Introduction to Bioinformatics 2. Genetics Background Course 341 Department of Computing Imperial...
-
date post
19-Dec-2015 -
Category
Documents
-
view
228 -
download
1
Transcript of Introduction to Bioinformatics 2. Genetics Background Course 341 Department of Computing Imperial...
Introduction to Bioinformatics2. Genetics Background
Course 341
Department of Computing
Imperial College, London
© Simon Colton
Coursework
1 coursework – worth 20 marks– Work in pairs
Retrieving information from a database
Using Perl to manipulate that information
The Robot Scientist
Performs experiments Learns from results
– Using machine learning Plans more experiments Saves time and money
Team member:– Stephen Muggleton
Biological Nomenclature
Need to know the meaning of:– Species, organism, cell, nucleus, chromosome, DNA– Genome, gene, base, residue, protein, amino acid– Transcription, translation, messenger RNA– Codons, genetic code, evolution, mutation, crossover– Polymer, genotype, phenotype, conformation– Inheritance, homology, phylogenetic trees
Substructure and Effect(Top Down/Bottom Up)
Species
Organism
Cell
Nucleus
Chromosome
DNA strand
Gene
Base
Protein
Amino AcidFoldsinto
Affects theFunction of
Affects theBehaviour of
Prescribes
Cells
Basic unit of life Different types of cell:
– Skin, brain, red/white blood– Different biological function
Cells produced by cells– Cell division (mitosis)– 2 daughter cells
Eukaryotic cells– Have a nucleus
Nucleus and Chromosomes
Each cell has nucleus Rod-shaped particles inside
– Are chromosomes– Which we think of in pairs
Different number for species– Human(46),tobacco(48)– Goldfish(94),chimp(48)– Usually paired up
X & Y Chromosomes– Humans: Male(xy), Female(xx)– Birds: Male(xx), Female(xy)
DNA Strands
Chromosomes are same in every cell of organism– Supercoiled DNA (Deoxyribonucleic acid)
Take a human, take one cell– Determine the structure of all chromosonal DNA– You’ve just read the human genome (for 1 person)– Human genome project
13 years, 3.2 billion chemicals (bases) in human genome
Other genomes being/been decoded:– Pufferfish, fruit fly, mouse, chicken, yeast, bacteria
DNA Structure
Double Helix (Crick & Watson)– 2 coiled matching strands– Backbone of sugar phosphate pairs
Nitrogenous Base Pairs – Roughly 20 atoms in a base– Adenine Thymine [A,T]– Cytosine Guanine [C,G]– Weak bonds (can be broken)– Form long chains called polymers
Read the sequence on 1 strand– GATTCATCATGGATCATACTAAC
Differences in DNA
2% tiny
Roughly 4%
Share
Materia
l
DNA differentiates:– Species/race/gender– Individuals
We share DNA with– Primates,mammals– Fish, plants, bacteria
Genotype– DNA of an individual
Genetic constitution
Phenotype– Characteristics of the
resulting organism Nature and nurture
Genes
Chunks of DNA sequence– Between 600 and 1200 bases long– 32,000 human genes, 100,000 genes in tulips
Large percentage of human genome – Is “junk”: does not code for proteins
“Simpler” organisms such as bacteria– Are much more evolved (have hardly any junk)– Viruses have overlapping genes (zipped/compressed)
Often the active part of a gene is spit into exons– Seperated by introns
The Synthesis of Proteins
Instructions for generating Amino Acid sequences– (i) DNA double helix is unzipped– (ii) One strand is transcribed to messenger RNA – (iii) RNA acts as a template
ribosomes translate the RNA into the sequence of amino acids
Amino acid sequences fold into a 3d molecule Gene expression
– Every cell has every gene in it (has all chromosomes)– Which ones produce proteins (are expressed) & when?
Transcription
Take one strand of DNA Write out the counterparts to each base
– G becomes C (and vice versa)– A becomes T (and vice versa)
Change Thymine [T] to Uracil [U] You have transcribed DNA into messenger RNA Example:
Start: GGATGCCAATGIntermediate: CCTACGGTTACTranscribed: CCUACGGUUAC
Genetic Code
How the translation occurs
Think of this as a function:– Input: triples of three base letters (Codons)– Output: amino acid– Example: ACC becomes threonine (T)
Gene sequences end with: – TAA, TAG or TGA
Genetic CodeA=Ala=Alanine
C=Cys=Cysteine
D=Asp=Aspartic acid
E=Glu=Glutamic acid
F=Phe=Phenylalanine
G=Gly=Glycine
H=His=Histidine
I=Ile=Isoleucine
K=Lys=Lysine
L=Leu=Leucine
M=Met=Methionine
N=Asn=Asparagine
P=Pro=Proline
Q=Gln=Glutamine
R=Arg=Arginine
S=Ser=Serine
T=Thr=Threonine
V=Val=Valine
W=Trp=Tryptophan
Y=Tyr=Tyrosine
Proteins
DNA codes for – strings of amino acids
Amino acids strings– Fold up into complex 3d molecule – 3d structures:conformations– Between 200 & 400 “residues”– Folds are proteins
Residue sequences– Always fold to same conformation
Proteins play a part– In almost every biological process
Evolution of Genes: Inheritance
Evolution of species– Caused by reproduction and survival of the fittest
But actually, it is the genotype which evolves– Organism has to live with it (or die before reproduction)– Three mechanisms: inheritance, mutation and crossover
Inheritance: properties from parents– Embryo has cells with 23 pairs of chromosomes– Each pair: 1 chromosome from father, 1 from mother– Most important factor in offspring’s genetic makeup
Evolution of Genes: Mutation
Genes alter (slightly) during reproduction– Caused by errors, from radiation, from toxicity– 3 possibilities: deletion, insertion, alteration
Deletion: ACGTTGACTC ACGTGACTC Insertion: ACGTTGACTC AGCGTTGACTC Substitution: ACGTTGACTC ACGATGACTT Mutations are almost always deleterious
– A single change has a massive effect on translation– Causes a different protein conformation
Evolution of Genes: Crossover (Recombination)
DNA sections are swapped – From male and female genetic input to offspring DNA
Bioinformatics Application #1Phylogenetic trees
Understand our evolution Genes are homologous
– If they share a common ancestor By looking at DNA seqs
– For particular genes– See who evolved from who
Example:– Mammoth most related to
African or Indian Elephants?
LUCA:– Last Universal Common Ancestor– Roughly 4 billion years ago
Genetic Disorders
Disorders have fuelled much genetics research– Remember that genes have evolved to function
Not to malfunction
Different types of genetic problems Downs syndrome: three chromosome 21s Cystic fibrosis:
– Single base-pair mutation disables a protein– Restricts the flow of ions into certain lung cells– Lung is less able to expel fluids
Bioinformatics Application #2Predicting Protein Structure
Proteins fold to set up an active site– Small, but highly effective (sub)structure– Active site(s) determine the activity of the protein
Remember that translation is a function– Always same structure given same set of codons– Is there a set of rules governing how proteins fold?– No one has found one yet– “Holy Grail” of bioinformatics
Protein Structure Knowledge
Both protein sequence and structure– Are being determined at an exponential rate
1.3+ Million protein sequences known– Found with projects like Human Genome Project
20,000+ protein structures known– Found using techniques like X-ray crystallography
Takes between 1 month and 3 years– To determine the structure of a protein– Process is getting quicker
Sequence versus Structure
009590850
100000
200000
300000
400000
500000
Year
Number
Protein sequence
Protein structure
Database Approaches
Slow(er) rate of finding protein structure– Still a good idea to pursue the Holy Grail
Structure is much more conservative than sequence– 1.3m genes, but only 2,000 – 10,000 different conformations
First approach to sequence prediction:– Store [sequence,structure] pairs in a database– Find ways to score similarity of residue sequences– Given a new sequence, find closest matches
A good match will possibly mean similar protein shape E.g., sequence identity > 35% will give a good match
– Rest of the first half of the course about these issues
Potential (Big) Payoffsof Protein Structure Prediction
Protein function prediction– Protein interactions and docking
Rational drug design– Inhibit or stimulate protein activity with a drug
Systems biology– Putting it all together: “E-cell” and “E-organism”– In-silico modelling of biological entities and process