INVESTIGATING THE HEMATOPOIETIC SYSTEM’S CONTRIBUTION TO AXOLOTL SKIN REGENERATION

By

ANNA KATHERINE RODGERS

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2018

© 2018 Anna Katherine Rodgers

To God, my husband, John Mark, and my parents, Randy and Margaret. Without their motivation, support, and love, this would not have been possible.

4

ACKNOWLEDGMENTS

I thank my husband for his un-ending support of me throughout this process. As

my cheerleader, motivator, shoulder to cry on, sounding board, logic checker, and lab

helper, he enabled me to successfully complete the work in this dissertation. I will be

forever grateful for his support during this time. I thank my parents who have believed

in, encouraged, and supported me throughout my life. I also thank the rest of my family

for their continued support.

I thank my mentor, Dr. Scott, for accepting me into his laboratory and for his

patience towards me as he guided me through this process. I thank him for the many

times we discussed my projects and having my best interest in mind to prepare me for

future endeavors. He saw my potential, even at times when I did not, and reassured me

in the difficult times.

I thank the members of the Scott laboratory, past and present: Mr. Gary Brown

for his motivation and joviality; Dr. Andrew Bryant for his comradery and experimental

aid; Dr. David Lopez for his mentorship when I began the lab, as well as for his

continued assistance after he left; Dr. Koji Hosaka for teaching me his axolotl

techniques upon which my projects hinged; Ms. Li Lin, for always being willing to assist

me with any project and teaching me her techniques; Mr. William Ziebarth, Mr. Thomas

McManus, Ms. Laylo Mukhsinova, and Mr. Luke Farmer for their aid with animal

husbandry and laboratory maintenance; Ms. Crystal Jones Sotomayer for her

comradery; Ms. Phoebe Lin for her excellent help with experiments; and Mr. Ruben O.

Garcia Vazquez for his enthusiasm to participate in my work. I thank my collaborators,

Dr. Mark Wallet and Ms. Melanie Cash, for all their immense aid with the elutriation

project.

5

I thank my committee members: Drs. William Dunn, Malcolm Maden, and Jorg

Bungert for their mentorship, suggestions, and guidance. I also thank the leadership of

the Molecular Cell Biology concentration for their support and encouragement over the

years: Drs. Yehia Daaka, Alexander Ishov, and Eric Vitriol.

6

TABLE OF CONTENTS page

ACKNOWLEDGMENTS ...................................................................................................... 4

LIST OF TABLES ................................................................................................................ 8

LIST OF FIGURES .............................................................................................................. 9

LIST OF ABBREVIATIONS ............................................................................................... 11

ABSTRACT ........................................................................................................................ 14

CHAPTER

1 WOUND HEALING AND REGENERATION .............................................................. 16

Mammalian Scarring ................................................................................................... 16 The Macrophage: Master Regulator of Wound Healing ............................................ 17 Plasticity of Macrophages ........................................................................................... 18

Macrophage Polarization in Wound Healing .............................................................. 20

Inflammation and Scarring .......................................................................................... 20 The Requirement of Macrophages for Mammalian Adult Wound Healing................ 21 The Axolotl Animal Model ........................................................................................... 22 Axolotl Skin Regeneration .......................................................................................... 25

Macrophage Contribution to Axolotl Regeneration .................................................... 26

Generation of Axolotls with Fluorescent Immune Systems ....................................... 27 Isolation of Axolotl Hematopoietic Stem Cells ........................................................... 28 Thesis Rationale and Goals ....................................................................................... 28

2 AXOLOTL MACROPHAGES IN SKIN REGENERATION ......................................... 34

Materials and Methods ............................................................................................... 34

Axolotl Maintenance ............................................................................................. 34 Axolotl Buffer Preparation .................................................................................... 35 Preparation of PBS- and Clodronate-Liposomes ................................................ 35 Depletion of Macrophages and Full-Thickness Excisional Wounding ................ 36

Analysis of Collagen Fibers ................................................................................. 36

Collection of Intraperitoneal Macrophages .......................................................... 36 Isolation of Peripheral White Blood Cells ............................................................ 37 Cytochemical Staining of Axolotl Cells ................................................................ 37 Labeling of Macrophages with Rhodamine-Dextran ........................................... 38 Histology, Immunohistochemistry, and Immunocytochemistry ........................... 38

Phagocytosis Assay ............................................................................................. 40

RNA Isolation and First Strand cDNA Synthesis................................................. 41 Primer Design ....................................................................................................... 41 Polymerase Chain Reaction ................................................................................ 42

7

Sequencing of PCR Products .............................................................................. 42 In Vitro Polarization of Axolotl Macrophages ...................................................... 43

Experimental Results .................................................................................................. 43

Clodronate-Liposome Treatment Increases Collagen Deposition ...................... 43 Differentiating Between Axolotl Neutrophils and Macrophages ......................... 45 Characterization of Axolotl Macrophage Polarization ......................................... 49

Phagocytosis as a marker of inflammation status ........................................ 50 Testing resident and elicited IP macrophages for expression of iNOS

and arginase ............................................................................................... 51

Development of PCR primers for iNOS and arginase expression ............... 52 Polarization of axolotl macrophages using exogenous stimuli..................... 53

Discussion of Results ................................................................................................. 54

3 ENRICHMENT OF THE AXOLOTL HSC USING CENTRIFUGAL COUNTERFLOW ELUTRIATION .............................................................................. 78

Methods ....................................................................................................................... 80 Animal Maintenance ............................................................................................. 80 Spleen Cell Isolation ............................................................................................ 80 Counterflow Centrifugal Elutriation ...................................................................... 81

Cytospins and Cytochemical Staining ................................................................. 81

Colony Forming Unit Assay ................................................................................. 82 ALDH Staining ...................................................................................................... 82 Non-Ablative Larval Transplants.......................................................................... 82 Limit of Dilution Analysis ...................................................................................... 83 Immunocytochemistry .......................................................................................... 83

Results ........................................................................................................................ 84

CCE Fractionation of Axolotl Spleen Cells .......................................................... 84 HSC Activity Elutes in the WBC Fractions of CCE ............................................. 86 CCE Fractionation Significantly Enriches Axolotl HSCs ..................................... 87

Discussion of Results ................................................................................................. 90

4 DISCUSSION ............................................................................................................106

APPENDIX: MACRO SCRIPT FOR COLLAGEN ANALYSIS .....................................110

LIST OF REFERENCES .................................................................................................111

BIOGRAPHICAL SKETCH ..............................................................................................118

8

LIST OF TABLES

Table page 3-1 Engraftment rates for LDA analysis .....................................................................102

9

LIST OF FIGURES

Figure page 1-1 iNOS and arginase metabolism of arginine ........................................................... 30

1-2 Normal architecture of axolotl skin. ........................................................................ 31

1-3 Comparison of events during axolotl wound regeneration and mammalian wound scarring ....................................................................................................... 32

1-4 Methods for creating axolotl hematopoietic chimeras ........................................... 33

2-1 Macrophage depletion and FTE wounding strategy .............................................. 58

2-2 First trial Clo-lipo cohort shows regeneration inhibition......................................... 59

2-3 Initial collagen deposition is not altered in Clo-lipo animals. ................................. 60

2-4 Dermal scarring of amputated limb a year after Clo-lipo treatment ...................... 61

2-5 Clo-lipo depletion trial 3 did not block limb regeneration ...................................... 62

2-6 Increased collagen deposition at D30 is resolved at D90 ..................................... 63

2-7 Collagen thickness is the same between PBS- and Clo-lipo wounds. ................. 64

2-8 Representative examples of axolotl neutrophils and monocyte/macrophages. ... 65

2-9 Cytochemical staining of axolotl neutrophils and macrophages ........................... 66

2-10 Dextran+ cells are mononuclear CAE+ ................................................................... 67

2-11 Dextran+ cells have variable MPO enzymatic activity ........................................... 68

2-12 Antibody staining of elicited IP neutrophils and monocyte/macrophages ............ 69

2-13 Phagocytosis activity of elicited and resident IP macrophages ............................ 70

2-14 Positive control antibody staining for arginase and iNOS ..................................... 71

2-15 Both resident and elicited IP cells express iNOS and arginase ............................ 72

2-16 iNOS primer design. .............................................................................................. 73

2-17 Arginase primer design .......................................................................................... 75

2-18 In vitro stimulation with murine cytokines did not induce polarization. ................. 77

10

3-1 CCE overview ......................................................................................................... 94

3-2 ALDH activity enriches for hematopoietic stem cells ............................................ 96

3-3 Optimization of CCE with axolotl cells ................................................................... 97

3-4 Fractionation of axolotl spleen cells using CCE. ................................................... 98

3-5 Hematopoietic progenitor activity concentrated in first elutriation peak .............100

3-6 Elutriated spleen cells show enrichment for HSPC activity.................................101

3-7 CCE significantly enriches for HSCs ...................................................................103

3-8 Staining for axolotl T cells ....................................................................................104

3-9 Summary of axolotl spleen fractionation using CCE ...........................................105

A-1 Macro script for collagen analysis using FIJI software ........................................110

11

LIST OF ABBREVIATIONS

AGSC Ambystoma Genetic Stock Center

ALDH Aldehyde Dehydrogenase

ANAE Alpha-Naphthyl Acetate Esterase

A-PBS Amphibian Phosphate Buffered Saline

a-SMA alpha-Smooth Muscle Actin

BAC Bacterial Artificial Chromosome

CAE Naphthol AS-D Chloroacetate

CCE Counterflow Centrifugal Elutriation

cDNA Complementary DNA

CFU Colony Forming Units

Clo-lipo Clodronate-liposomes

DAB 3,3'-diaminobenzidine

DAMPs Danger-Associated Molecular Patterns

DAPI 4',6-diamidino-2-phenylindole

DNA Deoxy-ribonucleic Acid

ECM Extracellular Matrix

ELDA Extreme LDA

FACS Fluorescence-activated cell sorting

FGF Fibroblast Growth Factor

FSC Forward Scatter

FTE Full thickness excisional

GFP Green Fluorescent Protein

GVHD Graft Versus Host Disease

HSC Hematopoietic Stem Cell

12

HSPC Hematopoietic Stem/Progenitor Cell

ICC Immunocytochemistry

IF Immunofluorescence

IFNg Interferon gamma

IgM Immunoglobulin M

IgY Immunoglobulin Y

IHC Immunohistochemistry

IL Interleukin

iNOS Inducible Nitric Oxide Synthase

IP Intraperitoneal

LDA Limiting Dilution Analysis

LPS Lipopolysaccharide

LT-HSC Long-Term Hematopoietic Stem Cell

M1 Classically activated macrophage, pro-inflammatory

M2 Alternatively activated macrophage, anti-inflammatory

MHC-II Major histocompatibility class II

MMP Matrix Metalloprotienase

MPO Myeloperoxidase

mRNA Messenger RNA

NO Nitric Oxide

NS Non-stimulated

ORF Open Reading Frame

PBS Phosphate Buffered Saline

PBS-lipo PBS-liposomes

PDGF Platelet Derived Growth Factor

13

PFA Paraformaldehyde

PU.1 Transcription factor encoded by the SPI1 gene

PWM-SCM Pokeweed Mitogen - Stimulated Spleen-Cell Conditioned Media

qPCR Quantitative Polymerase Chain Reaction

RBC Red blood cell

rhEPO Recombinant Human Erythropoietin

RNA Ribonucleic Acid

RT Room Temperature

SSC Side Scatter

TGF-B Transforming Growth Factor – Beta

TNF-a Tumor Necrosis Factor – alpha

VEGF Vascular Endothelial Growth Factor

Vol Volume

WBC White blood cell

14

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

INVESTIGATING THE HEMATOPOIETIC SYSTEM’S CONTRIBUTION TO AXOLOTL

SKIN REGENERATION

By

Anna Katherine Rodgers

May 2018

Chair: Edward W. Scott Major: Medical Sciences – Molecular Cell Biology

The axolotl (Ambystoma mexicanum) is the champion of regeneration, able to

regenerate its limbs, spinal cord, lens, heart, and skin. Unlike mammals, axolotls are

able to incur skin wounds without the formation of scar tissue. The immune system is

intimately involved in the wound healing process of mammals. In particular, the

macrophage is a master regulator of the wound healing process. Depletion of

mammalian macrophages during the first stage of wound-healing results in decreased

scar tissue formation. Conversely, depletion of macrophages before axolotl limb

amputation prevents regeneration with observed fibrosis. We hypothesized that early

axolotl macrophages regulate the axis of regeneration and scarring in the axolotl. Thus,

depletion of early macrophages during axolotl wound regeneration should result in

scarring. Using clodronate-liposomes to deplete macrophages, we found that dorsal

wounds had increased collagen deposition at day 30, and the skin of an un-regenerated

limb retained this excess collagen over a year after injury. When macrophages were

only partially depleted, limb regeneration occurred, and excess dermal collagen from

dorsal wounds showed evidence of remodeling towards the uninjured phenotype 90

15

days post-wounding. This data suggests that there is a macrophage threshold required

for both limb and dermal regeneration.

To study the hematopoietic system’s role in axolotl regeneration, our lab

previously developed a method to create chimeric immune axolotls through

transplantation of green fluorescent protein (GFP) spleen cells containing the

hematopoietic stem cell (HSC). However, the model is prone to graft-versus-host

disease (GVHD) due to the presence of mature T cells in the spleen. Enrichment of the

hematopoietic stem cell before transplantation can reduce GVHD incidence by reducing

T cell contamination. Due to the lack of appropriate antibodies to enrich for the axolotl

HSC, as is used in mice and humans, we tested antibody-free enrichment methods:

aldehyde dehydrogenase (ALDH) activity and counterflow centrifugal elutriation (CCE).

Using a non-ablative, “in utero” model to assess for HSC enrichment without the

interference of GVHD onset, we found CCE, but not ALDH, significantly enriches for

axolotl HSCs.

16

CHAPTER 1 WOUND HEALING AND REGENERATION

Mammalian Scarring

It is estimated that 100 million people in the developed world will have an injury

resulting in a scar each year.1 Scars are the end result of mammalian wound healing

due to the inability to regenerate the original tissue structure and composition of

uninjured tissue. The skin is the largest organ of the human body and is often subjected

to trauma resulting in scar tissue. Skin is responsible for thermal regulation as well as

protection against desiccation, UV radiation, and external pathogens.2 Scars are an

unorganized mass of collagen fibers formed when trauma penetrates through the

epidermis to the dermal layer.3 With few exceptions, mammals produce scars during the

normal course of wound healing. While scarring may represent a normal biological

process, the dysfunctional skin produced is not optimal.3 Scars are areas of UV

sensitivity, with a diminished function as a water barrier, and lack efficient immune

system surveillance mechanisms.4

Mammalian wound healing progresses through three stages: inflammation, tissue

formation and tissue remodeling. During these stages, important milestones are

achieved: 1) hemostasis, 2) infiltration of inflammatory cells into wound site 3) re-

epithelialization of the wound bed, 4) contraction of wound edges, 5) transitional

extracellular matrix (ECM) formation, and 6) remodeling of ECM.5,6 Damaged blood

vessels in the hemostasis phase release clotting factors to stop blood loss. The

escaped blood plasma proteins, mainly fibrinogen, and red blood cells eventually make

up the eschar, or scab, found on top of a healing wound. The inflammation stage is

marked with the infiltration of inflammatory white blood cells, neutrophils and

17

monocytes/macrophages, from the circulatory system into the wound bed. These

immune cells clear infections, damaged cells, and ECM in preparation for the tissue

formation stage.7,8 During this stage, re-epithelization is also occurring as keratinocytes

migrate under the scab to re-establish the epithelial barrier.3 Once the wound bed has

been cleared of infection and damaged/dying debris, fibroblasts migrate into the wound

bed and begin depositing a transitory ECM composed primarily of type III collagen.7,9

Angiogenesis of blood vessels also occurs within the wound bed to provide oxygen and

nutrients to the cells. This mix of collagen, fibroblasts and blood vessels is known as

granulation tissue and is the mark of the tissue formation stage.7 The last stage, tissue

remodeling, is where the granulation tissue is remodeled into scar tissue. The collagen

that was deposited in the tissue formation stage is replaced with type I collagen type.9

Collagen type I is organized into parallel bundles and is the most prominent type of

collagen in scar tissue.10 Over the next months to years, scar tissue can be remodeled

from the mechanical forces encountered during normal use.7 These forces shape the

scar tissue to better accommodate the function of the surrounding tissue, but the full

functionality and morphology is never restored.

The Macrophage: Master Regulator of Wound Healing

The immune system is produced through the normal process of hematopoiesis.

Hematopoiesis is the differentiation of the hematopoietic stem cell (HSC) into all the

different blood cell lineages. The immune system is divided into adaptive and innate

branches. The adaptive immune system is made up of T cells, B cells. The innate

immune system includes neutrophils, monocytes/macrophages, eosinophils, basophils,

mast cells, and natural killer cells. Monocytes are found in the circulatory system, and

upon extravasation into the surrounding tissue, they differentiate into macrophages.11

18

The macrophage is the master regulator of wound healing, playing a major role in

the progression of a wound through the normal stages of healing.12 After 2-3 days,

circulating monocytes are recruited to wound bed and differentiate into macrophages

that phagocytose any pathogens they may detect as well as apoptotic neutrophils.11

Macrophages also help clear the wound of damaged extracellular matrix in preparation

for granulation tissue formation.13,14 In the tissue formation phase, macrophages recruit

fibroblasts into the wound bed and promote their production of collagen through

secretion of fibroblast growth factor (FGF) and transforming growth factor beta (TGF-

ß)/Platelet derived growth factor (PDGF) respectively.14 Macrophages also promote the

angiogenesis of the blood vessels into the wound bed through secretion of vascular

endothelial growth factor (VEGF).12 In the remodeling phase, macrophages can directly

modify the extracellular matrix through secretion of ECM cleavage enzymes, matrix

metalloproteinases (MMPs), and phagocytosing ECM components.6,14

Plasticity of Macrophages

Macrophages are very plastic cells; they can be activated to achieve numerous

phenotypes depending on the signals they receive. Macrophages can go through

sequential stimulations with observable alterations in their phenotype at each step.15-17

Macrophage activation falls under two broad categories: classically activated and

alternatively activated also known as M1 and M2. Classically activated, or M1,

macrophages are inflammatory macrophages: they are highly phagocytic, release pro-

inflammatory cytokines, as well as produce nitric oxide (NO) through upregulation of the

inducible nitric oxide synthase (iNOS) protein.18 In vitro polarization of macrophages to

the M1 phenotype is achieved through co-stimulation of macrophages with interferon

gamma (IFN) and lipopolysaccharide (LPS).19 Upon stimulation, the most notable

19

changes are the increase in iNOS expression and secretion of the pro-inflammatory

cytokines such as interleukins 1, 6, 12, and 23 (IL1, IL6, IL12, IL23), and tumor necrosis

factor alpha (TNF-).18,19

Alternatively activated macrophages are so named because they have a different

phenotypes/functions compared to the classically activated phenotype. These

macrophages, also called M2 macrophages. While M2 macrophages are currently

divided into four sub-types, M2a, M2b, M2c, and M2d, the M2a sub-type was the first

identified and has been described as the wound-healing macrophage phenotype.20,21

Stimulation of macrophages with interleukin 4 (IL4) or interleukin 13 (IL13) gives rise to

the M2a sub-type and show increased arginase levels as opposed to iNOS.18,22 They

also have increased expression of scavenger and mannose receptors.21 It was originally

thought that the polarization of macrophages was a spectrum with M1 macrophages at

one end and M2 at the other.18 However, in vivo studies suggest that macrophage

polarization is more like a color wheel, where macrophages can express both M1 and

M2 markers concurrently.18,23,24 This plasticity allows the macrophage to respond

appropriately to changes in its environment.

The relationship between iNOS and arginase is unique because they share the

same substrate: arginine (Figure 1-1). iNOS metabolism of arginine leads to production

of NO which facilitates the microbial killing functions of M1 macrophages.25 Arginase

metabolizes arginine to produce ornithine, which can then be used to make polyamines

and proline.26 This phenotype is thought to aid in wound healing because polyamines

can support local cell proliferation and proline is required for collagen synthesis.27 In

most cases, there is a mutually exclusive expression of iNOS or arginase in

20

macrophages as the products of each enzymatic reaction can inhibit the expression of

the other.26

Macrophage Polarization in Wound Healing

The function and phenotype of the macrophage changes during the course of

wound healing. The current dogma is that during the inflammation stage, monocytes

recruited to the wound bed differentiate into the classically activated, M1

macrophages.12 This pro-inflammatory macrophage functions to prevent infection at the

wound site through its increased phagocytic activity.6 Through detection of danger-

associated molecular patterns (DAMPs), macrophages can debride the wound site of

necrotic tissue.13 In order for complete transition from the inflammation phase to the

tissue formation phase, the microenvironment must switch from pro-inflammatory to

anti-inflammatory.12,28 An important event thought to be key to this switch is the

phagocytosing of apoptotic neutrophils in the wound bed. In vitro, macrophages have

been shown to transition from a M1 state to a M2 state after phagocytosing apoptotic

neutrophils.29 M2 macrophages are responsible for the reparative process of the tissue

formation and tissue remodeling stages. They produce the growth factors and cytokines

important for neovascularization, fibroblast migration and proliferation, collagen

secretion, and collagen remodeling.12

Inflammation and Scarring

The ability to heal scar-free is a goal of regenerative medicine. As mammalians

age, their ability to regenerate decreases exponentially. While fetuses can heal wounds

scar-free this is lost postnatally.30 In studying fetal scar-free healing, it is seen that

cutaneous wounds incur less of an inflammatory response as seen in adults.31,32 Yet, if

the wound is large enough, or an inflammatory response is induced, a scar is formed

21

rather than regeneration.33,34 Fetal wounds can be induced to respond as adult wounds

in the presence of bacteria (dead or alive), which draws neutrophils and macrophages

to the wound bed and results in increased collagen deposition.34 To test if inflammatory

cells directly cause scarring in neonate mice, which normally heal through scar tissue

formation, PU.1 null mice were created which do not have functioning neutrophils or

macrophages.35 Performing biopsy punches on the paws of the mice, there was no

delay in the closure of the wounds, and the wound structure resembled that of the

uninjured tissue, rather than scarring.35 Inducing excess inflammation during wound

healing was also shown to increase scar formation in rabbit ears.36 While these studies

implicate macrophages as the cause of scarring, studies in adult mice show positive

roles of macrophages in wound healing.

The Requirement of Macrophages for Mammalian Adult Wound Healing

While macrophages increase inflammation in a wound, they are not dispensable

for adult healing. Because of the link between inflammation and scarring, it was

supposed that removal of macrophages would results in overall better wound healing.

However, depletion of macrophages from mice wounds leads to disrupted healing.37,38

This is because macrophages are more than just pro-inflammatory cells, their

alternative activation states aid in the orchestrated events of wound healing.

Indiscriminate removal of all macrophages from the wound healing process does

decrease inflammation, but also removes the pro-healing macrophages. A classic paper

from Leibovich and Ross39 sought to deplete macrophages from wounds and reduce

phagocytic activity using an anti-macrophage serum and hydrocortisone cream. They

saw a reduction in tissue debridement, a delay in fibroblast recruitment, and an overall

delay in wound healing. However, the authors used hydrocortisone cream which has the

22

potential to affect multiple cell types. The generation of transgenic mice to target only

macrophage populations has allowed for more precise experiments to study the role of

macrophages in adult wound healing. Two mouse models have been created in which

macrophages express the diphtheria toxin receptor allowing for the depletion of

macrophages through injection of diphtheria toxin.37,40 Depletion of macrophages for the

entire wound healing process led to delayed re-epithelialization of the wound, reduced

granulation tissue/scar tissue, and decreased angiogenesis into the wound bed, and

wound closure.37,38 Depletions during the different phases of wound healing led to the

determination of the temporal functions of the macrophage over the entire wound

healing process.40 It was found that depletion of the macrophages in the inflammation

phase led to a decrease in the size of scar tissue that eventually formed due to a

decrease in the amount of granulation tissue.40 Depletion of macrophages in the tissue

formation stage resulted in instable blood vessels (hemorrhaging) in the wound bed and

persistence of granulation tissue rather than the maturation to scar tissue.40 Depletion of

macrophages during the remodeling phase did not have a significant effect on the

remodeling of the scar tissue.40 Through these depletion studies we can understand

more clearly the different roles of macrophages throughout the wound healing process.

The Axolotl Animal Model

The axolotl, Ambystoma mexicanum, is an aquatic salamander that has been

studied for over 150 years because of its amazing regenerative abilities. Most

commonly known is its ability to regenerate an amputated limb through epimorphic

regeneration; regeneration through formation of a blastema which is a mass of cells

able to reform the missing structure.41 However, axolotls can also regenerate injured

spinal cords, optic lens, cartilage, muscle, and skin.41,42 Axolotls are unique amphibians

23

because they normally do not undergo metamorphosis. This leaves them in a state of

neoteny: possessing juvenile features, gills and tail fin, at sexual maturity. Yet, even

after induced metamorphosis axolotls still retain their regenerative abilities, unlike frogs

that do not regenerate after metamorphosis.42-44 However, the immune system of the

axolotl undergoes a cryptic metamorphosis that is not linked to their anatomical

metamorphosis. During this cryptic metamorphosis there is a switch from fetal to adult

hemoglobin, and an appearance of major histocompatibility class II (MHC II) molecules

on thymocytes, T cells, and erythrocytes.45 The completion of this cryptic

metamorphosis marks a switch in immune tolerance. Before the cryptic metamorphosis

is complete, animals can receive allogenic hematopoietic transplants without developing

graft versus host disease (GVHD).46 This is when the transplanted T cells from a donor

recognizes the recipient tissues as foreign and mounts a cytotoxic immune response.

The mechanism behind this induced tolerance is unknown.

The cellular immune system components of the axolotl are very similar to the

mammalian system. Their innate immune system is comprised of

monocytes/macrophages, neutrophils, dendritic cells, eosinophils, basophils, and mast

cells.46 They have an adaptive immune system with both B and T cells, though they only

produce two classes of immunoglobulins: IgM and IgY.47 While they do have enucleated

erythrocytes, a large portion are nucleated. Unlike in mammals, the long-term

hematopoietic stem cell (LT-HSC) resides in the spleen, not the bone marrow.46

However, their adaptive immune system is not as responsive as mammals, or even

frogs.48 Because of this, they are considered as having an immature immune system.

As previously discussed, as animals age, their regenerative potential decreases. This

24

phenomenon has been correlated to the maturation of the immune system: as the

immune system matures, the regenerative potential declines.48 In the fetal wound

model, the inflammatory response is decreased compared to adult models. Mimicking

an adult response by increasing inflammation, scarring occurs. Axolotls display fetal

wound healing characteristics of a reduce presence of inflammatory cells in the wound

bed.42 The axolotl model is unique in that the growth and development of the animal is

independent of the maturity of the immune system. Thus, the effects of development

and immune maturation on regeneration can be analyzed separately in this model.

The axolotl research community has made great strides in developing the

molecular biology tools required for modern experimental techniques. Because of the

long generation time of axolotls, 8-12 months, creating germline transgenic animals is a

very time-consuming process. However, each clutch can contain 500-1000 embryos

which develop ex vivo and are roughly 3mm in size. While their development may be

slow, there are some advantages over the murine system: the embryo size makes

embryo manipulation easier, ex vivo maturation eliminates the surgical implantation,

and the quantities of available embryos in one mating increases the odds of generating

a successful integration from one spawning. Also, larval axolotls are transparent, similar

to zebrafish, such that reporter constructs expressing fluorescent proteins can be easily

screened through visual observation using a fluorescent dissecting microscope. Using

the method of co-injection of plasmid and the ISceI meganuclease into fertilized eggs,

ubiquitously expressing GFP transgenic animals were produced.41 This method has

also been used to produce animals expressing GFP under a retinoic acid promoter.49 As

new transgenic methodologies were developed for mice, they were tested in the axolotl.

25

The Tol2, zinc-finger endonuclease and Crispr-Cas9 have been successfully used to

generate axolotl transgenic animals.50,51

It was only in 2017 that a preliminary genome assembly was made available to

the community by the Ambystoma Genetic Stock Center (AGSC) at the University of

Kentucky. In 2018, another independent genome assembly was published.52 This was a

great endeavor as the axolotl genome is proposed to be 30 times larger than the human

genome; this size is attributed to very long introns, not an increase in gene number.52,53

Up till now, only a partially annotated transcriptome was available through the AGSC.

Axolotl Skin Regeneration

It has been more recently discovered that the axolotl’s regenerative abilities also

include healing wounds scar-free.42,54 After a full-thickness excisional wound punch,

which removes both dermal and epidermal layers of the skin, the site of injury

recapitulates an uninjured phenotype after about 90 days.42 Like mammals, axolotl skin

is composed of three layers: the epidermis, dermis, and hypodermis (Figure 1-2 A). The

epidermis consists of multiple layers of epidermal cells attached to the basement

membrane interspersed with the Leydig cells.42 Leydig cells are common in amphibians

and are single cell glands that undergo holocrine secretion of their contents.55 The

mucous secreted coats the skin and is thought to protect against bacterial and viral

infections.55 Under the epidermis is the dermis composed of the stratum spongiosum

and the stratum compactum.42 The stratum spongiosum is composed of collagen fibers

and contains large glands that form from the germinal layer of the epidermis.42 Using

picrosirius red stain birefringence analysis, these collagen fibers are thin type III

collagen as seen by their green hue (Figure 1-2 B,C). The function of the dermal glands

has not been fully elucidated, but the lack of a duct suggests that the contents are

26

released after damage to the skin that ruptures the gland.56 The stratum compactum is

a thick banding of collagen oriented parallel to the epidermis. The skin is highly

vascularized and a large network of blood vessels runs beneath the basement

membrane of the epidermis.

The phases of scar-free wound healing of the axolotl are similar to that in

mammals, but the outcome is regeneration rather than scarring. There is an influx of

immune cells into the wound bed, fibroblasts are recruited to lay down ECM, which is

then remodeled the reform the skin to its original uninjured state.42 However, there are

some differences between the two (Figure 1-3). Re-epithelialization occurs very rapidly

in the axolotl; within 24 hours the wound bed is covered with a wound epithelium which

can take a week to complete in mice.42,54 There is a reduction in the number of immune

cells recruited into the wound bed of an axolotl.42 The deposition of the transitional ECM

by the fibroblasts is delayed until day 10, but begins being deposited within days after

wounding in mammals.42 This comparative biology approach to scar-free wound healing

highlights some important areas that should be investigated as possible requirements

for regeneration. While the immune system plays an important role in mammalian

wound healing, the role of the immune system for axolotl skin regeneration is unknown.

Macrophage Contribution to Axolotl Regeneration

Macrophage depletion studies in axolotl have been accomplished through the

use of clodronate encapsulated liposomes.57 Injection of clodronate-liposomes

intravenously depletes circulating monocytes/macrophages.57 Phagocytosis of the

clodronate-liposomes releases clodronate into the cytoplasm of the phagocyte

ultimately resulting in mitochondrial dysregulation and death.58-61 Thus, the circulating

pool of monocytes able to be recruited to a wound is diminished. Clodronate-liposomes

27

have been used to study the role of macrophages in axolotl limb regeneration. Depletion

of macrophages before amputation of a limb results in failure to regenerate the limb

associated with accumulation of collagen at the amputation site.57 However, if the limb

is first amputated and allowed to develop the blastema before macrophage depletion,

the limb is able to regenerate normally.57 The exact function of the early macrophages

in limb regeneration has not been determined. Yet, the first stage of limb regeneration is

wound healing of the amputation site.48 It may be that without macrophages, wound

healing is dysregulated preventing limb regeneration.

Generation of Axolotls with Fluorescent Immune Systems

To study the role of the axolotl immune system in regeneration, our lab

developed methods for creating chimeric axolotls with fluorescent immune systems

(Figure 1-4).46 Transplanting spleen cells from a GFP animal into a non-fluorescent

white animal, results in engraftment of GFP+ HSCs that produce GFP+ blood lineages

that can be visualized flowing through the blood stream and in the skin.46 Recruitment of

GFP+ immune cells can be visualized in these animals in response to injection of the

irritant thioglycollate, as well as phagocytosis of pHrodo E.coli injected into the skin.46

Irradiation of adult axolotls followed by transplantation increases chimerism, but the

GVHD occurrence is greater than 75% when using adult donor tissue.46 Because

axolotls are not fully inbred strains like research mouse strains, transplants are allogenic

rather than syngenic, and are prone to the development of GVHD.46 The occurrence of

GVHD can be lowered to less than 25% by using juvenile donor tissue from animals

less than 6 months of age, but not completely eliminated.46 Currently, the only method

to circumvent GVHD is to transplant into larval animals, presumably because the larval

microenvironment inhibits the mature donor T cells cytotoxicity.46 This method requires

28

a year incubation time for animals to grow to the size for experimental use. Our goal is

to develop a strategy to transplant into adult animals without GVHD development.

Isolation of Axolotl Hematopoietic Stem Cells

Isolation of the HSC from the T cells is a strategy to decrease GVHD rates.62 In

mice and humans, this is normally done with a cocktail of antibodies to select for HSCs

and select against any differentiated cells.62 However, the available antibody repertoire

for the axolotl is not robust enough for this strategy. Other antibody-free methods have

previously been successfully used in mice. The use of stem cell enrichment through

differential activity levels of aldehyde dehydrogenase (ALDH) has been used to isolate

HSCs in mice and humans.63,64 Stem cells have increased activity of the detoxifying

ALDH enzyme, thus through accumulation of a fluorescent substrate, cells can be

sorted based an ALDH activity based on fluorescence intensity.65 Another non-antibody

HSC enrichment strategy successfully used in mice is centrifugal counterflow elutriation

(CCE). This method uses opposing forces of flowrate and centrifugal force to separate

cells based on their size and density ,and has been shown to resolve the LT-HSC from

more differentiated hematopoietic progenitors in mice.66

Thesis Rationale and Goals

The lack of effective treatments for the reduction of scar tissue suggests a gap in

knowledge of how skin regeneration works. Using a comparative biology approach,

studying skin regeneration in the axolotl should lead to the discovery of potential targets

and therapeutics to reduce scarring in mammals. The macrophage is a key modulator of

wound healing in mammals, with early macrophages linked to increased scar tissue

formation. Conversely, early macrophages in axolotl limb regeneration tips the balance

between scarring and regeneration. Their absence results in failure to regenerate limbs

29

along with increase in fibrosis.57 In relation to skin regeneration, the role of axolotl

macrophages is still unknown. We hypothesized that a lack of macrophages during the

early stages of wound healing would lead to scarring in the axolotl skin. Histological

analysis was used to determine the gross changes that occurred during wound healing

with depleted early macrophages. To further study the role of the immune system in

axolotl regeneration, there is a need to efficiently produce hematopoietic chimeric

animals. Currently, the incidence of GVHD is too high and needs to be circumvented.

Enrichment of the axolotl HSC to reduce levels of transplanted T cells is required to

prevent GVHD. We hypothesized that we could adapt CCE, an antibody-free method of

HSC enrichment previously used in mice and humans, for axolotl use and enrich the

axolotl HSC.

30

Figure 1-1. iNOS and arginase metabolism of arginine.26

31

Figure 1-2. Normal architecture of axolotl skin. A) Skin section stained with Masson’s

Trichrome labeled with the prominent features of uninjured skin. B) Picrosirius Red stain under polarized light demonstrates uninjured collagen composition of axolotl skin. C) 20X magnification of rectangle in (B) shows the stratum compactum formed of large bundles of collagen running parallel to the epidermis contrasted to the thinner collagen fibers running perpendicular to the epidermis in the stratum spongiosum.

32

Figure 1-3. Comparison of events during axolotl wound regeneration and mammalian

wound scarring.42

33

Figure 1-4. Methods for creating axolotl hematopoietic chimeras. A) Hematopoietic

progenitors are only found in the liver and spleen of axolotls. B) Injection into irradiated adult white axolotls using GFP+ adult donor liver and spleen cells results in > 75% GVHD. Injection into irradiated adult white axolotls using GFP+ juvenile liver and spleen cells reduced GVHD to less than 25%. C) Injection of GFP+ adult liver and spleen cells into non-irradiated, larval white animals results in no GVHD.

34

CHAPTER 2 AXOLOTL MACROPHAGES IN SKIN REGENERATION

It has been suggested that a better understanding of regeneration through the

study of regenerative species is required before meaningful progress can be made to

promote regeneration in mammals. To this end, Seifert et al42 characterized the normal

axolotl wound healing process. By understanding axolotl wound healing, we can use

comparative biology to highlight differences that may be important to promote

mammalian regeneration. One of these differences found by Seifert et al42 was a

significant delay in ECM deposition. Mammalian macrophages are known regulators of

fibroblasts and collagen deposition associated with fibrosis during wound healing. The

axolotl macrophage may be differentially regulating fibroblasts to promote regeneration.

Our study investigates the role of macrophages in axolotl skin-wound

regeneration. We hypothesized that depletion of early macrophages would result in scar

formation in the axolotl. We used full-excisional flank wounds to study the macrophage

role specific to wound healing. We also sought to validate common markers used for

neutrophils and macrophages identification and began the work to assess axolotl

macrophage polarization in vivo.

Materials and Methods

Axolotl Maintenance

Axolotls were maintained in 40% Holtfreter’s solution at 18-21C on a 12-hr light,

12-hr dark cycle. Animals were purchased from the Ambystoma Genetic Stock Center

or bred in-house. This study was approved under the University of Florida Institutional

Animal Care and Use Committee protocol 201502645.

35

Axolotl Buffer Preparation

As a general note, axolotl cells have a different osmolarity compared to

mammalian cells, thus common buffers and medias are required to be diluted to 0.7X

strength when used for axolotl cells. Also, being cold-blooded animals, their internal

body temperature matches their housing temperature. Therefore, cells are cultured at

the same temperature that the animals are kept (18-21C).

Preparation of PBS- and Clodronate-Liposomes

The in-house clodronate was prepared using the procedure of Pi et al67 modified

from the original procedure of Rooijen and Sanders68. 80L of cholesterol solution

(100mg/mL in chloroform) (Sigma-Aldrich, 47127-U) and 80L Egg-phosphotidylcholine

(20mg/mL in chloroform) (Avanti, 840051C) were combined in a glass scintillation vial.

Chloroform was evaporated using N2 gas with subsequent low-pressure vacuum in a

speedvac for 1hr. For PBS-liposomes or clodronate-liposomes, 5mL of PBS or

clodronoate solution (20mg/mL) (Sigma-Aldrich, D4434) was added to the vial

respectively. The vials were shaken at RT on an orbital shaker for 30min, then

sonicated for 30min. The samples were ultracentrifuged for 1hr at 35,000 rpm at 4°C.

The clodronate liposomes form a layer on top of the liquid phase. The lower liquid was

extracted using a syringe and 5mL of PBS was added to wash the clodronate-

liposomes. PBS-liposomes pellet, thus the supernatant was aspirated and 5mL of PBS

was added to resuspend the PBS-liposomes. The ultracentrifugation was repeated and

supernatants aspirated as both PBS- and clodronate-liposomes pellet. Both liposomes

were resuspended both liposomes in 4mL PBS and stored at 4°C and used within 1

month.

36

Depletion of Macrophages and Full-Thickness Excisional Wounding

The clodronate-liposomal depletion strategy used was adapted from previous

studies. 57,69 Clodronate-and PBS-liposomes were sourced from Encapsula Nano

Sciences or made in-house. The liposomes were administered to adult axolotls >17cm

intravenously into the hind-leg veins using an insulin syringe every-other-day for a total

of 3 injections. Dosages of 1.54g/g per injection for in-house liposomes, or 1.75g/g

per injection for commercial liposomes were used. Twenty-four hours after the final

injection, full-thickness excisional (FTE) wounds, to include some of the underlying

muscle, were made on the backs of the animals, between the front and hind limbs,

using a sterile 2-mm biopsy punch (Integra Miltex, mfr. No. 33-31). Over the course of

wound healing, punches were collected using a sterile 4-mm biopsy punch (Integra

Miltex, mfr. No.33-34) and processed for histological analysis.

Analysis of Collagen Fibers

To determine the amount of collagen in the wound bed, images of Masson’s

Trichrome stained sections were analyzed using FIJI software using a macro kindly

given by George Marek, PhD (Figure A-1). Briefly, within the bounds of the wounded

area, delineated by injured stratum compactum, blue staining was detected and the

number of blue pixels was quantified. Welch’s unpaired t test was performed using

Prism 7 software (Graphpad Software). Significance was defined as a p value < 0.05.

Collection of Intraperitoneal Macrophages

Axolotls > 15cm were anesthetized in 0.1% ethyl 3-aminobenzoate

methanesulfonate salt (MS-222; Sigma-Aldrich) until the animals no longer respond to

being up-side down. Resident intraperitoneal (IP) macrophages were collected through

lavage of the peritoneal cavity with amphibian phosphate buffered saline (A-PBS, 0.7X

37

PBS). The macrophages were pelleted at 1000xg for 5min at 4°C and re-suspended in

10%FBS/A-PBS. Elicited macrophages were collected 5 days after IP injection of 3%

thioglycollate, (500L-1.5mL of thioglycollate was used depending on size). The

peritoneal cavity was lavaged with A-PBS and cells were pelleted at 1000xg for 5min at

4°C and re-suspended in 50mM EDTA/10%FBS/A-PBS. To remove contaminating

neutrophils, elicited IP cells were layered over Ficoll-Hypaque and centrifuged at 500xg

for 30min at room temperature (RT). The resulting buffy coat was isolated and washed

with 10% FBS/A-PBS and pelleted at 1000xg for 5min at 4°C and re-suspended in

10%FBS/A-PBS. For studying neutrophil and macrophage markers, the neutrophil

population was not removed.

Isolation of Peripheral White Blood Cells

Axolotls were anesthetized in 0.1% ethyl 3-aminobenzoate methanesulfonate salt

as described previously. Peripheral blood was drawn from the hind-leg vein using an

insulin syringe coated with 50mM EDTA/A-PBS. The blood was diluted into 500L of

50mM EDTA/10%FBS/A-PBS and layered over Ficoll-Hypaque and centrifuged at

500xg for 30 min at RT to red blood cells (RBCs). Some neutrophils remain in the Ficoll

layer and do not fully pellet with the RBCs. To collect neutrophils as well, the entire

volume above the RBC pellet was collected and washed with 10%FBS/A-PBS and

pelleted at 1000xg for 5 min at 4°C. The pellet was re-suspended in 10%FBS/A-PBS.

Cytospins were prepared using a cytocentrifuge at 600xg for 4 min.

Cytochemical Staining of Axolotl Cells

Slides of cytospun cells were stained using Naphthol AS-D Chloroacetate

staining (CAE) kit (Sigma-Aldrich; 91C), -Naphthyl Acetate Esterase (ANAE) kit

38

(Sigma-Aldrich; 91A,), or Myeloperoxidase (MPO) kit (Sigma-Aldrich; 390A,). The

manufacturer’s protocol was used with the following modifications:1) reaction volumes

were scaled down to 100L total volume/cytospin, 2) for MPO staining, 0.17mg of

peroxidase indicator reagent was used per 100L reaction volume, 3) incubation time

ranged from 20-30 min for MPO and 15min for ANAE. For double staining with CAE and

ANAE, the manufacturer’s protocol was followed with the decreased reaction volumes.

Labeling of Macrophages with Rhodamine-Dextran

Rhodmaine –Dextran (2,000,000 MW) (Thermo Fisher Scientific, D7139) was

resuspended in A-PBS to a working stock of 5mg/mL. The rhodamine-dextran was IV

injected at a dosage of 250g/20cm as previously described.57 Blood was drawn 24 hr

later and white blood cells (WBCs) isolated and cytospun to assess the phenotype and

staining of dextran+ cells.

Histology, Immunohistochemistry, and Immunocytochemistry

Tissues were collected in 4% paraformaldehyde and fixed at 4°C for 16-32 hr.

The tissues were washed with PBS and equilibrated in a series of sucrose solutions in

A-PBS at 4°C: 10%, 10:30% (2:1). 30:10% (2:1), 30%. Tissues were equilibrated in

Tissue-Tek ® O.C.T. compound, then frozen in a dry-ice/2-methyl butane bath. Tissues

were sectioned on a Leica cryostat at 12m thickness and air-dried overnight. Slides

were stained for collagen using Masson’s Trichrome Stain (American Master Tech;

KTMTRPT) and Picrosirius Red Stain (American Master Tech; KTPSRPT) according to

manufacturer’s protocol.

For immunohistochemistry (IHC) of the liver, slides were fixed in -20°C acetone

for 20 min. Slides were washed 2X with PBS for 3 min each. Slides were incubated with

39

Peroxo Block (Thermo Fisher Scientific; 002015) for 45 sec. Slides were washed and

blocked with 10% (vol/vol) goat serum in antibody diluent (Life technologies, cat.

003118) for 1hr at RT. Biotin was blocked using Avidin/Biotin blocking kit (Vector

laboratories; SP-2001); 15min Avidin blocking followed by 15 min Biotin blocking at RT.

Slides were washed and incubated with primary antibody diluted in antibody diluent

overnight at 4C in a humidified chamber. Slides were washed and incubated with

biotinylated secondary antibody in antibody diluent for 1hr at RT. Slides were washed

and incubated with Vectastain Elite ABC HRP (Vector Laboratories; R00018) for 30 min

at RT. Slides were washed and incubated with DAB substrate (Vector Laboratories, SK-

4100) with nickel to form a black precipitate. Antibodies: Arginase (Abcam; ab91279,

Rabbit polyclonal) 20g/mL, Biotinylated Goat-anti-Rabbit (Vector Laboratories; BA-

1000) 1:200.

For immunocytochemistry (ICC)-immunofluorescence (IF), slides of cytospun

cells were fixed and permeabilized in -20C methanol for 5 min and air-dried for at least

20 min. Cells were blocked with Fc Receptor Blocker (Innovex Biosciences; NB309-30)

for 1 hr at RT. Cells were washed 2X with PBS for 3 min each then blocked with 10%

(vol/vol) serum in antibody diluent (Life technologies; 003118) for 1hr at RT. Cells were

washed then incubated with primary antibody in antibody diluent overnight at 4C in a

humidified chamber. Cells were washed then incubated with appropriate fluorescent

secondary antibody in antibody diluent for 1hr at RT. Cells were washed then fixed with

4% paraformaldehyde (PFA) for 3 min to preserve nuclear architecture. Cells were

washed then mounted with Vectashield with DAPI (Vector Laboratories; H-1200).

Primary antibodies: Neutrophil Elastase (Abcam; ab21595, Rabbit polyclonal) 1:50,

40

F4/80 (AbDSerotec; MAP497, Rat monoclonal) 20g/mL, GFI-1 (Abcam; ab21061,

Rabbit polyclonal) 20g/mL, PU.1 (Abcam; ab83399, Rabbit polyclonal) 20g/mL, CD68

(Abcam; ab53444, Rat monoclonal) 5g/mL, CD11b (Biolegend; 101201, Rat

monoclonal: clone M1/70) 20g/mL, NIMP (Abcam; ab2577, Rat monoclonal) 10g/mL,

iNOS (Abcam; ab3523, Rabbit polyclonal) 20g/mL, Arginase (Abcam; ab91279, Rabbit

polyclonal) 20g/mL, Rabbit IgG (isotype control) (Abcam,ab172730), Rat IgG isotype

control (Pharminogen; 559478). Secondary antibodies: Fluorescin Goat anti-Rabbit and

Fluorescin Goat anti-Rat (1:200).

Microscopy was performed on a Leica DM5500B microscope using a

Hamamatsu digital camera (model C7780) and Volocity Imaging Software (Perkin

Elmer).

Phagocytosis Assay

pHrodo® E.Coli bioparticles (10mg) were re-suspended in 2mL of 10%FBS/A-

PBS, vortexed and sonicated for 5 min to remove clumps to give a 5mg/mL solution.

2x104 resident or elicited macrophages were mixed with the bioparticles after collection

from the animal and incubated with bioparticles (2.5mg/mL) in 10%FBS/A-PBS in glass

culture tubes for 3hr at 18-20°C or on ice, protected from light. The cells were pelleted

by 1000xg centrifugation for 5min at 4C and resuspended in 50mM EDTA/10%FBS/A-

PBS. The cells were analyzed for fluorescence using a BD FACS Canto II flow

cytometer and FACS DIVA software. In vitro polarized macrophages were incubated

with the bioparticles directly in the culture plate. For flow analysis, the macrophages

were lifted from the plates by incubating the cells with 50mM EDTA in A-PBS on ice for

41

10min. The cells were pelleted by 1000xg centrifugation for 5min at 4C and

resuspended in 50mM EDTA/10%FBS/A-PBS.

RNA Isolation and First Strand cDNA Synthesis

RNA was isolated from spleen cells, pokeweed mitogen stimulated spleen cells,

and elicited IP cells. Cells were pelleted at 1000xg for 5min at RT. The supernatant was

removed and cells were lysed with 1mL of RNAzol® RT by pipetting. The solution was

transferred to a 1.5mL microcentrifuge tube and 0.4mL of RNAse/DNAse free water was

added. The tube was then shaken for 15 seconds and allowed to sit at RT for 15 min.

The solution was centrifuged for 10 min at 12,000xg at RT to pellet protein and genomic

DNA. The supernatant was transferred to a Zymo Directzol™ RNA miniprep column

(R2070) and the RNA was isolated according to the manufacturer’s protocol. First

strand cDNA synthesis was performed on the resulting RNA using New England

Biolab’s Protoscript® First Strand cDNA synthesis kit (E600S). The cDNA was stored at

-20°C until use.

Primer Design

Arginase: The human ARG1 messenger RNA (mRNA) sequence was blasted

against the axolotl transcriptome using the AGRC’s online database found at

http://www.ambystoma.org/genome-resources. The sequences of the best-matched

contigs were then used as a template for primer design using NCBI’s Primer Blast

(https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Primer pairs with high G for

homodimers/heterodimers and having similar Tm values were selected as candidates.

iNOS: The human NOS2 protein sequence was analyzed using the Pfam

database for protein domain regions (https://pfam.xfam.org). The mRNA sequence

42

encoding for the NO synthase domain was then blasted against the axolotl

transcriptome database resulting in one significant contig result. The longest open

reading frame (ORF) of the contig was then searched for domains in Pfam. Pfam

predicted the presence of an NO synthase domain. The corresponding mRNA

sequence was used as the template for primer design using the NCBI primer design

website. Primer pairs were selected in the same manner as previously described.

Polymerase Chain Reaction

cDNA isolated from whole spleen, pokeweed mitogen stimulated cell cells, and

IP macrophages was tested for the presence of iNOS and arginase. GAPDH and B-

actin were used as positive controls. NEB’s Taq 2X Mastermix (New England Biolabs,

M0270) was used with 1M of primers and 2.5L of cDNA. The polymerase chain

reaction (PCR) ran for 40 cycles then was analyzed on 2% agarose gels. Primers:

Arginase: forward CCAAAAGTCCATAGGCGTC, reverse

GATCCAAACCATCCACATCAA; GAPDH70: forward GAC AAG GCA TCT GCT CAC

CT, reverse ATG TTC TGG TTG GCA CCT CT; B-actin71: forward

GCCCTGGCACCAAAGCACAATG, reverse GTTGGGCAGCCTTCATGGAGG. No

primers are listed for iNOS as a valid primer set has not been found.

Sequencing of PCR Products

The arginase PCR product was cloned using the TOPO TA cloning kit (Thermo

Fisher Scientific, 450640) according to the manufacturer’s protocol. Chemically

competent E.coli (Thermo Fisher Scientific, 18258012) were transformed with the

plasmid according to the manufacturer’s protocol. Transformed E.coli were plated onto

ampicillin (100g/mL) LB-agar plates and incubated at 37°C overnight. White colonies

43

were picked and grown in 5mL LB broth with 100g/mL ampicillin overnight at 37°C at

270 rpm. The plasmid containing the PCR product was isolated using Qiagen’s

QIAprep Spin Miniprep plasmid kit (27106) according to manufacturer’s protocol. The

plasmid was sequenced by GENEWIZ.

In Vitro Polarization of Axolotl Macrophages

Isolated D5 elicited IP macrophages were seeded in 12-well culture plates at a

concentration of 2x104 cell/well in 10%FBS/1X penicillin-streptomycin/1X insulin-

transferrin-selenium/70% L-15, pH6.4 and allowed to adhere overnight at ambient

axolotl room temperature (18°C). For M1 polarization, cells were co-stimulated with

murine INF (250U/mL) (Peprotech, 315-05) and LPS (100ng/mL) (Sigma, L2630). For

M2 polarization, cells were stimulated with murine IL4 (20U/mL) (Peprotech, 214-14).

Cells were stimulated for 32 hr at 18°C. After stimulation, the cells were rinsed and

incubated with pHrodo bioparticles for phagocytosis analysis, or lifted and cytospun for

iNOS and arginase ICC-IF.

Experimental Results

Clodronate-Liposome Treatment Increases Collagen Deposition

To study the role of early macrophages in axolotl skin regeneration, we used

intravenous injection of clodronate-liposomes (Clo-lipo) to deplete early macrophages

as first described by Godwin et al57 and later modified by Yun et al69. Because of our

current inability to distinguish neutrophils from macrophages, we chose to include an

internal control of macrophage depletion: limb amputation. Godwin et al57 found that

limb regeneration was inhibited after their full schedule of Clo-lipo treatment. Therefore,

we amputated a limb after our depletion strategy to verify sufficient depletion of

44

macrophages. Phosphate buffered saline-liposomes (PBS-lipo) were used in the control

group. Initial wounds were made with 2mm biopsy punches 24 hr after the final injection

of liposomes; at this time, the front-left limb was also amputated. Collection of the

healing wounds, using 4mm biopsy punches, was performed throughout the different

stages of wound healing (Figure 2-1). The first trial of Clo-lipo treatment demonstrated

inhibition of limb regeneration, evident at day 30 (Figure 2-2). We monitored collagen

deposition using Masson’s Trichrome stain which will stain collagen fibers blue. We

found that both PBS-lipo and Clo-lipo wounds started showing signs of collagen

deposition by day 10 (Figure 2-3) as previously reported.42 Thus, the delay in ECM

deposition seen in axolotl skin regeneration is not regulated by early macrophages.

However, by day 30, the Clo-lipo wounds had more collagen deposition (Figure 2-3).

The experimental design for this preliminary trial did not include dorsal wound analysis

past 30 days. However, histological examination of the un-regenerated limb over a year

later showed excessive dermal fibrosis (Figure 2-4). A second experimental trial of

clodronate-liposome macrophage depletion was performed with the experimental

design changed to include wounds to be sampled at later timepoints (90 and 120 days

post wounding) to assess the fate of the excess collagen in the dorsal wounds.

However, the limbs of the Clo-lipo animals regenerated, but perhaps with affected blood

vessel stability (Figure 2-5). This variability may have been the result of batch-to-batch

concentration variation of the in-house clodronate-liposome preparation. Manufactured

clodronate-liposomes were sourced, and a third trial was performed with the same

experimental design from the second trial (Figure 2-1 C). Again, Clo-lipo animals

showed signs of limb regeneration by day 30. This trial represents a partial depletion of

45

macrophages as the administration of clodronate-liposomes will have depleted

macrophages, just not to the level to inhibit limb regeneration. Analysis of wounds after

30 days showed an unexpected increase in collagen deposition, similar to that seen

from trial 1 Clo-lipo animals with fully-depleted macrophages (Figure 2-6 A,C,D). To see

if this extra collagen was eventually remodeled, we analyzed the collagen content of

Clo-lipo wounds after 90 days, which is when the literature reports that the wounds

should have recapitulated the uninjured phenotype.42 We found that the PBS-lipo and

Clo-lipo wounds were still healing, and had similar amounts of collagen in the healing

area (Figure 2-6 B,C,E). The collagen present also showed signs of regenerative

remodeling as the stratum spongiosum collagen content was decreasing, while the

stratum compactum was re-forming. Picrosirius Red stain can differentiate collagen fiber

thickness under polarized light. The hue corresponds to the thickness of the collagen

fibers. Green fibers are thinner, while yellow to red fibers are thicker. To the naked eye,

no differences in stratum spongiosum collagen fiber thickness were found between

PBS-lipo and Clo-lipo at day 30 or day 90 (Figure 2-7). Future hue analysis will be

performed on these pictures as described by Rich and Whittaker72 to confirm this

observation. Thus, even when the levels of macrophages are depleted above the

threshold to prevent limb regeneration, there is still an effect on collagen deposition.

However, at this level, the extra collagen is able to be remodeled towards an uninjured

phenotype and does not become scar tissue.

Differentiating Between Axolotl Neutrophils and Macrophages

For this wound healing study, it is important to be able to distinguish neutrophils

from macrophages. Both are normally present during the early stages of wound healing,

but our aim is to specifically target the macrophage population for depletion. To confirm

46

depletion of only early macrophages, and to monitor the return of macrophages to the

wound bed, we will stain wound sections for macrophage and neutrophil specific

markers. In previous studies, the use of common mouse reagents for macrophage and

neutrophil detection have been applied to the axolotl for the distinction of these two

populations: Naphthol AS-D Chloroacetate (CAE)57, neutrophil elastase57,

myeloperoxidase42, and Sudan Black B42 for neutrophils, and -Napthyl Acetate

Esterase (ANAE)57,69, 2M dalton Rhodamine-Dextran micropinocytosis57, F4/8046,57,69,

CSF1R57, and CD11b57 for monocytes/macrophages.

We sought to confirm these markers for distinction between neutrophil and

macrophage populations. While distinguishing nuclear morphology of neutrophils and

macrophages can be difficult in tissue sections, it can be done using cytospin

preparations. Monocytes/macrophages have mononuclear, circular or bean-shaped

nuclei (Figure 2-8), whereas neutrophil nuclei are multi-lobed or doughnut shaped with a

variety of morphologies seen in cytospins (Figure 2-8). Thus, cytospins of neutrophils

and monocyte/macrophages allows for analysis of reagent specificity due to the ability

to identify each cell type through morphology. Two sources of cells were used for

reagent testing: cytospins of peripheral white blood cells (WBCs) and elicited

intraperitoneal (IP) cells, which contain macrophages and neutrophils. As in mice,

intraperitoneal irritation by IP injection of thioglycollate elicits neutrophils and

macrophages into the peritoneal cavity.

Esterase chemistry is widely used by hematologists to distinguish between

monocytic and granulocyte lineages. The CAE reaction is used to stain human

neutrophils73-76, whereas the ANAE reaction stains human monocytes73,76. We stained

47

cytospins of both peripheral blood WBCs and elicited peritoneal cells with CAE and

ANAE. We found monocytes/macrophages and neutrophils stained positive with both

stains (Figure 2-9). Double staining with CAE and ANAE showed that the enzymes are

co-expressed in these cell lineages (Figure 2-9). There was one unknown cell type in

which CAE appeared to stain cytoplasmic granules which were still apparent after

ANAE staining (Figure 2-9). This cell type is not seen when staining peripheral WBCs

with CAE. Myeloperoxidase (MPO) is another enzymatic stain used to identify

neutrophils. While human monocytes and macrophages can stain positive, it is less

intense than the staining seen in neutrophils.77,78 Testing MPO enzymatic staining,

axolotl neutrophils stained intensely (Figure 2-9), while monocytes/macrophages ranged

in the intensity of their staining: from no staining to intense staining (Figure 2-11 A-C).

Sudan Black B is another common stain used for neutrophil identification and mirrors

myeloperoxidase staining in humans.79 Staining of peripheral blood WBCs showed

staining of neutrophils, not monocytes/macrophages (Figure 2-9). From these results,

differentiation between neutrophils and monocytes/macrophages cannot be

accomplished based on esterase or MPO enzymatic staining alone.

Monitoring of monocytes/macrophages levels in axolotl peripheral blood by

injection of 2,000,000 MW rhodamine-conjugated dextran has been used in previous

studies.57 The size of the dextran prohibits diffusion out of the blood vessels thus

allowing it to be macropinocytosed within the blood stream. While monocytic cells are

the main cells to uptake the dextran, circulating neutrophils could also macropinocytose

it as well. To see which cells were labeled with the dextran, cytospins of peripheral

WBCs of rhodamine-dextran injected animals were prepared. The cells were then

48

stained with CAE and MPO. All dextran+ cells were mononuclear and stained positive

with CAE and MPO cytochemical stains (Figures 2-10, and 2-11 B,C). However, not all

mononuclear cells that stained positive for CAE or MPO were dextran+. Thus, while it

appears only mononuclear cells uptake the rhodamine-dextran, not all mononuclear

cells are labeled at the current dosage. Thus, this method does allow for the monitoring

of relative, not absolute levels of monocytes cells in the peripheral blood.

Antibody staining has also been used in axolotl publications to distinguish

between macrophages and neutrophils. Because there are only a handful of antibodies

raised against axolotl proteins, most antibody staining is accomplished through cross-

species reactive antibodies. Neutrophil elastase (Abcam) and myeloperoxidase

(Thermo, B-373-A) antibodies have been used to identify axolotl neutrophils. Cytospins

of elicited neutrophils and macrophages were stained for neutrophil elastase. At

20g/mL, neutrophils intensely stained with some faint macrophages staining (Figure 2-

12). The MPO antibody is currently untested. F4/80 is a common marker found on

murine, but not human, macrophages. Two clones of F4/80 have been used in axolotl

publications; AbDSerotec clone CI-A3-146, and Biolegend clone BM857. The clone CI-

A3-1 was tested on the mixed population of elicited macrophages and neutrophils.

Neutrophils were the most intensely staining cells, while macrophage staining was

variable (Figure 2-12). These results suggest that the antibodies used, while cross-

reactive, are not staining the same cell populations as in mice. The published CSF1R

antibody has since been discontinued, thus another rabbit polyclonal antibody from

Abcam will be tested along with the F4/80 clone BM8. The published CD11b antibody

did not show cross-reactivity in our hands (Figure 2-12). Besides the published markers,

49

we also tested other potential markers of neutrophils and macrophages. We tested

antibodies for transcription factors GFI-1 and PU.1 that are required for differentiation of

hematopoietic cells toward either granulocytic or monocytic lineages respectively.80,81 In

mice, PU.1 is expressed in mature macrophages and granulocytes, while GFI-1 is only

expressed in granulocytes.80,81 Surprisingly, we found GFI-1 staining the cytoplasm of

both macrophages and neutrophils, while PU.1 stained neutrophils and macrophages

less intensely: at the periphery of the nucleus in neutrophils and in the cytoplasm of

macrophages (Figure 2-12). With PU.1, there was more intense staining of lymphocytes

that may be B cells which also express PU.1 in mice.80 CD68 is another maker used for

the identification of macrophages in murine models.82 However, in the axolotl no cross-

reactivity was seen (Figure 2-12). NIMP is an anti-neutrophil antibody that showed no

cross-reactivity in axolotl cells (Figure 2-12).

In summary, the data suggest that the neutrophil elastase antibody would best

monitor neutrophil levels between PBS-lipo and Clo-lipo tissue sections to verify that

Clo-lipo treatment does not affect neutrophil numbers in the wound bed. For

monocyte/macrophage detection within the wound bed, labeling with 2M Dalton

rhodamine-dextran prior to wounding would be the best choice.

Characterization of Axolotl Macrophage Polarization

It has been shown in mice that macrophages have distinct functions during the

different stages of wound healing. With the change in function must come a change in

phenotype. It is thought that early macrophages are pro-inflammatory then transition to

a more anti-inflammatory, pro-wound healing state later in the healing process. Because

inflammation is linked with scar tissue formation, it may be that axolotls to do not form

scar tissue because there is a decreased inflammatory response to a wound. Indeed,

50

there is less immune cell recruitment to the wound bed in axolotls compared to mice.42

Before we can determine the inflammatory state of axolotl macrophages in wound

healing, we need to validate markers for pro-inflammatory and pro-healing

macrophages. We wanted to test the widely accepted markers of iNOS and Arginase as

indicators of pro-inflammatory and pro-healing macrophages. 83,84 This requires

generating both pro-inflammatory and pro-healing macrophages as positive controls.

While in mice this is commonly achieved through exogenous polarization in vitro using

the cytokines IFN and IL4, we decided to test naturally occurring populations of

macrophages with probable pro-inflammatory and non-inflammatory states. This

circumvents the possibility of non-stimulation because of recognition failure of axolotl

receptors with murine cytokines. We chose to examine two peritoneal macrophage

populations: resident and elicited. Resident peritoneal macrophages are the population

of macrophages in the peritoneal cavity under normal homeostasis conditions. Elicited

peritoneal macrophages are the macrophages that infiltrate the peritoneal cavity in

response to IP injection of thioglycollate. In mice and rat models, these populations

show expression of iNOS and arginase.85-88 While axolotl elicited IP cells are a mixed

population of neutrophils and macrophages (Figure 2-13 A), neutrophils can be

removed after centrifugation over Ficoll-Hypaque (Figure 2-13 B). Resident IP cells are

mainly macrophages with few contaminating neutrophils (Figure 2-13 A).

Phagocytosis as a marker of inflammation status

A functional characteristic of inflammatory macrophages is their phagocytic

activity. While macrophages normally have basal levels of phagocytosis while

maintaining homeostasis, this activity is increased when in a pro-inflammatory activation

51

state. Thioglycollate elicited IP cells have increased phagocytic activity in both rats and

mice.88,89 The use of pHrodo E.coli allows for the detection of phagocytosed bacteria

versus adherent extracellular bacteria. As the bacteria is phagocytosed, the phagocytic

vacuoles become acidified. In this acidic environment, the pHrodo E.coli fluoresce, thus

the fluorescent signal corresponds to phagocytosed bacteria. Resident and elicited

peritoneal macrophages were incubated with pHrodo E.coli to assay their phagocytic

activity. After 3 hr, macrophages were analyzed using flow cytometry for presence of

phagocytosed fluorescent bacteria. We found elicited macrophages had almost double

the number of phagocytic macrophages compared to resident macrophages (Figure 2-

13 D,E). These results suggest that elicited macrophages are more polarized toward a

pro-inflammatory phenotype.

Testing resident and elicited IP macrophages for expression of iNOS and arginase

We ultimately want to use antibody staining of iNOS and arginase in our wound

healing studies to delineate between pro-inflammatory, M1, and pro-healing, M2,

macrophages respectively. To test if antibodies for mouse iNOS and arginase will cross-

react with axolotl proteins, we used axolotl liver as a positive control for arginase84, and

thioglycollate elicited neutrophils for iNOS90. Both antibodies showed cross-reactivity

with the corresponding axolotl controls (Figure 2-14). We then stained resident and

elicited peritoneal macrophage populations for expression of iNOS and Arginase (Figure

2-15). Interestingly, both proteins were expressed in resident and elicited macrophages,

but with increased staining in the resident macrophages. Resident macrophages had

arginase staining within the nucleus as well as the cytoplasm (Figure 2-15), while

elicited macrophages displayed mainly cytoplasmic staining (Figure 2-15). However, the

52

spatial expression would need to be confirmed using confocal microscopy. For both

resident and elicited macrophages, the iNOS staining was mainly in the cytoplasm.

Often times, the expression of iNOS and arginase is mutually exclusive. Based on these

co-expression results, the inflammatory status of elicited and resident macrophages

cannot yet be determined.

Development of PCR primers for iNOS and arginase expression

PCR is often used to detect gene expression changes of iNOS and arginase in

polarized macrophages.85,87 To see if mRNA expression correlates with our protein

staining data, we designed primers for both iNOS and arginase based on the axolotl

transcriptome as described in the methods section. First attempts to design iNOS

primers used axolotl cDNA contig sequence hits from blasting the whole human iNOS

mRNA sequence against the axolotl transcriptome. Primers tested on axolotl splenic

cDNA did not produce a PCR product. To try and induce iNOS expression, axolotl

spleen cells were incubated with pokeweed mitogen for 1-24 hrs. Previously published

GAPDH and B-actin primers were used as controls for cDNA quality. Still, no PCR

product was formed. The human iNOS protein contains four domains: an NO synthase

domain, flavodoxin domain, FAD binding domain, and oxidoreductase-NAD binding

domain (Figure 2-16 A). Searching the longest open reading frame of the axolotl contig

in the Pfam database showed only the last three domains. We decided to search the

axolotl transcriptome for an NO synthase domain, which is required for production of

NO by iNOS. Blasting the human NO synthase domain of iNOS against the axolotl

transcriptome reported a contig whose longest open reading frame contained a

predicted NO synthase domain (Figure 2-16 B-D). Multiple primers sets were

constructed against this region (Figure 2-16 E). We tested these primers on splenic

53

cDNA, pokeweed mitogen stimulated splenic cDNA, and d2 elicited IP cell cDNA.

However, no PCR product was formed.

Blasting human arginase mRNA against the axolotl transcriptome reported a

contig with homologous regions near the 5’ end (Figure 2-17 A). Primers were designed

around this area of homology and a PCR product was formed of the expected size

using these primers on splenic cDNA (Figure 2-17 B, C). Sequencing of the PCR

product confirmed amplification of the expected cDNA sequence (Figure 2-17 D).

Once a primer set has been identified that can amplify iNOS cDNA, we can

create primers suited for qPCR to characterize the relative gene expression iNOS and

arginase in resident and elicited IP macrophages. Endogenous control qPCR primers

for GAPDH and B-actin have already been designed and validated in the axolotl.91

Polarization of axolotl macrophages using exogenous stimuli

Using the methods of antibody staining and phagocytic activity, we attempted to

polarize elicited macrophages with M1 and M2a stimuli: murine IFN + LPS and murine

IL4 respectively. After 32 hours of stimulation, the cells were either incubated with

pHrodo bacteria for phagocytosis, or cytospun onto slides for antibody staining. We

found that there was no significant difference in phagocytosis between unstimulated

macrophages, and macrophages polarized toward M1 or M2a phenotypes (Figure 2-18

A,B). Interestingly, while freshly collected D5 IP macrophages show arginase

expression in the cytoplasm (Figure 2-15), after culturing for 3 days most of the

fluorescence appears to be localized in the nucleus (Figure 2-18 C). No difference in the

staining intensity or localization of iNOS or arginase staining was seen after stimulation.

It would be wrong to conclude from this experiment that axolotl macrophages cannot be

54

classically or alternatively activated. As stated previously, it is possible that the murine

cytokines are not recognized by the axolotl receptor, or perhaps a larger dosage of

cytokines are required.

Discussion of Results

Our study identifies the need for further screening of antibodies to specifically

stain axolotl macrophage and neutrophils. Most markers published to identify either of

these lineages demonstrated staining in both populations. Care must be taken when

studying these lineages in axolotl regeneration so as to not misinterpret results. The

ability to accurately distinguish neutrophils from macrophages in this study was

important because clodronate-liposomes have the potential to deplete neutrophils in the

circulatory system along with monocytes. We wanted to know that any effects we saw

were from macrophage depletion, not neutrophil depletion. Creation of lineage-specific

transgenic animals with inducible ablation will allow for more precise macrophage

depletion experiments.

Mammalian macrophages have important regulatory roles in wound healing,

however the role of the axolotl macrophage in skin wound regeneration was unknown.

While early macrophages in mammalian wound healing increase scar tissue formation,

early macrophages responding to limb amputation are required for regeneration. We

hypothesized that the early macrophages responding to a dorsal wound are similarly

important for proper wound regeneration. In this study, we used clodronate-liposomes to

deplete early wound healing macrophages to determine if scar tissue would form. We

found in axolotls with inhibited limb regeneration, the collagen deposition began the

same time of PBS-lipo animals. Seifert et al42 found that the wound epithelium

expresses MMPs which may account for the delay in ECM collagen deposition. Thus, it

55

does not appear that these macrophages regulate the early expression of MMPs in the

wound bed. While the dosage of commercially sourced clodronate-liposomes did not

inhibit limb regeneration, we did observe increased collagen deposition in D30 wounds

of Clo-lipo animals. Thus, we do expect to find partial depletion of macrophages after

the Clo-lipo treatment once a suitable marker is found. However, at day 90, the amount

of collagen in wounds was the same for both PBS-lipo and Clo-lipo animals. It appears

that collagen regulation is macrophage-dependent, and while partial macrophage

depleted wounds are still able to be regenerate, it may be that full depletion dips below

a regeneration threshold, resulting in a scar.

The correct dosage of clodronate-liposomes sourced from Encapsome to prevent

limb regeneration still needs to be determined. The dosage of clodronate-liposomes

was not published in the original Godwin et al57 paper, though Yun et al69 dosed at

20L/17cm length. However, Yun et al69 did not assess limb regeneration, as

macrophages were depleted after the limb bud had already formed, which does not

prevent limb regeneration.57 Using this dosage as a reference point, we dosed 17-20cm

animals with 20L, 20-23cm with 30L and <23 cm animals with 40L with our in-house

preparation of clodronate liposomes used in trial 1. With this dosing, limb regeneration

was blocked with an equivalent of 1.54g/g dosage of clodronate-liposomes. We

believe the concentration of the first batch of clodronate-liposomes was greater than the

second batch because injecting the same volume of liposomes did not prevent limb

regeneration in the second trial. We decided to commercially source the liposomes and

increased the dosage to 1.75g/g for the third trial. Even at this increased dosage, limb

regeneration was not prevented. An initial series of dosing with 1g/g increments will be

56

performed to find the dosage of commercially sourced liposomes that effectively

prevents limb regeneration. Fine-tuning of the dosage can then be performed at

0.25 g/g increments.

Understanding the pro-regenerative macrophage phenotype, and how the

phenotype is produced, is a future goal. Murine macrophages can polarize towards

different phenotypes based on the extracellular signals they receive. The phenotype of

the murine wound healing macrophage is still being researched, though current models

suggest a pro-inflammatory macrophage during the early stages of wound healing, and

a pro-healing macrophage, or M2a, during the later stages. Axolotl macrophage

polarization has never been investigated. It is thought that in response to a wound,

axolotl macrophages have a dampened inflammatory response compared to mice

leading to regeneration. It seems that axolotls do have less of a response to

thioglycollate elicitation into the peritoneal cavity. Mice are known to develop swollen

abdomen’s after a similar elicitation, whereas we found that axolotls do not. While we

know there is a decrease in immune cell infiltration into the axolotl wound bed, their

inflammatory status has not been characterized. We want to be able to characterize the

axolotl wound healing macrophage for comparative analysis with murine macrophages.

While it will be worthwhile to stain healing wound sections for iNOS and arginase to see

if a trend is present, current analysis of axolotl macrophage populations suggests co-

expression of the two proteins. This makes determining the inflammatory state less

straightforward. While mutually exclusive expression is often seen in mammals, where

the activity of one suppresses the expression of the other. However, arginase

57

sequestration in the nucleus may be the regulatory mechanism, thus regulating on a

protein level rather a mRNA level.

Currently, there are 4 different sub-types of alternatively activated macrophages.

Each subtype can be produced in vitro through stimulation with exogenous signaling

molecules. While this method would be ideal to recapitulate in the axolotl, current

attempts have not demonstrated polarization. This is most likely due to lack of binding of

murine signaling molecules with axolotl receptors. Therefore, to initially characterize

axolotl macrophage polarization, we used populations known to have divergent

polarization states in mice and rats: resident and elicited peritoneal macrophages. We

found that elicited IP macrophages and resident IP macrophages resemble pro-

inflammatory and alternatively activated macrophages respectively in their phagocytic

activity. Along with analyzing gene expression of iNOS and arginase, determining

expression of pro-inflammatory and anti-inflammatory cytokines would further aid in

determining the inflammatory state of these populations.

58

Figure 2-1. Macrophage depletion and FTE wounding strategy. A) Macrophage

depletion strategy using clodronate-liposomes. Previous publications report macrophage repletion by D15. B) Dorsal view of FTE wounding strategy used for trial 1. 2mm FTE wounds made on D0 were collected throughout the wound healing period using 4mm biopsy punches. The front left-limb was amputated on D0 as an indicator of macrophage depletion. C) Wounding strategy used for trial 3.

59

Figure 2-2. First trial Clo-lipo cohort shows regeneration inhibition. By D30, PBS-lipo

limbs have limb bud development. Clo-lipo animals lack this limb bud development. By D72, PBS-lipo limbs are forming digits, while Clo-lipo limbs still show no signs of regeneration. Dashed line indicated amputation plane.

60

Figure 2-3. Initial collagen deposition is not altered in Clo-lipo animals. A) Masson’s

Trichrome stain shows collagen deposition (blue fibers) starting after 10 days. The right panels show collagen detection using FIJI analysis macro. Analysis was restricted to the wounded area as bounded by the edges of the stratum compactum. 5X magnification. B) Quantification of collagen staining at days 10,15, and 30 after wounding. n=3 for PBS-lipo and n=2 for Clo-lipo.

61

Figure 2-4. Dermal scarring of amputated limb a year after Clo-lipo treatment. A) Un-

injured skin of the amputated limb shows normal dermis morphology with vertical orientation of collagen fibers in dermis and thick band of horizontal fibers in the stratum compactum. 5X magnification. B) Skin at site of amputation. 5X magnification. C) Increased magnification of area inside white rectangle in B. Excess dermal collagen is present over a year after amputation. 10X magnification.

62

Figure 2-5. Clo-lipo depletion trial 3 did not block limb regeneration. Limb bud

development was evident on PBS-lipo and Clo-lipo animals on D30. D60 showed further development in both PBS-lipo and Clo-lipo animals, though some Clo-lipo limbs appeared abnormal with signs of hemmoraging.

63

Figure 2-6. Increased collagen deposition at D30 is resolved at D90. A, B)

Representative sections of PBS-lipo and Clo-lipo wounds at D30 and D90. Collagen was measured in the injured area outlined in black. Middle panels show software analysis of collagen in black and lower panels overlay the measured collagen, in blue, over the original image, in black and white. 5X magnification. C) Quantification of the measured collagen at D30 and D90. The increase of collagen in PBS-lipo animals at D90 corresponds with the re-forming stratum compactum. D) Clo-lipo wounds had significantly increased collagen deposition at D30. E) By D90, PBS-lipo and Clo-lipo contained similar levels of collagen in the wounds. In D and E, each animal is plotted as an individual circle.

64

Figure 2-7. Collagen thickness is the same between PBS- and Clo-lipo wounds.

Picrosirius red staining of collagen fibers viewed under polarized light. While D30 Clo-lipo wounds had more collagen deposition, the collagen thickness did not appear significantly dysregulated. Similarly, at D90, PBS-lipo and Clo-lipo wounds have similar collagen fiber thickness distribution. The reforming stratum compactum is seen as intense red staining at the bottom of the dermis at D90. 20X magnification.

65

Figure 2-8. Representative examples of axolotl neutrophils and

monocyte/macrophages. Axolotl neutrophils show clearly lobular and doughnut nuclear morphologies. Monocytes have an oval or bean-shaped nucleus, while macrophages are more circular. Cells were stained using DiffQuik staining procedure. 20X Magnification.

66

Figure 2-9. Cytochemical staining of axolotl neutrophils and macrophages. CAE, ANAE,

and MPO all show staining of both monocytes/macrophages and neutrophils. Only Sudan black showed exclusive staining of neutrophils. Double staining cells with CAE/ANAE showed co-expression of both esterases in monocytes/macrophages and neutrophils. Double CAE/ANAE staining shows an unknown cell type (denoted with asterisks) that has restricted CAE activity (red) in cytoplasmic granules with cytoplasmic ANAE activity (in grey/black). The nucleus is purple in MPO and Sudan Black stains. 20X magnification.

67

Figure 2-10. Dextran+ cells are mononuclear CAE+. A) Dextran+ cells displayed

mononuclear morphology and stained with CAE. B) Neutrophils (arrows) also stained with CAE but were not Dextran+. 20X Magnification.

68

Figure 2-11. Dextran+ cells have variable MPO enzymatic activity A) Dextran+

mononuclear cell without MPO enzymatic staining. Neutrophils (arrows) are stained by MPO, but are not Dextran+. B) Weak MPO staining of Dextran+ mononuclear cell. C) Intense MPO staining of Dextran+ mononuclear cell. Not all monocytes are Dextran+ (arrowhead). 20X magnification.

69

Figure 2-12. Antibody staining of elicited IP neutrophils and monocyte/macrophages.

F4/80, a commonly used macrophage marker, showed increased staining in neutrophils and lymphocytes as compared to monocytes/macrophages. Other commonly used macrophage markers, CD11b and CD68, did not give cross-reactivity with axolotl cells. The expected neutrophil marker, neutrophil elastase, was the most promising for neutrophil specificity as neutrophil staining was much brighter than monocyte/macrophage staining. NIMP, a neutrophil marker, did not show cross-reactivity with axolotl cells. GFI-1 cytoplasmically stained both monocytes/macrophages and neutrophils. PU.1 stained peri-nuclear in neutrophils and faintly in macrophage cytoplasm. Lymphocytes showed strong cytoplasmic staining with PU.1. Arrows: Neutrophils; Closed Arrowheads: Monocyte/Macrophage; Open Arrowheads: Lymphocytes. Nuclei are stained with DAPI (blue). Upper panels are 20X magnification. The lower panels are 400% zoom of the white rectangles.

70

Figure 2-13. Phagocytosis activity of elicited and resident IP macrophages. A)

Representative populations of elicited and resident IP cells. Resident IP cells are mainly macrophages while elicited IP cells consist of both macrophages and neutrophils. Arrows: Neutrophils; Arrowheads: Monocyte/Macrophage. 20X Magnification. B) Ficoll efficiently separates IP macrophages from neutrophils. Asterisk shows an actively phagocytosing macrophage. 20X Magnification. C) Example of gating of P1 IP macrophage population. D) Elicited and resident IP macrophages were incubated with pHrodo on ice or at axolotl RT for 3hr. Phagocytosis was measured by fluorescence of pHrodo. E) Quantification of phagocytosis. Elicited macrophages have a higher percentage of phagocytosing macrophages as compared to resident macrophages. N=1 for both elicited and resident macrophage phagocytosis

71

Figure 2-14. Positive control antibody staining for arginase and iNOS. A) IHC DAB

staining for arginase in axolotl liver at 10X magnification. B) ICC-IF staining of elicited D2 IP cells with iNOS antibody at 20X magnification. Both macrophage and neutrophil populations show iNOS staining. Arrows: Neutrophils; Arrowheads: Monocyte/Macrophage.

72

Figure 2-15. Both resident and elicited IP cells express iNOS and arginase. Elicited D5

IP cells stained positive for both iNOS and arginase expression. Resident IP cells showed increased staining for both iNOS and arginase compared to elicited D5 IP cells. Decreasing the exposure for resident IP arginase stain showed both cytoplasmic and apparent nuclear localization of arginase. 20X magnification and 400% enlargement of corresponding white boxes. Arrows: Neutrophils; Arrowheads: Monocyte/Macrophage.

73

Figure 2-16. iNOS primer design. A) Human iNOS protein domains. B) The human

mRNA sequence encoding the NO synthase domain was blasted against the axolotl transcriptome resulting in one significant alignment. C) Sequence of cDNA isotig aligning with the human mRNA for the NO synthase domain. Highlighted sequence corresponds to the predicted axolotl NO synthase domain. D) Pfam search of longest ORF of isotig209642 predicted a NO synthase domain E) Primers designed against the NO synthase domain. F) No PCR product was formed using elicited D2 IP cells.

74

Figure 2-16. Continued

75

Figure 2-17. Arginase primer design. A) Human ARG1 mRNA was blasted against the

axolotl transcriptome resulting in 3 significant isotig alignments. B) Sequence of axolotl transcriptome isotig aligned with ARG1. Forward and reverse primers are shown in yellow and blue respectively. C) PCR product of expected size (704 base pairs) using arginase primers on IP macrophage cDNA. D) Sequence of PCR product is a 99% match to target sequence.

76

Figure 2-17. Continued

77

Figure 2-18. In vitro stimulation with murine cytokines did not induce polarization. A, B)

D5 Elicited IP macrophages were seeded at a density of 2x104 cell/well in a 12-well culture plate. Cells were allowed to adhere for >4 hours and were either cultured for 32 hours in normal media for non-stimulation (NS), 20U/mL

of IL4, or 250U/mL of IFN and 100ng/mL of LPS. After stimulation cells were incubated with pHrodo bacteria for 3 hours then lifted from the plates and analyzed using flow cytometry. Three wells per condition were analyzed. There was no difference in the phagocytic activity of non-stimulated and stimulated macrophages. C) The cells from one well of each culture condition where lifted from the culture plate and three cytospins were prepared for iNOS, Arginase and isotype control staining. iNOS and arginase staining did not change significantly after stimulation. 20X Magnification.

78

CHAPTER 3 ENRICHMENT OF THE AXOLOTL HSC USING CENTRIFUGAL COUNTERFLOW

ELUTRIATION

Regeneration is an ability only a handful of vertebrate animals possess as an

adult. It is, however, common for animals to possess some regenerative capacity in

their infancy that is rapidly lost as the animal ages. Mammals, for example, can

regenerate and heal scar-free in utero but this ability is mostly lost once born. Frogs,

likewise, can regenerate as tadpoles, but once they undergo metamorphosis the ability

is lost. Salamanders, however, are able to regenerate even after metamorphosis.

Axolotls are neotenic salamanders that can fully regenerate amputated limbs, skin,

spinal cord, and parts of their heart and brain.

The immune system plays a major role in mammalian wound healing and

macrophages, innate-immune cells, are required for the regeneration of axolotl limbs. In

order to further study the axolotl immune system’s role in wound healing and

regeneration, we previously developed chimeric axolotls with fluorescent immune cells.

Chimeric animals are generated through transplantation of fluorescent splenic cells,

containing the HSC, into a non-fluorescent animal; the equivalent of a bone-marrow

transplant. Our current methods for chimeric production are inefficient largely due to

GVHD onset resulting in skin lesions and ultimately death. The use of juvenile donor

material reduces, but does not eliminate, GVHD occurrence. Our goal is to enrich the

HSC to efficiently generate chimeric hematopoietic animals for studying the role of the

hematopoietic system in regeneration.

While antibodies are the most widely used enrichment method for HSCs in mice

and humans, there is a lack of antibodies for axolotl HSCs. Therefore, we are

investigating antibody-free enrichment methods to use for the axolotl. Two methods

79

have been successful in the murine model: enrichment based on 1) aldehyde

dehydrogenase (ALDH) enzyme levels and 2) counterflow centrifugal elutriation (CCE)

fractionation. ALDH is an intracellular detoxifying enzyme that is expressed at high

levels in stem cells and early progenitors. Incubation of a cell population with a

fluorescent substrate of ALDH results in accumulation of the fluorescent product within

cells. Stem cells can then be sorted for their high fluorescent signal. CCE separates

cells based on size and density by using opposing counterflow and centrifugal forces

(Figure 3-1). In this method, cells are pumped into one end of a chamber within a

spinning centrifuge rotor under conditions where the centrifuge force is greater than the

counterflow force from the pump; thus, cells are contained within the chamber (Figure 3-

1 B, step 1). Tubing connected to the other end of the chamber allows for the elutriation

buffer to exit the chamber and can be collected. Incrementally increasing the

counterflow force, by increasing the pump speed, allows the cells within the chamber to

be pushed out and collected (Figure 3-1 B, step 3). This method has a high resolving

power and can separate morphologically similar murine long-term hematopoietic stem

cells (LT-HSCs) from their progenitors.

Work of a previous graduate student found that while isolating ALDHhiSSClo cells

from whole spleen preparations did enrich for the HSC (Figure 3-2), it also increased

the incidence of GVHD to 100% through co-enrichment of T cells. Here, we used CCE

to enrich for axolotl HSCs and compared it to the ALDH enrichment strategy. We found

that pooled CCE fractions 11-13, 14-16, and 17-19 all significantly enrich for HSCs and

progenitors (HSPCs), with pooled fraction 14-16 showing the best long-term

engraftment. To compare enrichment strategies of ALDH and CCE, we used our non-

80

ablative larval transplant model to monitor engraftment of HSCs without interference of

GVHD. With this model, we found a greater enrichment of axolotl HSCs and

progenitors using CCE as compared to ALDHhi activity. Because non-ablative

transplants are known to have less engraftment compared to ablative transplants, we

expect engraftment to be even greater when performed on irradiated adults. Thus, when

creating axolotls with chimeric immune systems, we suggest elutriating juvenile donor

spleens and transplanting the pooled fraction 14-16 into irradiated adults.

Methods

Animal Maintenance

Axolotls were maintained in 40% Holtfreter’s solution at 18-21C on a 12-hr light,

12-hr dark cycle. Animals were purchased from the Ambystoma Genetic Stock Center

or bred in-house. D/d (white) larvae between 2-3 cm were used as the recipients of the

spleen cell injections to assay for HSC activity. This study was approved under the

University of Florida Institutional Animal Care and Use Committee protocol 201502645.

Spleen Cell Isolation

As a general note: axolotl cells have a different osmotic pressure than

mammalian cells requiring standard buffers/media be diluted to 70% normal strength

with water prior to use.

GFP animals >10cm were used as spleen cell donors. Before spleen resections,

animals were anesthetized in 0.1% ethyl 3-aminobenzoate methanesulfonate salt (MS-

222; Sigma-Aldrich). Single cells were obtained through maceration of the spleen using

sandblasted-frosted slides in amphibian PBS (A-PBS: 70% PBS) with 1-5% FBS or

BSA. The cells were strained through a 70µm mesh to remove clumps. If more

processing was required to obtain a single cell suspension, the cells were passed

81

through a gradation of syringe aspirations of 18, 20, and 26 gauges. The cells were

then pelleted at 1250rpm at 4C for 5 min and resuspended in buffers appropriate for

downstream applications.

Counterflow Centrifugal Elutriation

A minimum of 1x108 cells in a 30mL volume of Elutriation Buffer (1mM EDTA, 5%

BSA, APBS) were loaded into the Beckman standard elutriation chamber at 200xg with

a flow rate of 29mL/min. The cells were equilibrated at this speed for 15min, then the

flow rate was decreased to 14mL/min and equilibrated for another 15min. The

centrifuge was decreased to 60xg to begin elutriation. Cells were elutriated at a

constant g-force (60xg) with increasing pump speeds. Pump speeds increased from 5 to

38 (corresponding to a flow rate of 17-100 mL/min) for a total of 33 fractions collected.

For each pump speed, the elutriated cell solution was collected for 2 minutes. The

elutriation was performed at room temperature and the fractions were put on ice upon

collection. For further resolution of elutriated fractions, fractions can be collected for

longer periods of time to increase the total volume washing through the elutriation

chamber. Beckman Coulter recommends using 150mL to completely wash a cell

population out of the chamber.

Cytospins and Cytochemical Staining

Cytospins were prepared using positively charged slides (Denville Scientific

M1021) and a Shandon Cytospin 3 at 600rpm for 4 min. HEMA 3 Stain (Fisher

Scientific) was performed on non-fixed cytospins. For Napthol AS-D chloroacetate

esterase staining (Sigma, 91C), cells were fixed in suspension with 10% buffered

formalin for 10 min on ice, then pelleted and resuspended in 10%FBS/APBS and

cytospun.

82

Colony Forming Unit Assay

5x104cell/mL of elutriated fractions were added to methylcellulose media

containing pokeweed mitogen-stimulated spleen-cell conditioned media (PWM-SCM)

and recombinant human erythropoietin (rhEPO). 500µL of solution was plated in

duplicate in 12-well culture plates. Assays were incubated up to 2 weeks at ambient

axolotl room temperature (18-21°C). Methylcellulose media: 1.7% methylcellulose in A-

L15, 46% PWM-SCM, 2.37U/ml rhEPO. Plates were analyzed for colony forming units

(CFU) using an inverted microscope.

ALDH Staining

Single cell suspensions were stained based on their ALDH activity. GFP spleen

cells were stained with EMD Millipore’s AldeRed ALDH Detection Assay (EMD Millipore,

SCR150) using a red-fluorescent substrate. The kit was used according to the

manufacturer’s instructions. Axolotl ALDH Buffer was used instead of the kit Assay

Buffer to include MDR inhibitors to prevent loss of fluorescent product: 5% FBS in A L-

15, 1X Penn/Strep, 1X Insulin/Transferrin/Selenium with MDR inhibitors (50mM 2-

deoxy-glucose, 2.5mM Probencid, and 81µM Verapamil). Briefly, spleen cells were

resuspended in RT Axolotl ALDH Buffer at a concentration of 1x106 cell/mL. Cells were

stained at RT for 30 min protected from light with occasional mixing. Cells were then

pelleted at 500xg at 4C for 5 min and resuspended at a concentration up to 8x106

cell/mL in ice-cold Axolotl ALDH Buffer for fluorescence-activated cell sorting (FACS)

analysis. The top 20% brightest cells were sorted for all in vivo experiments.

Non-Ablative Larval Transplants

Larval d/d animals, 2-3 cm, were anesthetized in 0.05% MS-22 before injections.

Injection needles were pulled with a Flaming/Brown micropipette puller (Sutter

83

Instrument Co; cat: P-97) and clipped with watchmaker forceps to achieve an outer

diameter of 40-60µm. Cells were injected into the peritoneal cavity in a 2µL volume.

Brilliant Blue dye was used to visualize the injection. Once injected, animals were

placed in Steinberg’s Solution overnight, then transferred to 40% Holtfreter’s solution. At

least 10 animals were injected per condition.

Limit of Dilution Analysis

To determine the relative enrichment of HSCs using Elutriation and ALDH

activity, limiting dilution analysis (LDA) analysis was performed using the web-based

ELDA software program (http://bioinf.wehi.edu.au/software/elda/). The number of cells

injected, the total number of animals screened, and the total number of positive animals

were input into the software. Results are reported with the upper and lower 95%

confidence intervals.

Immunocytochemistry

For ICC-IF, slides of cytospun cells were fixed and permeabilized in -20C

methanol for 5 min and air-dried for at least 20 min. Cells were blocked with Fc

Receptor Blocker (Innovex Biosciences; NB309-30) for 1 hr at RT. Cells were washed

2X with PBS for 3 min each then blocked with 10% (vol/vol) goat serum in antibody

diluent (Life technologies; 003118) for 1hr at RT. Cells were washed then incubated

with primary antibody diluted in antibody diluent overnight at 4C in a humidified

chamber. Cells were washed then incubated with appropriate fluorescent secondary

antibody diluted in antibody diluent for 1hr at RT. Cells were washed then fixed with 4%

PFA for 3 min to preserve nuclear architecture. Cells were washed then mounted with

Vectashield with DAPI (Vector Laboratories; H-1200). Antibodies: CD2 (Abcam,

84

ab37212, rabbit polyclonal) 5g/mL, CD3 (Agilent, A045229-2, rabbit polyclonal)

5g/mL, Rabbit IgG (isotype control) (Abcam,ab172730) 5g/mL.

Results

CCE Fractionation of Axolotl Spleen Cells

We tested the counterflow centrifugal elutriation method for its ability to enrich for

axolotl HSCs. We optimized elutriation parameters (centrifuge speed and pump rate) to

effectively separate axolotl spleen cells (Figure 3-3). Axolotl cells require less centrifugal

force to keep them contained within the elutriation chamber (1260xg vs. 60xg) because

of their increased size compared to mouse cells, roughly 10x larger (Figure 3-3). We

fractionated the spleen cells into 33 fractions, starting with fraction 5 and ending with

fraction 38. Each fraction was named according to the corresponding pump setting at

which it was collected. Flow analysis showed a trend in increasing forward and side

scatter properties over the course of elutriation (Figure 3-4 C,D). This trend is consistent

with the separation method of elutriation; separating cells based on size and density.

White blood cells elutriated from the chamber first, indicating that they are smaller/less

dense than axolotl red blood cells (RBCs). This is the opposite of what is seen in human

and murine elutriations in which RBCs elute first (Figure 3-3 A). This was expected

upon observation of the cells within the chamber through the viewport on the lid of the

centrifuge after equilibration of the loaded cells (Figure 3-4 A). Before elutriation begins,

the cells naturally separate themselves based on their sedimentation properties. The

WBCs can be seen nearest to the exit of the chamber (closer to the center of the rotor),

indicating they will elute first (Figure 3-4 A). Cytospins of each fraction showed further

subfractionation with a trend of lymphocytes eluting first, then the myeloid lineages, then

85

RBCs (Figure 3-4 F). The cells were categorized based on their morphology. Because

lymphocytes and hematopoietic progenitor cells are morphologically similar, they could

not be differentiated in this manner. Also, because the spleen is the site of

hematopoiesis, there are not only fully differentiated WBC lineages, but their precursors

as well. The ability to identify precursors was not attempted. It may be a population of

precursors that are found in the later fractions labeled as unknown cell types (Figure 3-4

F, G). CAE staining confirms the myeloid lineages elutriating first out of the chamber

(Figure 3-4 E).

To see which fractions contained hematopoietic progenitors, colony forming unit

assays were performed with each elutriated fraction. CFU activity was concentrated in

the WBC elutriation peak, with fractions 12 and 18 having the most colonies form

(Figure 3-5 A,B). While CFU assays can assess progenitor activity, it is not an assay for

HSC activity. To indirectly identify which fractions most likely contained HSCs, we

utilized the ALDH staining assay which stains both progenitors and stem cells. We

elutriated non-fluorescent spleens and stained the fractions for ALDH activity. All

elutriation fractions were tested, either individually or as part of a pool. If pooled, equal

cell numbers were used from each fraction. A total of 1x106 cell were stained per

sample and fluorescence was analyzed using flow cytometry. The greatest percentage

of ALDHhi cells corresponded with the WBC fractions 11-23, with the peak at fraction 14

(Figure 3-5 C,D). We focused on these fractions for our in vivo studies. Interestingly, the

percentage of ALDHhi cells never exceeded that of un-elutriated spleen cells. We

believe this is due to the pooling of fractions 15-23. It is likely that fractions closer to

fraction 14 would have exceeded the un-elutriated percentage, but their concentration

86

was diluted by the addition of low ALDH-activity cells from the later fractions.

Nevertheless, enrichment of ALDH activity in is seen in the WBC fraction.

HSC Activity Elutes in the WBC Fractions of CCE

The gold standard to assay for HSC activity is the production of blood cells after

transplantation. Based on the ALDH activity found in elutriated fractions, we chose to

transplant fractions 11-22. Fraction 23 was not included as its flow cytometry forward

scatter (FSC) and side scatter (SSC) profile more closely resembled subsequent

fractions with low ALDH activity. GFP+ spleen cells were elutriated and fractions with

similar FSC and SSC profiles were pooled and transplanted using our non-ablative

larval model (Figure 3-6 A); thus, we pooled fractions 11-13, 14-16, 17-19, and 20-22.

Engraftment can be monitored in vivo by visualization of GFP+ blood cells in the blood

vessels of the larval axolotl’s transparent skin (Figure 3-6 B). For each cohort, 2000

cells were injected into at least 10 d/d (non-fluorescent) larval animals. Evidence of

hematopoietic stem/progenitor cell (HSPC) engraftment was seen in all injection cohorts

after 2.5 months: GFP+ cells were found colonized within the skin and flowing in the

bloodstream (Figure 3-6 B). Animals receiving transplants from fractions with little to no

ALDHhi cells (fractions 10 and 25), did not have engraftment (Figure 3-6 D). Also,

injecting 2000 cells from the un-elutriated GFP spleen did not result in any engraftment,

demonstrating enrichment using CCE (Figure 3-6 D).

Beckman Coulter suggests eluting 150mL of buffer through the chamber to fully

wash out cells of a given pump speed. During optimization of the elutriation protocol,

our elutriation fractions were collected based on time, not volume. We collected each

fraction for 2 min before increasing the pump speed to the next increment. Thus, for a

fraction collected at a flow-rate of 17mL/min (fraction 5), only about 34mL would be

87

elutriated through the chamber. As we increased the pump speed, we elutriated through

more buffer, but only reaching the 150mL suggested volume toward the later fractions.

To further delineate the end of one pooled fraction with the beginning of another, we

increased the elutriated volume collected of the end-cap fractions (fraction 10, 13, 16

and 19) to 150mL. We again elutriated GFP spleens and pooled fractions 11-13, 14-16,

17-19 and 20-22 and transplanted 2000 cells. After 2.5 months, engraftment was not

seen in animals transplanted with fraction 20-22 (Figure 3-6 C). HSPC activity was

restricted to fractions 11-13, 14-16, and 17-19. This suggests that in the former set of

transplants, HSPCs that should have been elutriated in fraction 19 were “contaminating”

fraction 20-22 and demonstrates the ability to adjust the resolving power of the

elutriator.

CCE Fractionation Significantly Enriches Axolotl HSCs

To quantify the level of enrichment seen with CCE, we performed a limiting

dilution assay (LDA). LDAs are used to quantify the frequency of stem cells in a

population. We performed the analysis by transplanting cells into non-ablated, larval

animals. However, non-ablative models are less sensitive assays for HSC activity, thus

any calculated frequency will be lower than if performed in an ablative model. Therefore,

we only used this method to compare fold-enrichment levels between the methods, not

to report stem cell frequencies. Larval animals 2.5-3 cm, less than 6 months old, were

transplanted at three different doses expected to achieve 10-90% engraftment rates.

After 2.5 months, the animals were check for engraftment (Table 3-1). The values in

Table 3-1 were input into the online “Extreme LDA” (ELDA) analysis software. CCE

fractions 11-13, 14-16, and 17-19 were significantly enriched in HSPCs as compared to

ALDHhi cells and whole spleen (Figure 3-7 A,B). However, between the fractions there

88

was no significant difference in enrichment. Interestingly, while there was a trend toward

enrichment with ALDHhi cells, it did not reach significance.

While there was no significant difference in enrichment between the fractions,

fraction 11-13 trended toward the highest level of enrichment. However, the LDA

calculations were based on engraftment levels seen at 2.5 months. At 2.5 months, there

could also be GFP+ hematopoietic progenitors contributing to the observed engraftment

that would later diminish as the progenitors were exhausted and their progeny died.

Evaluating the LDA after 6 months is ideal to distinguish between progenitor and true

HSC activity. However, long-term LDA analysis could not be performed due to low

animal numbers from the 1000- and 3000-cell transplants from all three elutriation

cohorts. But, all cohorts had sufficient animals from the 2000-cell transplants for long-

term engraftment analysis (Figure 3-7 C). Fraction 11-13 showed the greatest

percentage of high-level engraftment at 2.5 months, but reduction in peripheral GFP+

cells in the skin and blood at 6 months indicates that progenitors greatly contributed to

the earlier observed engraftment. While all three fraction cohorts had decreased

engraftment by 6 months, fraction 14-16 had the greatest percentage of both total

engraftment and high-level engraftment. Thus, we would recommend using fraction 14-

16 for transplantation to produce animals with long-lasting, high levels of engraftment.

To assess if elutriation can separate T cells from HSCs, we tested CD2 and

CD3 antibodies’ ability to detect T cells in peripheral WBC cytospins. Both CD2 and

CD3 have been used in the axolotl: CD2 in ICC46, and CD3 in protein western

blotting. CD2 staining of peripheral WBCs showed more intense staining in

macrophages and neutrophils, with the faintest staining in lymphocyte cells (Figure 3-8).

89

While increasing the antibody concentration would increase the staining of lymphocytes

to make detection easier to see in cytospins, the elutriation fractions are currently fixed

cell suspensions and do not show differential morphology after cytospin preparations.

Thus, positively staining cells would be indistinguishable from each other. CD3

antibody staining showed faint staining of only lymphocyte-looking populations, and not

macrophages or neutrophils (Figure 3-8). This antibody would be a good candidate to

increase the antibody concentration to increase the fluorescent signal.

We also tested the combination of elutriation and ALDH activity to see if the

combination resulted in an even greater enrichment. We performed the elutriation on

GFP spleens, pooled elutriation fractions 11-3, 14-16, and 17-19, stained those cells for

ALDH activity using a red-fluorescent substrate, sorted for the top 20% brightest cells,

then transplanted 1000 – 3000 cells into the larval axolotls. Unexpectedly, we did not

see an increase in engraftment levels in the animals, but rather a drastic decrease. Only

in fractions 14-16 and 17-19 did an animal show a couple GFP+ cells in blood, though

no GFP+ cells in skin were seen. After 6 months, there was no GFP+ cells in blood or

skin. This experiment would have to be repeated to confirm these results and additional

controls would be added: 1) transplantation of the elutriated cells with no ALDH

selection, 2) transplantation of ALDH stained cells taken through the sorting process,

but with no gating applied, and 3) transplantation of the cell pool depleted of ALDHhi

cells. These controls would tell us 1) if the cells showed expected engraftment after

elutriation alone, 2) if the extra processing of flow sorting after elutriation inhibited cell

engraftment, and 3) if the elutriated cells depleted of ALDHhi cells show engraftment

potential.

90

Discussion of Results

Antibody based cell sorting is the preferred method of HSC enrichment in mice

and human applications. While the development of axolotl-specific molecular tools has

greatly increased, we are still behind in the area of axolotl-specific antibodies. Some

mouse antibodies cross-react with the axolotl, but we have not found any that work well

with flow cytometry. Our goal, therefore, was to efficiently create chimeric axolotls with

fluorescent immune systems using antibody-free methods of enriching for the HSC:

ALDH activity and CCE. In this study, we have shown that axolotl HSCs can be

enriched using the process of counterflow centrifugal elutriation. We were able to

narrow HSC activity to fractions 11-19 with peak activity in fractions 14-16 (Figure 3-9).

Based on our results, we propose transplanting fractions 14-16 of elutriated

juvenile spleen cells into irradiated adults as the current best method to efficiently

generate chimeric immune axolotls. We expect with the reduction in GVHD seen with

the use of juvenile donor cells, combined with the enriched HSCs from CCE, GVHD will

be further reduced. Future work will be the transplantation of the LT-HSC enriched F14-

16 population into irradiated adults to assess GVHD occurrence. This route is preferable

as one adult spleen contains sufficient numbers of cells to perform an elutriation, while

multiple juvenile animals would be required.

The use of stem cell enrichment through differential activity levels of ALDH has

been used to isolate HSCs in mice and humans. Stem cells have increased activity of

the detoxifying ALDH enzyme, thus through accumulation of a fluorescent substrate,

cells can be sorted based an ALDH activity through fluorescence intensity. Work done

by a previous graduate student showed that repopulation potential is observed down to

500 ALDHhiSSClo spleen cells in the ablative transplant model. Unfortunately, the

91

presence of alloreactive T cells in the selection process results quicker onset of GVHD,

less than 8 weeks after transplant, hindering the ability to perform long-term

engraftment evaluations. In mice, it is standard practice to eliminate mature lineage

positive cells (like T cells) through negative selection of lineage+ cells. We are unable to

mirror this procedure in the axolotl due to the lack of available antibodies. Interestingly,

the larval axolotl does not develop GVHD after an allogenic transplant containing

mature T cells, most likely through a tolerogenic microenvironment. Thus, by

transplanting into larval animals we can circumvent GVHD to assess long-term

engraftment even in the presence of T cells. Therefore, we used our non-ablative larval

model to further assess ALDH enrichment of HSCs. Limiting dilution assays showed 1.8

fold-enrichment using ALDHhi cells compared to using whole spleen, however it did not

reach significance. The differences in engraftment seen between the non-ablative and

ablative models are most likely due to the presence of endogenous HSCs. Without

ablation, fewer HSCs injected into the animal will engraft into the recipient. The use of

irradiation creates space in the HSC niches for the exogenous HSCs to engraft. Thus,

stem cell engraftment will always be lower in a non-ablative transplant model. Also, the

previous work used SSCloALDHhi cells for transplant, effectively combining two methods

of enrichment based on size and ALDH activity. This extra selection criteria could have

led to an overall increased enrichment. This current study evaluates HSC enrichment on

ALDH activity alone, regardless of SSC properties.

CCE separates cells based on their size and density through the balancing of

centrifugal and flow-through forces acting on the cells. This method has been used to

separate cells by phase of cell cycle, cell type, malignancy, and has even been able to

92

separate the mouse HSC from other hematopoietic progenitors. We believe the HSCs

can be further resolved by increasing the volume used to collect each fraction and

transplanting fractions 14, 15, and 16 individually. Currently, the volume used to elute

the fractions is determined by the flow-rate. We collected fractions for 2 minutes and

then increased the pump speed. Thus, as the flow-rate increased, so did the volume

used to collect the fraction. Because of this, we were most likely getting “carry-over” of

one fraction into the other, especially in the earlier WBC fractions collected at the lower

pump speeds: in this case, a fraction is defined as being all the possible cells that can

be elutriated at a given g-force and flow-rate. This carry-over is masked when

sequential fractions are pooled, and is only apparent when collecting a fraction that will

not be pooled with the subsequent fraction. This carry-over can lead to a “diffusion” of

apparent HSC activity. Our repeat of the elutriation and collection of 150mL from

fractions whose next collection would not be in the same pool (i.e: F10, F13, F16, F19)

supports the feasibility to increase the resolution of HSC activity by confining it to fewer

fractions (Figure 3-7 C).

We believed that combining CCE with ALDH activity enrichment would lead to an

even greater enrichment of HSCs. However, the opposite was observed. Taken by

itself, it would suggest that ALDHhi activity does not enrich for HSCs. However, we know

this is not the case as animals transplanted with 3000 – 8000 ALDHhi cells still had high

engraftment levels after 6 months. This result would also suggest that the ALDHhi cells

that result in engraftment are not found in the elutriation fractions 11-19. We do not

believe this to be the case as the ALDHhi cells were concentrated in the WBC elutriation

fractions, with a peak at fraction 14 (Figure 3-6 D). Taking all these data into account,

93

we believe the lack of engraftment seen with the combination of elutriation and ALDH

sorting is likely a negative effect of the extra processing on the cells.

With an enriched population of HSCs without contaminating T cells, we could

efficiently transplant adult animals to generate chimeric hematopoietic systems

expressing GFP+ white blood cells. Efficiency is critical as rearing animals to adulthood

is time consuming. With chimeric hematopoietic animals, we can study the immune

system’s response in regeneration. We can visualize, in real-time, their recruitment to

the site of injury, as well as use their fluorescence for cell sorting to analyze their gene

expression during regeneration. However, this model only labels a portion of the

animal’s immune system, and different lineages are indistinguishable in vivo. We are

currently working to create transgenic axolotls, with the help of the Ambystoma Genetic

Stock Center, that will express GFP in specific hematopoietic lineages.

94

Figure 3-1. CCE overview. A) Schematic of the elutriation setup. B) Cells are pumped

into the elutriation chamber with a greater centrifugal force than counterflow force, containing cells within the chamber. The loaded cells align within the chamber where the counterflow force is equal to or greater than their centrifugal sedimentation. Increasing the counterflow force elutriates cells next to the elutriation boundary. Images courtesy of Beckman Coulter.

95

Figure 3-1. Continued

96

Figure 3-2. ALDH activity enriches for hematopoietic stem cells. Previous graduate

student’s work demonstrated that transplantation of SSCloALDHhi hematopoietic cells from a nuclear-red cherry transgenic animal resulted in engraftment and multi-lineage blood cell production.

97

Figure 3-3. Optimization of CCE with axolotl cells. A) Axolotl spleen cells were elutriated

using increased flow rate : G force ratios. The colored vertical lines indicate where respective human cells normally elute. The plotted circles are elutriated axolotl cells. B) Size comparison of axolotl and mouse blood cells at 20X magnification.

98

Figure 3-4. Fractionation of axolotl spleen cells using CCE. A) Equilibrated axolotl

spleen cells within the elutriation chamber seen through viewport. Axolotl WBCs are smaller/less dense than RBCs, thus they equilibrate closer to the chamber exit. B) Representative elutriation curve of axolotl spleen cells. C) Population gatings 1-6 increase in FSC and population 7 is an increase in SSC. As elutriation proceeds, populations of increasing FSC and SSC appear incrementally. D) Plotting of the frequencies of the populations over the elutriation process shows populations with lower FSC/SSC properties elute first (left panel), and populations with higher FSC/SSC properties elute later (right panel). E) CAE staining of elutriation fractions to detect the myeloid lineage. E’) An example of a positively stained cell with CAE. F) Graphical representation of where different hematopoietic lineages elutriate based on morphological analysis of fractions. G) Examples of cell populations of different elutriation fractions at 20X magnification.

99

Figure 3-4. Continued

100

Figure 3-5. Hematopoietic progenitor activity concentrated in first elutriation peak. A)

Elutriated axolotl spleen cells were cultured in methylcellulose media for 7 days and colony production was assessed. Open circle dots represent fractions with colony production. Blue circles represent fractions with the most colonies produced. B) Representative colony from fraction 12 and 18. C) Whole spleen and elutriation fractions were stained for ALDH activity. D) Graphical representation of ALDH staining. Fraction 14 shows highest ALDH activity. Pooled samples are represented by one datum point plotted at the median fraction sample. The graph is color coded to represent which elutriation fractions are represented in each ALDH assay sample.

101

Figure 3-6. Elutriated spleen cells show enrichment for HSPC activity. A) Whole GFP+

spleen cells were elutriated and the fractions were transplanted IP into larval axolotls. B) Fluorescent blood cells can be seen in the skin. C) Increasing the elutriation volume of fraction 19 resulted in loss of HSPC activity in F20-22. D) CCE fractions 11-19 have enriched levels of HSPCs compared to un-elutriated whole spleen and ALDH+ cells.

102

Table 3-1. Engraftment rates for LDA analysis

Cell number transplanted

F11-13 engraftment rates

F14-16 engraftment rates

F17-19 engraftment rates

ALDH engraftment rates

Whole spleen engraftment rates

1000 4/7 4/9 4/8 - -

2000 6/9 6/9 5/8 - -

3000 10/10 6/8 7/10 4/7 -

6000 - - - 3/6 -

8000 - - - 6/8 -

10000 - - - - 4/10

15000 - - - - 5/8

18000 - - - - 8/9

103

Figure 3-7. CCE significantly enriches for HSCs. A) Using ELDA analysis software, CCE

fractions are the most enriched for HSPCs. These frequencies are expected to be lower in ablative models. B) Enrichment calculations based on LDA analysis. C) Long-term engraftment analysis demonstrates F14-16 to contain the most HSCs.

104

Figure 3-8. Staining for axolotl T cells. While CD2 does faintly stain lymphocyte cells,

there is stronger staining seen in macrophages and neutrophils. There is no macrophage staining with CD3e, with faint staining of lymphocytes. Arrows: neutrophils; Closed arrowheads: monocyte/macrophages; Open arrowheads: lymphocytes. 20X magnification. White boxes are enlarged 400%.

105

Figure 3-9. Summary of axolotl spleen fractionation using CCE. Hematopoietic stem cell

activity is enriched in elutriation fractions 11-19 with a peak at fractions 14-16.

106

CHAPTER 4 DISCUSSION

Macrophages are required for normal resolution of mammalian wound healing,

while also contributing to scar tissue formation. This duality has led to investigation on

how to prevent the contribution to scar tissue, while preserving pro-healing functions.

Understanding the numerous macrophage functions during the normal mammalian

wound healing process has aided this investigation. The use of comparative biology can

be a powerful tool to highlight significant differences between scarring and regeneration.

We use the axolotl as our animal model for a comparative biology approach to skin

regeneration. Our long-term goal is to study the phenotype and function of

macrophages in axolotl skin regeneration compared to their mammalian counterparts in

scarring. We hope to discover the molecular mechanisms employed by the axolotl

macrophage to promote regeneration rather than scarring and test these findings on the

murine model. The goal of this work was to study the role of early macrophages in

relation to dermal fibrosis and develop the tools to: 1) identify macrophages and

neutrophils in situ, 2) characterize iNOS and arginase expression in axolotl

macrophages and their potential use as markers of polarization, and 3) enrich for axolotl

HSCs for the efficient production of hematopoietic chimeric animals. From the results of

this work, we know now that there is a connection between axolotl macrophages and

dermal regeneration, because in their absence, excess collagen is deposited. Also, we

discovered that some markers previously used for differentiation between axolotl

macrophages and neutrophils actually show expression in both monocyte/macrophage

and neutrophil lineages. Additionally, the expression of iNOS and arginase in axolotl

macrophages had never been studied. We found antibodies that cross-react with axolotl

107

iNOS and arginase as well as designed PCR primers that can be used to identify the

presence of arginase expression in axolotl tissues. We also found the first evidence that

in vivo populations of axolotl macrophages have differential phagocytic activity and

expression of iNOS and arginase. Finally, we adapted a method never before used in

the axolotl, CCE fractionation, to enrich for the axolotl LT-HSC.

We hypothesized that depletion of early macrophages would result in scar tissue

formation in axolotl dermal wounds. We analyzed the skin of an un-regenerated limb a

year after amputation having depleted the macrophages. We found that the dermis of

the skin covering the amputation site of an un-regenerated limb was full of collagen,

much like is seen in mammalian scar tissue. This increase in dermal collagen was also

seen in a dorsal biopsy punch, 30 days after wounding. We found that partially depleting

macrophages through treatment with clodronate-liposomes at a dosage that does not

prevent limb regeneration, still induces increased dermal collagen after 30 days.

However, this collagen is able to be remodeled towards the uninjured phenotype after

90 days. There appears to be a connection between the macrophage level that prevents

limb regeneration and promotes scar tissue formation. While dorsal wounds depleted of

early macrophages to a level below the regenerative threshold were not analyzed after

30 days, we believe that there would have been dermal scarring as seen in the skin

covering the amputated limb. A similar scarring of axolotl heart muscle was shown in a

recent publication by Godwin et al93 in which macrophages were depleted before

cryoinjury to the heart and collagen was deposited but not remodeled. It appears that

axolotl limb regeneration is directly linked to not inducing a scarring response after limb

amputation. We believe that the first step towards human limb regeneration is the ability

108

to heal injuries scar free. Otherwise, we may learn all the secrets for inducing

epimorphic regeneration in humans but not be able to apply them because of our

natural scarring response.

Future areas of study can include gene expression analysis of these macrophage

depleted wounds through RNAseq analysis. This will give a global picture of the wound

environment without the early macrophages and what genes are affected by

macrophage depletion. Expression of genes that are known regulators of fibroblasts and

fibrosis such as FGF, TGF-, and IL1 would be of most interest. We know that under

normal skin regenerative conditions, there are fewer cells with the myofibroblast marker,

-smooth muscle actin (-SMA), in axolotl skin as compared to mice.42,54 These

fibroblasts secrete higher levels of collagen and are associated with fibrosis in

mammalian wounds.94 In the healing axolotl heart without early macrophages, there is

an increase in -SMA fibroblasts.93 The increase in collagen deposition in macrophage

depleted wounds may be a result of increased fibroblast differentiation to

myofibroblasts.

The temporal functions of mammalian macrophages in wound healing was

characterized through ablation of macrophages during the different stages of wound

healing.40 Analyzing the effect on wound healing without macrophages identifies their

normal functions. Similar depletion of macrophages in the axolotl will help delineate the

roles of macrophages throughout the wound regeneration process. Additionally, gene

expression analysis of isolated wound macrophages would correlate gene expression

with regenerative function. This regenerative gene expression could then be modulated

in mammalian macrophages and the resulting wound healing assessed.

109

Our chimeric immune system model can be used to isolate macrophages from

the wound bed by developing gating strategies to separate out macrophages from other

immune cells in the wound using FACS. Comparison of gene expression analysis of

isolated axolotl wound macrophages to mammalian would macrophages will highlight

differential gene expression in a regenerative versus scarring model. Mammalian

macrophages could then be modulated toward the regenerative gene expression

patterns during wound healing with the aim to prevent scar tissue formation.

Creation of lineage-specific transgenics would also allow for targeted depletions

of the macrophages as was done in murine wound healing models.37,40 Our lab is

collaborating with the AGSC to generate lineage-specific transgenics using bacterial

artificial chromosome (BAC) constructs used originally in zebrafish. The recent

availability of a preliminary axolotl genome sequence should facilitate the discovery of

axolotl promoters for lineage-specific genes.

The axolotl is a powerful animal model to study adult regeneration. The

similarities of basic biology between axolotls and mammals make translational

applications feasible. While limb regeneration would be the holy grail of regenerative

medicine, the ability to heal wounds scar free is far more attainable. In order for a

comparative biology approach to be taken, more research characterizing normal

regeneration must occur.

110

APPENDIX MACRO SCRIPT FOR COLLAGEN ANALYSIS

Figure A-1. Macro script for collagen analysis using FIJI software

111

LIST OF REFERENCES

1. Sund B. New Developments in Wound Care. London: PJB Publications; 2000:1-255.

2. Takeo M, Lee W, Ito M. Wound healing and skin regeneration. Cold Spring Harb Perspect Med. 2015;5(1):a023267.

3. Gurtner GC, Werner S, Barrandon Y, Longaker MT. Wound repair and regeneration. Nature. 2008;453(7193):314-321.

4. Junker JP, Philip J, Kiwanuka E, Hackl F, Caterson EJ, Eriksson E. Assessing quality of healing in skin: review of available methods and devices. Wound Repair Regen. 2014;22 Suppl 1:2-10.

5. Guo S, Dipietro LA. Factors affecting wound healing. J Dent Res. 2010;89(3):219-229.

6. Rodero MP, Khosrotehrani K. Skin wound healing modulation by macrophages. Int J Clin Exp Pathol. 2010;3(7):643-653.

7. Greenhalgh DG. The role of apoptosis in wound healing. Int J Biochem Cell Biol. 1998;30(9):1019-1030.

8. Eming SA, Krieg T, Davidson JM. Inflammation in wound repair: molecular and cellular mechanisms. J Invest Dermatol. 2007;127(3):514-525.

9. Broughton G, Janis JE, Attinger CE. The basic science of wound healing. Plast Reconstr Surg. 2006;117(7 Suppl):12S-34S.

10. van Zuijlen PP, Ruurda JJ, van Veen HA, et al. Collagen morphology in human skin and scar tissue: no adaptations in response to mechanical loading at joints. Burns. 2003;29(5):423-431.

11. Eming SA, Hammerschmidt M, Krieg T, Roers A. Interrelation of immunity and tissue repair or regeneration. Semin Cell Dev Biol. 2009;20(5):517-527.

12. Koh TJ, DiPietro LA. Inflammation and wound healing: the role of the macrophage. Expert Rev Mol Med. 2011;13:e23.

13. Rohl J, Zaharia A, Rudolph M, Murray R. The role of inflammation in cutaneous repair. Wound Practice and Research. 2015;23(1):8-15.

14. Wynn TA, Barron L. Macrophages: master regulators of inflammation and fibrosis. Semin Liver Dis. 2010;30(3):245-257.

15. Ploeger DT, Hosper NA, Schipper M, Koerts JA, de Rond S, Bank RA. Cell plasticity in wound healing: paracrine factors of M1/ M2 polarized macrophages

112

influence the phenotypical state of dermal fibroblasts. Cell Commun Signal. 2013;11(1):29.

16. Stout RD, Jiang C, Matta B, Tietzel I, Watkins SK, Suttles J. Macrophages sequentially change their functional phenotype in response to changes in microenvironmental influences. J Immunol. 2005;175(1):342-349.

17. Ploeger DT, van Putten SM, Koerts JA, van Luyn MJ, Harmsen MC. Human macrophages primed with angiogenic factors show dynamic plasticity, irrespective of extracellular matrix components. Immunobiology. 2012;217(3):299-306.

18. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nat Rev Immunol. 2008;8(12):958-969.

19. Mosser DM, Zhang X. Activation of murine macrophages. Curr Protoc Immunol. 2008;Chapter 14:Unit 14.12.

20. Rőszer T. Understanding the Mysterious M2 Macrophage through Activation Markers and Effector Mechanisms. Mediators Inflamm. 2015;2015:816460.

21. Stein M, Keshav S, Harris N, Gordon S. Interleukin 4 potently enhances murine macrophage mannose receptor activity: a marker of alternative immunologic macrophage activation. J Exp Med. 1992;176(1):287-292.

22. Classen A, Lloberas J, Celada A. Macrophage activation: classical versus alternative. Methods Mol Biol. 2009;531:29-43.

23. Brancato SK, Albina JE. Wound macrophages as key regulators of repair: origin, phenotype, and function. Am J Pathol. 2011;178(1):19-25.

24. Daley JM, Brancato SK, Thomay AA, Reichner JS, Albina JE. The phenotype of murine wound macrophages. J Leukoc Biol. 2010;87(1):59-67.

25. MacMicking J, Xie QW, Nathan C. Nitric oxide and macrophage function. Annu Rev Immunol. 1997;15:323-350.

26. Rath M, Müller I, Kropf P, Closs EI, Munder M. Metabolism via Arginase or Nitric Oxide Synthase: Two Competing Arginine Pathways in Macrophages. Front Immunol. 2014;5:532.

27. Munder M. Arginase: an emerging key player in the mammalian immune system. Br J Pharmacol. 2009;158(3):638-651.

28. Khanna S, Biswas S, Shang Y, et al. Macrophage dysfunction impairs resolution of inflammation in the wounds of diabetic mice. PLoS One. 2010;5(3):e9539.

29. Fadok VA, Bratton DL, Konowal A, Freed PW, Westcott JY, Henson PM. Macrophages that have ingested apoptotic cells in vitro inhibit proinflammatory cytokine

113

production through autocrine/paracrine mechanisms involving TGF-beta, PGE2, and PAF. J Clin Invest. 1998;101(4):890-898.

30. Rowlatt U. Intrauterine wound healing in a 20 week human fetus. Virchows Arch A Pathol Anat Histol. 1979;381(3):353-361.

31. Cowin AJ, Brosnan MP, Holmes TM, Ferguson MW. Endogenous inflammatory response to dermal wound healing in the fetal and adult mouse. Dev Dyn. 1998;212(3):385-393.

32. Krummel TM, Nelson JM, Diegelmann RF, et al. Fetal response to injury in the rabbit. J Pediatr Surg. 1987;22(7):640-644.

33. Cass DL, Bullard KM, Sylvester KG, Yang EY, Longaker MT, Adzick NS. Wound size and gestational age modulate scar formation in fetal wound repair. J Pediatr Surg. 1997;32(3):411-415.

34. Frantz FW, Bettinger DA, Haynes JH, et al. Biology of fetal repair: the presence of bacteria in fetal wounds induces an adult-like healing response. J Pediatr Surg. 1993;28(3):428-433; discussion 433-424.

35. Martin P, D'Souza D, Martin J, et al. Wound healing in the PU.1 null mouse--tissue repair is not dependent on inflammatory cells. Curr Biol. 2003;13(13):1122-1128.

36. Qian LW, Fourcaudot AB, Yamane K, You T, Chan RK, Leung KP. Exacerbated and prolonged inflammation impairs wound healing and increases scarring. Wound Repair Regen. 2016;24(1):26-34.

37. Mirza R, DiPietro LA, Koh TJ. Selective and specific macrophage ablation is detrimental to wound healing in mice. Am J Pathol. 2009;175(6):2454-2462.

38. Goren I, Allmann N, Yogev N, et al. A transgenic mouse model of inducible macrophage depletion: effects of diphtheria toxin-driven lysozyme M-specific cell lineage ablation on wound inflammatory, angiogenic, and contractive processes. Am J Pathol. 2009;175(1):132-147.

39. Leibovich SJ, Ross R. The role of the macrophage in wound repair. A study with hydrocortisone and antimacrophage serum. Am J Pathol. 1975;78(1):71-100.

40. Lucas T, Waisman A, Ranjan R, et al. Differential roles of macrophages in diverse phases of skin repair. J Immunol. 2010;184(7):3964-3977.

41. Sobkow L, Epperlein HH, Herklotz S, Straube WL, Tanaka EM. A germline GFP transgenic axolotl and its use to track cell fate: dual origin of the fin mesenchyme during development and the fate of blood cells during regeneration. Dev Biol. 2006;290(2):386-397.

114

42. Seifert AW, Monaghan JR, Voss SR, Maden M. Skin regeneration in adult axolotls: a blueprint for scar-free healing in vertebrates. PLoS One. 2012;7(4):e32875.

43. Bertolotti E, Malagoli D, Franchini A. Skin wound healing in different aged Xenopus laevis. J Morphol. 2013;274(8):956-964.

44. Dent JN. Limb regeneration in larvae and metamorphosing individuals of the South African clawed toad. J Morphol. 1962;110:61-77.

45. Kaufman J, Flank M, Du Pasquier L. The MHC Molecules of Ectothermic Vertebrates. In: Cohen GWWaN, ed. Phylogenesis of Immune Functions. Boca Raton, Florida: CRC Press; 1991:344.

46. Lopez D, Lin L, Monaghan JR, et al. Mapping hematopoiesis in a fully regenerative vertebrate: the axolotl. Blood. 2014;124(8):1232-1241.

47. Fellah JS, Vaulot D, Tournefier A, Charlemagne J. Ontogeny of immunoglobulin expression in the Mexican axolotl. Development. 1989;107(2):253-263.

48. Godwin JW, Rosenthal N. Scar-free wound healing and regeneration in amphibians: immunological influences on regenerative success. Differentiation. 2014;87(1-2):66-75.

49. Monaghan JR, Maden M. Visualization of retinoic acid signaling in transgenic axolotls during limb development and regeneration. Dev Biol. 2012;368(1):63-75.

50. Khattak S, Schuez M, Richter T, et al. Germline Transgenic Methods for Tracking Cells and Testing Gene Function during Regeneration in the Axolotl. Stem Cell Reports. 2013;1(1):90-103.

51. Flowers GP, Timberlake AT, McLean KC, Monaghan JR, Crews CM. Highly efficient targeted mutagenesis in axolotl using Cas9 RNA-guided nuclease. Development. 2014;141(10):2165-2171.

52. Nowoshilow S, Schloissnig S, Fei JF, et al. The axolotl genome and the evolution of key tissue formation regulators. Nature. 2018;554(7690):50-55.

53. Smith JJ, Putta S, Zhu W, et al. Genic regions of a large salamander genome contain long introns and novel genes. BMC Genomics. 2009;10:19.

54. Levesque M, Villiard E, Roy S. Skin wound healing in axolotls: a scarless process. J Exp Zool B Mol Dev Evol. 2010;314(8):684-697.

55. Andrew W, Hickman CP. Histology of the vertebrates; a comparative text [by] Warren Andrew [and] Cleveland P. Hickman. St. Louis,: Mosby; 1974.

56. Holder N, Glade R. Skin glands in the axolotl: the creation and maintenance of a spacing pattern. J Embryol Exp Morphol. 1984;79:97-112.

115

57. Godwin JW, Pinto AR, Rosenthal NA. Macrophages are required for adult salamander limb regeneration. Proc Natl Acad Sci U S A. 2013;110(23):9415-9420.

58. Rogers MJ, Russell RG, Blackburn GM, Williamson MP, Watts DJ. Metabolism of halogenated bisphosphonates by the cellular slime mould Dictyostelium discoideum. Biochem Biophys Res Commun. 1992;189(1):414-423.

59. Rogers MJ, Watts DJ, Russell RG, et al. Inhibitory effects of bisphosphonates on growth of amoebae of the cellular slime mold Dictyostelium discoideum. J Bone Miner Res. 1994;9(7):1029-1039.

60. Lehenkari PP, Kellinsalmi M, Näpänkangas JP, et al. Further insight into mechanism of action of clodronate: inhibition of mitochondrial ADP/ATP translocase by a nonhydrolyzable, adenine-containing metabolite. Mol Pharmacol. 2002;61(5):1255-1262.

61. Frith JC, Mönkkönen J, Blackburn GM, Russell RG, Rogers MJ. Clodronate and liposome-encapsulated clodronate are metabolized to a toxic ATP analog, adenosine 5'-(beta, gamma-dichloromethylene) triphosphate, by mammalian cells in vitro. J Bone Miner Res. 1997;12(9):1358-1367.

62. Kraft DL, Weissman IL. Hematopoietic Stem Cells: Basic Science to Clinical Applications. In: Lee EH, Bongso A, eds. Stem Cells: From Bench To Bedside: World Scientific Publishing Co. Pte. Ltd.; 2005.

63. Armstrong L, Stojkovic M, Dimmick I, et al. Phenotypic characterization of murine primitive hematopoietic progenitor cells isolated on basis of aldehyde dehydrogenase activity. Stem Cells. 2004;22(7):1142-1151.

64. Hess DA, Meyerrose TE, Wirthlin L, et al. Functional characterization of highly purified human hematopoietic repopulating cells isolated according to aldehyde dehydrogenase activity. Blood. 2004;104(6):1648-1655.

65. Storms RW, Trujillo AP, Springer JB, et al. Isolation of primitive human hematopoietic progenitors on the basis of aldehyde dehydrogenase activity. Proc Natl Acad Sci U S A. 1999;96(16):9118-9123.

66. Jones RJ, Wagner JE, Celano P, Zicha MS, Sharkis SJ. Separation of pluripotent haematopoietic stem cells from spleen colony-forming cells. Nature. 1990;347(6289):188-189.

67. Pi L, Fu C, Lu Y, et al. Vascular Endothelial Cell-Specific Connective Tissue Growth Factor (CTGF) Is Necessary for Development of Chronic Hypoxia-Induced Pulmonary Hypertension. Front Physiol. 2018;9:138.

68. Van Rooijen N, Sanders A. Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J Immunol Methods. 1994;174(1-2):83-93.

116

69. Yun MH, Davaapil H, Brockes JP. Recurrent turnover of senescent cells during regeneration of a complex structure. Elife. 2015;4.

70. Lévesque M, Gatien S, Finnson K, et al. Transforming growth factor: beta signaling is essential for limb regeneration in axolotls. PLoS One. 2007;2(11):e1227.

71. André S, Kerfourn F, Affaticati P, Guerci A, Ravassard P, Fellah JS. Highly restricted diversity of TCR delta chains of the amphibian Mexican axolotl (Ambystoma mexicanum) in peripheral tissues. Eur J Immunol. 2007;37(6):1621-1633.

72. Rich L WP. Collagen and Picrosirius Red staining: a polarized light assessment of fibrillar hue and spatial distribution. Brazilian Journal of Morphological Sciences. 2005(22):97-104.

73. Yam LT, Li CY, Crosby WH. Cytochemical identification of monocytes and granulocytes. Am J Clin Pathol. 1971;55(3):283-290.

74. Rindler R, Schmalzl F, Hörtnagl H, Braunsteiner H. Naphthol AS-D chloroacetate esterases in granule extracts from human neutrophil leukocytes. Blut. 1971;23(4):223-227.

75. Dubravec DB, Spriggs DR, Mannick JA, Rodrick ML. Circulating human peripheral blood granulocytes synthesize and secrete tumor necrosis factor alpha. Proc Natl Acad Sci U S A. 1990;87(17):6758-6761.

76. Kottke-Marchant K, Davis BH. Laboratory hematology practice. Chichester, West Sussex, UK: Wiley-Blackwell; 2012.

77. Tay SP, Cheong SK, Hamidah NH, Ainoon O. Flow cytometric analysis of intracellular myeloperoxidase distinguishes lymphocytes, monocytes and granulocytes. Malays J Pathol. 1998;20(2):91-94.

78. Naeim F. Atlas of hematopathology : morphology, immunophenotype, cytogenetics, and molecular approaches (ed 1st). Amsterdam: Elsevier/Academic Press; 2013.

79. Davey F, Nelson D. Sudan Black B Staining. In: Williams W, Beutler E, Erslev A, Rundles R, eds. Hematology. New York: McGraw-Hill; 1977:1629-1630.

80. Back J, Allman D, Chan S, Kastner P. Visualizing PU.1 activity during hematopoiesis. Exp Hematol. 2005;33(4):395-402.

81. Hock H, Hamblen MJ, Rooke HM, et al. Intrinsic requirement for zinc finger transcription factor Gfi-1 in neutrophil differentiation. Immunity. 2003;18(1):109-120.

82. Simkin J, Gawriluk TR, Gensel JC, Seifert AW. Macrophages are necessary for epimorphic regeneration in African spiny mice. Elife. 2017;6.

117

83. Hesse M, Modolell M, La Flamme AC, et al. Differential regulation of nitric oxide synthase-2 and arginase-1 by type 1/type 2 cytokines in vivo: granulomatous pathology is shaped by the pattern of L-arginine metabolism. J Immunol. 2001;167(11):6533-6544.

84. Yang Z, Ming XF. Functions of arginase isoforms in macrophage inflammatory responses: impact on cardiovascular diseases and metabolic disorders. Front Immunol. 2014;5:533.

85. Abdallahi OM, Bensalem H, Augier R, Diagana M, De Reggi M, Gharib B. Arginase expression in peritoneal macrophages and increase in circulating polyamine levels in mice infected with Schistosoma mansoni. Cell Mol Life Sci. 2001;58(9):1350-1357.

86. Cecílio CA, Costa EH, Simioni PU, Gabriel DL, Tamashiro WM. Aging alters the production of iNOS, arginase and cytokines in murine macrophages. Braz J Med Biol Res. 2011;44(7):671-681.

87. Li Z, Zhao ZJ, Zhu XQ, et al. Differences in iNOS and arginase expression and activity in the macrophages of rats are responsible for the resistance against T. gondii infection. PLoS One. 2012;7(4):e35834.

88. Dimitrijević M, Stanojević S, Blagojević V, et al. Aging affects the responsiveness of rat peritoneal macrophages to GM-CSF and IL-4. Biogerontology. 2016;17(2):359-371.

89. Pavlou S, Wang L, Xu H, Chen M. Higher phagocytic activity of thioglycollate-elicited peritoneal macrophages is related to metabolic status of the cells. J Inflamm (Lond). 2017;14:4.

90. Cerchiaro GA, Scavone C, Texeira S, Sannomiya P. Inducible nitric oxide synthase in rat neutrophils: role of insulin. Biochem Pharmacol. 2001;62(3):357-362.

91. Guelke E, Bucan V, Liebsch C, et al. Identification of reference genes and validation for gene expression studies in diverse axolotl (Ambystoma mexicanum) tissues. Gene. 2015;560(1):114-123.

92. André S, Kerfourn F, Fellah JS. Molecular and biochemical characterization of the Mexican axolotl CD3 (CD3ε and CD3γ/δ). Immunogenetics. 2011;63(12):847-853.

93. Godwin JW, Debuque R, Salimova E, Rosenthal NA. Heart regeneration in the salamander relies on macrophage-mediated control of fibroblast activation and the extracellular landscape. NPJ Regen Med. 2017;2.

94. Phan SH. Biology of fibroblasts and myofibroblasts. Proc Am Thorac Soc. 2008;5(3):334-337.

118

BIOGRAPHICAL SKETCH

Anna Katherine Rodgers was born in Tallahassee, Florida in 1987 to Randy and

Margaret Wilding. She lived in Quincy, Florida for 10 years, then her family moved to

Live Oak, Florida. She attended Suwannee High School and graduated Valedictorian in

2005. She was awarded the Florida Academic Scholars Bright Futures Scholarship

upon graduation.

She attended Santa Fe Community College in 2005 and received an Associate of

Arts degree in chemistry. She transferred to the University of Florida in 2007. During her

undergraduate studies, she worked at the University of Florida’s Racing lab where she

learned laboratory skills and worked her way up to method development for detecting

metabolic steroids in serum samples for the horse racing industry. She graduated Cum

Laude in 2009 with a degree in chemistry with a biochemistry focus.

Her husband’s assignment to RAF Lakenheath, UK in the United States Air

Force took her to England after graduation. She started working for a contract research

organization, Quotient Bioresearch Ltd, in 2010. She was part of a team that developed

enzyme-linked immunosorbent assays for the detection of novel proteins in support of

phase I clinical trials.

In 2012, she joined the Interdisciplinary Program in Biomedical Sciences at the

University of Florida’s College of Medicine. In 2013, she joined Dr. Edward Scott’s

laboratory in the field of molecular cell biology. She studied the macrophage’s role in

skin regeneration using the axolotl animal model. She completed her dissertation in

2018 showing that axolotl macrophages regulate the axis between scarring and

regeneration in skin.