Interleukin-26 in Antibacterial Host Defense of Human Lungs. Effects on Neutrophil Mobilization

Interleukin-26 in Antibacterial Host Defense of Human Lungs:

Effects on Neutrophil Mobilization

Karlhans F. Che1; Sara Tengvall

2*; Bettina Levänen

1*; Elin Silverpil

1; Margaretha E.

Smith2; Muhammed Awad

3,4; Max Vikström

5; Lena Palmberg

1; Ingemar Qvarfordt

2;

Magnus Sköld3,4 & Anders Lindén

1,2,4.

*These authors contributed equally.

1) Unit for Lung and Airway Research, Institute of Environmental Medicine, Karolinska

Institutet, Stockholm, SE 171 77 Sweden.

2) Lung Immunology Group, Institute of Medicine, Sahlgrenska Academy at the University of

Gothenburg, SE 405 30, Sweden.

3) Unit of Respiratory Medicine, Department of Medicine Solna, Karolinska Institutet, Stockholm

SE 171 77, Sweden.

4) Lung Allergy Clinic, Karolinska University Hospital, Stockholm, SE 171 76, Sweden.

5) Unit for Cardiovascular Epidemiology, Institute of Environmental Medicine, Karolinska

Institutet, Stockholm, SE 171 77, Sweden.

Corresponding author:

Anders Lindén, M.D., Ph.D.

Unit for Lung and Airway Research, Physiology Division, Institute for Environmental Medicine,

Karolinska Institutet, PO Box 210, SE 171 77 Stockholm,

E-mail: [email protected], Phone: +46 707 090 2286

Author contribution: A.L. conceived the project, provided funding and coordinated the research.

K.F.C., S.T., B.L., E.S., M.E.S., L.P., I.Q. and A.L. outlined the research protocols. K.F.C., S.T.,

B.L., E.S., M.E.S., M.A., and M.S. performed the practical research. K.F.C., M.E.S., M.A., M.S.,

of 56 AJRCCM Articles in Press. Published on 07-October-2014 as 10.1164/rccm.201404-0689OC

Copyright © 2014 by the American Thoracic Society

and A.L. provided human specimens. K.F.C., S.T., B.L., E.S., M.V., and A.L. reviewed the data.

K.F.C. and A.L. wrote the manuscript. S.T., B.L., E.S., L.P. and I.Q. critically reviewed the

contents of the manuscript and all authors approved the final version of the manuscript.

Project Funding: Project funding was obtained from the Heart-Lung Fund (#20130294) and

from King Gustav V’s and Queen Victoria’s Freemason Research Foundation. Federal funding

was obtained from Karolinska Institutet and, in accordance with the ALF/LUA agreement, from

Stockholms Läns Landsting and the Västra Götaland Region. No funding was obtained from the

tobacco industry and none of the authors has financial conflict with or interest in the contents of

this manuscript.

Running title: IL-26 in pulmonary host defense

Subject descriptor number: 10.6.

Text word count: 3,687

At a Glance Commentary:

Scientific Knowledge on the Subject: The role of the presumed Th17 cytokine IL-26 in

antibacterial host defense of the lungs is not known.

What This Study Adds to the Field: This study suggests that IL-26 is produced by alveolar

macrophages mainly and exerts critical actions in antibacterial host defense of human lungs. By

stimulating receptors on neutrophils and by acting on other cells as well, IL-26 focuses neutrophil

mobilization towards bacteria and accumulated immune cells. Therefore, targeting IL-26 in

severe infections and inflammatory disorders of the lungs may have therapeutic potential.

This article has an online data supplement, which is accessible from this issue's table of content

online at www.atsjournals.org



Abstract

Rationale: The role of the presumed Th17 cytokine interleukin (IL)-26 in antibacterial host

defense of the lungs is not known.

Objective: To characterize the role of IL-26 in antibacterial host defense of human lungs.

Methods: Intra-bronchial exposure of healthy volunteers to endotoxin and vehicle was performed

during bronchoscopy and bronchoalveolar lavage (BAL) samples were harvested. Intracellular

IL-26 was detected using immunocytochemistry and -cytofluorescence. This IL-26 was also

detected using flow cytometry, as was its receptor complex. Cytokines and phosphorylated

STAT1 plus -3 were quantified using ELISA. Gene expression was analyzed by real-time PCR

and neutrophil migration was assessed in vitro.

Measurements and Main Results: Extracellular IL-26 was detected in BAL samples without

prior exposure in vivo and was markedly increased after endotoxin exposure. Alveolar

macrophages (AM) displayed gene expression for, contained, and released IL-26. T-helper (Th)

and cytotoxic T (Tc) cells also contained IL-26. In the BAL samples, IL-26 concentrations and

innate effector cells displayed a correlation. Recombinant IL-26 potentiated neutrophil

chemotaxis induced by IL-8 and fMLP but decreased chemokinesis for neutrophils.

Myeloperoxidase in conditioned media from neutrophils was decreased. The IL-26 receptor

complex was detected in neutrophils and IL-26 decreased phosphorylated STAT3 in these cells.

In BAL and bronchial epithelial cells, IL-26 increased gene expression of the IL-26 receptor

complex and STAT1 plus -3. Finally, IL-26 increased the release of neutrophil-mobilizing

cytokines in BAL but not in epithelial cells.



Conclusion: This study implies that alveolar macrophages produce IL-26 that stimulates

receptors on neutrophils and focuses their mobilization towards bacteria and accumulated

immune cells in human lungs.

Abstract word count: 257

Key words: IL-10, infection, inflammation, macrophage, T cell



1

Introduction

Bacterial infections in the lungs and airways affect and kill millions of people worldwide each

year (1). Despite these facts and extensive research efforts, there is limited understanding of the

immunological mechanisms underlying antibacterial host defense of the lungs. This is

unfortunate given the increasing need for new therapy that can complement antibiotics or target

chronic inflammatory disorders.

There is evidence that T-helper (Th) 17 cells are critically involved in antibacterial host

defense of the lungs (2-10) and interleukin (IL)-26 is a relatively unknown cytokine that may be

produced by Th17 cells (11-14). By releasing their archetype cytokine IL-17A, these Th17 cells

can contribute to the recruitment and accumulation of neutrophils and macrophages during

infections in the lungs (2, 7). However, given the variety of cytokines released by Th17 cells,

remarkably little is known about the corresponding role of Th17 cytokines other than IL-17A.

This is particularly true for IL-26, presumably because there is no known homologue to IL-26 in

non-primates (15).

In contrast to the lack of information on antibacterial host defense in the lungs, evidence

from human joint and gut tissue cells suggests that IL-26 is involved in chronic inflammatory

disorders, such as rheumatoid arthritis (RA) (16) and Crohn’s disease (17). In a model of human

lining epithelial cells from the colon and skin, recombinant human (rh) IL-26 stimulated the

release of the neutrophil-recruiting C-X-C chemokine IL-8 (14) and was also demonstrated in gut

tissue from patients with Crohn’s disease (17). In support of these observations, the increased

mRNA for IL-26 in Crohn’s disease correlated with mRNA for IL-8 (17) and the antibacterial

Th17 cytokine IL-22 (17). Moreover, IL-26 was markedly increased in synovial fluid from

patients with RA and rhIL-26 induced the release of the neutrophil-mobilizing cytokines IL-1β,



2

IL-6, tumor necrosis factor (TNF)-α, and IL-8 in human monocytes (16). Although this evidence

is indirect, it is compatible with a pro-inflammatory role for IL-26 in antibacterial host defense

(11, 15, 18).

Given that IL-26 and IL-17A can be coproduced by Th17 cells and that these cells are

present in human airways exposed to bacterial stimuli (2, 7, 10, 11), we hypothesized that IL-26,

just like IL-17A, is involved and plays a critical role in antibacterial host defense of human lungs.

We here report evidence from healthy volunteers and human primary cells supporting this

hypothesis and none of the results in this study have previously been reported in the form of an

abstract.



3

Material and Methods

We performed bronchoscopies and collected bronchoalaveolar lavage (BAL) samples in healthy

volunteers, with or without intra-bronchial exposure to endotoxin and vehicle (2, 19-21). With

the aim to detect intracellular IL-26 in BAL cells, we performed immunocytochemistry (ICC)

and immunocytofluorescence (ICF) as well as flow cytometry (FACS) (2, 19, 21). We also

cultured and stimulated BAL cells, isolated, cultured and stimulated blood neutrophils and

primary bronchial epithelial cells (22). Moreover, we quantified cytokines including IL-26 and

phosphorylated STAT1 and -3 using ELISA, and gene expressions using real-time PCR. Finally,

we utilized a neutrophil migration assay (23). All the methods are described in the Online

supplement (see Method E1).

Statistical Analysis: Parametric analysis was performed using Students paired t-test (GraphPad

Prism® software) unless otherwise stated (see Method E1).



4

Results

The Release of IL-26 in Response to Endotoxin and Its Association with Neutrophils and

Macrophages

Because local exposure to endotoxin in vivo increases IL-17A and Th17-like cells in healthy

human airways (2), we determined whether IL-26 responds in a similar manner. We used an

established protocol for unilateral, intra-bronchial exposure in healthy volunteers, allowing

simultaneous control sampling in a contralateral bronchial segment (2, 20). Bronchoscopies were

performed at the time of exposure and were repeated at either 12, 24 or 48 hours (h) later. We

detected IL-26 in non-concentrated, cell-free BAL fluid even in BAL fluid from the vehicle-

exposed bronchial segments and these concentrations of IL-26 were markedly increased in the

endotoxin-exposed segments of the same subjects. This pattern was observed in 30 out of the 31

(97%) volunteers studied (Figure 1A). Moreover, endotoxin exposure in vitro of BAL cells from

healthy volunteers who had not been exposed to endotoxin or vehicle in vivo displayed a clear

increase of IL-26 concentrations in conditioned media (Figure 1B). In line with this, endotoxin

exposure in vitro caused a 3.4-fold increase in IL-26 mRNA (Figure 1C). The BAL fluid from

the same individuals (n=18) contained measurable IL-26 protein [135 (30-603) pg/mL] as well,

although these concentrations were somewhat lower than those in the BAL fluid from bronchial

segments exposed to vehicle. This was probably because of the absence of a preceding

bronchoscopy or spill-over of endotoxin from adjacently exposed bronchial segments (19, 24).

Importantly, we found a strong correlation for IL-26 and neutrophils (Figure 1D) and

macrophages (Figure 1E), but not for lymphocytes (Figure 1F) in these subjects. Notably, in

BAL samples from volunteers undergoing unilateral, intra-bronchial endotoxin exposure in vivo,

increased IL-26 coincided with increased concentrations of accumulated innate immune cells, in



5

particular neutrophils, at 12, 24 or 48 h (cell counts published in Glader et al)(2). Using the

Bernard test (see Method E1), taking into account the use of two samples from each individual

(ie. vehicle- and endotoxin-exposed bronchial segments) as a single variable, we found direct

associations of IL-26 and neutrophil (p=0.002) and macrophage (p=0.006) concentrations.

Intracellular IL-26 Protein in Small and Large Mononuclear BAL Cells

T-helper cells from human blood constitute sources of IL-26 that is coproduced with IL-17A and

IL-22, designating Th17 cells as a source of IL-26 (11-14). However, Corvaisier et al recently

published evidence that IL-26 is secreted by CD68+ synoviocytes in the joints of patients with

RA (16). It is also known that the archetype Th17 cytokine IL-17A can be produced by CD68+

alveolar macrophages (AM) and cytotoxic T-cells under certain conditions, suggesting several

sources of IL-26 (25, 26). Consequently, our initial aim was to identify sources of IL-26 among

small and large mononuclear cells from the airways. First, we analyzed unsorted BAL cells from

healthy volunteers undergoing intra-bronchial endotoxin-exposure in vivo with respect to

detecting IL-26 protein utilizing specific monoclonal antibodies for ICC and ICF. The strong

immunoreactivity of the ICC indicated IL-26 protein in small as well as large mononuclear cells

as oppose to the isotype control (Figure 2A and B). Our protocol clearly discriminated between

positive and negative cells (Figure 2B), arguing against unspecific binding. To strengthen the

evidence for IL-26 protein in the large mononuclear cells presumed to be AM, a specific

monoclonal anti-CD68 antibody was added. We then showed colocalization of CD68 and IL-26

in large mononuclear BAL cells (Figure 2D), which was not the case for the corresponding

isotype control antibody (Figure 2C). We confirmed the colocalization of CD68 and IL-26 in the

large mononuclear BAL cells using ICF (Figure 2E, F and G).

Expression of IL-26 protein in Cytotoxic T-cells, T-helper Cells and Macrophages



6

Using FACS, we next characterized the small mononuclear sources of IL-26 in unsorted BAL

cells from healthy volunteers that had not undergone prior in vivo exposure to vehicle and

endotoxin. The BAL cells were stimulated ex vivo with 100 ng/ml of endotoxin or vehicle during

24 h, in the absence of the protein transport inhibitor monensin. Here, we used specific

monoclonal antibodies against IL-26 (16) and against markers of T (CD3), Th (CD4), cytotoxic T

(Tc) cells (CD8), and the Th17 transcription factor (RORCvar2), plus the corresponding isotype

control antibodies. We detected colocalization of IL-26 protein with all these T cell markers,

without substantial differences between cells stimulated with vehicle or endotoxin (n=6) (Figure

3A). In contrast, we were unable to detect any colocalization of IL-26 and IL-17A in the gated

small mononuclear cells. This negative outcome is arguably conclusive since the same FACS

protocol clearly detected IL-17A in Th17 cells differentiated from human blood in vitro (data not

shown). For the purpose of optimizing the detection of IL-26-producing cells, we stimulated the

BAL cells during 4 h with endotoxin or vehicle in the presence of monensin (n=3). Again, we

found colocalization of IL-26 with the macrophage marker CD68 [41.3 (21-63) %] as well as

with the T-cell markers CD3 [34.5 (19.3-54.4) %], CD4 [27.7 ([19.5-45.8) %] and CD8 [11.2

(7.58-14.6) %] (Figure 3B). However, there were no clear differences between cells stimulated

with vehicle or endotoxin.

Given the detected colocalization of IL-26 and CD68 using ICC, ICF and FACS on unsorted

BAL cells, we conducted FACS on BAL cells enriched through adhesion and stimulated ex vivo

with 1 ug/ml of endotoxin or vehicle during 20 h without monensin. Almost all the adherent BAL

cells expressed CD68, in the presence of endotoxin [99.5 (99.3-99.7) %] or its vehicle [99.3 (99.2

-99.7) %] (n=4), verifying an enriched AM population. In these CD68+ cells, we found a high

percentage of inherent expression of IL-26 in the vehicle-exposed cells, one that was further

enhanced after stimulation with endotoxin (Figure 3C). To ascertain that AM also release IL-26,



7

we quantified IL-26 protein in the conditioned media. We then detected IL-26 after vehicle

exposure and this IL-26 was increased after stimulation with endotoxin (Figure 3D). Finally, the

adherent BAL cells were analyzed for mRNA expression of IL-26 (n=4) and we found that the

detected mRNA tended be increased after stimulation with endotoxin (see Figure E1)

IL-26 Potentiates Chemotaxis but Inhibits Chemokinesis of Neutrophils

The statistically proven correlations between IL-26 and neutrophils in BAL samples (Figure 1D)

indicated that IL-26 exerts effects on neutrophil migration; even more so, since ICC and ICF

indicated that BAL neutrophils do not express IL-26 (Figure 2). To evaluate whether IL-26 may

exert a direct or indirect effect on neutrophil migration, we examined the impact of rhIL-26 on

chemotaxis and chemokinesis of blood neutrophils in vitro. We found that rhIL-26 potentiated

chemotaxis induced by IL-8 and fMLP (Figure 4A and 4B). By assessing the maximum effect

caused by rhIL-26, we found that rhIL-26 increased IL-8-induced migration by a 4.2-fold [1.3-

17.1] (n=8) and fMLP-induced migration by an 11.6-fold [1.1-41.9] (n=5), suggesting strong

potentiation of chemotaxis. In contrast, stimulation with rhIL-26 alone in untreated neutrophils

inhibited spontaneous migration (i.e. chemokinesis) (Figure 4C).

Effect of IL-26 on Phosphorylated STAT1 and -3 in Neutrophils

Previous studies have linked receptor stimulation with IL-26 to alterations in STAT1 and -3 (11,

12, 14, 15). When we tried to verify functional IL-26 receptor signaling in isolated neutrophils,

we found that rhIL-26 exerted a reproducible decrease in phosphorylated STAT3. Stimulation

with rhIL-26 had a corresponding effect after costimulation with G-CSF (a potent STAT3-

activator (27)) (Figure 4D). In contrast, during costimulation with IL-8 or fMLP, rhIL-26 did not

alter phosphorylated STAT3 in a reproducible manner (see Figure E2A). Moreover, we found no



8

effect of rhIL-26 alone on STAT1, nor after costimulation with G-CSF, IL-8 or fMLP (see

Figure E2B & C).

Expression of the IL-26 Receptor Protein Complex on Neutrophils

We also investigated the expression of IL-26 receptor complex (IL-10R2 and IL-20R1) on

isolated blood neutrophils in vitro. We then found inherent expression of both receptor sub-units

(Figure 4E-H) but pre-stimulation with rhIL-26, LPS, IL-8, or fMLP did not alter this receptor

expression (see Figure E2D & E)

IL-26 Stimulates the Release of Neutrophil-Mobilizing Cytokines and Up-regulates Gene

Expression of Its Receptor Complex and Signaling Molecules in BAL cells

Its proven link to neutrophil mobilization in RA and Chron’s disease as well as our novel finding

that IL-26 was increased in BAL fluid from healthy volunteers after endotoxin exposure in vivo,

motivated us to characterize the effects of IL-26 on the release of four neutrophil-mobilizing

cytokines in unsorted BAL cells ex vivo. We then found that stimulation with rhIL-26 increased

IL-8, IL-1β, TNF-α, and GM-CSF in conditioned media (Figure 5A-D). We also characterized

the effects of IL-26 on gene expression of the IL-26 receptor complex and the downstream

signaling molecules in unsorted BAL cells. We detected the targeted mRNA (p-values for

targeted mRNA relative to the house-keeping gene β-actin) and a clear increase in IL-10R2

(p=0.03), IL-20R1 (p=0.0057) and STAT1 (p=0.01) after stimulation with rhIL-26 (Figure 5E).

For STAT3 (p=0.1), there was a trend towards an IL-26-induced increase only (Figure 5E).

IL-26 Inhibits the Release of MPO Protein in Neutrophils

Neutrophils are considered the main sources of MPO protein in the airways (28) but these cells

are scarce in BAL samples from healthy non-smoking volunteers (29) (see Figure E3). Given the

latter, we collected unsorted BAL samples with a neutrophil fraction of at least 2% of the total



9

cell number and stimulated these cells with rhIL-26 or vehicle during 24 h in vitro. This

stimulation decreased MPO in conditioned media (Figure 5F). The same type of inhibitory effect

was observed in isolated blood neutrophils in vitro as well (Figure 5G).

IL-26 Inhibits the Release of Neutrophil-Mobilizing Cytokines and Up-regulates Gene

Expression of Its Receptor Complex and Signaling Molecules in Bronchial Epithelial Cells

Bronchial epithelial cells play a critical role in initiating inflammatory responses to local bacteria

(30). We therefore assessed the effects of IL-26 on the release of neutrophil-mobilizing cytokines

using PBECs, submerged in culture in vitro. Here, stimulation with rhIL-26 decreased IL-8, IL-

1β, TNF-α, and GM-CSF in conditioned media (Figure 6A-D). We also characterized the effects

of IL-26 on gene expression of the IL-26 receptor complex and the downstream signaling

molecules. We detected the targeted mRNA (p-values for targeted mRNA relative to the house-

keeping gene β-actin) and a clear increase in IL-10R2 (p=0.03), IL-20R1 (p=0.02), STAT1

(p=0.03) and STAT3 (p=0.02) after stimulation by rhIL-26 (Figure 6E). In addition, we examined

the effects of IL-26 on antimicrobial peptides (LL-37, calprotectin and beta defensin-2) plus the

secretory leukocyte peptidase inhibitor (SLPI) in the conditioned media from PBEC using

ELISA. Here, although concentrations were detectable, stimulation with rhIL-26 did not increase

SLPI and calprotectin (see Figure E4). The concentrations for LL-37 and beta defensin-2 were

not detectable.

Discussion

We investigated BAL samples from healthy volunteers, after intra-bronchial exposure to

endotoxin and to its vehicle as well as without any prior exposure in vivo. We found detectable

concentrations of IL-26 even in bronchial segments without prior exposure or with exposure to

vehicle only. These IL-26 concentrations were markedly increased in bronchial segments with



10

prior exposure to the toll-like receptor (TLR)-4 agonist endotoxin. Moreover, the concentrations

of innate effector cells and IL-26 correlated in bronchial segments exposed to endotoxin or

vehicle as well as unexposed healthy volunteers. Given the massive dilution of the

bronchoepithelial lining fluid during BAL, these relatively high concentrations indicate a

substantial and inducible release of IL-26 protein in human lungs.

In order to identify the potential sources of IL-26 among immune cells in the

bronchoalevolar space, we utilized ICC, ICF and FACS. Notably, these three approaches all

provided evidence that AM constitute a prominent source of IL-26 in the lungs. Moreover,

stimulation with endotoxin ex vivo significantly increased IL-26 in the CD68+ adherent BAL

cells, indicating induced production of IL-26 in the abundant AM; a novel finding in line with

previously published data on IL-26 expression in CD68+ synoviocytes in patients with RA (16).

Expanding the evaluation of IL-26 production in AM, we demonstrated mRNA and an

endotoxin-induced increase in intracellular IL-26 as well as extracellular IL-26 in a 99% positive

fraction of CD68+ cells. Collectively, these findings prove that AMs can produce and release IL-

26. Given these novel findings and the previously published negative data on human monocytes

and dendritic cells (31), we speculate that, after extravasation, monocytes need to mature into

tissue macrophages to develop the capacity to produce IL-26. The immunological importance of

AM and their role as the most abundant “immune barrier cells” in the lungs warrant further study

in this respect.

In addition to previous studies of IL-26 in T cells (11-14), we here forward novel

evidence for its production in T cells from human lungs as well. We demonstrate the presence of

IL-26 in small mononuclear BAL cells in vivo as well as the specific colocalization of IL-26 and

the generic T-cell marker CD3, the Th-marker CD4 and the Tc-marker CD8. Interestingly, the



11

detection of colocalization of IL-26 with the Tc-marker CD8 is an entirely novel finding

irrespective of human organ. It is to be expected that we found significant intracellular expression

of IL-26 protein in T cells without endotoxin-induced increase. This is because T cells have very

limited expression of TLR-4 compared to macrophages and do not normally produce cytokines

nor proliferate in response to endotoxin (32, 33).

We did detect colocalization of IL-26 with the archetype Th17 transcription factor

RORCvar2 but only in a modest 14% of the endotoxin-stimulated small mononuclear cells. It

thus seems unlikely that this Th17 population accounts for the larger part of the IL-26 protein

detected in the BAL samples of the current study, given our demonstration of its transcription,

production and release by abundant AM. Thus, we suggest that IL-26 may be produced by

several types of immune cells in healthy human lungs but AM emerge as the most prominent

source during activation of antibacterial host defense, at least after exposure to a TLR4 agonist.

Although we were unable to block endogenous IL-26 signaling in humans in vivo for

ethical reasons, our current study brings forward no less than five (5) lines of evidence that local

IL-26 is functionally important for the mobilization of neutrophils to sites of bacteria and

accumulated immune cells in human lungs. First, the induced increase in IL-26 was associated

with a pronounced accumulation of innate effector cells in vivo and the concentrations of these

entities even correlated with one another. Second, we found that IL-26 potentiated neutrophil

chemotaxis induced by IL-8 (~4-fold) or fMLP (~12-fold) in vitro. Third, we found that IL-26

alone inhibited chemokinesis of neutrophils in vitro. Fourth, we established evidence for a

functional IL-26 membrane protein receptor complex in neutrophils by using FACS and by

showing an induced decrease in phosphorylated STAT3 by rhIL-26. We found that IL-26

decreased phosphorylated STAT3 even after costimulation with the potent STAT3-activator G-



12

CSF but not in the presence of IL-8 or fMLP, which is compatible with previous studies (27). In

this way, IL-26 may serve an important immunological purpose, by inhibiting random migration

of neutrophils through the inhibition of STAT3. In contrast, IL-26 may promote meaningful

migration towards gradients of chemokines (IL-8) and compounds from invading bacteria

(fMLP) via a mechanism separate from STAT3, a potentially important area for future

mechanistic research. Fifth, we identified stimulating effects of IL-26 on four archetype

neutrophil-mobilizing cytokines released from immune cells in the unsorted BAL samples

cultured ex vivo, including IL-1β, TNF-α, GM-CSF and IL-8. It seems likely that AM, the most

abundant immune barrier cell in the airways, constitute the main source of these cytokines, given

the published demonstration that IL-26 increases the release of pro-inflammatory cytokines in

blood monocytes (16). Here, in terms of neutrophil mobilization, it is also interesting to note that

IL-8 may not only act as a chemokine, but also as an enhancer of neutrophil activity during

infections or tissue injury (34, 35). We also find the inhibitory effect of IL-26 on the release of

very same neutrophil-mobilizing cytokines in PBEC cultured in vitro intriguing. Given the other

four lines of evidence, this particular finding points out the possibility that IL-26 favors

neutrophil mobilization where bacteria and immune cells are accumulated rather than in the

airway mucosa per se. Future studies on organs other than the lungs may show how generic these

proposed mechanisms are.

Another mechanistic link between IL-26 and neutrophil mobilization addressed in this

study is that IL-26 inhibits the inherent release of MPO, the neutrophil activity marker (28).

Hypothetically, this inhibition by IL-26 may prevent MPO release until a bacterial stimulus is

encountered. Clearly, this type of inhibitory effect by IL-26 bears therapeutic potential for severe



13

complications to infections, including acute lung injury and other chronic inflammatory disorders

characterized by excessive neutrophil activity (36).

We also examined the effect of rhIL-26 on the gene expression of its own receptor sub-

units IL-10R2 and IL-20R1 as well as of its downstream intracellular signaling molecules STAT1

and STAT3, in BAL cells and PBEC. We find it exciting that our results indicate a positive

feedback mechanism by which IL-26 can up-regulate the gene expression of its receptor

complex, as well as its downstream signal molecules, in immune cells and structural cells of the

lungs. Hypothetically, it is possible that, after bacterial exposure in human lungs, IL-26 is

increased and enhances the local responsiveness to re-stimulation by itself.

It is of mechanistic interest that the opposing effects of IL-26 in immune and structural

cells are compatible with IL-26 acting on more than one type of receptor complex, a possibility

deserving further study in its own. Moreover, IL-8, and to some extent GM-CSF, are of

particular importance for the mobilization of neutrophils during bacterial infections but IL-1β and

TNF-α represent more “generic” pro-inflammatory and pyrogenic cytokines (37-42). IL-1β and

TNF-α typically emanate from macrophages and numerous immune and structural cells during

acute injury or chronic inflammatory disorders in the lungs, in addition to infections caused by

extracellular bacteria (37-42). Even the IL-26-induced release of GM-CSF may have bearing for

acute injury or chronic inflammatory disorders, since this growth factor is believed to be an

important survival and immune activation factor in response to tissue injuries in the lungs (43,

44). Moreover, as indicated by publications emerging while the current manuscript was being

written, IL-26 may be involved in additional aspects of host defense, including infections by

intracellular bacteria or viruses (45, 46).



14

In conclusion, this study forwards original evidence that IL-26 is involved and plays a

critical role in antibacterial host defense of human lungs. The study suggests that IL-26 is

abundantly produced and released by AM, possibly by local Th and Tc as well. Our study shows

that neutrophils have functional receptors for IL-26 and indicates that, as a net result of its

immunological effects, IL-26 potentiates neutrophil migration towards the bacterial compound

fMLP and the archetype chemokine IL-8. This implies that, in human lungs, IL-26 focuses

neutrophil mobilization towards sites of bacteria and accumulated immune cells releasing

chemokines. This intriguing involvement of IL-26 in antibacterial host defense deserves to be

further studied as it bears potential for therapy.

Acknowledgements

We thank Pernilla Glader, Ph.D., Marit Hansson, M.D and Louise Bramer, B.Sci. for their

methodological contribution during the preparation for this study. We also thank Professor

Esbjörn Telemo for his expert advice during the preparation of the work with ICC and ICF. We

thank Kristin Blidberg, Ph.D for assisting in setting up the chemotaxis assay. In addition, we

thank Professor Kjell Larsson for his critical comments on the manuscript. Moreover, we

gratefully acknowledge the research nurses Helene Blomqvist, Gunnel de Forest and Margitha

Dahl, at the Lung Allergy Clinic at Karolinska University Hospital Solna, and the research nurse

Barbro Balder, at the Section for Respiratory Medicine, Sahlgrenska University Hospital, for

their important work in recruiting and examining the healthy volunteers included in this study.

Competing interest

The authors have no financial or conflict of interest with the contents of this manuscript



15

References

1. Niederman MS, Mandell LA, Anzueto A, Bass JB, Broughton WA, Campbell GD, Dean N,

File T, Fine MJ, Gross PA, Martinez F, Marrie TJ, Plouffe JF, Ramirez J, Sarosi GA,

Torres A, Wilson R, Yu VL, American Thoracic S. Guidelines for the management of

adults with community-acquired pneumonia. Diagnosis, assessment of severity,

antimicrobial therapy, and prevention. Am J Respir Crit Care Med 2001;163:1730-1754.

2. Glader P, Smith ME, Malmhall C, Balder B, Sjostrand M, Qvarfordt I, Linden A. Interleukin-

17-producing t-helper cells and related cytokines in human airways exposed to endotoxin.

Eur Respir J 2010;36:1155-1164.

3. Hoshino H, Lotvall J, Skoogh BE, Linden A. Neutrophil recruitment by interleukin-17 into rat

airways in vivo. Role of tachykinins. Am J Respir Crit Care Med 1999;159:1423-1428.

4. Kolls JK, Linden A. Interleukin-17 family members and inflammation. Immunity 2004;21:467-

476.

5. Laan M, Cui ZH, Hoshino H, Lotvall J, Sjostrand M, Gruenert DC, Skoogh BE, Linden A.

Neutrophil recruitment by human il-17 via c-x-c chemokine release in the airways. J

Immunol 1999;162:2347-2352.

6. Mukherjee S, Lindell DM, Berlin AA, Morris SB, Shanley TP, Hershenson MB, Lukacs NW.

Il-17-induced pulmonary pathogenesis during respiratory viral infection and exacerbation

of allergic disease. Am J Pathol 2011;179:248-258.

7. Paats MS, Bergen IM, Hanselaar WE, van Zoelen EC, Verbrugh HA, Hoogsteden HC, van den

Blink B, Hendriks RW, van der Eerden MM. T helper 17 cells are involved in the local

and systemic inflammatory response in community-acquired pneumonia. Thorax

2013;68:468-474.



16

8. Ye P, Garvey PB, Zhang P, Nelson S, Bagby G, Summer WR, Schwarzenberger P, Shellito JE,

Kolls JK. Interleukin-17 and lung host defense against klebsiella pneumoniae infection.

Am J Respir Cell Mol Biol 2001;25:335-340.

9. Sergejeva S, Ivanov S, Lotvall J, Linden A. Interleukin-17 as a recruitment and survival factor

for airway macrophages in allergic airway inflammation. Am J Respir Cell Mol Biol

2005;33:248-253.

10. Weaver CT, Elson CO, Fouser LA, Kolls JK. The th17 pathway and inflammatory diseases of

the intestines, lungs, and skin. Annu Rev Pathol 2013;8:477-512.

11. Donnelly RP, Sheikh F, Dickensheets H, Savan R, Young HA, Walter MR. Interleukin-26:

An il-10-related cytokine produced by th17 cells. Cytokine Growth Factor Rev

2010;21:393-401.

12. Knappe A, Hor S, Wittmann S, Fickenscher H. Induction of a novel cellular homolog of

interleukin-10, ak155, by transformation of t lymphocytes with herpesvirus saimiri. J

Virol 2000;74:3881-3887.

13. Wolk K, Kunz S, Asadullah K, Sabat R. Cutting edge: Immune cells as sources and targets of

the il-10 family members? J Immunol 2002;168:5397-5402.

14. Hor S, Pirzer H, Dumoutier L, Bauer F, Wittmann S, Sticht H, Renauld JC, de Waal Malefyt

R, Fickenscher H. The t-cell lymphokine interleukin-26 targets epithelial cells through the

interleukin-20 receptor 1 and interleukin-10 receptor 2 chains. J Biol Chem

2004;279:33343-33351.

15. Fickenscher H, Pirzer H. Interleukin-26. Int Immunopharmacol y 2004;4:609-613.

16. Corvaisier M, Delneste Y, Jeanvoine H, Preisser L, Blanchard S, Garo E, Hoppe E, Barre B,

Audran M, Bouvard B, Saint-Andre JP, Jeannin P. Correction: Il-26 is overexpressed in



17

rheumatoid arthritis and induces proinflammatory cytokine production and th17 cell

generation. PLoS Biol 2012;10.

17. Dambacher J, Beigel F, Zitzmann K, De Toni EN, Goke B, Diepolder HM, Auernhammer CJ,

Brand S. The role of the novel th17 cytokine il-26 in intestinal inflammation. Gut

2009;58:1207-1217.

18. Ouyang W, Rutz S, Crellin NK, Valdez PA, Hymowitz SG. Regulation and functions of the

il-10 family of cytokines in inflammation and disease. Annu Rev Immunol 2011;29:71-

109.

19. Smith ME, Bozinovski S, Malmhall C, Sjostrand M, Glader P, Venge P, Hiemstra PS,

Anderson GP, Linden A, Qvarfordt I. Increase in net activity of serine proteinases but not

gelatinases after local endotoxin exposure in the peripheral airways of healthy subjects.

PLoS One 2013;8:e75032.

20. O'Grady NP, Preas HL, Pugin J, Fiuza C, Tropea M, Reda D, Banks SM, Suffredini AF.

Local inflammatory responses following bronchial endotoxin instillation in humans. Am J

Respir Crit Care Med 2001;163:1591-1598.

21. Karimi R, Tornling G, Grunewald J, Eklund A, Skold CM. Cell recovery in bronchoalveolar

lavage fluid in smokers is dependent on cumulative smoking history. PLoS One

2012;7:e34232.

22. Strandberg K, Palmberg L, Larsson K. Effect of formoterol and salmeterol on il-6 and il-8

release in airway epithelial cells. Respir Med 2007;101:1132-1139.

23. Blidberg K, Palmberg L, Dahlen B, Lantz AS, Larsson K. Increased neutrophil migration in

smokers with or without chronic obstructive pulmonary disease. Respirology

2012;17:854-860.



18

24. Glader P, Eldh B, Bozinovski S, Andelid K, Sjostrand M, Malmhall C, Anderson GP, Riise

GC, Qvarfordt I, Linden A. Impact of acute exposure to tobacco smoke on gelatinases in

the bronchoalveolar space. Eur Respir J 2008;32:644-650.

25. Zhuang Y, Peng LS, Zhao YL, Shi Y, Mao XH, Chen W, Pang KC, Liu XF, Liu T, Zhang JY,

Zeng H, Liu KY, Guo G, Tong WD, Shi Y, Tang B, Li N, Yu S, Luo P, Zhang WJ, Lu

DS, Yu PW, Zou QM. Cd8(+) t cells that produce interleukin-17 regulate myeloid-

derived suppressor cells and are associated with survival time of patients with gastric

cancer. Gastroenterology 2012;143:951-962 e958.

26. Song C, Luo L, Lei Z, Li B, Liang Z, Liu G, Li D, Zhang G, Huang B, Feng ZH. Il-17-

producing alveolar macrophages mediate allergic lung inflammation related to asthma. J

Immunol 2008;181:6117-6124.

27. Stevenson NJ, Haan S, McClurg AE, McGrattan MJ, Armstrong MA, Heinrich PC, Johnston

JA. The chemoattractants, il-8 and formyl-methionyl-leucyl-phenylalanine, regulate

granulocyte colony-stimulating factor signaling by inducing suppressor of cytokine

signaling-1 expression. J Immunol 2004;173:3243-3249.

28. Prokopowicz Z, Marcinkiewicz J, Katz DR, Chain BM. Neutrophil myeloperoxidase: Soldier

and statesman. Arch Immunol Ther Exp (Warsz) 2012;60:43-54.

29. Herr C, Beisswenger C, Hess C, Kandler K, Suttorp N, Welte T, Schroeder JM, Vogelmeier

C, Group RBftCS. Suppression of pulmonary innate host defence in smokers. Thorax

2009;64:144-149.

30. Diamond G, Legarda D, Ryan LK. The innate immune response of the respiratory epithelium.

Immunol Rev 2000;173:27-38.

31. Wolk K, Witte K, Witte E, Proesch S, Schulze-Tanzil G, Nasilowska K, Thilo J, Asadullah K,

Sterry W, Volk HD, Sabat R. Maturing dendritic cells are an important source of il-29 and



19

il-20 that may cooperatively increase the innate immunity of keratinocytes. J Leukoc Biol

2008;83:1181-1193.

32. Caron G, Duluc D, Fremaux I, Jeannin P, David C, Gascan H, Delneste Y. Direct stimulation

of human t cells via tlr5 and tlr7/8: Flagellin and r-848 up-regulate proliferation and ifn-

gamma production by memory cd4+ t cells. J Immunol 2005;175:1551-1557.

33. Komai-Koma M, Jones L, Ogg GS, Xu D, Liew FY. Tlr2 is expressed on activated t cells as a

costimulatory receptor. Proc Natl Acad Sci U S A 2004;101:3029-3034.

34. Beeh KM, Kornmann O, Buhl R, Culpitt SV, Giembycz MA, Barnes PJ. Neutrophil

chemotactic activity of sputum from patients with copd: Role of interleukin 8 and

leukotriene b4. Chest 2003;123:1240-1247.

35. Yamamoto C, Yoneda T, Yoshikawa M, Fu A, Tokuyama T, Tsukaguchi K, Narita N.

Airway inflammation in copd assessed by sputum levels of interleukin-8. Chest

1997;112:505-510.

36. Craig A, Mai J, Cai S, Jeyaseelan S. Neutrophil recruitment to the lungs during bacterial

pneumonia. Infect Immun 2009;77:568-575.

37. Church LD, Cook GP, McDermott MF. Primer: Inflammasomes and interleukin 1beta in

inflammatory disorders. Nat Clin Pract Rheumatol 2008;4:34-42.

38. Dinarello CA. Interleukin-1 beta, interleukin-18, and the interleukin-1 beta converting

enzyme. Ann N Y Acad Sci 1998;856:1-11.

39. Palladino MA, Bahjat FR, Theodorakis EA, Moldawer LL. Anti-tnf-alpha therapies: The next

generation. Nat Rev Drug Discov 2003;2:736-746.

40. Antunes G, Evans SA, Lordan JL, Frew AJ. Systemic cytokine levels in community-acquired

pneumonia and their association with disease severity. Eur Respir J 2002;20:990-995.



20

41. Greene C, Lowe G, Taggart C, Gallagher P, McElvaney N, O'Neill S. Tumor necrosis factor-

alpha-converting enzyme: Its role in community-acquired pneumonia. J Infect Dis

2002;186:1790-1796.

42. Wu CL, Lee YL, Chang KM, Chang GC, King SL, Chiang CD, Niederman MS.

Bronchoalveolar interleukin-1 beta: A marker of bacterial burden in mechanically

ventilated patients with community-acquired pneumonia. Crit Care Med 2003;31:812-

817.

43. Huang FF, Barnes PF, Feng Y, Donis R, Chroneos ZC, Idell S, Allen T, Perez DR, Whitsett

JA, Dunussi-Joannopoulos K, Shams H. Gm-csf in the lung protects against lethal

influenza infection. Am J Respir Crit Care Med 2011;184:259-268.

44. Laan M, Prause O, Miyamoto M, Sjostrand M, Hytonen AM, Kaneko T, Lotvall J, Linden A.

A role of gm-csf in the accumulation of neutrophils in the airways caused by il-17 and

tnf-alpha. Eur Respir J 2003;21:387-393.

45. Guerra-Laso JM, Raposo-Garcia S, Garcia-Garcia S, Diez-Tascon C, Rivero-Lezcano OM.

Microarray analysis of mycobacterium tuberculosis-infected monocytes reveals il-26 as a

new candidate gene for tuberculosis susceptibility. Immunology 2014.

46. Miot C, Beaumont E, Duluc D, Le Guillou-Guillemette H, Preisser L, Garo E, Blanchard S,

Hubert Fouchard I, Creminon C, Lamourette P, Fremaux I, Cales P, Lunel-Fabiani F,

Boursier J, Braum O, Fickenscher H, Roingeard P, Delneste Y, Jeannin P. Il-26 is

overexpressed in chronically hcv-infected patients and enhances trail-mediated

cytotoxicity and interferon production by human nk cells. Gut 2014.



21

Figure Legends

Figure 1. Effects of the TLR-4 receptor agonist endotoxin on the release of IL-26 in the

airways. (A) Concentrations of IL-26 protein in cell-free bronchoalveolar (BAL) fluid from

healthy volunteers measured using ELISA. The BAL samples were harvested during

bronchoscopy either at 12 hours (h) (n=6), 24 h (n=17) or 48 h (n=8) after intra-bronchial

exposure in vivo to endotoxin (squares, see Materials and Methods) and vehicle (circles) in each

subject. (B and C) Unsorted BAL cells from healthy volunteers without prior exposure to

endotoxin or vehicle in vivo were stimulated with endotoxin (squares, 1 ug/ml) or vehicle

(circles) ex vivo (24 h) and IL-26 protein quantified by ELISA in cell-free conditioned media (B)

and mRNA of IL-26 measured using RT-PCR (C). Data sets on mRNA (C) are presented as fold

differences of the mRNA from the vehicle (n=8). Some figure panels (A and B) show matched

data (connected with solid black lines) for stimulation with endotoxin and vehicle in each donor.

The bold black lines indicate the mean values, and the p-values according to Students paired t-

test are presented (A-C). (D-F) Correlation of neutrophil (D), macrophage (E) and lymphocyte

(F) concentrations (x 106 cells/ml) and IL-26 in BAL samples from subject without prior

exposure to endotoxin or vehicle (n=18). In (D, E and F), the p-values according to the Pearson

correlation test are presented.

Figure 2. Detection of IL-26 ex vivo in airway immune cells after intra-bronchial endotoxin

exposure in vivo. Cytospin preparations of unsorted bronchoalveoloar lavage (BAL) cells were

prepared for immunocytochemistry (ICC: panel A-D) or immunocytofluorescence (ICF: panel E-

G). Specifically, ICC panels show immunoreactivity for (A) monoclonal IgG2b isotype control

antibody, (B) monoclonal specific IL-26 antibody (red-brown), "+" indicates positively stained

and "arrow" indicates negatively stained cells), (C) a monoclonal IgG2b isotype control antibody



22

plus a monoclonal antibody against the macrophage marker CD68 (brown) and (D) monoclonal

antibody against the macrophage marker CD68 (brown) plus a monoclonal IL-26 antibody

(purple). Panels A and B represents magnification of X 40 while C and D represents X 25

magnification. The ICF panels show immunoreactivity for (E) the monoclonal IgG2b isotype

control antibody plus a monoclonal antibody against the macrophage marker CD68 (red), (F and

G) a monoclonal antibody against the macrophage marker CD68 (red) plus a monoclonal IL-26

antibody (green). Panels E and F represents X 25 and X 63 magnifications, respectively. Each

panel represents a typical result from 1 out of 4 subjects analyzed with each respective method.

Figure 3. Detection of IL-26 in airway immune cells stimulated with endotoxin or vehicle ex

vivo. (A) Individual percentage immunoreactivity for the colocalization of IL-26 with cell

markers CD8, RORCvar2, CD4 and CD3 in unsorted bronchoalveoloar lavage (BAL) cells gated

from small mononuclear cells during FACS analysis. The unsorted BAL cells were stimulated

(24 h) by endotoxin (squares, 100 ng/mL) or vehicle (circles) ex vivo, without monensin (n=6).

(B) Representative plots out of 3 experiments for the colocalization of intracellular IL-26 and the

cell markers CD3, CD4, CD8 and CD68 in unsorted BAL cells gated from mononuclear cells.

The unsorted BAL cells were stimulated with endotoxin (1 ug/ml) or vehicle ex vivo (4 h), in the

presence of monensin. (C) Individual percentage immunoreactivity for the colocalization of IL-

26 and CD68 in adherent BAL cells. The adherent BAL cells were stimulated with endotoxin (1

ug/ml) or vehicle ex vivo (20 h), without monensin and analyzed using FACS (n=4). (D)

Concentrations of IL-26 protein in cell-free conditioned media from cultures of adherent BAL

cells. The adherent BAL cells were stimulated with endotoxin (1 ug/ml) or vehicle ex vivo (20 h)

and IL-26 protein measured using ELISA (n=5). Thin lines for graphs indicate matched samples



23

from each subject and bold lines indicate mean values. The p-values indicated (A, C and D) are

according to Students paired t-test.

Figure 4. Effects of IL-26 on neutrophil migration, phosphorylated STAT3 and IL-26

surface receptor protein complex. Fluorescent labeled neutrophils were added on the upper

surface of a polycarbonate filter in a chemotaxis plate and the chemoattractants were added in the

bottom wells as specified in the figure panels. Plates were incubated (1 h) and the fluorescence of

emigrated cells measured using a fluorescent plate reader. (A) Effects of recombinant human (rh)

IL-26 on neutrophil migration towards IL-8 (n=8), (B) effects of rhIL-26 on neutrophil migration

towards fMLP (n=5) and (C) effects of IL-26 alone on spontaneous neutrophil migration (n=8).

(D) Dose-dependent effects of rhIL-26 on concentrations of phosphorylated STAT3 (n=11).

Three hundred thousand blood neutrophils were stimulated (20 minutes) with different

concentrations of IL-26. Cells were lysed and phosphorylated STAT3 measured in the cell lysates

using Phosphor Tracer ELISA. (E-H) The expression of IL-26 membrane receptor complex

proteins on neutrophils after culture (2 h) ex vivo (n=6). Data shows mean with SEM. The p-

values indicated are according to Students paired t-test (on logarithmically transformed data for

panel A-C).

Figure 5. Effects of rhIL-26 on cytokine release, IL-26-receptor gene expression in BAL

cells and MPO release in BAL cells and blood neutrophils. Unsorted bronchoalveoloar lavage

(BAL) cells from unexposed healthy volunteers were cultured and stimulated with rhIL-26 (100

ng/ml) or vehicle ex vivo (24 h). Protein concentrations of (A) IL-1β, (B) TNF-α, (C) IL-8 and

(D) GM-CSF measured in cell-free conditioned medium are shown (n=9 for all). (E) The fold

gene expression measured in BAL cells for IL-10R2, IL-20R1, STAT1 and STAT3 is presented

(n=8). (F) The protein concentration of MPO in BAL cell-free conditioned medium (n=6) is



24

shown. (G) Protein concentrations of MPO in cell-free conditioned medium of blood neutrophils

stimulated with rhIL-26 (100 ng/ml) or vehicle (18 h) ex vivo (n=9). Data shows mean with SEM.

The p-values for all panels indicated are according to Students paired t-test. For panel (F) alone, a

one tailed paired t-test was performed given the one-way hypothesis.

Figure 6. Effects of rhIL-26 on cytokine release, and IL-26-receptor gene expression in

structural airway cells. Primary bronchial epithelial cells (PBEC) from unexposed human

volunteers were stimulated with rhIL-26 (100 ng/ml) or vehicle in culture (24 h) ex vivo.

Concentrations of (A) IL-1β, (B) TNF-α, (C) IL-8 and (D) GM-CSF in cell-free conditioned

medium (n=9 for all groups). (E) Fold gene expression measured in PBEC for IL-10R2, IL-20R1,

STAT1 and STAT3 (n=6). Data shows mean with SEM. The p-values for all panels indicated are

according to Students paired t-test.



IL-2

6(n

g/m

l)

12 h 24 h 48 h0

1

2

3p<0.001 p<0.001 p=0.004

Macrophages x106/L

IL-2

6(p

g/m

l)

0 50 100 150 200 2500

200

400

600

800r=0.6p=0.009

Neutrophils x106/L

IL-2

6(p

g/m

l)

0 5 10 150

200

400

600

800r=0.7p=0.001

Lymphocytes x106/L

IL-2

6(p

g/m

l)

0 10 20 30 40 500

200

400

600

800r=0.1p=0.6

IL-2

6g

en

efo

ldd

iffe

ren

ce

Vehicle Endotoxin0

1

2

3

4

5

A B

C D

E F

IL-2

6(m

g/m

l)

Vehicle Endotoxin 0.0

0.5

1.0

1.5

2.0

2.5 p=0.002



292x286mm (300 x 300 DPI)



-

%IL

-26

co

ex

pre

ss

ion

Vehicle Endotoxin0

20

40

60

80

100 p=0.028

CD68

IL-2

6(u

g/m

l)

Vehicle Endotoxin0.0

0.5

1.0

1.5

2.0 p=0.033

C D

isotype Vehicle Endotoxin

CD

3C

D4

CD

8C

D6

8

%IL

-26

co

ex

pre

ss

ion

CD8 RORc2 CD4 CD30

20

40

60

80 VehicleEndotoxin

A

B

IL-26



Flu

ore

sc

en

ce

of

mig

rate

dc

ells

(x1

04)

Vehic

le

1000

ng/ml

333n

g/ml

111n

g/ml

37ng/m

l0

5

10

15

20

p=0.03 p=0.08 p=0.015 p=0.002

Flu

ore

sc

en

ce

of

mig

rate

dc

ells

(x1

04)

7.4 7.4 7.4 7.4 7.40

20

40

60

IL-8(ng/ml) :IL-26(ng/ml): Veh 1000 333 111 37

p=0.03 p=0.014 p=0.012 p=0.004

Flu

ore

sc

en

ce

of

mig

rate

dc

ells

(x1

04)

2.2 2.2 2.2 2.2 2.20

20

40

60

80

100

fMLP(uM)IL-26(ng/ml) Veh 1000 333 111 37

p=0.03 p=0.03 p=0.02 p=0.1

A B

C D

IL-1

0R2

MF

I(x

102

)

Isotype IL-10R20246

7

8

9

10P=0.001

ReceptorIsotype

IL-10R2

IL-20R1

IL-2

0R1

MF

I(x

102

)

Isotype IL-20R10246

8

10

12 P=0.03

Flo

ure

scen

ceo

f

Ph

osp

ho

ryla

ted

ST

AT

3(10

3)

Vehic

le

1ng/m

l

10ng/m

l

100n

g/ml

1000

ng/ml

G-CSF

G-CSF/IL

2601

12

14

16

405060

p=0.01 p=0.01 p=0.052 p=0.03

p=0.04

E F

G H



IL-1

b(p

g/m

l)

Vehicle IL-260

100

200

300

400p=0.03

IL-8

(ng

/ml)

Vehicle IL-260

50

100

150

200

250

p=0.016

GM

-CS

F(p

g/m

l)

Vehicle IL-260

50

100

150

200

250

p=0.013

Gen

efo

ldd

iffe

ren

ce

s

IL-10R2 IL-20R1 STAT1 STAT30

1

2

3VehicleIL-26

MP

O(n

g/m

l)

Vehicle IL-260

5

10

15

20

p=0.03

MP

O(n

g/m

l)

Vehicle IL-260

100

200

300

400

p=0.015

TN

F-a

(ng

/ml)

Vehicle IL-260.0

0.5

1.0

1.5

2.0

2.5

p=0.04

A B

C D

F G

E



IL-1

b(p

g/m

l)

Vehicle IL-260

20

40

60

p=0.003

TN

F-a

(pg

/ml)

Vehicle IL260

2

4

6

8

10

p<0.001

IL-8

(ng

/ml)

Vehicle IL-260.6

0.8

1.0

1.2

1.4 p<0.001

GM

-CS

F(p

g/m

l)

Vehicle IL-260

100

200

300

p=0.009

Gen

efo

ldd

iffe

ren

ce

s

IL-10R2 IL-20R1 STAT1 STAT30.0

0.5

1.0

1.5

2.0 VehicleIL-26

A B

C D

E



1


Effects on Neutrophil Mobilization

Karlhans F. Che; Sara Tengvall; Bettina Levänen; Elin Silverpil; Margaretha E. Smith;

Muhammed Awad; Max Vikström; Lena Palmberg; Ingemar Qvarfordt; Magnus Sköld & Anders

Lindén.

Online Data Supplement



2

Material and Methods

BAL Samples from Healthy Volunteers Exposed to Endotoxin and Vehicle in vivo

All experiments on exposed healthy volunteers were conducted according to the declaration of

Helsinki. The endotoxin exposure experiments on healthy volunteers in vivo were approved by

the Regional Ethical Review Board in Gothenburg, Sweden and a more detailed description of

these experiments has been published previously (E1, 2). Briefly, healthy volunteers were

recruited after informed consent. The inclusion criteria required that all volunteers were non-

atopic, non-smoking, without any regular medication and concurrent disease. Female volunteers

were requested to display a negative pregnancy test. All volunteers with an infection within 4

weeks prior to bronchoscopy were re-scheduled. After a first visit for medical examination

conducted by a physician (blood test, dynamic spirometry, electrocardiogram and a negative skin

prick test), a second visit was set for endotoxin exposure. The endotoxin solution was then

instilled unilaterally in a segmental bronchus and the vehicle solution was instilled in a

contralateral segmental bronchus of the same subject, thus allowing for matched intervention and

control samples within each subject. The harvest of BAL samples took place during the

bronchoscopy at the third visit, 12, 24 or 48 h after the initial bronchoscopy. For the volunteers

who were included in the endotoxin exposure in vivo, certain data (on BAL cell counts only)

were part of data sets included in two previous publications (E1, 2).

BAL Samples from Healthy Volunteers Not Exposed to Endotoxin or Vehicle in vivo

The harvest of BAL samples from unexposed healthy volunteers in vivo was approved by the

Regional Ethical Review Board in Stockholm, Sweden (#2012/1571-3). Briefly, healthy

volunteers were recruited after informed consent and they were 25 (19-51) years of age. Eleven

female and 8 male volunteers were investigated (n=19 in total). These subjects were all non-



3

smokers without any regular medication and/or concurrent disease. All volunteers with an

infection within 4 weeks prior to bronchoscopy were re-scheduled. A medical examination was

always conducted by a physician prior to inclusion (see above). Negative in vitro screening for

the presence of specific IgE antibodies (Phadiatop, Pharmacia®

) was also required. The subjects

were investigated during the period from November 2012 to November 2013.

Bronchoscopy and BAL sample collection was conducted under anesthesia at the Lung Allergy

Clinic, Karolinska University Hospital Solna, Stockholm as previously described (E3). In

summary, a flexible fibreoptic bronchoscope (Olympus Optical Co Ltd,) was passed nasally and

wedged into a middle lobe bronchus where sterile phosphate buffered saline (PBS) solution at

37ºC was instilled (3). Immediately after each instillation, the fluid was re-aspirated and collected

in a siliconized plastic bottle kept on ice. The recovery volume (percentage of instilled volume)

was 70 (36-82) %.

Handling of BAL Samples

The BAL samples from endotoxin-exposed subjects were prepared as previously described (E1-

3) and analyzed using immunocytochemistry and immunofluorescence. The BAL samples from

unexposed healthy volunteers were filtered through a Dacron net (Millipore®), centrifuged (400

x G during 10 min) at 4ºC. The pellet was then re-suspended in PBS and counted in a Bürker

chamber. Cell viability was determined by trypan blue exclusion. Cytospin slides were prepared

from the native cell pellet and stained with May-Grünwald and Giemsa to determine the

leukocyte differential cell count. At least 500 cells (excluding epithelial and red blood cells) per

slide were examined at ×100 magnification using light microscopy. The BAL cells were analyzed

by flow cytometry and/or cultured ex vivo for the measurement of the various immunological

parameters (see below). The cell-free BAL fluid samples were immediately frozen (-80°C) for



4

subsequent analysis with ELISA. For cytokine measurements in conditioned media, one million

BAL cells were cultured in 24-well plates exposed to endotoxin (1 ug/ml; E coli serotype 026:B6

source strain ATCC 12795) or vehicle during 24 h. After this, the cell-free conditioned media

were harvested and frozen (-80°C) for subsequent analysis with ELISA and the cell pellets were

collected for quantification of mRNA using real time (RT)-PCR.

Immunostaining

Immunocytochemistry (ICC) and immunocytofluorescence (ICF) staining, was performed using

cytospin slides prepared using freshly isolated BAL cells harvested immediately after intra-

bronchial exposure to endotoxin and vehicle in vivo. These cytospin samples were air-dried and

stored frozen (-80°C) until further process.

Immunocytochemistry: Before use, cytospin slides were thawed and fixed in formaldehyde (4%)

and subsequently blocked with Protein serum free block (Dako® A/S, Glostrup) to neutralize the

reactive aldehyde groups, blocked with horse serum (5%) and in addition blocked with

BLOXALL (Vector Laboratories®). Subsequently, slides were incubated with primary

monoclonal mouse anti-human IL-26 antibody (Clone 197505, R&D) or mouse IgG2b isotype

control (Clone 20116, R&D). After washing, slides were incubated with a secondary antibody

from anti-mouse immPRESS kit (Vector Laboratories®). Bound antibodies were then visualized

by ImmPACT VIP-substrate chromogen system (Vector Laboratories®). The procedure was then

repeated with in-between washes, but with a primary rabbit anti-human CD68 antibody

(Abbiotech®) followed by a secondary antibody from the anti-rabbit immPRESS kit (Vector

Laboratories®). Bound antibodies were now visualized by ImmPACT DAB-substrate chromogen

system (Vector Laboratories®) and slides finally counterstained with Methyl Green (Vector

Laboratories®).



5

Immunocytofluorescence: Before use, slides were thawed and fixed in 4% formaldehyde, blocked

with Protein serum free block® to neutralize the reactive aldehyde groups. Non-specific staining

was blocked with horse and goat serum (5% for both; Dako A/S®), followed by incubation with

a primary monoclonal mouse anti-human IL-26 antibody or mouse IgG2b isotype control

antibody. After washing, slides were incubated with a Dylight 488 horse anti-mouse antibody

(Vector Laboratories®) secondary antibody. This procedure was then repeated with in-between

washes, but with a primary rabbit anti-human CD68 antibody (Abbiotech®) followed by a

Dylight 594 goat anti rabbit antibody (Vector Laboratories®). Slides were mounted in Vectastain

with DAPI (Vector Laboratories®) and imaged with a confocal light microscope (LSM 700

microscope, Carl Zeiss®). Upon request, the manufacturer of IL-26 detection antibody has

claimed high sensitivity and specificity without any cross-reactivity or interference with other

molecules of the IL-10 cytokine family. It has been also demonstrated and confirmed that this

antibody indeed does not cross react with other members of the IL-10 family (4).

Flow Cytometry

The origins and clone numbers of the antibodies used in this study are specified in a

supplementary table (Table E1). The non-labeled IL-26 polyclonal antibody and the

corresponding isotype control (R&D Systems®) was conjugated with APC using the LL-APC-

XL conjugation kit (AH Diagnostics®).

Unsorted BAL cells: Three million unsorted BAL cells were cultured and stimulated (24 h) ex

vivo in a 6-well plate with vehicle or Endotoxin (100 ng/ml; E coli 0113:H10 10,000 endotoxin

units, 1235503 U.S. Pharmacopeial Convention) in RPMI-1640 medium with L-glutamine

(Fisher ScientificTM

), supplemented with penicillin/streptomycin (20 U/ml) and FCS (10%;

Sigma-AldrichTM

). The non-adhered cells were harvested after individual cultures and stained



6

with fluorochrome-conjugated antibodies; CD3-APC-H7, CD4-FITC or CD8-FITC, and matched

isotype controls while the cell free conditioned media was used for ELISA. Unsorted BAL cells

were also stimulated in cultures (5 h) in the presence of golgi stop. Cells were subsequently

washed, fixed and permeabilized using a Fixation and Permeabilization Solution Kit (Becton-

Dickinson®

, (BD) Biosciences®) according to manufacturer’s instructions. The intracellular

molecules of interest where stained with fluorochrome conjugated antibodies namely RORCvar2-

PE, IL-17A-PerCP-Cy5.5 (BD Biosciences®), and IL-26-APC (R&D Systems®), and their

matched isotype control antibodies.

Enriched BAL macrophages: One million unsorted BAL cells/ml were plated and cultured (2 h)

ex vivo in a 24-well plate, in RPMI-1640 medium supplemented with penicillin/streptomycin (20

U/ml). The non-adherent cells were washed off (X 3) in ice cold RPMI-1640 medium and the

adherent cells stimulated with vehicle or endotoxin (100 ng/mL) in RPMI-1640 medium with L-

glutamine (Fisher Scientific®

), supplemented with penicillin/streptomycin (20 U/ml) and FCS

(10%) (Sigma-AldrichTM

) during 20 h. Cell-free conditioned medium was harvested for the

assessment of extracellular release of IL-26 protein. A fraction of the attached cells were lysed

directly on the plates for mRNA analysis whereas the other fraction was detached for analysis

using flow cytometry. The cells were detached using ice cold PBS containing EDTA (0.02%) and

lidocaine (4 mg/ml) on a rocking platform shaker (15 minutes (min) at 4oC) and harvested. The

cell-suspension was further diluted with an equal volume of RPMI-1640 medium containing FCS

(20 %) and centrifuged to collect cell pellet. Cells were permeabilized and underwent

intracellular staining for the macrophage marker CD68 (CD68-PE-C7) and IL-26 (IL-26-APC)

for co-expression analysis. Stained samples were acquired by flow cytometry (BD flow

cytometry LSR Fortessa, BD Biosciences®) and analyzed by Flowjo (Tree Star, IncTM

).



7

Neutrophils: Isolated neutrophils were stained directly or cultured (20 h) in the presence of IL-26

(100 ng/ml), endotoxin (100 ng/ml), IL-8 (7.4 ng/ml) and fMLP (2.4 uM) or vehicle in culture

media (5% FCS in HBSS) before staining. Cells were washed and stained for the IL-26 receptors,

IL-10R2-APC and IL-20R1 as well as their respective isotype control antibodies IgG1-PE and

IgG1 APC.

Isolation, Culture and Stimulation of Primary Bronchial Epithelial Cells in vitro

Primary bronchial epithelial cells (PBEC) were established as previously described (5). Briefly, a

piece of bronchus was excised from the healthy part of bronchial tissue of lung cancer patients

after surgery. The tissue piece was trimmed in pieces, washed in cold PBS without Ca2+

/Mg2+

(Gibco®

) and incubated (2 h at 37oC) in protease (0.02%; protease XIV, Sigma-Aldrich

®) with

humidified air with CO2 (5%). The PBEC were then gently dislodged from the luminal surface

and washed once in PBS and seeded into plates that had been pre-coated (2 h) with coating buffer

i.e Vitrogen (30µg/ml; Cohesion Technologies®

), fibronectin 10µg/ml (Gibco®

) bovine serum

albumin (BSA, 10µg/ml; Boehringer-Ingelheim®

) and penicillin/streptomycin (20 U/ml;

BioWhittaker®

,) in PBS. Cells were cultured in keratinocyte serum-free medium (KSFM)

(Gibco®) supplemented with epidermal growth factor (EGF; 5 ng/ml), bovine pituitary extract

(BPE; 50 µg/ml) (all from Gibco®), penicillin/streptomycin (20 U/ml) and ciprofloxacin (10

µg/ml; gift from Bayer®

). The PBEC were cultured (37°C) in humidified air with CO2 (5%) and

culture medium changed every second day until the cells were confluent. The cell culture tests for

Mycoplasma contamination (the Swedish Institute for Veterinary Medicine, Uppsala, Sweden)

were always negative.

We utilized PBEC from passage 5 to 8 for stimulation experiments ex vivo. For these

experiments, 100,000 cells were seeded in Falcon pre-coated 24-well plates (BD) and cultured



8

until cells were semi-confluent. Prior to the experiments, the PBEC were starved (8 h) in KSFM

only (without growth factors). Growth factor-supplemented KSFM was subsequently replaced

and PBEC were stimulated (24 h at 37oC) by rhIL-26 (100 ng/ml) or its vehicle in humidified air

with CO2 (5%). Cell-free conditioned media were collected for cytokine analysis with ELISA and

lysed cells were collected for quantification of mRNA using RT-PCR.

Isolation, Culture and Stimulation of Blood Neutrophils ex vivo

Ten milliliters of fresh venous blood was collected in EDTA tubes from healthy volunteers after

informed consent. The blood was thoroughly mixed with Dextran (2%; Sigma-Aldrich®

) at a

ratio of 1:1 and left standing (RT during 25 min). The yellowish upper fraction was collected and

layered on an equal volume of LymphoprepTM

(Fresenius Kabi®

Norge As). The Cell-lymphoprep

preparation was centrifuged (600 X G) without brakes during 25 min at 4oC to minimize

neutrophil activation. The bottom pellet containing the neutrophils and red blood cells (RBC) was

collected and the RBC lysed by hypotonic lysis using cold sterile distilled water (6 ml during 30

seconds) followed by NaCl (3.4%; 2 ml) to reestablish balance). Cells were then spun down,

counted and the neutrophil viability was determined by trypan blue exclusion or assessed for

apoptosis (Apoptosis kit, BD®

) using flow cytometry. One million neutrophils/ml were then

seeded in culture media (1 ml), i.e. RPMI 1640 with L-glutamine supplemented with FCS (10 %),

penicillin/streptomycin (20 U/ml), and Hepes (2 mM) in a Falcon 24-well plate. The neutrophils

were stimulated with IL-26 (100 ng/ml) or exposed to vehicle (6 and 18 h). Cell-free conditioned

media and cells were collected separately for the analysis of MPO by ELISA and

apoptosis/necrosis by flow cytometry. Studies on cell migration were performed as described

below. For the quantification of phosphorylated STAT3 and -1 concentrations, using 300,000

cells in medium (100 ul, 5 % FCS in HBSS), cells were allowed to rest (2 h at 37oC) in the



9

incubator. Cells were then stimulated with rhIL-26 (1000, 100, 10 and 1 ng/ml during 20 min)

and vehicle, adding G-CSF (30 ng/ml, R&D Systems) as a positive control. Cells were lysed (25

ul Lysis Concentrate) according to manufacturer’s instruction (Abcam®) and lysates stored

frozen (-80 o

C) for subsequent ELISA work.

Migration Assay

The assay was performed as previously shown (6). Initially, a concentration response assay was

set up to assess the degree of migration at different concentrations of IL-8 (R&D Systems®),

fMLP (Sigma Aldrich®) and IL-26. A sub-optimal concentration of IL-8 (7.4 ng/ml) and fMLP

(2.2 uM) was selected as the concentration where cell migration was not too high or too low and

on which an inhibitory or potentiating effect of IL-26 could be tested. A range of decreasing

concentrations of IL-26 (1,000, 333, 111 and 37 ng/ml) were used alone or in combination with

IL-8 and fMLP. The bottom wells of the assay system (ChemoTx Neuro Probe Incorporated®)

were then filled with the prepared chemoattractants (29 ul). The neutrophils (5x106

cells/mL)

were labeled (30 min at RT) with a fluorescent dye Calcein AM (Life technologies®) and were

subsequently washed once in cold PBS. The labeled cells were again re-suspended (5x106

cells/mL) and loaded (25 ul) directly on the upper surface of the polycarbonate filter (5 µm poor

size). Plates were incubated (37oC during 1 h) after which the non-migrated cells were carefully

removed. Migrated cells trapped in the filter were forced out by centrifuging the plate (1500

RPM, 2 min). The filter was then removed and the fluorescence of the migrated cells was

measured using a fluorescent plate reader.

STAT3 and STAT1 Phosphorylation by Phospho Tracer ELISA

Concentrations of intracellular, phosphorylated STAT3 and -1 were measured using the Phospho

Tracer ELISA kit, in accordance with the manufacturer’s instructions (Abcam®). Briefly, the cell



10

lysate was added in wells (50 µl) followed by the antibody mix (equal fractions of the capture

and detection antibodies). Plates were incubated at RT (1 h) on a shaker after which plates were

washed (3x 200 µl) with wash buffer. The substrate mix (10-Acetyl-3,7-dihydroxyphenoxazine

(ADHP) and ADHP diluent) was added (100 µl) and incubated (10 min at RT) in the dark on a

shaker. The reaction was inhibited with stop solution (10 µl) and plates read using a florescent

reader (530 nm).

Quantification of Cytokines by ELISA

The quantification of IL-26 protein concentrations in cell-free BAL fluid harvested in vivo or

conditioned medium harvested from ex vivo cultures was performed in accordance with the

manufacturer’s instructions (Cusabio Biotech®). Briefly, diluted samples and standards were

immediately added to the wells and incubated (2 h at 37oC). Samples were removed and the

biotin-conjugated detection antibody was immediately added and incubated (1 h) without

washing. The plates were then washed (3 times) and avidin-conjugated Horseradish-Peroxidase

(HRP) added during 1 h. Plates were developed with tetramethylbenzidine (TMB) substrate (30

min) and the reaction stopped with stop solution. All the incubations were done at 37oC. The

optical density was read (λ 450 nm, with 570 nm correction) using a microplate reader (Model

Spectra Max 250, Molecular Devices®

). The concentrations of IL-1β, TNF-α, IL-8, GM-CSF and

MPO were measured using the R&D Systems® duo ELISA kit according to the manufacturer’s

instructions. Here, the plates were pre-coated overnight with capture antibody at room

temperature (RT), washed (3 times) with wash buffer and blocked (1 h) in block solution. After

washing off unbound blocking solution, the diluted samples and standards were incubated (2 h at

RT), washed and incubated (2 h) again with biotin conjugated detection antibody. Streptavidin

conjugated HRP was added after washing (20 min at RT). The bound antibody was revealed by



11

adding the TMB substrate (Sigma-AldrichTM

) and the reaction stopped with 2N sulphuric acid

after 20 min of incubation. The optical density was read (λ 450 nm, with 540 nm correction)

using a microplate reader (Model Spectra Max 250, Molecular DevicesTM

).

Isolation of RNA, Reverse Transcription and Quantitative RT-PCR Analysis

The mRNA was prepared using a commercial Spin technology (Qiagen® AB) according to the

manufacturer’s protocol. First-strand cDNA was made from mRNA (1 µg) in a controlled

reaction volume (20 µl) using the high capacity RNA-cDNA kit (Life technologies) in

accordance with the manufacturer’s instructions. The primers were designed using the NCBI

Primer-BLAST (Basic Local Alignment Search Tool) online software

(http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC= BlastHome). The

cDNA was quantified for IL-10R2 (Forward primer: ACAACCCATGACGAAACGGT, Reverse

primer: GTCTTGGCCCTTGTTTGCTG), IL-20R1 (Forward primer:

AATGGACTCCACCAGAGGGT, Reverse primer: TGGTGGGCCAATTTGTGTTTC), STAT1

(Forward primer: TAATCAGGCTCAGTCGGGGA, Reverse primer:

ATCACTTTTGTGTGCGTGCC), STAT3 (Forward primer: TCTGCCGGAGAAACAGTTGG;

Reverse primer: AGGTACCGTGTGTCAAGCTG) and β-actin as an endogenous control

(Forward primer: CTGGGACGACATGCAGAAAA, Reverse primer:

AAGGAAGGCTGGAAGAGTGC) using qRT-PCRs (Prism 7500HT instrument, Applied

BiosystemsTM

). Samples were manually loaded in 96-well MicroAmp®

optical fast-plates

(Applied BiosystemsTM

). Each sample was run in duplicates in a reaction mixture (10 µL) that

contained forward and reverse primers (5 pmol/L, 1 µL each) (Cybergene®

), Fast SYBR Green®

Master Mix (5 µL; Applied BiosystemsTM

), templates cDNA (4 ng in 2µL) and water (1 µL).



12

Results were expressed as ∆∆Ct (relative values) and presented as fold differences where vehicle

exposed cells are set to 1.

Statistical Analysis

Parametric descriptive and analytical statistics were applied unless otherwise stated. Students

two-tailed and paired t-test was utilized to compute comparisons between paired data sets and

ANOVA for multiple data sets except otherwise stated. In one case, a one-tailed t-test was

performed due to a one-sided hypothesis based upon preceding experimental results (MPO

experiments in vitro). The Person correlation test was applied for the analysis of correlations. All

statistics was performed on non-transformed data except in one case where it was not evident that

the data was normally distributed due to a limited sample size and the data was then transformed

logarithmically before applying the t-test (chemotaxis experiments in vitro). The Bernard test was

used to compute an association between IL-26 and cell concentration from subjects undergoing

intra-bronchial exposure in vivo to endotoxin and vehicle (see below for the details). p-values less

than 0.05 were considered statistically significant. Of note, p-values less than 0.001 were all

presented as p<0.001 to save space.

Bernard’s test: The specific data on BAL samples consisted of 33 observations, where each

individual was measured with respect to IL-26 and two innate effector cell types; neutrophils and

BAL macrophages. It should be noted that all these 3 parameters considered were known to

increase due to endotoxin. Thus, data regarding the biomarker (IL-26) and the two cell types were

measured in samples from both the vehicle- and the endotoxin-exposed bronchial segment in

each subject. The Bernard test was carried out to support the hypothesis that the concentration of

IL-26 and the two types of innate effector cells were significantly associated in the samples from

endotoxin-exposed bronchial segments. However, due to the limited amount of data (n=33)



13

statistical analysis using a regression line was not applicable. Ranking the data, we showed that

the relative differences between IL-26 and the two types of innate effector cells remained the

same in both the samples from both the vehicle- and the endotoxin-exposed bronchial segments.

This suggests that an increase in IL-26 also resulted to an increase in these cell types at the site of

endotoxin exposure. In other words, looking at the individual data, we saw a rather clear trend

showing each subject expressing highest concentration of both IL-26 and each cell types in the

matched sample from the endotoxin-exposed bronchial segment. The test was therefore set to

count the frequency of cases where we had increased levels of both IL-26 and the respective cells

in the endotoxin-exposed samples. These values were then compared using a chi-square

distribution. The outcome gave us the probability of what can be expected that increased IL-26

concentration is also affecting the number of the innate effector cells, neutrophils and BAL

macrophages. However, we have compared the variation of both the levels of IL-26 and the cell

types between the control and endotoxin exposed samples within each subject.



14

Supplementary Figure Legends

Figure E1. Messenger RNA expression in alveolar macrophages. Adherent macrophages from

bronchoalevolar lavage (BAL) samples were stimulated with endotoxin (1 ug/ml) or vehicle (20

h). Total RNA was extracted and IL-26 mRNA was measured using real time PCR. Data shown

are mean values with SEM (n=4). p-values according to Students paired t-test are indicated.

Figure E2. Phosphorylated STATs and IL-26 receptor complex in blood neutrophils after

co-stimulation. Blood neutrophils (300,000 per well) were allowed to rest in the cell incubator (2

h) and were subsequently stimulated (20 min), as specified in the figure panels. (A) Effect on

phosphorylated STAT3 in lysed neutrophils, as measured by Phosphor Tracer ELISA (n=5); (B

& C) Effect on phosphorylated STAT1 measured in analogy with panel “A” (n=8); (D & E)

FACS analysis of the membrane protein expression for IL-10R2 and IL-20R1 in washed

neutrophils (n=6). Data shown are mean values with SEM. p-values >0.05 (Students t-test) for all

groups (ie. no statistically significant effect) are indicated as “ns”.

Figure E3. Cell differential counts for bronchoalveolar lavage cells harvested from

unexposed healthy volunteers. Samples of bronchoalevolar lavage (BAL) cells were harvested

by performing bronchoscopy. The percentages of large mononuclear (macrophages as circles),

small mononuclear (lymphocytes as squares) and granulocytes (neutrophils as triangles) are

presented. Data shown are mean and individual values for cells from healthy volunteers who have

not been prior exposed to endotoxin or vehicle in vivo (n=17).

Figure E4 Effects of IL-26 on antimicrobial peptides in primary bronchial epithelial cells.

Primary bronchial epithelial cells harvested from unexposed human volunteers were stimulated

with recombinant human (rh) IL-26 protein (100 ng/ml) or treated with vehicle during culture (24



15

h) ex vivo. Concentrations of (A) Secretory leukocyte peptidase inhibitor (SLPI) and (B)

Calprotectin protein were measured in cell-free conditioned medium using ELISA (n=10). Data

shown are mean values with SEM. p-values are indicated according to Students paired t-test.



16

References

E1. Glader P, Smith ME, Malmhall C, Balder B, Sjostrand M, Qvarfordt I, Linden A. Interleukin-

17-producing t-helper cells and related cytokines in human airways exposed to endotoxin.

Eur Respir J 2010;36:1155-1164.

E2. Smith ME, Bozinovski S, Malmhall C, Sjostrand M, Glader P, Venge P, Hiemstra PS,

Anderson GP, Linden A, Qvarfordt I. Increase in net activity of serine proteinases but not

gelatinases after local endotoxin exposure in the peripheral airways of healthy subjects.

PloS One 2013;8:e75032.

E3. Karimi R, Tornling G, Grunewald J, Eklund A, Skold CM. Cell recovery in bronchoalveolar

lavage fluid in smokers is dependent on cumulative smoking history. PloS One

2012;7:e34232.

E4. Corvaisier M, Delneste Y, Jeanvoine H, Preisser L, Blanchard S, Garo E, Hoppe E, Barre B,

Audran M, Bouvard B, Saint-Andre JP, Jeannin P. Correction: Il-26 is overexpressed in

rheumatoid arthritis and induces proinflammatory cytokine production and th17 cell

generation. PLoS Biol 2012;10.

E5. Strandberg K, Palmberg L, Larsson K. Effect of formoterol and salmeterol on il-6 and il-8

release in airway epithelial cells. Respir Med 2007;101:1132-1139.

E6. Blidberg K, Palmberg L, Dahlen B, Lantz AS, Larsson K. Increased neutrophil migration in

smokers with or without chronic obstructive pulmonary disease. Respirology

2012;17:854-860.




Effects on Neutrophils Mobilization

Karlhans F. Che; Sara Tengvall; Bettina Levänen; Elin Silverpil; Margaretha E. Smith;

Muhammed Awad; Max Vikström; Lena Palmberg; Ingemar Qvarfordt; Magnus Sköld & Anders

Lindén.

Online Table Supplement



Table E1. Antibodies and clone numbers used for flow cytometryT cells

Cat #560835556616557085557154552724MAB1375MAB0041556655550795555743551954349053

Cat #56027555535656079956232755708548-7229-4112-6988-82MAB1375560167562438550795562306556655555743

Cat #2506894225473281

Cat #FAB874AFAB11762PIC002A555749Isotype Control IgG1 κ PE MOP-21 BD Biosciences

Isotype Control IgG1 APC 11711 R&D SystemsAntibody IL-20R1 PE 173714 R&D SystemsAntibody IL-10R2 APC 90220 R&D SystemsType Marker Fluorochrome Clone CompanyNeutrophils Panel 4

Isotype Control Ms IgG2B, κ Pe-Cy7 eBMG2b eBioscienceAntibody CD68 PE-Cy7 eBioY1/82A eBioscienceType Marker Fluorochrome Clone CompanyMacrophages Panel 3

Isotype Control Ms IgG2A PE MOPC-21 BD BiosciencesIsotype Control Ms IgG2B, κ FITC 27-35 BD BiosciencesIsotype Control Ms IgG2A, k PE-CF594 G155-178 BD BiosciencesIsotype Control Ms IgG1, k PerCP-Cy5.5 MOPC-21 BD BiosciencesIsotype Control Ms IgG1, k Brilliant Violet™ 421 X40 BD BiosciencesIsotype Control Ms IgG1, κ APC-H7 MOPC-21 BD BiosciencesAntibody IL-26 n/a 197505 R&D SystemsAntibody RORc2 PE AFKJS-9 eBioscienceAntibody IL-22 eFluor 450 22URTI eBioscienceAntibody CD8 FITC RPA-T8 BD BiosciencesAntibody CD45RO PE-CF594 UCHL1 BD BiosciencesAntibody IL-17A PerCP-Cy5.5 N49-653 BD BiosciencesAntibody CD4 FITC RPA-T4 BD BiosciencesAntibody CD3 APC-H7 SK7 BD BiosciencesType Marker Fluorochrome Clone CompanyT cells Panel 2

Isotype Control Ms IgG2A PE X39 BD BiosciencesIsotype Control Ms IgG1 κ FITC MOPC-21 BD BiosciencesIsotype Control Ms IgG2B PE 27-35 BD BiosciencesIsotype Control Ms IgG1 PerCP-Cy5.5 MOPC-21 BD BiosciencesIsotype Control Ms IgG2B FITC 27-35 BD BiosciencesIsotype Control Ms IgG2B n/a 133303 R&D SystemsAntibody IL-26 n/a 197505 R&D SystemsAntibody CD45 PerCP-Cy5.5 TU116 BD BiosciencesAntibody CD14 PE M5E2 BD BiosciencesAntibody CD8 FITC RPA-T8 BD BiosciencesAntibody CD4 PE M-T477 BD BiosciencesAntibody CD3 PerCP-Cy5.5 UCHT1 BD Biosciences

Panel 1Type Marker Fluorochrome Clone Company



IL-2

6fo

ldd

iffe

ren

ce

Vehicle Endotoxin 0

5

10

15 of 56 AJRCCM Articles in Press. Published on 07-October-2014 as 10.1164/rccm.201404-0689OC


Flo

ure

scen

ceo

f

Ph

osp

ho

ryla

ted

ST

AT

3(x

103)

Vehic

le

100n

g/ml

IL-8

IL-8

/IL-2

6fM

LP

fMLP/IL

-26

0

5

10

15

20

Flo

ure

scen

ceo

f

Ph

osp

ho

ryla

ted

ST

AT

1(x

103)

Vehic

le

1000

ng/ml

100n

g/ml

10ng/m

l

1ng/m

l

G-CSF

G-CSF/IL

260

5

10

15

Flo

ure

scen

ceo

f

Ph

osp

ho

ryla

ted

ST

AT

1(x

103)

Vehic

le

100n

g/ml

IL-8

IL-8

/IL26

fMLP

fMLP/IL

260

5

10

15

IL-1

0R2

MF

I(x

102

)

Isoty

pe

Vehic

leIL

-26

LPSIL

-8fM

LP0

2

4

6

8

10

IL-2

0R1

MF

I(x

102

)

Isoty

pe

Vehic

leIL

-26

LPSIL

-8fM

LP0

5

10

15

20

A B

C

D E

ns ns

ns

nsns



%o

fal

lcel

ls

Mac

rophag

es

Lymphocy

tes

Neutro

phils0

50

100



SL

PI(

ng

/ml)

Vehicle IL-260

2

4

6

p=0.425

Cal

pro

tect

in(n

g/m

l)

Vehicle IL-260

1

2

3

4

5

p=0.159



Interleukin-26 in Antibacterial Host Defense of Human Lungs. Effects on Neutrophil Mobilization

Documents

Transcript of Interleukin-26 in Antibacterial Host Defense of Human Lungs. Effects on Neutrophil Mobilization