Investigation of the localization and phenotypic effects of the mRNA transport

protein She3 in Candida albicans

Amanda Estes- SMCC, INBRE

Mentor: Dr. Anne McBride- Bowdoin College

August 1, 2014

1

Abstract

The yeast Candida albicans is a normally commensal microorganism that can become a

lethal opportunistic pathogen in individuals with immune deficiencies. The ability to form

hyphal cells contributes to its virulence. Optimal growth and host cell invasion by hyphae

require proteins to be located to its tip or its surface by protein transport or the localized

translation of transported mRNAs. She3 protein has been shown to be part of a complex that

transports mRNAs to the hyphal tip, but its localization in cells has not yet been determined.

This study aimed to determine where She3 can be found in C. albicans cells. Yeast cells were

transformed with DNA created to link the coding region of She3 with a green fluorescent protein

(GFP) gene so that She3 could be visualized in cells with epifluorescence microscopy. Budding

yeast cells exhibited nuclear fluorescence, and expression of a GFP-fusion protein was detected

by immunoblot, however further investigation needs to be done to confirm proper She3-GFP

fusion. In addition, the phenotypic effects of She3 were tested by growing cells of strains with

and without She3 on different media to test for filamentation and lipase production.

Filamentation was affected by She3 while lipase action was not.

Introduction

The diploid microorganism Candida albicans is a commensal fungus that is found in

warm-blooded animals. Although it lives as part of the normal microflora of about 70% of all

humans (Hube, 2004), C. albicans can become an opportunistic pathogen. In relatively healthy

individuals, C. albicans can cause local infections in epithelial tissues while in the

immunocompromised, it can progress to life-threatening systemic infections of the organs and

blood stream (Sudbery, 2011). The ability of Candida cells to change from round budding yeast

to long, thin, hyphal cells in response to environmental cues contributes to its pathogenicity

(Mayer, et al. 2013). Although yeast-form cells may be involved in some initial events of host

cell invasion (Saville, et al. 2003), the filaments of hyphae have unique features such as the

ability to adhere to host cells and invade them through endocytosis, that contribute to virulence

(Zhu and Filler, 2010).

In order to function properly, many proteins that contribute to hyphal growth and

other aspects of the cell’s ability to invade host tissues must be located in the hypha or on its

surface (Elson, et al. 2009). For these proteins to arrive at their target destinations, either the

2

proteins themselves are transported, or they are translated from transported mRNAs (Elson, et al.

2009). C. albicans She3, a protein orthologous to an mRNA transport protein in Saccharomyces

cerevisiae that is important for Swi5p-dependent HO expression, has been shown to transport a

set of mRNAs to the hyphal tip (Elson, et al. 2009). In S. cerevisiae, mRNA is transported from

mother to daughter cell by a complex composed of the RNA binding protein She2 bound to She3

protein which itself is connected to Myo4 (myosin) motor protein (Bohl et al. 2000). She2 is

able to enter the nucleus where it binds to an mRNA and then shuttles it out of the nucleus to join

She3 and Myo4, which then moves along an actin fiber to the new cell (Bohl et al. 2000). The

analogous complex in C. albicans cannot contain either She2 or Myo4 proteins, since the C.

albicans genome encodes no She2 or Myo4 ortholog; instead, mRNAs encoding proteins

necessary for the most effective hyphal growth are likely to bind either directly to She3 or to

another mRNA-binding protein. The resulting complex could be transported to the yeast bud

and hyphal tip by another Type V myosin protein, Myo2, which copurifies with C. albicans She3

(Burnim, 2014). C. albicans is able to form hyphae in the absence of She3; however some

defects seen in hyphal formation of she3∆/∆ cells suggest that She3-dependent mRNA transport

may be important to this process, thus She3 may have an effect on virulence (Elson, et al. 2009).

Previous studies have shown the importance of She3 for proper hyphal growth and for

transport of many mRNAs in C. albicans (Elson, et al. 2009) and have identified some of the

proteins with which She3 associates (Burnim, 2014). Yet, no study has determined where She3

localizes in C. albicans budding or hyphal cells. Does She3 stay in the cytoplasm as it does in S.

cerevisiae, or can it be found in the nucleus? One focus of this study is determining the specific

location of She3 protein in C. albicans cells by tagging She3 with GFPγ so that it may be

visualized with epifluorescent microscopy. GFPγ is a variant of GFP engineered to exhibit a

more intense signal and to be more photostable than other versions (Zhang and Konopka, 2009).

These properties were expected to be helpful in visualization of She3, as the C. albicans cell

itself exhibits a fairly high background signal in fluorescence imaging. In addition, while the

presence of She3 has been observed to be important to proper hyphal formation on certain

filament-inducing media (Elson, et al. 2009), this study sought to observe the effects of SHE3

deletion using similar and previously untested types of media. By growing cells on media and in

environments that mimic filament-inducing conditions within a host (Nadeem, et al. 2013), the

effect that absence of She3 has on filamentous phenotypes was observed. Cells were also tested

3

on media to detect lipase activity, a hyphal function of C. albicans that may be affected by She3

but has yet to be investigated.

Methods and Materials

Creation of DNA to link GFPγ::URA3 to SHE3 DNA products were created to

integrate GFPγ into the C. albicans genome at the SHE3 locus, along with URA3, the gene for

uridine synthesis as the selectable marker. Pairs of short oligonucleotides were designed (Table

1) to amplify the 3’ end of the SHE3 coding region along with a plasmid template containing a

cassette of GFPγ::URA3 (Zhang and Konopka, 2009) and the 3’ SHE3 untranslated region

(Figure 1).

Amplification was performed using Fast Start Taq polymerase (Roche) according to the

manufacturer’s protocol and PCR with conditions chosen based on the success of similar

previous experiments conducted in the McBride lab (Zott, 2014): 94°C for 5 minutes, 94°C for 1

minute, 55°C for 1 minute, 72°C for 4 minutes, cycle back to second step 30 times, then 72°C for

4 minutes and 10°C holding step until removal of PCR products. The products were then

analyzed by gel electrophoresis to insure proper amplification of the cassette to the predicted size

of about 2,500 base pairs.

Table 1. Oligonucleotide primers used in this study

Primer Sequence (5’-3’) Description

AM544 CTAAAAGAAGATCAACCTATAATAACAACAACAACAACAACAGCAAAAGAA ATTCGC

SHE3-GFPγ forward

AM545 GCCTACAATATATAGTTAATTCCTTCATCGTTATCCATTTTTTTAAAAAAAAAC

TAACGTGTA

SHE3-GFPγ

reverse

Figure 1. Creation of DNA to link

GFPγ::URA3 template to SHE3. A plasmid

template cassette containing GFPγ and URA3

genes was amplified by PCR with a pair of

short oligonucleotides: a 5’ primer

corresponding to the 3’ end of She3 coding

region (blue) and 5’ beginning of GFPγ 3’

(green) and a 3’ primer corresponding to the 3’

end of URA3 (yellow) with the 3’end of She3

untranslated region (orange).

4

Transformation of C. albicans with GFPγ::URA3 PCR product Strains used and

generated in this table are shown in Table 2. The genome of the parental C. albicans strain used

in this study, SE6 (Elson, et al 2009, Table 1), contains only one copy of SHE3 and no URA3.

Transformation of SE6 with the products of the PCR amplification of GFPγ::URA3 with primers

corresponding to the SHE3 coding region was used to create a link of GFPγ to SHE3 in the C.

albicans genome (Figure 2). Cells were transformed according to a protocol provided by the

laboratory of Julia Koehler. SE6 cells (10 mL) were grown overnight at room temperature and

harvested at OD600 of 5. PCR-amplified DNA was added to cells pelleted from 1.3 mL of

culture. Cells were incubated with 40µl of carrier DNA, 40% PEG, Tris EDTA, lithium acetate

and DTT for 1 hour at 30 °C, then heat-shocked in a 42 °C water bath for 45 minutes. Cells were

then collected by centrifuge at 1000rpm for 5 minutes, washed with growth medium lacking

uridine, plated on medium lacking uridine and incubated at 30⁰C for 3 days.

Table 2. Strains used in this study

C. albicans strain Genotypes Source Purpose

SE5

she3Δ/she3Δ ura3Δ/ura3Δ

Elson, et al 2009

Phenotypic assays

SE6

SHE3/she3Δ ura3Δ/ura3Δ

Elson, et al 2009

Phenotypic assays/She3-GFP localization

AMC99

SLR1-GFP::URA3/slr∆

McBride lab

She-GFP localization (+GFP)

AEC4

URA3/ura3∆

This study

She3-GFP localization (-GFP)

SHE3-GFPγ::URA3/she3∆

This study

She3-GFP localization

Figure 2. Integrative transformation of PCR

product into C. albicans chromosome. Primers

used to amplify GFPγ::URA3 template also

contain sequences corresponding to SHE3 coding

region 3’ end and beginning of the 3’untranslated

region, allowing for recombination at the coding

region of SHE3 during transformation.

AEC29

5

Microscopy Forty uridine-prototrophic transformants as well as cells of positive and

negative controls (AMC99 with GFP and AEC4 without GFP) were grown shaking overnight in

ura- growth media with glucose in a multi-well plate at 30⁰C. Cultures were diluted in fresh

media and viewed in log phase after 2-3 hours of growth. Budding yeast-form cells (2-5µl) were

placed on agarose coated slides, and viewed with an Olympus BX51 microscope with 100x oil

immersion objective. Images were captured using Q-Capture software with exposure of 15ms

for bright field and 5s for GFP filters.

Western blot Anti-GFP immunoblotting was used to analyze expression of She3-GFP

in the cells that exhibited possible localized fluorescent signal (AEC29), cells known to express a

GFP fusion protein (AMC99) and cells without GFP (AEC4). Log-phase yeast cells were

collected and lysed in RIPA buffer in the presence of protease inhibitors. Total protein levels of

lysates were measured by BIORAD protein assay. Lysates were diluted to a concentration of

3µg/µl of protein (to load 30µg total protein in 10 µl) in Express PAGE loading buffer

(Genscript). Proteins were resolved by 10% SDS-PAGE and transferred to a nitrocellulose

membrane according to manufacturer’s protocol (Genscript). The blot was blocked with 5%

milk in phosphate buffered saline with Tween 20, rinsed, and then incubated with a 1:1000

dilution of anti-GFP primary antibody (Roche) overnight. The next day, the blot was rinsed and

incubated for 45 minutes with a 1:5000 dilution of anti-mouse IgG horseradish peroxidase-

conjugated secondary antibody. The blot was developed using chemiluminescence detection

(Pierce) and imaged in 1, 5, and 15 minute exposures to autoradiographic film.

Phenotypic plate assays Conditions within the C. albicans host that may induce

filamentation of yeast cells can be simulated by growing single colonies on solid media within a

moist environment with temperatures over 35⁰C and factors such as a high pH or nutrient

deprivation (Nadeem, et al. 2013). Filamentation of the ura∆/∆ strains SE5 (she3∆/∆) and SE6

(SHE3/she3∆) (Elson et al., 2009), was tested by spot-plating 5µl of 107 stationary phase cells on

RPMI and Spider media supplemented with uridine. Plates were incubated in a humidified

container at 37⁰C and observed after 8 days. Lipase activity of the same strains was tested by

spotting 3µl of cultures diluted to OD600~0.5 on egg yolk agar plates supplemented with uridine.

Plates were incubated at 37⁰C in humidified container for 2 days and observed every 24 hours.

6

Results

GFPγ::URA3 was amplified by PCR Analysis by gel electrophoresis indicated that

GFPγ::URA3 was amplified by PCR with 5’ and 3’ oligonucleotides that allow for

recombination with the SHE3 coding region, resulting in a band of about 2.5 kbp (Figure 3) and

minor band at about 5 kbp. SE6 cells transformed with the GFPγ::URA3 PCR product produced

56 colonies on plates with Ura- media after incubating in 30⁰C for 3 days. No colonies were

present on Ura- media plated with cells incubated without the GFPγ::URA3 PCR product.

Epifluorescence microscopy detected possible nuclear localization in strains

transformed with GFP::URA3 In order to determine the location of She3 in C. albicans

budding cells, the protein was tagged with GFP to make it visible by epifluorescent microscopy.

Microscopy of over 40 transformants revealed discernible specifically localized fluorescence in

at least one SHE3-GFPγ::URA3 transformant relative to cells known not to express GFP (Figure

4). While many transformants exhibited whole cell fluorescence or no signal at all, some had

areas of signal that may have been localized to the nucleus or cytoplasm, but no determination

could be made due to background cell fluorescence. One transformant (strain AEC29) exhibited

areas of fluorescence that appeared to be specific to the nucleus.

Figure 4. A She3-GFP fusion protein may localize to the nucleus in budding cells . Fluorescent and brightfield

images of the same field were taken of transformants. Brightfield and GFP-filtered images were taken at 15ms and 5s

exposures, respectively.

She3-GFP No GFP

Figure 3. Amplification of GFPγ::URA3 by PCR.

A GFPγ::URA3 cassette was amplified from plasmid

template DNA using primers designed to amplify the

cassette and 3’ end of the SHE3 coding region and the

3’ SHE3 untranslated region. Note minor band in

GFPγ::URA3 lane. PCR products were resolved in

0.8% agarose gel stained with ethidium bromide.

7

Anti-GFP immunoblot detects weak signal of She3-GFP expression An immunoblot

was used to confirm expression of She3-GFP. A 15 minute film exposure of the anti-GFP

immunoblot detected a faint band between the protein size markers of 80-100 kDa (Figure 5) in

the AEC29 lane. Shorter exposures produced weaker bands in the same location. Based on its

amino acid composition, She3-GFPγ has a molecular mass of about 86 kDa. The AMC99 lane

contained a strong band corresponding to the positive control, Slr1-GFP. The strain used that is

known not to contain GFP, AEC4, produced no band in the corresponding lane.

Absence of She3 causes defects in filamentation on RPMI and Spider plates To test

the effect of She3 on filamentation phenotypes, she3∆/she3∆ and SHE3/she3∆ strains were

grown in single colonies on media and under conditions known to induce filamentation in wild-

type strains. After 8 days of growth in 37⁰C in a humidified container, both colonies on the

uridine-supplemented RPMI plate had developed a raised central region of white wrinkled

growth surrounded by a halo of filamentation (Figure 6A). However, SHE3/she3∆ colonies

contained more than double the ratio of peripheral filamentation growth to the central region than

she3∆/she3∆ colonies. The filamentous growth of SHE3/she3∆ colonies also appeared more

uniform, while she3∆/she3∆ colonies exhibited an expanded central region with a small

outgrowth of irregular filaments. On Spider agar with uridine, only SHE3/she3∆ colonies

produced a peripheral outgrowth of filaments (Figure 6B).

Figure 5. Weak band detected between 80-100

kDa in SHE3-GFP::URA3-transformed strain.

Cells of strains transformed with GFP::URA3

were grown overnight in Ura- medium and

collected at log phase. Cells were lysed in RIPA

buffer in the presence of protease inhibitors.

Proteins from lysates were resolved by SDS-

PAGE. Predicted size of She3-GFP is 86.3 kDa

Slr1-

She3-GFP?

8

Lipase activity is not affected by She3 To determine if the absence of She3 inhibited

lipase activity, SE5 (she3∆/she3∆) and SE6 (SHE3/she3∆) strains were grown on egg yolk agar

plates supplemented with uridine and colony zones of precipitation were observed for phenotypic

differences. No differences in lipase action phenotypes were detected after observations at 24

and 48 hours. In addition, the SHE3/she3∆ colony was observed to have central wrinkling

whereas the same region of she3∆/she3∆ was smooth.

Discussion

She3 has been determined to play a role in the normal formation and function of C.

albicans hyphae and contributes to the cell’s ability to damage host cells (Elson, et al. 2009).

This study aimed to provide a more detailed understanding of the mechanism of action of the

transport protein by determining its localization in the cell as well as shedding light on the

importance of She3 by examining the effects of its absence on hyphal form and function in

colonies on previously untested media.

Figure 6. Filamentation is affected by She3.

Cells of each strain (107 in 5µl) were plated by

spotting on RPMI (A) and Spider (B) agar

supplemented with uridine and grown for 8 days at

37⁰C.

SHE3/she3∆ she3∆/∆

A. RPMI

B. Spider

Figure 7. Lipase activity is not affected

by the absence of She3. 3µl of diluted

cells from SHE3/she3∆ and she3∆/she3∆ strains were grown for 48 hours at 37⁰C.

SHE3/she3∆ she3∆/∆

9

Amplification of GFPγ::URA3 PCR products with primers containing SHE3 sequences

produced a band of the expected size when analyzed by gel electrophoresis, along with a minor

band of about 5 kbp (Figure 3). This extra band is most likely due to the detection of the plasmid

template DNA from which the GFPγ::URA3 cassette was derived (Zhang and Konopka, 2009).

Based on epifluorescence microscopy of cells transformed with DNA designed to link

GFP to She3, it is likely that She3-GFP localizes to the nucleus in budding yeast cells (Figure 4),

an interesting finding, as She3 is excluded from the nucleus in S. cerevisiae (Müller, et al. 2011).

However, out of over 40 strains, compared to the control strain known not to contain GFP, only

one transformant provided a discernible specific localization of fluorescent signal. Other cells

did not consistently show a fluorescent signal above background fluorescence, in spite of the

ability of these strains to biosynthesize uridine, which suggested successful transformation of the

GFPγ::URA3 cassette. The GFP tag on the She3 C-terminus may have impeded the expression

of She3-GFP with one strain having a fortuitous mutation that increased expression.

Alternatively, most of the cells may not have been at a stage in growth where the protein is being

expressed at high enough levels for visualization.

A Western blot was performed to confirm the expression of GFP linked to She3 in the

strain exhibiting the most perceptible specific fluorescent signal. A weak band close to the

expected size of 86 kDa was visible in the lane corresponding to this strain (Figure 5). Though

this result coupled with epifluorescence imaging of possible nuclear localization is promising,

further confirmation of She3-GFP expression is required. While the weak signal may be due to

the GFP tag on She3 causing destabilization of the protein, immunoblot analysis of a more

concentrated lysate might rule out the possibility that the visible band is a background signal

rather than an actual protein. Genomic DNA analysis through PCR with oligos that amplify the

5’ and 3’ points of insertion of the GFPγ::URA3 cassette should be performed in the future to

provide more definitive evidence that it has been successfully integrated at the 3’ end of SHE3.

After this analysis confirms the presence of a GFP tag on She3, DAPI staining will allow

confirmation of She3-GFP nuclear localization in budding cells. Additionally, cells should be

observed after the induction of filamentation, to investigate where She3 localizes in the hypha.

For example She3-GFP may localize in the hyphal tip as this is the ultimate destination of

mRNAs dependent on She3 for transport (Elson, et al. 2009).

10

In the event that the above findings of this study are not confirmed in the future, a GFP

tag on the 5’ end of the SHE3 coding region may be more effective to pinpoint the localization of

She3 in budding and hyphal C. albicans cells. As mentioned previously, it may be that

GFPγ::URA3 was integrated at the 3’ end of the She3 coding region, but that the location of the

tag had a detrimental effect on the protein on its functional end, thus, expression was inhibited.

Confirmation of the findings in this study could suggest that C. albicans She3 has a role in

mRNA transport similar to that of She2 in S. cerevisiae, entering the nucleus to bind mRNA and

shuttling it out to the rest of a transport complex to be moved from the mother to the daughter

cell (Bohl, et al. 2000). Furthermore, since it has been shown that She3 copurifies with Myo2 in

C. albicans (Burnim, 2014), if no other proteins are found to copurify with She3, it may be that

the mRNA transport complex in C. albicans consists only of She3 as both the liaison to the

Myo2 motor protein, similar to the role of She3 in S. cerevisiae (Bohl, et al. 2000) and as the

primary mRNA transporter.

To test the effect of She3 on phenotypes of colonies in different environments, the

growth of strains with (SE6) and without (SE5) the protein was compared on different media.

The absence of She3 causes observable defects on the development of filaments on RPMI as

well as on Spider agar plates. On both media, colonies with She3 were able to form a periphery

of filamentous outgrowth from the central colony region, whereas colonies without She3 on

RPMI had very little outgrowth in relation to the central region and none on Spider agar. The

effect of She3 on phenotypes on RPMI medium is a novel finding. Another study (Elson, et al.

2009) had similar results with Spider agar, however, the study did not supplement with uridine,

as the strains used had a gene for uridine synthesis.

Lipase has been found to have a role in hyphal invasion of host cells, (Ghannoum, 2000),

but it is not clear if She3 plays a role in its presence at the hyphal tip. The effect of She3 on

lipase activity was tested by comparing the zones of precipitation on egg yolk agar. Colonies of

cells with and without She3 had almost identical zones of precipitation. This finding indicates

that She3 may not be involved in the transport of mRNA that is translated into lipase and that the

protein itself is transported by another means. The wrinkling of the SHE3/she3∆ colony

indicates filamentation.

In studies that continue this work, the results of the phenotypic plate assays used in this

study should serve as a model to determine if a tag of GFPγ on She3 might affect the protein’s

11

function in proper filamentation. If the GFP tag is on the functional end of She3, it may prevent

She3’s interaction with mRNAs, causing defects in the hyphal activity, including filamentation.

Phenotypes of colonies from strains modified with the tag can be compared to SHE3/she3∆ and

she3∆/∆ colonies to observe possible defects in filamentation.

This study and those of others have been able to utilize the established S. cerevisiae

mRNA transport system as a model to gain insight into a similar system in C. albicans (Burnim,

2014, Elson, et al. 2009, Zott, 2014). Better understanding of the C. albicans system,

specifically how proteins get localized to the hyphal tip, can provide information about factors

that contribute to pathogenicity of this and possibly other infectious microbes.

12

References

Bohl F, Kruse C, Frank A, Ferring D, Jansen RP. She2p, a novel RNA binding protein tethers

ASH1 mRNA to the Myo4p myosin motor via She3p. EMBO J 2000, 19: 5514–5524

Burnim S. Identification of mRNA transport protein complexes in the pathogenic yeast Candida

albicans. Bowdoin College Biochemistry Program Honors Thesis 2014

Elson SL, Noble SM, Solis NV, Filler SG, Johnson AD: An RNA transport system in Candida

albicans regulates hyphal morphology and invasive growth. PLoS genetics 2009, 5(9):e1000664.

Hube B. From commensal to pathogen: stage-and tissue-specific gene expression of Candida

albicans. Current Opinion Microbiology 2004. 7.4: 336-341.

Ghannoum MA. Potential role of phospholipases in virulence and fungal pathogenesis. Clinical

Microbiology Review 2000. 13: 122–143;

Mayer F.L., Wilson D., and Hube, B. Candida albicans pathogenicity mechanisms. Virulence

2013. 4: 119-128

Müller M, Heym RG, Mayer A, Kramer K, Schmid M, Cramer P, Urlaub H, Jansen RP, Niessing

D: A cytoplasmic complex mediates specific mRNA recognition and localization in yeast. PLoS

biology 2011, 9(4):e1000611.

Nadeem S, Shafiq A, Hakim S, Anjum Y, and Kazm S. U. Effect of growth media, pH and

temperature on yeast to hyphal transition in Candida albicans. Open Journal of Medical

Microbiology 2013, 3(3):185-192.

Saville, SP, Lazzell AL, Monteagudo C, Lopez-Ribot JL: Engineered control of cell morphology

in vivo reveals distinct roles for yeast and filamentous forms of Candida albicans during

infection. Eukaryotic cell 2003. 2(5):1053-1060.

Sudbery, P.E. Growth of Candida albicans hyphae. Nat. Rev. Microbiology 2011, 9, 737-748.

Zhang C, Konopka JB. A photostable green fluorescent protein variant for analysis of protein

localization in Candida albicans. Eukaryotic cell 2010, 9(1):224

Zhu W., and Filler, S.G. Interactions of Candida albicans with epithelial cells. Cell

Microbiology 2010. (12),273-282.

Zott, AE. Investigating dependence of protein localization on mRNA transport in pathogenic

yeast C. albicans. Bowdoin College Biochemistry Program Honors Thesis 2014