate
and landscape factors associated with Buruli ulcer incidence in victoria, Australia,”
Public Library of Science ONE, Article IDe51074.
Reynaud, Y., Millet, J., Couvin, D., Rastogi, N., Brown, C., Couppié , P., Legrand, E.
(2015). Heterogeneity Among Mycobacterium ulcerans from French Guiana
Revealed by Multilocus Variable Number Tandem Repeat Analysis (MLVA). Public
Library of Science ONE 10(2), e0118597. doi:10.1371/journal.pone.0118597.
Roltegen, K., Stinear, T. and Pluschkle, G. (2012). The genome, evolution and
diversity of Mycobacterium ulcerans. Infection, Genetics and Evolution, 12:522- 529.
Ross, B., Johnson, P., Oppedisano, F., Marino, L., Sievers, A., Stinear, T., Hayman,
J., Veitch, M., and Robins-Browne, R. (1997). Detection of Mycobacterium ulcerans
in environmental samples during an outbreak of ulcerative disease. Applied and
Environmental Microbiology, 63, 4135–4138.
Schulze-Robbecke, R. and Buchholtz, K. (1992). Heat susceptibility of aquatic
mycobacteria. Journal of Applied and Environmental Microbiology, 58, 1869–1873.
Semret, M., Koromihis, G., MacLean, J. D., Libman, M., and Ward, B. J. (1999).
Mycobacterium ulcerans infection (Buruli ulcer): first reported case in a traveler.
American Journal of Tropical Medicine and Hygiene 61, 689–693.
Silva, M. T., Portaels, F. and Pedrosa, J. (2009). Pathogenetic mechanisms of the
intracellular parasite Mycobacterium ulcerans leading to Buruli ulcer. Lancet
Infectious Diseases 9, 699–710.
Simmonds, R. E., Lali, F. V., Smallie, T., Small, P. L. and Foxwell, B. M. (2009).
Mycolactone inhibits monocyte cytokine production by a post transcriptional
mechanism. Journal of Immunology, 182, 2194–2202.
Sizaire, V., Nackers, F., Comte, E., and Portaels, F. (2006). Mycobacterium ulcerans
infection: control, diagnosis, and treatment. Lancet Infectious Diseases, 6, 288–96.
Smeulders, M. J., Keer, J., Speight, R. A. and Williams, H. D. (1999). Adaptation of
Mycobacterium smegmatis to stationary phase. Journal of Bacteriology, 181, 270–
283.
Sopoh, G. E, Johnson, R. C., Chauty, A., Dossou, A. D., Aguiar, J., Salmon, O.,
Portaels, F. and Asiedu, K. (2007). Buruli ulcer surveillance, Benin, 2003-2005.
Emerging Infectious Diseases;13, 1374–6.
Stienstra, Y., van der Werf, T.S., van der Graaf, W.T., Secor, W. E., Kihlstrom, S. L.,
and Dobos, K. M., (2004). Buruli ulcer and schistosomiasis: no association found.
American Journal of Tropical Medicine and Hygiene, 71, 318:21.
Stinear, T. P., Jenkin, G. A., Johnson, P. D. R. and Davies, J. K. (2000b).
Comparative genetic analysis of Mycobacterium ulcerans and Mycobacterium
University of Ghana http://ugspace.ug.edu.gh
![Page 80: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/80.jpg)
68
marinum reveals evidence of recent divergence. Journal of Bacteriology, 182, 6322–
6330.
Stinear, T. P., Mve-Obiang, A., Small, P. L., Frigui, W., Pryor, M. J., Brosch, R.,
Jenkin, G. A., Johnson, P. D., Davies, J. K., and Lee, R. E. (2004). Giant plasmid
encodedpolyketide synthases produce the macrolide toxin of Mycobacterium
ulcerans. Proceedings of the National Academy of Sciences, 101(5), 1345–1349.
Stinear, T. P., Pryor, M. J., Porter, J. L. and Cole, S. T. (2005). Functional analysis
and annotation of the virulence plasmid pMUM001 from Mycobacterium ulcerans.
Microbiology, 151, 683–692.
Stinear, T., Davies, J., Jenkin, G., Hayman, J., Oppedisano, F. and Johnson, P.
(2000a). Identification of Mycobacterium ulcerans in the environment from regions in
Southeast Australia in which it is endemic with sequence capture-PCR. Applied and
Environmental Microbiology, 66, 3206–3212.
Stinear, T., Ross, B., Davies, J., Marino, L., Robins-Browne, R., Oppedisano, F.,
Sievers, A. and Johnson, P. (1999). Identification and characterization of IS2404 and
IS2606: two distinct repeated sequences for detection of Mycobacterium ulcerans by
PCR. Journal of Clinical Microbiology, 37, 1018–1023.
Stinear, T., Seemann, T., Pidot, S., Frigui, W., Reysset, G., Garnier, T., Meurice, G.,
Simon, D., Bouchier, C., Ma, L., Tichit, M., Porter, J., Ryan, J., Johnson, P., Davies,
J., Jenkin, G., Small, P., Jones, L., Laval, T. F., F., Daffe´, M., Parkhill, J. and Cole.
S. (2007). Reductive evolution and niche-adaptation inferred from the genome of
Mycobacterium ulcerans, the causative agent of Buruli ulcer. Genome Research,
17:192–200.
Swart, C. C., Deaton, L. E. and Felgenhauer, B. E. (2006). The salivary gland and
salivary enzymes of the giant water bugs (Heteroptera; Belostomatidae). Comparative
Biochemistry and Physiology, 145, 114–122.
Torrado, E., Fraga, A. G., Castro, A.G., Stragier, P., Meyers, W. M., Portaels, F.,
Silva, M. T. and Pedrosa, J. (2007). Evidence for an intramacrophage growth phase of
Mycobacterium ulcerans. Infection and Immunity, 75 :977–987.
van der Werf, T. S., van der Graaf, W. T., Groothuis, D. G., and Knell, A. J. (1989).
Mycobacterium ulcerans infection in Ashanti region, Ghana. Transactions of the
Royal Society of Tropical Medicine and Hygiene, 83(3), 410-413.
Veitch, M. G. K., Johnson, P. D. R., Flood, P. E., Leslie, D., Street, A. C. and
Hayman, J. A. (1997). A large localized outbreak of Mycobacterium ulcerans
infection on a temperate southern Australian island. Journal of Epidemiology and
Infection 119, 313–318.
Wagner, T., Benbow, M. E., Brenden, T. O., Qi, J. and Johnson, R. C, (2008). Buruli
ulcer disease prevalence in Benin, West Africa: associations with land use/cover and
the identification of disease clusters. International Journal of Health Geographics,
27, 7-25.
University of Ghana http://ugspace.ug.edu.gh
![Page 81: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/81.jpg)
69
Walsh, D. S., Portaels, F., and Meyers, W. M. (2008). Buruli ulcer (Mycobacterium
ulcerans infection). Transactions of the Royal Society of Tropical Medicine and
Hygiene 102(10), 969-978. doi: S0035-9203(08)00265-4 [pii]
10.1016/j.trstmh.2008.06.006.
Williamson, H. R, Benbow, M. E, Nguyen, K. D, Beachboard, D. C, Kimbirauskas,
R. K, Mollie D. McIntosh, M. A., Quaye, C., Ampadu, E. O., Boakye, D., Merritt, R.
W. and Small, P. L. C. (2008). Distribution of Mycobacterium ulcerans in Buruli
Ulcer Endemic and Non-Endemic Aquatic Sites in Ghana. Public Library of Science
Neglected Tropical Diseases 2(3), e205. doi:10.1371/journal.pntd.0000205.
Williamson, H. R., Mosi, L., Donnell, R., Aqqad, M., Merritt., R. W., and Small, P. L.
C. (2014). Mycobacterium ulcerans Fails to Infect through Skin Abrasions in a
Guinea Pig Infection Model: Implications for Transmission. Public Library of Science
Neglected Tropical Diseases 8(4), e2770. doi:10.1371/journal.pntd.0002770.
World Health Organization (1998). Buruli ulcer.
www.who.int/buruli/gbui/en/index.html .
World Health Organization (2007). “Mycobacterium ulcerans infection Fact Sheet
Nu199,”WorldHealthOrganization,http://www.who.int/mediacentre/factsheets/fs199/e
n/.
World Health Organization (2008). Buruli ulcer: progress report, 2004–2008. Weekly
epidemiological record, 83: 145–156.
World Health Organization (2013). Control of neglected tropical disease,
http://www.who.int/buruli/en/ .
World Health Organization (2014). Buruli ulcer: Fact sheet no 199,
http://www.who.int/buruli/en/.
World Health Organization (2015). Incidence, prevalence and mapping of Buruli
ulcer, http://www.who.int/buruli/research/priorities/healthmapping/en/ .
Yip, M., Porter, J.,. Fyfe, J., Lavender, C.,. Portaels, F., Rhodesm, M., Kator, H.,
Colorni, A.,. Jenkin, G. and Stinear, T. (2007). Evolution of Mycobacterium ulcerans
and other mycolactone-producing mycobacteria from a common Mycobacterium
marinum progenitor. Journal of Bacteriology, 189, 2021: 2029.
University of Ghana http://ugspace.ug.edu.gh
![Page 82: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/82.jpg)
70
APPENDICES
Appendix 1
Preparation of Transport Medium
Difco Middlebrook 7H9 broth (4.7g) and 2 ml glycerol was dissolved in 900 ml of
distilled water and autoclaved for 10 minutes at 121°C. Volumes of 5ml were then
dispensed into sterile universal bottles.
University of Ghana http://ugspace.ug.edu.gh
![Page 83: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/83.jpg)
71
Appendix 2
Questionnaire used for sampling
Questionnaire
Questionnaire Number:
Name of community:
Date interviewed:
Informed consent sought: Yes No
Participant Information
Name of participant:
Residential Address:
Phone number:
Age Gender
Educational Status:
Environmental exposure
A. Contact with slow flowing water body
Activities performed
Swimming Fetching wading Others
B. Direct contact with the soil
Activities performed
Playing Crawling Farming others
Occupational exposure
Galamsey Pottery Fishing Others
University of Ghana http://ugspace.ug.edu.gh
![Page 84: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/84.jpg)
72
Appendix 3
Sampling scheme
University of Ghana http://ugspace.ug.edu.gh
![Page 85: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/85.jpg)
73
Appendix 4
Primers and sequences for IS2404, IS2606 and KR Taqman real time PCR
Probes and sequences for IS2404, IS2606 and KR Taqman real time PCR
Primer Sequence (5’-3’)
IS2404 TF AAAGCACCACGCAGCATCT
IS2404 TR AGCGACCCCAGTGGATTG
IS2606 TF CCGTCACAGACCAGGAAGAAG
IS2606 TR TGCTGACGGAGTTGAAAAACC
KR TF TCACGGCCTGCGATATCA
KR TR TTGTGTGGGCACTGAATTGAC
Probe Sequence (5’-3’)
IS2404 TP 6 FAM-CGTCCAACGCGATC-MGBNFQ
IS2606 TP VIC-TGTCGGCCACGCCG-MGBNFQ
KR TP 6 FAM-ACCCCGAAGCACTG-MGBNFQ
University of Ghana http://ugspace.ug.edu.gh
![Page 86: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/86.jpg)
74
Appendix 5
Table 1: Mean Ct values for pooled and individual samples positive for IS2404
target
Table 2: Mean Ct values for pooled samples positive for KR and IS2606
Pool ID KR
Ct value
IS2606
Ct value
Pool 2E 31.1 34.42
Pool 3C 35.85 inhibited
Pool 3D 39.35 inhibited
Pool ID Individual sample IS2404
Ct value
Pool 2E 31.44
OK 21 38.63
Ok 24 38.11
Ok 25 38.42
Pool 3C 38.85
Ob 13 36.27
Pool 3D 37.3
Ob 17 37.77
University of Ghana http://ugspace.ug.edu.gh
![Page 87: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/87.jpg)
75
Table 3: Mean Ct values for KR and IS2606 for individual samples
Table 4: Difference in Ct values between IS2606 and IS2404, ∆Ct(IS2606-IS2404)
for the individual samples positive for any of three targets
Pool ID Individual sample KR
Ct value
IS2606
Ct value
2E OK 21 39.38 inhibited
Ok24 38.26 39.63
OK 25 37.18 inhibited
3C Ob 13 35.52 38. 61
3D Ob 17 39.31 39.35
Pool ID Individual ID IS2404
Ct value
IS2606
Ct value
KR
Ct value
∆Ct(IS2606-
IS2404)
2E OK 21 38.63 inhibited 39.38
Ok24 38.11 39.63 38.26 1.52
OK 25 38.42 inhibited 37.18
3C Ob 13 36.27 38.61 35.52 2.34
3D Ob 17 37.77 39.35 39.31 1.58
University of Ghana http://ugspace.ug.edu.gh
![Page 88: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/88.jpg)
76
Appendix 6
SPSS (version 16.0) read out for the variables endemicity and gender
Case Processing Summary
Cases
Valid Missing Total
N Percent N Percent N Percent
Gender * Endemicity 400 99.0% 4 1.0% 404 100.0%
Gender * Endemicity Crosstabulation
Endemicity
Total
Bu endemic
comm.
Non -endemic
comm.
Gender Males Count 125 99 224
Expected Count 112.0 112.0 224.0
% within Gender 55.8% 44.2% 100.0%
% within Endemicity 62.5% 49.5% 56.0%
% of Total 31.2% 24.8% 56.0%
Residual 13.0 -13.0
Std. Residual 1.2 -1.2
Females Count 75 101 176
Expected Count 88.0 88.0 176.0
% within Gender 42.6% 57.4% 100.0%
% within Endemicity 37.5% 50.5% 44.0%
% of Total 18.8% 25.2% 44.0%
Residual -13.0 13.0
Std. Residual -1.4 1.4
Total Count 200 200 400
Expected Count 200.0 200.0 400.0
% within Gender 50.0% 50.0% 100.0%
% within Endemicity 100.0% 100.0% 100.0%
% of Total 50.0% 50.0% 100.0%
University of Ghana http://ugspace.ug.edu.gh
![Page 89: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/89.jpg)
77
Chi-Square Tests
Value df
Asymp. Sig. (2-
sided)
Exact Sig. (2-
sided)
Exact Sig. (1-
sided)
Pearson Chi-Square 6.859a 1 .009
Continuity Correctionb 6.341 1 .012
Likelihood Ratio 6.880 1 .009
Fisher's Exact Test .012 .006
Linear-by-Linear Association 6.842 1 .009
N of Valid Casesb 400
a. 0 cells (.0%) have expected count less than 5. The minimum expected count is 88.00.
b. Computed only for a 2x2 table
Symmetric Measures
Value Approx. Sig.
Nominal by Nominal Phi .131 .009
Cramer's V .131 .009
N of Valid Cases 400
University of Ghana http://ugspace.ug.edu.gh
![Page 90: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/90.jpg)
78
Appendix 7
SPSS (version 16.0) read out for the variables endemicity and age
Age * Endemicity Crosstabulation
Endemicity
Total
BU endemic
communities
Non endemic
communities
Age <16 years Count 104 83 187
Expected Count 93.5 93.5 187.0
% within Endemicity 52.0% 41.5% 46.8%
Residual 10.5 -10.5
Std. Residual 1.1 -1.1
16-45 years Count 63 70 133
Expected Count 66.5 66.5 133.0
% within Endemicity 31.5% 35.0% 33.2%
Residual -3.5 3.5
Std. Residual -.4 .4
> 45 years Count 33 47 80
Expected Count 40.0 40.0 80.0
% within Endemicity 16.5% 23.5% 20.0%
Residual -7.0 7.0
Std. Residual -1.1 1.1
Total Count 200 200 400
Expected Count 200.0 200.0 400.0
% within Endemicity 100.0% 100.0% 100.0%
University of Ghana http://ugspace.ug.edu.gh
![Page 91: Isaac Prah Examination of Human Skin Surfaces for the ...](https://reader030.fdocuments.us/reader030/viewer/2022040709/624cb8c65935a00ec4247d45/html5/thumbnails/91.jpg)
79
Chi-Square Tests
Value df
Asymp. Sig. (2-
sided)
Pearson Chi-Square 5.177a 2 .075
Likelihood Ratio 5.195 2 .074
Linear-by-Linear Association 5.126 1 .024
N of Valid Cases 400
a. 0 cells (.0%) have expected count less than 5. The minimum
expected count is 40.00.
Symmetric Measures
Value Approx. Sig.
Nominal by Nominal Phi .114 .075
Cramer's V .114 .075
N of Valid Cases 400
University of Ghana http://ugspace.ug.edu.gh