Introduction to Bioinformatics Dot Plots. One of the simplest and oldest methods for sequence...
-
Upload
whitney-small -
Category
Documents
-
view
215 -
download
2
Transcript of Introduction to Bioinformatics Dot Plots. One of the simplest and oldest methods for sequence...
![Page 1: Introduction to Bioinformatics Dot Plots. One of the simplest and oldest methods for sequence alignment Visualization of regions of similarity –Assign.](https://reader036.fdocuments.us/reader036/viewer/2022082817/56649e245503460f94b1222e/html5/thumbnails/1.jpg)
Introduction to Bioinformatics
Dot Plots
![Page 2: Introduction to Bioinformatics Dot Plots. One of the simplest and oldest methods for sequence alignment Visualization of regions of similarity –Assign.](https://reader036.fdocuments.us/reader036/viewer/2022082817/56649e245503460f94b1222e/html5/thumbnails/2.jpg)
Dot Plots
• One of the simplest and oldest methods for sequence alignment
• Visualization of regions of similarity – Assign one sequence on the horizontal axis– Assign the other on the vertical axis– Place dots on the space of matches– Diagonal lines means adjacent regions of
identity
![Page 3: Introduction to Bioinformatics Dot Plots. One of the simplest and oldest methods for sequence alignment Visualization of regions of similarity –Assign.](https://reader036.fdocuments.us/reader036/viewer/2022082817/56649e245503460f94b1222e/html5/thumbnails/3.jpg)
Simple Example• Construct a simple dot plot for
GCTGAAGCGAA
One sequence goes horizontally, the other verticallyMark boxes w/ matched horizontal and vertical symbolsLook for diagonal(s)
Alignment:GCTGAAGCT-AA
G C T G A A
G * *
C *
T *
A *
A *
![Page 4: Introduction to Bioinformatics Dot Plots. One of the simplest and oldest methods for sequence alignment Visualization of regions of similarity –Assign.](https://reader036.fdocuments.us/reader036/viewer/2022082817/56649e245503460f94b1222e/html5/thumbnails/4.jpg)
Another Example• Construct a simple dot plot for
GCTAGTCAGATCTGACGCTAGATGGTCACATCTGCCGC
A long stretch of nearly identical residues is revealed starting at the fifth nucleotide of each sequence (GTCA-ATCTG-CGC).
![Page 5: Introduction to Bioinformatics Dot Plots. One of the simplest and oldest methods for sequence alignment Visualization of regions of similarity –Assign.](https://reader036.fdocuments.us/reader036/viewer/2022082817/56649e245503460f94b1222e/html5/thumbnails/5.jpg)
Sliding Window and Cutoff
• Problem– Plot becomes noisy when comparing large,
similar sequences
• Solution– Sliding window (size = w)– Cutoff (value = v)– Consider w nucleotides at a time – When at least v matches in a window, place a
dot on the space where the window starts
![Page 6: Introduction to Bioinformatics Dot Plots. One of the simplest and oldest methods for sequence alignment Visualization of regions of similarity –Assign.](https://reader036.fdocuments.us/reader036/viewer/2022082817/56649e245503460f94b1222e/html5/thumbnails/6.jpg)
Example• Same example with w = 4 and v = 3
• Compare to the previous plot. You make the call!
![Page 7: Introduction to Bioinformatics Dot Plots. One of the simplest and oldest methods for sequence alignment Visualization of regions of similarity –Assign.](https://reader036.fdocuments.us/reader036/viewer/2022082817/56649e245503460f94b1222e/html5/thumbnails/7.jpg)
Worksheet • w = 4 and v = 3
![Page 8: Introduction to Bioinformatics Dot Plots. One of the simplest and oldest methods for sequence alignment Visualization of regions of similarity –Assign.](https://reader036.fdocuments.us/reader036/viewer/2022082817/56649e245503460f94b1222e/html5/thumbnails/8.jpg)
What else can it do (and how)?
• Gaps • Inverse subsequence• Repeats• Palindrome• Genome rearrangement• Exon identification• RNA structure prediction• Nice tool for conceptualizing sequence-
related algorithms