Invades Chicken Erythrocytes during Infection ACCEPTED · 25 as parasites or commensals of...
Transcript of Invades Chicken Erythrocytes during Infection ACCEPTED · 25 as parasites or commensals of...
Mycoplasma gallisepticum Invades Chicken
Erythrocytes during Infection
Gunther Vogl1, Astrid Plaickner1, Susan Szathmary2,
László Stipkovits2, Renate Rosengarten1, Michael P.
Szostak1*
1 Institute of Bacteriology, Mycology and Hygiene, Department of
Pathobiology, University of Veterinary Medicine Vienna, Veterinaerplatz
1, A-1210 Vienna, Austria
2 Veterinary Medical Research Institute, Hungarian Academy of Science,
Krt 21, H-1143 Budapest, Hungary
* Corresponding author,
phone: +43-1-25077-2104,
fax: +43-1-25077-2190,
email: [email protected]
Running Title: Mycoplasma gallisepticum Invades Erythrocytes
ACCEPTED
Copyright © 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.00871-07 IAI Accepts, published online ahead of print on 22 October 2007
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 2
Abstract 1
Recently, it was demonstrated in in vitro assays that the avian pathogen 2
Mycoplasma gallisepticum has the capability of invading non-phagocytic 3
cells. It was further shown that the mycoplasmas can survive and multiply 4
intracellularly for at least 48 h and that this cell invasion capacity 5
contributes to the systemic spreading of M. gallisepticum from the 6
respiratory tract to the inner organs. With the gentamicin invasion assay 7
and a differential immunofluorescence technique combined with confocal 8
laser scanning microscopy, we were able to demonstrate in in vitro 9
experiments that M. gallisepticum is also capable of invading sheep and 10
chicken erythrocytes. The frequency of invasion of three well-defined 11
M. gallisepticum strains was examined over a period of 24 h, and a 12
significant increase in invasiveness occurred after 8 h of infection. In 13
addition, blood samples derived from chickens experimentally infected by 14
aerosol with the virulent M. gallisepticum strain Rlow were analyzed. 15
Surprisingly, M. gallisepticum Rlow was detected in the blood stream of 16
infected chickens by nested PCR as well as by differential 17
immunofluorescence and interference contrast microscopy showing 18
mycoplasmas not only on the surface but also inside chicken erythrocytes. 19
This finding gives novel insights into the pathomechanism of 20
M. gallisepticum and may have implications for the development of 21
preventive strategies. 22
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 3
Introduction 23
Mycoplasmas are cell wall-less prokaryotes that are widespread in nature 24
as parasites or commensals of eukaryotic hosts. Many of them are 25
pathogens for mammals, reptiles, fish, arthropods, and plants (28) 26
causing a wide variety of diseases with a predilection for the respiratory 27
tract, the genital tract, and joints (30). Among the agents of infection and 28
disease in domestic poultry and wild birds, M. gallisepticum is the most 29
important mycoplasma species (18), causing great losses in the poultry 30
industry. Infections often remain asymptomatic, but commercial poultry 31
flocks are required to be M. gallisepticum-free, as infected birds become 32
life-long carriers with the means to horizontal and vertical transmission. 33
The clinical manifestation following infection which is characterized as 34
“Chronic Respiratory Disease (CRD)” in chickens and “Infectious Sinusitis” 35
in turkeys is mainly induced by stress (18). As the infection starts with the 36
colonization of the respiratory tract, tracheitis and air sacculitis are the 37
predominant symptoms of a localized infection in chickens. Occasionally, 38
M. gallisepticum infections are also associated with arthritis, salpingitis, 39
conjunctivitis, and fatal encephalopathy (25), indicating that the organism 40
is able to cross the mucosal epithelial barrier and reach distant locations in 41
the chicken. Experimentally, it has been shown that the pathogen is able 42
to spread throughout the body following aerosol infection as found by 43
reisolation of M. gallisepticum from the heart, brain, liver, spleen, and 44
kidneys of experimentally infected chickens (25). How this agent manages 45
to convert a local infection into a systemic one, still remains elusive. 46
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 4
Until the end of the 1980s, mycoplasmas were considered exclusively as 47
extracellular pathogens. This dogma was retracted, when in 1989, Lo et 48
al. (20) published the first report of a cell-invasive mycoplasma which was 49
isolated from patients with AIDS and later identified as M. fermentans. In 50
the years afterwards, the cell-invasive property of M. fermentans was 51
confirmed by other investigators (31, 32), and three other human 52
mycoplasmas, M. genitalium, M. pneumoniae and M. penetrans, were 53
reported to be similarly invasive for non-phagocytic cells (2, 21, 23, 32, 54
36). After these first discoveries of the cell-invasive potential of 55
mycoplasmas which are pathogenic for humans, M. gallisepticum, which 56
phylogenetically belongs to the M. pneumoniae cluster, was also described 57
to be cell-invasive, as it was shown to invade HeLa cells and chicken 58
embryo fibroblasts (CEF) in vitro (7, 34). At least for this mycoplasma 59
species it was further shown that the cell-invasive capacity plays an 60
important role in systemic spreading, because only the cell-invasive strain 61
Rlow was reisolated from inner organs after aerosol challenge of chickens, 62
whereas the non-invasive strain Rhigh was not (25). 63
That cell invasiveness provides bacterial pathogens with a number of 64
advantages is a generally accepted view. These advantages include 65
protection from the immune system, reduction of the efficacy of antibiotics 66
during treatment, as well as nutritional benefits. Moreover, internalization 67
by the eukaryotic host cell may enable the pathogen to pass through cell 68
barriers such as the mucosal epithelium. Of the cell-invasive 69
mycoplasmas, so far only M. fermentans, M. penetrans, and M. genitalium 70
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 5
have been found inside cells in vivo. Intracellular M. fermentans and 71
M. penetrans have been visualized in clinical samples or tissue material 72
from AIDS patients using electron microscopy (20, 21), whereas more 73
recently intracellular M. genitalium has been demonstrated in human 74
vaginal samples using confocal immunoanalysis (5). In contrast, no 75
intracellular residence in vivo has been described for M. pneumoniae and 76
M. gallisepticum to date, even though this has been implicated for 77
M. gallisepticum from the systemic spreading of cell culture invasion-78
positive organisms in the chicken host after experimental infection (25). 79
However, more recently, M. pneumoniae was detected by PCR in the 80
bloodstream of a substantial proportion of patients with mycoplasma 81
pneumonia (10). Since M. gallisepticum and M. pneumoniae are related 82
phylogenetically and have other features in common, including an 83
attachment organelle, homology of adhesins and adhesion-related 84
molecules, gliding motility, and the similarity of disease, this prompted us 85
to investigate the capability of M. gallisepticum to invade red blood cells 86
(RBCs). 87
In this report, we provide evidence for the first time that 88
M. gallisepticum is able to invade RBCs. Erythrocyte-invasive organisms 89
were not only detected after in vitro infection but also in vivo in blood 90
samples of experimentally infected chickens. These findings implicate an 91
infection strategy that was previously unknown for pathogenic 92
mycoplasmas. By invading the host’s RBCs during infection, 93
M. gallisepticum gains access to a perfect transportation system that 94
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 6
allows the agent to colonize distant niches while concomitantly being 95
protected from the host’s immune system. 96
Materials and Methods 97
Mycoplasma strains and growth conditions. M. gallisepticum strains 98
Rlow and Rhigh used in this study were kindly provided by S. Levisohn, 99
Kimron Veterinary Institute, Bet Dagan, Israel. Rlow represents the 10th 100
passage of the prototype strain R (19), and Rhigh represents the 164th 101
passage in artificial medium. The vaccine strain 6/85 was kindly provided 102
by Intervet (Intervet Intl., Boxmeer, The Netherlands). 103
All M. gallisepticum strains were grown in modified Hayflick medium (35) 104
containing 20% (vol/vol) heat-inactivated horse serum (Gibco Products - 105
Invitrogen Ltd., Paisley, UK). To estimate the number of colony forming 106
units (CFU) in cultures, serial dilutions were plated on modified Hayflick 107
medium containing 1% (wt/vol) Difco Agar Noble (BD, Franklin Lakes, NJ) 108
and incubated at 37°C. CFU were counted 7-10 days later using a SMZ-U 109
stereomicroscope (Nikon Corp., Tokyo, Japan). 110
DNA extraction. DNA extractions from M. gallisepticum cultures were 111
performed following the phenol extraction-method of Bashiruddin (3). The 112
DNA concentration was measured photometrically with a Gene Quant II 113
RNA/DNA Calculator (Pharmacia Biotech, Cambridge, UK). For the 114
detection of M. gallisepticum in blood of infected chickens, DNA was 115
extracted from the blood-Alsever´s solution mixture with the DNeasy 116
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 7
Blood & Tissue Kit (Qiagen, MD) following the manufacturer’s protocol. 117
Ten µl of blood was used per extraction, and DNA was eluted twice from 118
the column using 100 µl sterile H20 per elution. For subsequent nested 119
PCR analysis 50 µl of eluate were used. 120
Scanning electron microscopy. Sheep or chicken erythrocytes mixed 121
with M. gallisepticum cells for various periods of time were incubated 122
overnight on poly-L-lysine coated cover slips to allow binding of the red 123
blood cells. The cover slips were washed 3 times with PBS followed by 2 124
washes with cacodylate buffer (0.1 M sodium cacodylate, pH 7.4) for 10 125
min. Samples were then fixed in 2.5% glutaraldehyde in cacodylate buffer 126
for 2 h at 4°C, and washed 3 times in cacodylate buffer. After a 127
dehydration of the samples with graded series of ethanol concentrations, 128
the specimens were critical point-dried in a Bal-TEC CPD030 (BAL-TEC AG, 129
Balzers, Liechtenstein), and after mounting, they were sputter-coated with 130
gold/palladium in a Polaron SC7640 (Quorum Technologies Ltd., 131
Newhaven, UK). The samples were viewed using a JEOL JSM 5410LV 132
scanning electron microscope (Jeol Ltd., Tokyo, Japan), operated at 10 133
kV. 134
Nested PCR. A nested PCR covering the 5’ region of crmA was 135
developed to detect M. gallisepticum in chicken blood. The external 136
primers J3F/J3R were applied in a 20 cycle amplification reaction yielding 137
a 349 bp product, while the internal primers J2F/J2R in a 30 cycle reaction 138
generated a 288 bp PCR product. The first amplification reaction was 139
performed in a total volume of 100 µl containing final concentrations of 3 140
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 8
mM MgCl2, 0.2 mM dNTPs, 200 nM primers J3F (5’- 141
GCAATTAGTTAATCAAGCAAG -3’) and J3R (5’- 142
ATTACCAATTCTATTTGAGTTAG -3’), and 5 units of GoTaq polymerase 143
(Promega Corp., Madison, WI). Amplification conditions were 94°C for 3 144
min followed by 20 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 2 145
min, and a final extension step for 7 min at 72°C. For the nested PCR 146
reaction, 2 µl of the first PCR amplification reaction were used. The 147
reaction was performed in a total volume of 25 µl containing final 148
concentrations of 3 mM MgCl2, 0.2 mM dNTPs, 200 nM primers J2F (5’- 149
GAACGCTAGATGCTAATTCTG-3’) and J2R (5’- 150
GAACGTTAGCTTCATCATTAACC-3’), and 1.5 units of GoTaq polymerase. 151
The amplification conditions were similar to the first PCR, but included 30 152
instead of 20 cycles. Detection of amplification products was achieved by 153
electrophoresis of 3 µl of the reaction product in a 1.6% agarose gel 154
containing ethidium bromide and inspection under UV light. Gel pictures 155
were taken with the ChemiDocTM XRS Gel Documentation System (Bio-Rad 156
Laboratories Inc., Hercules, CA). 157
Gentamicin invasion assay. The number of intracellular 158
M. gallisepticum in HeLa-229 cells was analyzed using the gentamicin 159
invasion assay as described elsewhere (34) except for testing the efficacy 160
of gentamicin: briefly, mycoplasma cultures were centrifuged, washed, 161
and resuspended in Invitrogen’s minimum essential medium (MEM) to a 162
final density of 3-5 × 108 CFU per ml. Then, serial dilutions of gentamicin 163
were added to reach final concentrations from 25 to 400 µg/ml. After 3 h 164
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 9
of incubation at 37°C, aliquots were plated onto agar plates without 165
gentamicin. As a gentamicin concentration of 100 µg/ml was shown to be 166
sufficient to kill all mycoplasmas in the medium, the gentamicin invasion 167
assays were performed with a gentamicin concentration of 400 µg/ml. 168
For quantification of intraerythrocytic M. gallisepticum, the protocol was 169
adapted as follows: Citrated chicken blood was centrifuged at 1,000 g for 170
3 min, and the pellet was washed at least two times in PBS while the buffy 171
coat layer containing white blood cells was removed. The remaining RBCs 172
were adjusted to 2 × 108 RBC/ml with PBS. M. gallisepticum strains Rlow, 173
Rhigh, and 6/85 were grown as described above to mid-exponential phase, 174
as indicated by the metabolic color change of the medium, followed by at 175
least 3 washings with PBS. During washing, the M. gallisepticum culture 176
was centrifuged at 12,000 g for 10 min, and after the final centrifugation 177
the pellet was resuspended in Invitrogen´s MEM mix containing L-178
glutamine, Earle’s balanced salts, and HEPES, supplemented with 179
Invitrogen´s 5% (vol/vol) tryptose phosphate broth, 0.1 mM non-180
essential amino acids, and 7.75% (vol/vol) fetal calf serum. Resuspended 181
M. gallisepticum cells were passed through a 23 G-injection needle with 182
high speed at least 20 times to disperse the mycoplasma cells. For 183
infection of RBCs, M. gallisepticum cultures were diluted to approximately 184
4-8 × 105 CFU/ml and mixed with RBCs to yield a final ratio of 185
erythrocytes:mycoplasmas of 125:1 to 500:1. After 1, 2, 4, 8, and 24 h of 186
infection at 37°C, 1 ml samples were removed and split into two parts: 187
One part was mixed with the same volume of MEM containing gentamicin 188
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 10
to reach a final concentration of 400 µg/ml and incubated for 3 h at 37°C 189
to kill all extracellular mycoplasmas, whereas the second part received the 190
same treatment but without the antibiotic. After incubation, the samples 191
were washed at least 3 times with PBS by centrifugation at 12,000 g for 192
10 min. Finally, appropriate dilutions of both gentamicin-treated and 193
untreated RBC suspensions were plated onto modified Hayflick agar plates 194
to allow intraerythrocytic mycoplasmas to form colonies. The number of 195
colonies was determined 7-10 days later and the invasion frequencies 196
were calculated from the numbers of colonies with and without gentamicin 197
treatment. 198
Differential immunofluorescence assay. The presence of 199
mycoplasmas within RBCs either in the in vitro or the in vivo experiments 200
was investigated by a modified version of the double-immunofluorescence 201
(DIF) method described by Heesemann and Laufs (15). An adaptation of 202
this method for use with mycoplasmas and HeLa cells, and the generation 203
of polyclonal anti-M. gallisepticum rabbit antibodies (Abs) have been 204
described elsewhere (34). The DIF method was adapted for use with 205
erythrocytes as follows: Chicken or sheep RBCs were washed and infected 206
with M. gallisepticum cultures similar to the procedure described for the 207
gentamicin invasion assay. The infected RBCs were gently washed 3 times 208
with PBS containing 2% (wt/vol) bovine serum albumin (PBS-BSA), and 209
extracellular mycoplasmas were detected by incubating unpermeabilized 210
cells with rabbit anti-M. gallisepticum-hyperimmune serum diluted 1:200 211
in PBS-BSA for 30 min at room temperature (RT) and then with 1:2,000-212
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 11
diluted fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit-IgG 213
(Harlan Sera-Lab Ltd., Loughborough, UK) for 30 min at RT. The RBCs 214
were then placed into chambers of an 8-well Lab-Tek II chamber slide 215
(Nalge Nunc Intl., Rochester, NY) and air-dried. The RBCs were fixed and 216
permeabilized with ethanol washings of increasing concentration (50-217
96%) to allow intracellular antibody diffusion followed by two washings 218
with 100% methanol and air-drying. In order to stain all extracellular and 219
intracellular mycoplasma, each chamber was incubated with the same 220
anti-M. gallisepticum hyperimmune serum for 30 min, followed by an 221
incubation for 30 min with goat anti-rabbit-IgG labeled with Alexa Fluor 222
405 (Molecular Probes, Invitrogen). In the case of RBCs from 223
experimentally infected chickens, goat anti-rabbit-IgG labeled with Alexa 224
Fluor 633 (Molecular Probes, Invitrogen) was used. Finally, the chambers 225
were removed, and the samples were mounted under a glass cover slip in 226
1:1.7 (vol/vol) glycerol:PBS containing 13% (wt/vol) Mowiol (Clariant, 227
Muttenez, Switzerland) and 0.5% (wt/vol) n-propyl gallate (Sigma-Aldrich, 228
St. Louis, MO). Samples were examined with the confocal laser scanning 229
microscope LSM 510 Meta (Carl Zeiss MicroImaging GmbH, Jena, 230
Germany) using argon (488 nm), diode (405 nm), or helium-neon lasers 231
(633 nm) for specific excitation of the fluorescence dyes FITC, Alexa Fluor 232
405, and Alexa Fluor 633. The resulting fluorescence images were 233
superimposed by differential interference contrast (DIC) micrographs for 234
visualization of the RBCs. 235
Animal experiments. One-day old Ross 308 chickens originating from 236
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 12
a commercial flock free of M. gallisepticum and M. synoviae as monitored 237
by monthly serological testings were selected for the infection experiment 238
which was performed at the Veterinary Medical Research Institute, 239
Budapest, Hugary, in accordance with the guidelines of the Hungarian Law 240
for protection of animal rights. The mycoplasma-free status was verified 241
by testing chicken sera with the MYGA and MYSY ELISA kits (Diagnosticum 242
Zrt., Budapest, Hungary) and by 14-day-cultivation of trachea swab 243
samples in modified Hayflick medium. Ten chickens were selected for the 244
animal experiment and raised under isolated conditions. At day 21, they 245
were placed in an aerosol chamber of 0.22 m3. For the experimental 246
infection, 10 ml of a freshly grown culture of M. gallisepticum strain Rlow 247
(5.6 x 107 CFU ml-1) was sprayed with 1 atm pressure for 100 sec into the 248
chamber and the birds were left exposed for another 20 min. Blood was 249
collected the day before challenge and then on days 6, 12, and 20 p.i. 250
from the chicken wing vein. Blood from all the chickens- sampled on the 251
same day- was pooled and mixed with an equal amount of Alsever´s 252
solution. After thorough mixing, the blood was kept at 4°C or frozen at 253
-20°C until further PCR analysis. 254
Statistical analysis of the gentamicin invasion assay. Numerical 255
data for gentamicin invasion assays were calculated from the means of at 256
least 5 independent experiments ± standard deviation. The normal 257
distribution of the data was tested with the Kolmogorov-Smirnov test. 258
Invasion frequencies of strains Rlow, Rhigh, and 6/85 at different times were 259
compared by one-way analysis of variance (ANOVA) using the statistical 260
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 13
analysis program SPSS 14.0 (SPSS Inc., Chicago, IL). A P value of <0.05 261
was considered significant. 262
Results 263
Interaction of M. gallisepticum with Erythrocytes Visualized by 264
Scanning Electron Microscopy. In a first approach to examine the 265
erythrocyte-invasion properties of M. gallisepticum, the morphological 266
details of its interaction with erythrocytes was studied by scanning electron 267
microscopy after incubating sheep and chicken RBCs for various periods of 268
time with mycoplasma cells. As seen in Figure 1, showing an infected 269
sheep (Fig. 1A) and chicken (Fig. 1B) erythrocyte, some of the 270
mycoplasmas appeared to adhere with their tip structure to the RBC 271
surface. This observation was not unexpected, as the tip structure of 272
M. gallisepticum is considered as specialized multifunctional organelle that 273
mediates attachment to the respiratory epithelium of the chicken host 274
during infection (6). Some of the RBCs displayed a misshapen and twisted 275
morphology (Fig. 1B), as was also reported by Lam (17) and Razin et al. 276
(29). The most intriguing detail, however, were the imprints seen on the 277
otherwise smooth surface of selected RBCs, as shown in Figure 1A. The 278
form of these imprints resembled the pear-like shape of M. gallisepticum 279
cells that might have penetrated the RBC membrane at that point. This 280
finding encouraged us to further investigate whether M. gallisepticum is in 281
fact able to invade RBCs in vitro. 282
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 14
M. gallisepticum Invades Erythrocytes In Vitro. To investigate the 283
presence of intracellular mycoplasma, a double immunofluorescence 284
technique (DIF) was used. The DIF staining was applied on sheep and 285
chicken erythrocytes incubated for different periods of time with the 286
virulent M. gallisepticum strain Rlow. Confocal laser scanning micrographs 287
of sheep RBCs infected for 24 h revealed the presence of intraerythrocytic 288
M. gallisepticum cells (data not shown). The RBCs contained only one 289
organism per cell, and the number of RBCs carrying intraerythrocytic 290
mycoplasmas was very low, estimated to be 1 out of 2,000. 291
M. gallisepticum Rlow was able to invade chicken erythrocytes after 292
infection for 24 h (Fig. 2). The superimposition of FITC- and Alexa Fluor 293
405-fluorescence with the differential interference contrast (DIC) 294
micrograph clearly showed both, surface and intracellular foci of 295
fluorescence corresponding to extracellular and intracellular mycoplasmas 296
(Fig. 2E). 297
In parallel studies, when scanning along a vertical Z-axis and taking 298
micrographs of each 0.5 µm slice (Fig. 2D-F), an extracellular mycoplasma 299
located at the erythrocyte’s surface (yellow) became visible, fading out as 300
the cross section layer was moved downwards. At the same time, an 301
intracellular mycoplasma (red) came into view showing the relative 302
difference in the localization of these two mycoplasma cells. Uninfected 303
RBCs treated with anti-M. gallisepticum antiserum and FITC- and Alexa 304
fluor 405 conjugated antibodies exhibited no fluorescence at all (not 305
shown). Interestingly, all intracellular mycoplasmas were located in the 306
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 15
cytoplasm or perinuclear region, but never inside the nucleus of the 307
chicken RBCs. 308
The gentamicin invasion assay, a method first described by Kihlström 309
(16) was used to quantify the percentage of intracellular bacteria within 310
the whole population. Since gentamicin is not able to cross intact 311
eukaryotic cell membranes, it kills only extracellular mycoplasmas when 312
added to a M. gallisepticum-infected cell culture. A time course 313
experiment (Fig. 3) was used to compare the number of CFU in 314
gentamicin-treated and untreated M. gallisepticum-infected RBC 315
suspensions. After 30 min of infection, M. gallisepticum established 316
intracellular residence, therefore surviving the gentamicin treatment (data 317
not shown). Significant differences of cell invasiveness were observed 318
between the hemadsorption (HA)-positive strain Rlow and HA-negative 319
strains Rhigh and 6/85 (Fig. 3), with strain Rlow being the strain of highest 320
invasiveness. The mean invasion frequencies of Rlow ranged from 0.13% 321
after the first hour to 1.18% after 24 h, whereas the highest invasion rate 322
was found at 0.22% for strains Rhigh at 8 h and 0.09% for 6/85 at 4 h. At 323
all times examined, Rlow exhibited the highest invasion rate, while strain 324
6/85 had the lowest. The reduced invasion rate of 6/85 is statistically 325
significant compared to Rlow and Rhigh after 8 h (P < 0.05) and to Rlow after 326
24 h (P < 0.02). Statistical significant differences of invasiveness between 327
Rlow and Rhigh were only observed after 24 h of invasion (P < 0.05). 328
Overall, the invasion frequencies of all three M. gallisepticum strains were 329
drastically lower when RBCs were used instead of the HeLa-229 cell line. 330
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 16
Concurring with the invasion rates for Rlow and Rhigh reported by Winner et 331
al. (34), we observed invasion frequencies after 2 h of infection of 5.7% 332
and 1.1%, respectively, whereas the vaccine strain 6/85 exhibited a lower 333
invasion rate of 0.5%. Comparing these frequencies with the invasion 334
frequencies found with RBCs, this means a 18-fold, 48-fold and 11-fold 335
higher invasion rate for Rlow, Rhigh and 6/85, respectively, when HeLa-cells 336
are used. 337
Interestingly, in the time course experiment the invasion frequencies of 338
Rlow did not follow a linear course from 1 to 24 h invasion time, but 339
increased only slightly during the first 8 h. Between 8 and 24 h the 340
invasion frequency of Rlow increased 6-fold whereas the invasion rate 341
stayed relatively constant for Rhigh and 6/85. 342
M. gallisepticum Invades Chicken Erythrocytes during In Vivo 343
Infection. Blood samples taken from chickens experimentally infected 344
with M. gallisepticum Rlow were analyzed for the presence of 345
M. gallisepticum by DIF microscopy and by nested PCR. The successful 346
infection and systemic spreading of the pathogen was proven by necropsy 347
including lesion scoring of typical M. gallisepticum-associated lesions and 348
reisolation of the pathogen from inner organs (data not shown). 349
When applying the same DIF technique on these blood samples as in the 350
in vitro experiments, M. gallisepticum cells residing not only on the 351
surface but also inside the chicken RBCs could be detected (Fig. 4). The 352
numbers of mycoplasmas found either inside or on the surface of RBCs in 353
blood samples of experimentally infected chickens was rather low. Only 354
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 17
one out of 500 RBCs of the experimentally infected chickens carried a 355
M. gallisepticum cell either intra- or extracellularly as estimated from the 356
investigation of multiple samples. 357
For a highly sensitive detection of M. gallisepticum Rlow in chicken blood, 358
a PCR method based on the nested amplification of a sequence in the 5’ 359
region of the crmA gene was developed. The sensitivity of the nested PCR 360
approach was determined with both, serial dilutions of genomic DNA of 361
Rlow and with chicken blood mixed with dilutions of viable M. gallisepticum. 362
An amount as low as 16 fg of genomic DNA of Rlow tested positive with this 363
PCR approach calculated to correspond to 14.5 M. gallisepticum genome 364
equivalents. The calculation is based on the given genome size of 365
M. gallisepticum strain Rlow of 996,422 bp (27). When mixing viable Rlow 366
with erythrocytes, the detection limit of the nested PCR approach was 1.7 367
CFU. 368
With this highly sensitive PCR approach, blood samples from 369
experimentally infected chickens were analyzed (Fig. 5). Blood from 370
chickens taken before infection (day 0, negative control) did not result in 371
a PCR amplification product, indicating that no mycoplasma was present in 372
the blood before infection. The same sample mixed with 3.7 × 104 CFU 373
per ml of Rlow (positive control) led to the amplification of the 288 bp 374
fragment showing that no PCR-inhibitory compounds were present in the 375
blood samples. All samples taken 6, 12, and 20 days post infection (p.i.) 376
tested positive, indicating the presence of M. gallisepticum Rlow in the 377
blood stream of chickens as early as 6 days p.i. Based on the sensitivity of 378
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 18
the nested PCR assay with mycoplasma-spiked erythrocytes (see above), 379
the PCR detection signal was calculated to correspond to at least 680 CFU 380
per ml of chicken blood. 381
Discussion 382
When analyzing the erythrocyte-adhesion properties of different 383
M. gallisepticum strains we made scanning electron micrographs of 384
M. gallisepticum-infected RBCs where we observed invaginations and 385
grooves containing structures that show the typical pear-like shape of 386
M. gallisepticum as the surface-attached mycoplasmas. Changes in the 387
surface of mycoplasma-infected chicken erythrocytes like the appearance 388
of dimples and grooves were already reported before by Lam (17), and 389
indentations of sheep erythrocyte membranes after exposure to 390
M. gallisepticum were described by Razin et al. (29). Such indentations 391
have also been described for M. penetrans in interaction with eukaryotic 392
cells (21) and for the erythrocyte-invasive bacterium Bartonella 393
bacilliformis (4). Lam even observed perforations on the surface of 394
M. gallisepticum-exposed erythrocytes and speculated that 395
M. gallisepticum may penetrate the RBCs (17). In this report we provide 396
evidence that M. gallisepticum indeed is able to invade RBCs, not only in 397
an experimental in vitro system, but also under in vivo conditions during 398
the course of experimental infection. 399
The erythrocyte invasion of M. gallisepticum was proven in vitro with 400
well-established approaches to identify intracellular bacteria in order not 401
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 19
to rely on a single method only. The technical problems inherent in each 402
method might lead to an erroneous judgment on the cell invasiveness of a 403
given pathogen if only a single method is used. A common problem of the 404
gentamicin invasion assay is that the number of mycoplasma colonies 405
growing on the agar plates better represents the number of infected host 406
cells rather than the number of invasive mycoplasmas. Several 407
mycoplasmas simultaneously infecting one given RBC or intracellularly 408
multiplying mycoplasmas derived from a single infecting organism might 409
lead to the formation of only one single mycoplasma colony on Hayflick 410
agar. The same result can be expected if a single mycoplasma infects one 411
RBC without multiplying. The real invasion frequency of a given 412
M. gallisepticum strain therefore might be different. To minimize the 413
possible error, a low multiplicity of infection of erythrocytes: mycoplasmas 414
ranging from 125:1 to 500:1 was chosen, to reduce the possibility of 415
multiple infections of any given RBC. To rule out the effect of intracellular 416
multiplication on the results, the CFU of treated and untreated 417
M. gallisepticum/RBC- suspensions were compared. This is in contrast to 418
Winner et al. (34) who compared CFU values before and after gentamicin 419
treatment, which in our case gave slightly higher invasion rates (data not 420
shown), an effect that could also be due to extracellular multiplication of 421
M. gallisepticum during incubation in the untreated control group. 422
The time-course experiment for the in vitro invasion capabilities of the 423
three M. gallisepticum strains included in this study was followed for 24 h. 424
Longer infection periods resulted in falsely negative results as the 425
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 20
erythrocytes apparently started to lyse after that period of time. 426
Interestingly, the invasion rates of the virulent strain Rlow increased only 427
slightly during the first 8 h but then increased by a factor of nearly 6 428
during the next 16 h. A possible explanation might be that after the first 429
contact with the RBCs, M. gallisepticum responds by producing certain 430
gene products which enable the pathogen to enter the RBC more 431
efficiently. Another explanation might be that the small percentage of 432
M. gallisepticum that successfully invades the RBCs in the first few hours 433
have multiplied intracellularly, and after escaping the originally invaded 434
RBC, they again invaded previously uninfected RBCs de novo. The ability 435
of M. gallisepticum to multiply inside cells has already been described for 436
HeLa-229 cells (34). 437
Mycoplasma species other than M. gallisepticum were also reported to 438
propagate intracellularly, as it has been described for M. penetrans and for 439
the closely related species M. pneumoniae and M. genitalium (2, 8, 23). 440
The apparent advantages of entering eukaryotic cells are protection from 441
the host’s immune system, while getting easy access to nutrients. In the 442
case of erythrocyte invasion the additional benefit might be the iron found 443
inside the erythrocytes in large amounts in the form of hemin or other 444
trace metals. The requirement of iron for bacterial growth is a common 445
theme in pathogenicity (13), and hemin is known to support the growth of 446
invasive bacteria like Bartonella quintana (26) and Haemophilus influenzae 447
(1). An influence of hemin on growth of mycoplasmas has, however, not 448
been described to date. 449
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 21
Another main advantage of entering erythrocytes might be the means to 450
reach new sites of infection. M. gallisepticum causes acute and chronic 451
infections in birds (18) and chronicity of mycoplasma infections is 452
speculated to be due to intracellular persistence of the pathogen (2, 8). 453
M. gallisepticum has been reisolated from different chicken organs 454
including the brain after experimental in vivo infection (25). The systemic 455
spreading via the blood stream, however, might explain how the pathogen 456
reaches its distant niches after the first colonization of the air sacs by 457
causing a transient bacteremia of at least 20 days post infection, as 458
indicated by the nested PCR experiments. After a certain time of 459
intraerythrocytic residence, M. gallisepticum may escape by lysing the 460
erythrocyte with the help of the membrane-bound hemolysin activity 461
reported by Minion and Jarvill-Taylor (24). 462
The cell invasion process of mycoplasmas is still poorly understood. 463
Fibronectin-binding proteins as detected in other facultative intracellular 464
bacteria (11, 12) have been identified also in M. penetrans (14), 465
M. pneumoniae (9), and more recently also in M. gallisepticum (22). 466
However, the mechanism of M. gallisepticum invasion into non-phagocytic 467
eukaryotic cells is still not clear at present. In M. pneumoniae it has been 468
speculated that adhesion and invasion are independent features, because 469
cytadherence-positive but invasion-negative strains were detected (2). In 470
the strains used in our experiments, we observed that erythrocyte 471
invasion of M. gallisepticum correlates with hemadsorption, therefore 472
concluding that cytadherence, and expression of the hemadsorption-473
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 22
mediating genes gapA and crmA (7, 33) is at least a prerequisite for cell 474
invasion if not directly correlated. 475
Although host cell invasion has been reported for a few mycoplasma 476
species, including M. gallisepticum (2, 7, 20, 23, 31, 32, 34, 36), this is to 477
our knowledge the first report that provides evidence that M. gallisepticum 478
invades red blood cells in vitro and in vivo, a fact which has not been 479
shown for any mycoplasma species so far. A more thorough investigation 480
about the mechanism underlying erythrocyte invasion will be addressed in 481
the near future. 482
Acknowledgements 483
We thank M. Skalicky and C. Binter for assistance with the statistical 484
calculations, and C. Neubauer for providing chicken blood for the in vitro 485
assays. 486
Funding 487
This work was supported in part by grant P16538 (to RR) from the 488
Austrian Science Fund (FWF), and by a pilot project grant (to MPS) from 489
the University of Veterinary Medicine Vienna through its research focus 490
programme. GV was financially supported by the FWF and by a doctoral 491
fellowship from the University of Veterinary Medicine Vienna. AP was 492
supported by Mycosafe Diagnostics GmbH. 493
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 23
References 494
1. Artman, M., E. Domenech, and M. Weiner. 1983. Growth of 495
Haemophilus influenzae in simulated blood cultures supplemented with 496
hemin and NAD. J. Clin. Microbiol. 18:376-379. 497
2. Baseman, J. B., M. Lange, N. L. Criscimagna, J. A. Giron, and C. 498
A. Thomas. 1995. Interplay between mycoplasmas and host target 499
cells. Microb. Pathog. 19:105-116. 500
3. Bashiruddin, J. B. 1998. Extraction of DNA from Mycoplasmas, p. 501
141-144. In R. Miles and R. Nicholas (ed.), Mycoplasma Protocols, vol. 502
104. Humana Press, Totowa, New Jersey. 503
4. Benson, L. A., S. Kar, G. McLaughlin, and G. M. Ihler. 1986. Entry 504
of Bartonella bacilliformis into erythrocytes. Infect. Immun. 54:347-505
353. 506
5. Blaylock, M. W., O. Musatovova, J. G. Baseman, and J. B. 507
Baseman. 2004. Determination of infectious load of Mycoplasma 508
genitalium in clinical samples of human vaginal cells. J. Clin. Microbiol. 509
42:746-752. 510
6. Carson, J. L., P.-C. Hu, and A. M. Collier. 1992. Cell Structural and 511
Functional Elements, p. 63-72. In J. Maniloff, R. N. McElhaney, L. R. 512
Finch, and J. B. Baseman (ed.), Mycoplasmas - Molecular Biology and 513
Pathogenesis. American Society for Microbiology, Washington, D.C. 514
7. Citti, C., G. F. Browning, and R. Rosengarten. 2005. Phenotypic 515
diversity and cell invasion in host subversion by pathogenic 516
mycoplasmas, p. 439-483. In A. Blanchard and G. F. Browning (ed.), 517
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 24
Mycoplasmas: Pathogenesis, molecular biology, and emerging 518
strategies for control. Horizon Bioscience, Wymondham, Norfolk, UK. 519
8. Dallo, S. F., and J. B. Baseman. 2000. Intracellular DNA replication 520
and long-term survival of pathogenic mycoplasmas. Microb. Pathog. 521
29:301-309. 522
9. Dallo, S. F., T. R. Kannan, M. W. Blaylock, and J. B. Baseman. 523
2002. Elongation factor Tu and E1 beta subunit of pyruvate 524
dehydrogenase complex act as fibronectin binding proteins in 525
Mycoplasma pneumoniae. Mol. Microbiol. 46:1041-1051. 526
10. Daxboeck, F., G. Khanakah, C. Bauer, M. Stadler, H. Hofmann, 527
and G. Stanek. 2005. Detection of Mycoplasma pneumoniae in serum 528
specimens from patients with mycoplasma pneumonia by PCR. Int. J. 529
Med. Microbiol. 295:279-285. 530
11. Duensing, T. D., J. S. Wing, and J. P. van Putten. 1999. 531
Sulfated polysaccharide-directed recruitment of mammalian host 532
proteins: a novel strategy in microbial pathogenesis. Infect. Immun. 533
67:4463-4468. 534
12. Dziewanowska, K., J. M. Patti, C. F. Deobald, K. W. Bayles, W. 535
R. Trumble, and G. A. Bohach. 1999. Fibronectin binding protein and 536
host cell tyrosine kinase are required for internalization of 537
Staphylococcus aureus by epithelial cells. Infect. Immun. 67:4673-538
4678. 539
13. Finlay, B. B., and S. Falkow. 1997. Common themes in microbial 540
pathogenicity revisited. Microbiol. Mol. Biol. Rev. 61:136-169. 541
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 25
14. Giron, J. A., M. Lange, and J. B. Baseman. 1996. Adherence, 542
fibronectin binding, and induction of cytoskeleton reorganization in 543
cultured human cells by Mycoplasma penetrans. Infect. Immun. 544
64:197-208. 545
15. Heesemann, J., and R. Laufs. 1985. Double immunofluorescence 546
microscopic technique for accurate differentiation of extracellularly and 547
intracellularly located bacteria in cell culture. J. Clin. Microbiol. 22:168-548
175. 549
16. Kihlstrom, E. 1977. Infection of HeLa cells with Salmonella 550
typhimurium 395 MS and MR10 bacteria. Infect. Immun. 17:290-295. 551
17. Lam, K. M. 2003. Mycoplasma gallisepticum-induced alterations in 552
chicken red blood cells. Avian Dis. 47:485-488. 553
18. Ley, D. H. 2003. Mycoplasma gallisepticum Infection, p. 722-743. 554
In Y. M. Saif (ed.), Diseases of Poultry, 11 ed. Iowa State Press, Ames. 555
19. Lin, M. Y., and S. H. Kleven. 1984. Evaluation of attenuated 556
strains of Mycoplasma gallisepticum as vaccines in young chickens. 557
Avian Dis. 28:88-99. 558
20. Lo, S. C., M. S. Dawson, D. M. Wong, P. B. Newton, 3rd, M. A. 559
Sonoda, W. F. Engler, R. Y. Wang, J. W. Shih, H. J. Alter, and D. 560
J. Wear. 1989. Identification of Mycoplasma incognitus infection in 561
patients with AIDS: an immunohistochemical, in situ hybridization and 562
ultrastructural study. Am. J. Trop. Med. Hyg. 41:601-616. 563
21. Lo, S. C., M. M. Hayes, H. Kotani, P. F. Pierce, D. J. Wear, P. B. 564
Newton, 3rd, J. G. Tully, and J. W. Shih. 1993. Adhesion onto and 565
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 26
invasion into mammalian cells by Mycoplasma penetrans: a newly 566
isolated mycoplasma from patients with AIDS. Mod. Pathol. 6:276-280. 567
22. May, M., L. Papazisi, T. S. Gorton, and S. J. Geary. 2006. 568
Identification of fibronectin-binding proteins in Mycoplasma 569
gallisepticum strain R. Infect. Immun. 74:1777-1785. 570
23. Mernaugh, G. R., S. F. Dallo, S. C. Holt, and J. B. Baseman. 571
1993. Properties of adhering and nonadhering populations of 572
Mycoplasma genitalium. Clin. Infect. Dis. 17 Suppl 1:S69-78. 573
24. Minion, F. C., and K. Jarvill-Taylor. 1994. Membrane-associated 574
hemolysin activities in mycoplasmas. FEMS Microbiol. Lett. 116:101-575
106. 576
25. Much, P., F. Winner, L. Stipkovits, R. Rosengarten, and C. 577
Citti. 2002. Mycoplasma gallisepticum: Influence of cell invasiveness 578
on the outcome of experimental infection in chickens. FEMS Immunol. 579
Med. Microbiol. 34:181-186. 580
26. Myers, W. F., L. D. Cutler, and C. L. Wisseman, Jr. 1969. Role of 581
erythrocytes and serum in the nutrition of Rickettsia quintana. J. 582
Bacteriol. 97:663-666. 583
27. Papazisi, L., T. S. Gorton, G. Kutish, P. F. Markham, G. F. 584
Browning, D. K. Nguyen, S. Swartzell, A. Madan, G. Mahairas, 585
and S. J. Geary. 2003. The complete genome sequence of the avian 586
pathogen Mycoplasma gallisepticum strain R(low). Microbiology 587
149:2307-2316. 588
28. Razin, S. 1992. Mycoplasma taxonomy and ecology, p. 3-22. In J. 589
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 27
Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), 590
Mycoplasmas: Molecular Biology and Pathogensis. American Society for 591
Microbiology, Washington, D.C. 592
29. Razin, S., M. Banai, H. Gamliel, A. Polliack, W. Bredt, and I. 593
Kahane. 1980. Scanning electron microscopy of mycoplasmas 594
adhering to erythrocytes. Infect. Immun. 30:538-546. 595
30. Simecka, J. W., J. K. Davis, M. K. Davidson, S. E. Ross, C. T. 596
Städtlander, H. Kirchhoff, and G. H. Cassell. 1992. Mycoplasma 597
Diseases of Animals, p. 391 - 415. In J. Maniloff (ed.), Mycoplasmas, 598
Molecular Biology and Pathogenesis. American Society for Microbiology, 599
Washington D.C. 600
31. Stadtlander, C. T., H. L. Watson, J. W. Simecka, and G. H. 601
Cassell. 1993. Cytopathogenicity of Mycoplasma fermentans (including 602
strain incognitus). Clin. Infect. Dis. 17 Suppl 1:S289-301. 603
32. Taylor-Robinson, D., H. A. Davies, P. Sarathchandra, and P. 604
M. Furr. 1991. Intracellular location of mycoplasmas in cultured cells 605
demonstrated by immunocytochemistry and electron microscopy. Int. 606
J. Exp. Pathol. 72:705-714. 607
33. Winner, F., I. Markova, P. Much, A. Lugmair, K. Siebert-Gulle, 608
G. Vogl, R. Rosengarten, and C. Citti. 2003. Phenotypic switching in 609
Mycoplasma gallisepticum hemadsorption is governed by a high-610
frequency, reversible point mutation. Infect. Immun. 71:1265-1273. 611
34. Winner, F., R. Rosengarten, and C. Citti. 2000. In vitro cell 612
invasion of Mycoplasma gallisepticum. Infect. Immun. 68:4238-4244. 613
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 28
35. Wise, K. S., and R. K. Watson. 1983. Mycoplasma hyorhinis GDL 614
surface protein antigen p120 defined by monoclonal antibody. Infect. 615
Immun. 41:1332-1339. 616
36. Yavlovich, A., M. Tarshis, and S. Rottem. 2004. Internalization 617
and intracellular survival of Mycoplasma pneumoniae by non-618
phagocytic cells. FEMS Microbiol. Lett. 233:241-246. 619
620
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 29
Figure Legends 621
FIG. 1. Scanning electron micrographs of sheep (A) and chicken (B) 622
erythrocytes after in vitro-infection with a clonal derivative of 623
M. gallisepticum strain Rlow. The arrows indicate mycoplasmas or imprints 624
of mycoplasmas appearing to sink into the erythrocyte surface. 625
FIG. 2. Confocal Z-scan of a chicken RBCs in vitro-infected with 626
M. gallisepticum strain Rlow after DIF staining. 627
The same area of a confocal microscopic picture after DIF staining is 628
analyzed for extracellular M. gallisepticum labeled with FITC (green 629
fluorescence, A) and for extra- and intracellular M. gallisepticum labeled 630
with Alexa Fluor 405 (red fluorescence, B). Superimposition (D-F) of the 631
green and red fluorescence with the differential interference contrast 632
(DIC) micrograph (C) results in yellow fluorescence indicating extracellular 633
M. gallisepticum, while the red fluorescent focus indicates an 634
intraerythrocytic mycoplasma cell. When scanning from top to bottom (D-635
F) of the erythrocyte, first an extracellular mycoplasma cell located at the 636
surface (yellow label) is visible, slowly fading out as the cross section 637
layer is moving downwards (E,F). At the same time the intracellular 638
mycoplasma cell is coming to the fore (E,F) showing the relative difference 639
in the localization of these two mycoplasma cells. 640
FIG. 3. Chicken RBC invasion frequencies of M. gallisepticum strains Rlow, 641
Rhigh, and 6/85 at different times. 642
Each value represents the mean ± standard deviation of a minimum of 5 643
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Mycoplasma gallisepticum Invades Erythrocytes 30
independent gentamicin invasion assays. The asterisk symbol indicates 644
statistical significant differences of RBC invasiveness between Rlow (white 645
bars) and Rhigh (grey bars) or 6/85 (black bars), the plus symbol 646
represents statistical significance between Rhigh and 6/85. 647
FIG. 4. RBCs from an experimentally M. gallisepticum-infected chicken 648
after DIF staining. 649
Superimposed picture after FITC- and Alexa Fluor 633-labeling showing 650
M. gallisepticum attached to the RBC’s surface (yellow label) and inside 651
the chicken RBC (red label) after experimental in vivo infection. The 652
erythrocytes were visualized by differential interference microscopy. 653
FIG. 5. Agarose gel electrophoresis of nested PCR products from blood 654
samples of experimentally infected chickens. 655
Blood samples were taken before experimental infection of chickens (lane 656
0), on day 6 p.i. (lanes 1,2), day 12 p.i. (lanes 3-5), and day 20 p.i. 657
(lanes 6-8). A positive control using M. gallisepticum-spiked chicken blood 658
(+) and a PCR negative control (-) were included. M, molecular size 659
marker (1 kb ladder, Invitrogen). 660
ACCEPTED
on July 15, 2020 by guesthttp://iai.asm
.org/D
ownloaded from