Insect toxicity in plant associated fluorescent pseudomonads

Faculteit Bio-ingenieurswetenschappen

Academiejaar 2012 – 2013

Insect toxicity in plant associated fluorescent pseudomonads

Insecten toxiciteit bij plant-geassocieerde fluorescente pseudomonaden

Thomas Van den haute Promotors: Prof. Dr. ir. Monica Höfte, Prof. Dr. ir. Patrick De Clercq Tutors: Prof. Dr. ir. Monica Höfte, Dr. Chien-Jui Huang

Masterproef voorgelegd tot het behalen van de graad van Master in de Bio-

Ingenieurswetenschappen: Landbouwkunde

i

De auteur en de promotors geven de toelating deze masterproef voor consultatie

beschikbaar te stellen en delen ervan te kopiëren voor persoonlijk gebruik. Elk ander gebruik

valt onder de beperkingen van het auteursrecht, in het bijzonder met betrekking tot de

verplichting uitdrukkelijk de bron te vermelden bij het aanhalen van resultaten uit deze

masterproef.

Gent, Juni 2013

De auteur:

Thomas Van den haute

De promotors:

Prof. Dr. ir. M. Höfte

Prof. Dr. ir. P. De Clercq

ii

PREFACE

Mijn masterpoef, het pronkstuk van een 6 jaar durende studie, is eindelijk af. Nu ik dit tot

een goed einde bracht, sluit ik naast mijn boeken ook een hoofdstuk af in mijn levensloop.

“De beste tijd uit u leven”, het studentenleven, is nu voorbij. Een tijd getekend door

dieptepunten, maar vooral heel veel hoogtepunten: het zenuwslopende afwachten op de

allereerste resultaten, het maken van vele nieuwe vrienden, een eerste keer buizen, de

onstuimige feestjes, het leren kennen van mijn stad Gent vanuit een andere oogpunt,

liefdesperikelen, het eerste mondelijke examen, de vele studietrips, in het oog van de storm

zitten in Kievit, 6 maanden overleven in het zonnige Córdoba, mijn Brits en labotechnieken

bijschaven in Reading, … Te veel om op te noemen. Dit alles had ik echter nooit kunnen doen

ware het niet van een aantal bijzondere mensen.

In de eerste plaats wil ik mijn beide promotors, prof. dr. ir. Höfte en prof. dr. ir. De Clercq,

bedanken voor deze kans die ik heb gekregen en hopelijk met beide handen heb gegrepen.

Het was niet alleen een professionele verrijking aan labo-ervaring maar ook een harde

leerschool in geduld, concentratie en werklust. Dankzij jullie nauwe opvolging bleef ik met

de voetjes op de grond en verloor ik mezelf niet in m’n chaotische gedachtegang.

Secondly I wish to express my greatest gratitude to my tutor Huang, who guided me through

the reluctant ways of Pseudomonas. Our endless discussions were an enormous source of

inspiration and it kept me motivated. I also wanted to thank everyone from the lab of

Phytopathology for helping me with my many questions. Ook had ik graag het labo van

Agrozoölogie willen bedanken, en dan vooral Leen en Didier, voor hun hulp bij het kweken

van mijn behoeftige insectjes.

Vervolgens wou ik mijn medethesisstudentjes bedanken. Lien, Charissa, Ellen, ondanks

ieders probleempjes (plantjes vergeten water geven, ontploffende flessen, brandwonden en

mislukte proeven) waren we er voor elkaar en hadden we altijd tijd voor ’n koffiepauze of ’n

leuke babbel. Ik wens iedereen veel succes toe, maar eerst een welverdiende vakantie.

Tot slot, de waarheid overtreft het cliché, ware het niet dankzij de oneindige steun van mijn

ouders en grootouders, was ik nooit geraakt waar ik nu sta. Mama en papa, jullie boden me

de kans te studeren, jullie bleven me motiveren om verder te doen en we amuseerden ons

rot. Nu hoop ik jullie te kunnen bewijzen dat het geen “six years down the drain” waren. Het

was in ieder geval een onvergetelijke rit waar we geluk en vreugde deelden.

iii

SUMMARY

Ever since the first descriptions of plant-protecting rhizobacteria, microorganisms with

specific qualities have been proposed as valuable alternatives to conventional crop

protection measures, mostly involving synthetic chemicals. Research involving the control or

suppression of soil-borne fungal and bacterial pathogens had risen substantially. Recently,

insect pest control by microorganisms was readily received for research. After the prominent

discoveries of insecticidal toxins from Bacillus thuringiensis and from the nematode-

associated Photorhabdus spp. and Xenorhabdus spp., certain fluorescent pseudomonads can

be added to this group of bacteria gifted with secondary metabolites with insecticidal

activity. In this study we evaluate several fluorescent pseudomonads with potential

biocontrol properties against insects.

In a first part we examine the insect toxicity of Pseudomonas cichorii strains NCPPB 907 and

SF1-54. We injected the bacteria inside the hemocoel of larvae of greater wax moth (Galleria

mellonella) and demonstrate toxicity at concentrations of 106 cfu/larvae. To NCPPB 907,

MCP was suggested to play a key role in insect toxicity. Our assays confirm this statement

and show reduced mortality of G. mellonella injected with the MCP mutant of NCPPB 907.

However, we cannot demonstrate a restoration of the insecticidal activity with the MCP

complementary strain. In order to further elucidate the pathogenicity mechanisms we

examined several known virulence factors with mutant strains of SF1-54. Although

important to some bacteria in their pathogenicity, neither the GacS/GacA two component

regulatory system, nor the type III secretory system were of importance in insect toxicity of

P. cichorii SF1-54. Nevertheless, the mutant impaired of cichopeptin production caused

higher mortality. How the absence of the cichopeptins augment the insecticidal capacity is

still up to speculation.

Secondly, we evaluate the insecticidal properties of Pseudomonas sp. CMR12a, a very potent

biocontrol agent. By injection in the hemocoel of G. mellonella larvae we demonstrated

insect toxicity of CMR12a at very low concentrations down to 80 cfu/larvae. FitD, a recently

iv

characterized insect toxin in Pseudomonas CHA0 and also associated with CMR12a, was

confirmed by our study to be present in CMR12a and is most likely to be responsible for its

entomopathogenic characteristic. However, residual mortality remained in fitD mutants of

CHA0 indicating for additional insecticidal components. Mutants of CMR12a impaired of the

production of multiple secondary metabolites did not show any significant differences in

mortality against G. mellonella in comparison to the wild type, except for the gacA mutant.

The gacA mutant showed a clear increased activity. We suggest this phenomenon to be a

result of “growth advantage in stationary phase” (GASP). GASP occurs when spontaneous

mutants get a competitive advantage due to the reduced number of expressed metabolites.

Results from oral toxicity assays where cottonworm caterpillars (Spodoptera littoralis) were

presented with inoculated artificial diet, indicate that CMR12a cannot cause mortality after

digestion.

A third part consists of the further characterization of novel biocontrol pseudomonads.

Insecticidal properties can be used to differentiate strain from each other and to attribute

potential control properties. In a virulence assay we demonstrate mortality of G. mellonella

larvae injected with NSE1 at 8 x 104 cfu/larva. With this result we deliver proof of NSE1 and

NNC8 being different strains, although them being classified as closely related strains.

With a DNA sequence analysis we demonstrate the presence of the insect toxin FitD in

CMR12a and CMR5c. The sequence analysis of the novel pseudomonad strains did not

generate clear results, which indicate that the proposed primers are not specific enough to

be applied on all Pseudomonas spp.

v

SAMENVATTING

Al sinds de eerste beschrijvingen van plant-microbiële interacties in de bodem werden

micro-organismen met specifieke gunstige eigenschappen onderzocht om mogelijks te

dienen als alternatief voor conventionele gewasbeschermingsmaatregelen, die veelal

gebaseerd zijn op het gebruik van synthetische pesticiden. Daaruit vloeide een exponentiële

groei aan onderzoek naar het beheersen of bestrijden van bodem gebonden

plantpathogenen door middel van micro-organismen. Recent werd ook de bestrijding van

insectenplagen met bacteriën meer uitgelicht. Na de prominente ontdekkingen van insecten

toxines geproduceerd door Bacillus thuringiensis en door de nematoden-symbiotische

Photorhabdus spp en Xenorhabdus spp., kan men nu ook een aantal fluorescente

pseudomonaden toevoegen aan de lijst van entomopathogene bacteriën. In deze studie

onderzoeken we enkele fluorescente pseudomonaden op hun potentieel vermogen om

insectenplagen te bestrijden.

In een eerste luik onderzochten we de toxiciteit van Pseudomonas cichorii SF1-54 en NCPPB

907 ten opzichte van insecten. We injecteerden bacteriën in het hemocoel van wasmot

larven (Galleria mellonella) en toonden daarbij toxiciteit aan van NCPPB 907 en SF1-54 bij

concentraties van 1 x 106 cfu/larve. Voor de stam NCPPB 907 werd gesuggereerd dat de

chemotaxis proteïne MCP een cruciale rol zou spelen in de insecten toxiciteit. Onze proeven

bevestigen deze veronderstelling vermits een reductie in mortaliteit van G. mellonella

geïnjecteerd met MCP-mutanten werd geobserveerd. Wanneer we echter de larven

injecteerden met complementaire stammen konden we geen herstel van toxiciteit

waarnemen. Met het oog op het verder uitklaren van ziektemechanismen onderzochten we

het belang van enkele gekende virulentie factoren met mutanten van SF1-54. Ondanks het

belang van de factoren in het ziekteverwekkend vermogen van sommige bacteriën, waren

noch de GacS/GacA twee componenten systeem, noch de type III secretie systeem van

belang in de insect toxiciteit van P. cichorii SF1-54. Uit injectie proeven met mutanten

verzwakt in de productie van cichopeptine, kunnen we een verhoogd effect vaststellen. Hoe

de afwezigheid van cichopeptine kan leiden tot een verhoogde mortaliteit is tot nog toe voer

voor speculatie.

vi

Vervolgens bestuderen we de insecticide eigenschappen van Pseudomonas CMR12a, een

krachtige biocontrole organisme. Met geïnjecteerde larven van G. mellonella tonen we

toxiciteit aan van CMR12a bij lage concentraties tot 80 cfu/larve. De aanwezigheid in

CMR12a van FitD, een recentelijk beschreven insecten toxine in P. protegens CHA0 en ook

gelinkt aan CMR12a, werd in onze studie bevestigd en is hoogstwaarschijnlijk

verantwoordelijk voor diens entomopathogene karakteristiek. Bij CHA0 werd echter een

residuele mortaliteit vastgesteld bij fitD mutanten, dewelke wijst op bijkomstige insecticide

componenten. Mutanten van CMR12a verzwakt in de productie van verschillende

secundaire metabolieten vertoonden geen significante verschillen in mortaliteit van G.

mellonella na injectie, behalve de gacA mutant. Bij de gacA mutant werd een toename in

mortaliteit vastgesteld. We veronderstellen dat dit fenomeen het gevolg is van “growth

advantage in stationary phase” (GASP). GASP doet zich voor wanneer spontane mutanten

een competitief voordeel vergaren door het opzeggen van de productie van enkele

secundaire metabolieten. Resultaten van proeven waarbij katoenuil rupsen (Spodoptera

littoralis) werden blootgesteld aan CMR12a door middel van een geïnoculeerd artificieel

dieet duiden erop dat CMR12a niet in staat is insecten te doden na orale inname.

Tot slot bestond een derde luik uit het verder karakteriseren van nieuwe biocontrole

Pseudomonas stammen. Insecticide eigenschappen kunnen gebruikt worden om bacteriën

van elkaar te onderscheiden en eveneens kan deze het potentieel als biocontrole stam

verrijken. Tijdens toxiciteitsproeven vonden we mortaliteit van G. mellonella larven

geïnjecteerd met 8 x 104 cfu/larve van NSE1. Hiermee leveren we bewijs dat NSE1 en NNC8

tot een verschillende stam behoren, ondanks ze geclassificeerd zijn als nauw verwante

stammen.

Aan de hand van een DNA sequentie-analyse vonden we het toxine FitD terug in zowel

CMR12a als CMR5c. De PCR en sequentie-analyse kon echter voor de nieuwe Pseudomonas

stammen geen duidelijke resultaten opleveren. Daaruit leiden we af dat de voorgestelde

primers niet voldoende specifiek zijn om toe te passen op alle Pseudomonas spp.

vii

LIST OF ABBREVIATIONS

Bt Bacillus thuringiensis (as pesticide) Cfu Colony forming units CifA Cichofactin A CifB Cichofactin B CipA Cichopeptin A CLP Cyclic lipopeptide CLP1 Sessilin CLP2 Motilin DAPG Diacetylphloroglucinol DNA Desoxyribonucleic acid Dpi Days post inoculation/injection Fit Fluorescent insecticidal toxin GASP Growth advantage in stationary phase Gm Gentamycin HCN Hydrogen cyanide Hpi Hours post inoculation/injection HR Hypersensitive response hrc Hypersensitive reaction and pathogenicity conserved genes hrp Hypersensitive reaction and pathogenicity genes IPM Integrated pest management ISR Induced systemic resistance KB King’s B medium LB Luria Bertani medium LD Lethal dose LT Lethal time Mcf Makes caterpillar floppy MCP Methyl-accepting chemotaxis protein Nal Naladixic acid Nif Nitrofurantoin NRPS Non-ribosomal peptide synthetase OD Optical density PB Phosphate buffer PCA Phenazine-1-carboxylic acid PCN Phenazine-1-carboxamide PCR Polymerase chain reaction PGPR Plant growth-promoting rhizobacteria Phz Phenazine PLT Pyoluterin PVC Photorhabdus virulence cassettes rpm Rotations per minute Tc Toxin complexes TTSS Type III secretion system Wt Wild type

viii

CONTENT

PREFACE ...................................................................................................................................................ii

SUMMARY ............................................................................................................................................... iii

SAMENVATTING ....................................................................................................................................... v

LIST OF ABBREVIATIONS ......................................................................................................................... vii

1. INTRODUCTION ................................................................................................................................... 1

2. LITERATURE STUDY .............................................................................................................................. 5

2.1 Biological control ........................................................................................................................... 5

2.1.1 Integrated pest management ............................................................................................ 5

2.1.2 Plant-beneficial bacteria .................................................................................................... 6

2.1.3 Entomopathogenic microorganisms ................................................................................. 8

2.2 Entomopathogenic pseudomonads ............................................................................................ 11

2.2.1 Introduction ..................................................................................................................... 11

2.2.2 Pseudomonas protegens CHA0 ........................................................................................ 12

2.2.3 Pseudomonas sp. CMR12a .............................................................................................. 14

2.2.4 Pseudomonas cichorii ...................................................................................................... 17

2.2.5 Novel Nigerian fluorescent pseudomonads NNC1-NNC8, NSE1-NSE5............................ 18

2.3 Model insects .............................................................................................................................. 19

2.3.1 Galleria mellonella ........................................................................................................... 19

2.3.2 Spodoptera littoralis ........................................................................................................ 20

3. MATERIALS AND METHODS............................................................................................................... 21

3.1 Materials ...................................................................................................................................... 21

3.1.1 Media ............................................................................................................................... 21

3.1.2 Bacteria and culture conditions ....................................................................................... 21

3.1.3 Insects .............................................................................................................................. 23

3.2 Methods ...................................................................................................................................... 26

3.2.1 Virulence assays ............................................................................................................... 26

3.2.2 PCR procedure and DNA analysis .................................................................................... 29

3.2.3 Construction of complement strain of Pseudomonas cichorii 907-MCP::Tn5 ................ 29

3.2.4 Bacterial colonization ...................................................................................................... 30

3.2.5 Statistical analysis ............................................................................................................ 30

4. RESULTS ............................................................................................................................................. 32

ix

4.1 Pseudomonas cichorii .................................................................................................................. 32

4.1.1 Introduction ..................................................................................................................... 32

4.1.2 Effects of culture media of P. cichorii against G. mellonella ........................................... 33

4.1.3 Insect toxicity of P. cichorii after injection in G. mellonella ............................................ 33

4.1.4 Role of MCP in insect toxicity caused by strain NCPPB 907 ............................................ 36

4.1.5 Role of virulence factors from P. cichorii SF1-54 in the toxicity to G. mellonella ........... 36

4.2 Pseudomonas CMR12a ................................................................................................................ 38

4.2.1 Introduction ..................................................................................................................... 38

4.2.2 Effect of culture media of Pseudomonas CMR12a against G. mellonella ....................... 38

4.2.3 Effect of concentration of Pseudomonas CMR12a on insect toxicity to G. mellonella ... 38

4.2.4 Insect toxicity of Pseudomonas CMR12a after injection in G. mellonella ....................... 40

4.2.5 Oral insect toxicity of Pseudomonas CMR12a to S. littoralis ........................................... 42

4.2.6 Bacterial colonization of Pseudomonas CMR12a in G. mellonella .................................. 43

4.3 Nigerian strains ............................................................................................................................ 43

4.3.1 Introduction ..................................................................................................................... 43

4.3.2 Results ............................................................................................................................. 43

4.4 PCR and sequence analysis .......................................................................................................... 45

5. DISCUSSION ....................................................................................................................................... 47

5.1 Pseudomonas cichorii .................................................................................................................. 47

5.2 Pseudomonas sp. CMR12a .......................................................................................................... 49

5.3 Nigerian Pseudomonas spp. ........................................................................................................ 53

6. CONCLUSIONS ................................................................................................................................... 55

7. REFERENCES ...................................................................................................................................... 57

1

1. INTRODUCTION

Knowing that the last fifty years the global population has grown more rapidly than ever

before, questions arise concerning the capacity of current food production to support such

growth (Oerke and Dehne, 2004). Initially this growth was supported by an explosion of

knowledge in the fields of plant breeding, synthetic soil fertilizers and new pest control

chemicals. This was the so-called Green Revolution which allowed the world’s food

production to double (Evenson and Gollin, 2003; Pingali, 2012). Secondly, diverse

ecosystems were converted into simple agro-ecosystems to allow farmers to cultivate on a

larger scale and consequently improve productivity. Unfortunately, these measures towards

the industrialization of agriculture caused an increased need for crop protection, as the

newly created conditions are optimal for the development of pests (Oerke et al., 1994;

Oerke and Dehne, 2004; Oerke, 2006). This is especially true for large-scale monocultures or

areas with heavy fertilizer application.

Weeds, animal pests (insects, nematodes, etc.) and plant pathogens (fungi, bacteria and

viruses) separately are responsible for more or less 15% of today’s crop losses, despite the

use of pesticides (Oerke et al., 1994; Oerke, 2006). Together they inflict a total loss of

approximately one third of the attainable yield. Weeds compete for the available light,

space, nutrients and water and by this way cause indirect loss. Pathogens and animals on the

other hand, rather cause direct damage by the destruction of plant tissue.

In order to maintain a substantial productivity, the importance of crop protection cannot be

ignored. In spite of this, the use of some chemical pesticides has been drastically restricted

or entirely banned from the European market (Hilloks, 2012; EU Directive 91/414/EEC). This

was set in accordance to the growing concern over the environment and for the safety of the

consumers (Devine and Furlong, 2007). Also several pesticides show a limited efficacy and/or

resistance was established under the targeted organisms (Pedigo, 2002). Therefore novel

pesticides had to be developed or the use of chemical pesticides had to be reduced.

2

Consequently, farmers had to shift their attention towards a more integrated strategy of

crop protection. Here biological control of diseases and pests offered a very promising

prospect. Suppressive soils are one aspect of this biological control and are defined as soils

where a virulent pathogen cannot or hardly cause damage to a susceptible host (Mazzola,

2002). Severe disease can occur in certain cropping systems, but after a few outbreaks the

disease completely loses importance even though pathogen and host are still present.

Suppressive soils form a very interesting source of inspiration for researchers since it has

been revealed that the microbial biomass of the soil would often be responsible for this

protective capacity (Mazzola, 2002, 2004; Weller et al., 2002).

Another aspect to biological pest management is the use and application of biological

pesticides. Pathogenic microorganisms, bacteria, fungi and viruses, are used to eradicate or

restrain populations of harmful organisms, including insects. Microbial insect pathogens are

very specific but in general only act with sufficient success after ingestion, so they are best

used to control lepidopteran, coleopteran and dipteran insect pests, who are notorious plant

tissue-eating insects (de Maagd et al., 2001; Bode, 2009).

Nowadays, research indicates and makes it more and more clear that beside the more

known entomopathogenic microorganisms like Bacillus thuringiensis, also Pseudomonas spp.

produce, within their wide range of metabolites, components with insecticidal activity

(Mahar et al., 2005; Vodovar et al., 2006; Péchy-Tarr et al., 2008; Devi and Kothamasi, 2009;

Vallet-Gely et al., 2010). Why exactly soil habiting organisms such as Bacillus spp. carry

insecticidal genes remains unclear. Although B. thuringiensis does not have a history of

animal pathogenicity, it has been suggested that carrying insect toxin genes offers some

competitive advantages (de Maagd et al., 2001). In the rhizosphere exists an extreme and

fierce competition where only the best and strongest prevail. Pseudomonas spp. have to

compete with other bacteria, protozoa and nematodes (Siddique and Mahmood, 1999;

Mazzola et al., 2009; Jousset et al., 2010). Very often food sources are scarce and in such

occasions, possessing the ability to either protect a food source or convert for instance

insect larvae into a food source offers a substantial competitive advantage (de Maagd et al.,

2001). Recently, genome sequencing revealed that closely related micro-organisms, like

Photorhabdus spp., and even certain pseudomonads also carry genes that transcribe for

3

large insecticidal toxins (Duchaud et al., 2003; Waterfield et al., 2008; Vodovar et al., 2006;

Péchy-Tarr et al., 2008).

The objective of this work was to investigate if certain fluorescent pseudomonads have a

insecticidal activity and if they can defend plants from insect invasion. The goal was to

investigate the potential of Pseudomonas cichorii and Pseudomonas CMR12a as a useful

biocontrol agent and more specifically to what extent they can be used in the fight against

insect pests. Both bacteria have a history of possible action against insects.

In the study of Robinson (2011) P. cichorii NCPPB 907 had a significant injectable toxicity

towards Galleria mellonella (greater wax moth). Unfortunately, no specific gene encoding for

insect-toxins could be found, although suggestion had been made that chemotaxis would be

involved in the virulence due to the reduced toxicity of methyl-accepting chemotaxis

proteins mutants (MCP). Thus we tried to figure out the involvement of MCP and other

virulence factors in insect toxicity of both a Belgian P. cichorii strain SF1-54 and the NCPPB

907 strain.

Next to this plant-pathogenic Pseudomonas, we also selected an effective and notorious

biocontrol pseudomonad, Pseudomonas CMR12a, found in soils of red cocoyam in

Cameroon (Perneel et al., 2007). The work of Ruffner and colleagues (unpublished) already

pointed out that CMR12a was a carrier of a gene encoding for a large insect toxin named

FitD. Although the fitD mutant of another biocontrol pseudomonad, CHA0, showed a

significant reduction in mortality of the insects after injection (Péchy-Tarr et al., 2008;

Ruffner et al., 2012), there was still a substantial mortality retained (Ruffner et al.,

submitted). Because of this, researchers suggested that the insecticidal activity is most likely

to be linked to multiple traits, which offered interesting possibilities for further investigation

in this work. First, we wanted to convert the hypothesis of insecticidal activity by

Pseudomonas CMR12a into practice. The aim was to test toxicity towards different

lepidopteran insects when injected and when consumed orally. Secondly, cyclic lipopeptides

and phenazines, compounds produced by CMR12a, have proven to be important factors in

the virulence of the pseudomonads towards different organisms. Hence we considered

4

examining the attributions of the compounds in the pathogenicity towards the lepidopteran

insect G. mellonella and Spodoptera littoralis of Pseudomonas CMR12a.

5

2. LITERATURE STUDY

2.1 Biological control

2.1.1 Integrated pest management

Integrated Pest Management (IPM) was a concept introduced to reduce the amount/

frequency of pesticides used in order to secure a more sustainable plant production. With

certain thresholds for the application of pesticides, minor losses are allowed to acceptable

economic levels and with minimum risks to human health and environment, while still

restraining major outbreaks or development of pest populations. For IPM priorities also

shifted from immediate use of pesticides to a more complete approach of crop protection

using the whole range of available techniques for pest control: primarily physical and cultural

protection, secondly biological protection and lastly, when all other options have been

revised, chemical protection, this all in harmony with existing ecosystems (Pedigo, 2002;

FAO, 2013).

The idea of IPM is becoming an important concept in sustainable agriculture. Pests and soil-

borne diseases have particularly been troublesome to control (Haas and Défago, 2005). Crop

rotation, plant breeding and pesticides are often insufficient for an acceptable control (Haas

and Défago, 2005). As an alternative to chemical pesticides, the biological control of pests

has been considered as a promising strategy to minimize the use of synthetic substances.

Biological control is a method to kill or reduce pests in crop production relying on other

living organisms (i.e. natural enemies) (Pedigo, 2002).

Biological control is a promising alternative to the chemical pesticides. It is completely in

accordance with the concept of sustainability. Treating plant material or soil with microbial

agents could be a valuable substitute to synthetic pesticides. On this account, naturally

occurring plant-beneficial microorganisms, mostly present in disease-suppressive soils, have

been particularly interesting for research.

6

2.1.2 Plant-beneficial bacteria

On several locations world-wide, agricultural soils have been described where, although

pathogens are present in the soil, no or little disease occur (Weller et al., 2002). The

microbial community of the soil has been stated to be responsible for this remarkable

observation (Mazzola, 2002; Cook and Rovira, 1976). The protective nature for the plants of

suppressive soils can be split into two mechanisms: general and specific suppression.

General suppression is a consequence of the intrinsic qualities of the soil (Weller et al.,

2002). Mostly the entire microbial biomass or abiotic factors such as pH, organic matter or

clay content are responsible (Amir and Alabouvette, 1993; Serra-Wittling et al., 1996;

Mazzola, 2002). In contrast to general suppression, specific suppression can be transferred

from suppressive soils to conductive soils. Specific suppression is assigned to be more the

effect of certain groups or individual microorganisms. When such soil is pasteurized or

fumigated it loses its specific protective quality completely, indicating the value of

microorganisms (Mazzola, 2002).

Several plant growth-promoting rhizobacteria (PGPR) have already been reported. To

successfully support and/or maintain plant health, a rapid and efficient colonization of

rhizophere and roots is of essential importance. The increased microbial activity in the

rhizophere is due to the leaking of large quantities of organic matter in the form of root

exudates and rhizodeposits (de Weger et al., 1995; Smalla et al., 2006; Hartmann et al.,

2008). Both antagonistic as deleterious rhizobacteria experience a positive chemotaxis

towards the root exudates. The production of secondary metabolites offers PGPRs a

selective and competitive advantage. Moreover PGPRs can address more different nutrient

sources which increase their adaptability and chances of survival in stressful and/or limited

nutritious environments. Secondly PGRPs suppress the expansion of other organisms directly

by antibiosis or indirectly by the induction of plant defense mechanisms (induced systemic

resistance, ISR). Additionally the plant profits from the rhizobacteria as some strains provide

nitrogen by the means of fixation or increase the supply of poorly soluble nutrients like

phosphorus and iron. The increased availability of inorganic nutrients is due to the

production of various organic acids or metal-chelating molecules (i.e. siderophores). Finally

7

PGPRs regularly produce phytohormones, like auxins, cytokinins or gibberellins, that may

boost plant growth as well (Gutiérrez-Mañero et al., 2000; Khalid et al., 2003; García et al.,

2004; Joo et al., 2004; Ryu et al., 2005; Senthilkumar et al., 2009; Piccoli et al., 2010).

Relevant examples of PGPRs with notable biocontrol activity of fungi are the non-pathogenic

Fusarium spp. and Trichoderma spp. and for bacteria Bacillus spp. and Pseudomonas spp.

(Weller et al., 2002; Benítez et al., 2004; Compant et al., 2005, 2010; Haas and Défago, 2005;

Weller, 2007; Verma et al., 2007; Ongena and Jacques, 2008; Santoyo et al., 2012). More

specifically the fluorescent pseudomonads have been of particular interest in respect to the

development of biocontrol agents, because they happen to possess a wide range of

exceptional features. Besides the properties of PGPRs described above, fluorescent

pseudomonads also produce a wide variety of exoproducts (Haas and Défago, 2005;

Raaijmakers and Mazzola, 2012). Several of these products have been characterized and

their activity has been revealed. For instance, Take-all decline is a worldwide phenomenon in

monocultures of wheat caused by fluorescent pseudomonads. After cultivating wheat or

barley continuously, a spontaneous attenuation of take-all disease, caused by

Gaeumannomyces graminis var. tritici, occurs (Cook and Rovira, 1976; Weller et al., 2002,

2007; Cook, 2003). This attenuation is typically observed during the first 2 to 4 years after an

initial increase of the pathogen, regularly causing one or more outbreaks of the disease

(Baker and Cook, 1974). Wheat cultivars support the development of specific bacteria and

consequently enrich the soil with groups of antagonistic microorganisms. Although Sanguin

et al. (2009) suspect that the soil suppressiveness cannot solely result from fluorescent

pseudomonads, despite of making up the majority of the bacterial community during the

stages of disease occurrence. They thought suppressiveness can only be achieved within a

complex interaction between a mixed group of different microorganisms changing over the

time of the wheat monoculture. Nevertheless the production of phenazine-1-carboxylic acid

and 2,4-diacetylphlorglucinol by the fluorescent pseudomonads are generally assumed to

play a key role in the contribution to the take-all decline (Thomashow and Weller, 1988;

Weller et al., 2007).

8

2.1.3 Entomopathogenic microorganisms

The amount of literature reporting on disease-suppressive soils has increased considerably

over the past decades (Mazzola, 2002; Weller et al., 2002; Haas and Défago, 2005; Weller,

2007; Hajek et al., 2007). The main reason for bacteria to address such intense strategies to

interfere with the development of competing organisms is to survive and secure their own

spot in the bacterial community. Beside disease-suppressing microorganisms, also insect-

killing bacteria have been found in agricultural soils (Bode, 2009). Because of the high

diversity of insects, parasites developed accordingly and adapted specifically to insects as a

host and/or food source (Bode, 2009). The majority of the insecticidal toxins used in

agriculture nowadays come from the successful biocontrol bacterium: Bacillus thuringiensis

(ffrench-Constant et al., 2006). The growing amount of genome sequencing projects

revealed that besides B. thuringiensis, other soil-living organisms such as fluorescent

pseudomonads and the nematode-associated bacteria, Photorhabdus spp. and Xenorhabdus

spp., carry genes encoding for insecticidal secondary metabolites (Duchaud et al., 2003;

Vodovar et al., 2006; Challacombe et al., 2007; Olcott et al., 2008; Waterfield et al., 2008).

2.1.3.1 Bacillus thuringiensis

Although it is the most important biopesticide for the control of insect pests, Bt (Bacillus

thuringiensis formulated as a biopesticide) barely covers around 2% of the total market of

insecticides (Bravo et al., 2011). B. thuringiensis is a Gram positive soil-native bacterium

belonging to the family of Bacillaceae. When the bacterium starts sporulating during

stressful circumstances, it produces insecticidal crystal proteins called -endotoxins (Höfte et

al., 1986; Zhou et al., 2008; Bravo et al., 2011). There are 67 groups (Cry1-Cry67) covering

500 different cry genes amongst the -endotoxins which can be classified by their primary

acid sequence and separated into 4 structurally different families: 3 domain Cry toxins (3D),

mosquitocidal Cry toxins (Mtx), binary-like toxins (Bin) and the Cyt toxins (Bravo et al., 2005).

The Cry and Cyt toxins are very selective to a narrow range of insects. Susceptible insects are

members of the lepidopteran, coleopteran and dipteran family (Bravo et al., 2011). Once

ingested the soluble pro--endotoxins undergo conformational changes induced by the

insect proper proteases. Once processed the toxins are active and start binding with specific

proteins connected to the insect midgut epithelium. This specificity towards the binding sites

9

determines the specificity of the toxin towards the insect accordingly. Once bonded, a

complex sequential process is followed by the insertion of the toxin into the midgut

epithelium membrane. The cells are now perforated and are killed by osmotic shock (Bravo

et al., 2005, 2007, 2011; Zhou et al., 2008; Soberón et al., 2009). The entire midgut tissue is

disrupted and is followed by septicemia caused probably not only by the B. thuringiensis

itself but opportunistic bacteria as well (Raymond et al., 2010).

From experience, Bt has proven to be a very efficient biopesticide to plant-eating

lepidopterans that often are important pests (Soberón et al., 2009). Additionally Bt has been

the world-wide example of a successful application of biotechnology in agriculture. In 1985,

Ghent researchers developed the first transgenic Bt-crops (Vaeck et al., 1987). In contrast to

sprays, the -endotoxin from transgenic crops are protected from UV and specificity towards

harmful plant-chewing and boring insects is enhanced (Christou et al., 2006; James, 2009).

Regardless, one disadvantage arose: due to the unilateral usage of specific -endotoxin,

resistance by certain insects occurred and forms a major threat to the application of Bt-

transgenic crops. Mutations of the toxins reporters, Cry-toxin deactivation and elevation of

the immune response are the most common resistance strategies found. To cope with this

phenomenon, Bravo and Soberón (2008) suggest gene-stacking with different Cry toxins with

different mode of action as a possible solution. With this in mind, the discovery of more

toxins could add more possibilities to this concept.

2.1.3.2 Photorhabdus spp. and Xenorhabdus spp.

Both Photorhabdus spp. and Xenorhabdus spp., belonging to the family of

Enterobacteriaceae, engage in a symbiotic association with the nematodes Heterorhabditis

spp. and Steinernema spp., respectively. The nematodes actively seek host insects and

penetrate the cuticle or enter through natural openings like the mouth, anus or spiracles.

Once in the insect’s body cavity (hemocoel), the nematode regurgitates the bacteria present

in their stomach. Once the bacteria are released, replication starts joined with the

production of a range of toxins and kill the insect host within 48 hours (Bowen et al., 1998).

Meanwhile, the nematode multiplies inside the insect simultaneously and feeds from the

bacterial biomass and nutrients obtained from the insect source. After several replications

10

and depletion of the nutrient supplies, the new generation of infective juveniles takes up

new bacteria and burst outside the cadaver in search for new hosts.

Gene sequencing, gene annotation and the adjoining analysis led to the discoveries of

several genes encoding for large proteins to which antibiosis and insecticidal activities are

attributed (Bowen et al., 1998; ffrench-Constant and Bowen, 1999; ; Waterfield et al., 2001,

2008, 2009; Daborn et al., 2002; ffrench-Constant and Waterfield, 2006; ffrench-Constant et

al., 2007; Goodrich-Blair and Clarke, 2007). Photorhabdus spp. exploit toxins to kill their

insect host but also to prevent decay by opportunistic food competitors (Li et al., 1999;

Gouge and Snyder, 2006). Within the gut, the bacterium expresses multi-subunit compounds

of high molecular weight named ‘toxin complexes’ (Tc). Due to the lethal oral activity of the

Tc’s, the precise biological role of the toxin to Photorhabdus spp. is unclear and thought to

be of lesser importance in a natural infection (ffrench-Constant et al., 2007). The Tc’s are

displayed on the outer membrane of the bacterium and require 3 components (A, B, C).

Assumptions are made that component A accounts for the insecticidal activity and the B, C

components are needed for the full toxicity (Waterfield et al., 2001 ). Until now, only the

group of Liu et al. (2003) accomplished to insert the component A gene (TcdA) into

Arabidopsis thaliana successfully to develop an insect-resistant plant.

Of more use are the toxins active after injection. The PVC’s, or ‘Photorhabdus virulence

casettes,’ were first recognized via homology to putative insecticidal toxins from Serratia

entomophily (Hurst et al., 2000). Recombinant Escherichia coli carrying the PVC genes could

survive and kill Galleria mellonella after injection (ffrench-Constant et al., 2007). Hence the

lethal effect of the toxin to insects was suggested. Further analysis showed that the toxin

destroys the insect hemocytes by changing the actin cytoskeleton dramatically (ffrench-

Constant et al., 2007; Nielsen-LeRoux et al., 2012).

Another type of toxin with injectable activity are the ‘makes caterpillar floppy’ (Mcf) toxins.

The construction of a mutant library of recombinant E. coli led to the identification of these

new toxins. Mcf1 intoxication results into the insect losing its body turgor entirely and

becoming ‘floppy’. The toxin initiates the destruction of midgut-epithelium cells upon which

11

the hemocoel starts leaking. Additionally Mcf1 also attacks the insect hemocytes by

promoting apoptosis (Daborn et al., 2002; ffrench-Constant et al., 2007)

2.2 Entomopathogenic pseudomonads

2.2.1 Introduction

Fluorescent pseudomonads are characterized as Gram negative, non-spore-forming and rod-

shaped bacteria belonging to the family of the Pseudomonadaceae. They possess one or

more flagella and are very motile. Most commonly they can be found in the vicinity of the

plant rhizosphere. Fluorescent pseudomonads have been revealed to be competent

biocontrol agents based on their aggressive colonization of plant roots and rhizosphere,

plant-growth promotion and effective protection against soil-borne pathogenic bacteria and

fungi (Haas and Keel, 2003; Haas and Défago, 2005; Compant et al., 2005; 2010; Dubuis et

al., 2007).

Fluorescent pseudomonads release a mixture of exoproducts, such as components with iron

chelating, lytic or antibiotic activity that affect surrounding populations directly (Haas and

Défago, 2005; Cornelis, 2010). Many of the substances are linked to anti-microbial or anti-

fungal activity, and therefore enhance the competitiveness of the bacteria and defense

against bacterivores , like in suppressive soils. 2,4-diacetylphloroglucinol (DAPG), pyoluteorin

(PLT), pyrrolnitrin, phenazines (Phz), hydrogen cyanide (HCN) and cyclic lipopeptides (CLP)

are only a few of these compounds (Haas and Keel, 2003; Ramette et al., 2003, 2011; Haas

and Défago, 2005; Loper and Gross, 2007; Tran et al., 2007; Raaijmakers et al., 2006, 2010,

2012; D’aes et al., 2010; Mavrodi et al., 2010; Le et al., 2012). It would be interesting to

know if besides the specific characteristics of strong PGPR, fluorescent pseudomonads also

possess the ability to protect themselves against insect threats or even avert them from

their niche. This would offer more possibilities in the quest for successful and more

complete biocontrol agents or even in the exploration for new and promising biological

pesticides to offer an alternative to the classical agrochemicals.

12

2.2.2 Pseudomonas protegens CHA0

Pseudomonas protegens CHA0, previously named Pseudomonas fluorescens (Ramette et al.,

2011), was first described by Stutz et al. (1986). They found the bacterium in suppressive

soils to black root rot in tobacco fields in Switzerland. Introduction of CHA0 into conductive

soils protected the plant from disease, while afterwards heat-treated soils lost their

suppressiveness entirely. This strongly proved the involvement of CHA0 regarding the

protective nature of suppressive soils (Stutz et al. 1986). Further research confirmed this

statement and identified CHA0 to be a very potent biocontrol agent against plant-pathogenic

bacteria and fungi (Stutz et al., 1986; de Werra et al., 2009; Jousset et al., 2010, 2011).

Péchy-Tarr et al. (2008) recently reported about the discovery of a novel gene encoding for

an insect toxin. Previous investigation already reported insect toxins by other

pseudomonads. Vodovar et al. (2006) sequenced the complete genome of Pseudomonas

entomophila and several putative genes for insecticidal proteins were detected. Remarkably

no genes encoding for the type III or type IV secretion system were found, although most

Gram negative pathogenic bacteria possess a secretion system to inject proteins into

eukaryotic host cells (Cornelis and Van Gijsegem; 2000). Instead, injection tests on Galleria

mellonella with random-mutants then clarified that the two-component system GacA/GacS

regulates the production of this new toxin (Vodovar et al., 2006).

The insecticidal activity displayed by P. protegens CHA0 is associated with a large protein,

named Fit (for Pseudomonas fluorescent insect toxin). The Fit cluster consists out of eight

different open reading frames (ORFs), designated fitA to fitH (Péchy-Tarr et al., 2008). The

attempt to identify this toxin indicated a close similarity to the Mcf1 from Pseudomonas

luminescens. The FitD protein shows 72% homology with the Mcf1 toxin, suggesting that FitD

probably is the insecticidal component (Péchy-Tarr et al., 2008). Further analysis predicted

the flanking fitABC and fitE to account for the formation of a type I secretion-like system to

facilitate excretion of the toxins. FitF is predicted to be a sensor receptor protein bound to

the membrane. FitG and FitH regulate the expression of the toxin (Péchy-Tarr et al., 2012).

FitG is held responsible for the activation of the Fit insect toxin production while FitH is its

repressor. This was concluded after monitoring deleted fitG or fitH and overexpressing fitG

13

mutants of CHA0. Deletion of fitG did not result into extraordinary differences to the wild

type control. In contrast, the overexpression of fitG or a deletion in the fitH led to strong

enhanced levels of FitD concentrations. Remarkably, from the double fitG/fitH mutant

concentration levels returned to normal, indicating the interaction between the FitG and

FitH proteins (Péchy-Tarr et al., 2012). To confirm the toxicity of FitD, mutants were

constructed. The fitD knock-out mutant of CHA0 showed reduced toxicity towards G.

mellonella, while mutants of non-pathogenic Escherichia coli expressing the FitD toxin, killed

the insects. fitD thus proved to be of great importance for the bacterium’s insecticidal trait.

However, although the insecticidal activity was reduced in fitD knock-out mutants of CHA0,

additional compounds are contributing to the virulence, since the bacterium did not lose its

toxicity towards insects entirely.

Besides genomic homology, tests on G. mellonella showed similar symptoms to those of P.

luminescens as well. Upon injection, CHA0 can already kill the G. mellonella larvae at very

low concentration down to 30 cells per insect of which they die after approximately 40 hours

(Péchy-Tarr et al., 2008). Manduca larvae required 3000 cells per insect to be killed within 30

hours. The appearance of infected larvae changed to a floppy phenotype due to the possible

loss of turgor and a strong melanization. Next to the injectable toxicity, Ruffner et al. (2012)

gave evidence of oral insect toxicity. CHA0 at low dose could also cause high mortality after

ingestion. However, E. coli carrying the fitD gene only was insufficient for oral toxicity. The

researchers suggest that secondary metabolites or mechanisms contribute to the oral insect

toxicity of CHA0.

Previously already stated clearly, to be a successful PGPR, colonization is a key aspect. In the

same sense, investigation was made on the capacity of the bacteria to colonize and persist in

its target environment. Besides growing well in the plant rhizosphere, interestingly, CHA0

was also able to survive and multiply inside insect hosts (Péchy-Tarr et al., 2008; Ruffner et

al., 2012). This was observed both after ingestion and injection of the bacterium.

Nevertheless, only after contact with insects could FitD be produced. This added up to the

hypothesis that the expression of the toxin needed a sensor receptor protein (FitF) and an

external insect stimulus to initiate (Péchy-Tarr et al., 2008).

14

2.2.3 Pseudomonas sp. CMR12a

The discovery of the Pseudomonas CMR12a was a result of the search to an alternative to

the human pathogenetic Pseudomonas aeruginosa, which allegedly has disease suppressive

qualities towards root rot in cocoyam (Perneel et al., 2008). Although P. aeruginosa strains

isolated from soil have been demonstrated to possess biocontrol activities, P. aeruginosa is a

human pathogen that can cause serious infections to people with reduced resistance such as

cystic fibrosis- or HIV- patients (Driscoll et al., 2007; Döring & Pier, 2008). In order to

minimize human health risks it makes perfect sense to avoid application of P. aeruginsa on

the cocoyam roots which are the parts meant for the eventual consumption. Pseudomonas

CMR12a was isolated from healthy red cocoyam surrounded by infested plants in field in

Cameroon (Perneel et al., 2007). Screening of CMR12a demonstrated the synthesis of

antagonistic metabolites phenazine-1-carboxylic acid (PCA), phenazine-1-carboxamide (PCN)

and two groups of biosurfactants.

Biosurfactants are of considerable importance to biocontrol pseudomonads as they

contribute to motility, biofilm formation, root colonization, antimicrobial activity and

biocontrol of plant diseases (De Souza et al., 2003; Raaijmakers et al. 2006; De Bruijn et al.,

2007; Tran et al., 2007a; Tran et al., 2007b; Hultberg et al., 2010). Most biosurfactants

produced by pseudomonads are cyclic lipopeptides (CLPs). They have a basic structure

consisting of a hydrophilic and a hydrophobic part. They contribute to the control of diseases

by modifying surface properties, altering bioavailability of exogenous and endogenous

compounds and interact with membranes (D’aes et al., 2010; Raaijmakers et al., 2010). The

biosynthesis of CLPs is accomplished through non-ribosomal biosynthesis pathways

facilitated by large multienzyme complexes, called non-ribosomal peptide synthetases, NRPS

(Raaijmakers et al., 2010). CLPs are composed of a cyclic oligopeptide lactone ring and

hydrophobic fatty acid tail (Raaijmakers et al., 2006; Ongena and Jacques, 2008). This

dualistic amphipatic nature of the molecules allows bacteria to interact with other bifolded

molecules, such as phospholipids from plasma membranes. CLPs are able to insert into the

plasma membrane of the target tissue and hence disrupt established equilibriums such as

H+, Ca2+ and K+. The result is a total collapse of the pH and ion gradient with cell death as a

consequence (Bender et al., 1999)

15

Using two approaches, genetic analysis of the non-ribosomal peptide synthetase genes and a

chemical structure analysis, D’aes (2012) attemped to characterize the CLPs originating from

Pseudomonas sp. CMR12a. Two CLPs were found, CLP1 and CLP2, and renamed sessilin and

motilin according to their functionality. Both CLPs were hypothesized to be antagonists and

create a minute balance regulating the motility and colonization pattern of the bacteria

(D’aes et al., 2011). Later, swarming assays showed clear abolishment of swarming of the

CLP2 mutant and larger spread was detected for the CLP1 mutant. This indicated that motilin

is required for swarming, while sessilin had a negative effect on swarming (D’aes, 2012).

Intriguingly, after assessing the influence of the CLPs on biofilm formation by CMR12a, a

reverse effect was noticed. Biofilm production was promoted by sessilin and inhibited by

motilin (D’aes, 2012). In addition, D’aes et al. (2011) demonstrated a remarkably higher

production of phenazines compared to the wild type by sessilin-deficient mutants and this

should be taken into account during further experiments.

Phenazines consist of a large family of heterocyclic nitrogen-containing molecules (Mavrodi

et al., 2006; 2013). They have been identified as brightly coloured pigments with broad-

spectrum antibiotic activity and broadly described as an essential factor in the biocontrol of

plant soil-borne pathogens (Thomashow and Weller, 1988; Chin-A-Woeng et al., 2003;

Mavrodi et al., 2006; D’aes et al., 2010). The most common phenazines are pyocyanin,

phenazine-1-carboxylic acid (PCA) and phenazine-1-carboxamide (PCN); the last two are the

main phenazine produced by CMR12a. The mechanisms performed by these phenazines are

poorly understood although hypothesis is that they would act as a reducing agent, and thus

decoupling the oxidative phosphorylation and consequently generating toxic superoxide

radicals and hydrogen peroxide (Chin-A-Woeng et al., 2003). Also biofilm-formation was

shown to be promoted a little by phenazines (D’aes, 2012; Maddula et al., 2006; Ramos et

al., 2010). In biocontrol pseudomonads, both phenazines and the cyclic lipopeptides are

regulated by the two-compound GacS/GacA system, which is known as the main regulatory

system for the synthesis of secondary metabolites (Mavrodi et al., 2006; D’aes et al., 2010).

Additionally, the interaction between CLPs and phenazines, in relation to the virulence of

pseudomonads, should be taken into account. Perneel et al. (2008) measured a synergetic

effect of the combined component because CLPs enhance solubility and increase absorption

16

of phenazines. Nevertheless in the control of root rot on bean by CMR12a no more than an

additive effect could be detected (D’aes et al., 2011)

For the identification of the novel Pseudomonas CMR12a, Perneel and colleagues (2007)

employed SDS-Page and 16S rDNA sequencing techniques. Unfortunately, no satisfactory

identification could be achieved, although, due to high similarity of 16S rDNA sequence, they

were able to include CMR12a into the Pseudmonas putida group (Anzai et al., 2000; Perneel

et al., 2007; Mavrodi et al., 2010). Recently, during an attempt to disentangle the

evolutionary web of the insect toxin FitD, striking discoveries had been made concerning

Pseudomonas CMR12a (Ruffner et al., unpublished). First, after PCR amplification from all

involved pseudomonads, only the newly nominated protegens group, chlorororaphis group

(Loper et al., 2012) and CMR12a showed positive results for the Fit-toxin locus. Intriguingly,

Pseudomonas CMR12a could not be included in neither of both groups. Although previous

observations separated CMR12a to the putida group, the study by Ruffner et al.

(unpublished) indicated a higher identity similarity of specific housekeeping genes towards

the P. protegens group. Eventually CMR12a was considered belonging to a phylogenetic

distinct group. Additionally, unlike the other strains carrying a fit gene, CMR12a does not

produce DAPG and PLT (Perneel et al., 2007).

Secondly, further analysis of the fit locus in CMR12a, resulted in an interesting hypothesis

linking the fit gene with the Mcf1 insect toxin gene of Photorhabdus spp. The genomic

analysis consisted of a comparison of the evolutionary changes in horizontally and vertically

transmitted genes. A high number of substitutions in synonymous sites is found for vertically

transmitted genes in comparison to horizontally transmitted genes. This strategy was

applied on the fit loci of the different Pseudomonas groups and the mcf1 gene of

Photorhabdus spp. The ratio (dS) was calculated between the fitD/mcf1 gene and

housekeeping genes. The dS was considerably higher intraspecies in relation to interspecies

(Ruffner et al., unpublished). There were significantly less substitutes for mcf1/fitD than for

the housekeeping genes (Ruffner et al., unpublished). This strongly indicated horizontal

transmission. To determine the direction of the transmission the GC content of the

insecticidal toxin gene was compared to average GC content. Results then showed a

considerable difference in GC content between the mcf1 gene and the average GC content,

17

while the pseudomonads did not differ much. Hypothesis was then formulated that the mcf1

gene from Photorhabdus species is probably horizontally transferred, most likely by a

Pseudomonas spp. or yet unknown intermediate vector (Ruffner et al., unpublished).

2.2.4 Pseudomonas cichorii

Unlike previously described bacteria, not all pseudomonads are beneficial to plants.

Pseudomonas cichorii is a leaf pathogen part of the syringae-group (Anzai et al., 2000). It

induces apoptotic cell death which leads to bacterial rot or soft rot in a broad range of host

crops including ornamentals, grasses and vegetable plants (Aysan et al., 2003; Maringoni et

al., 2003; Kiba et al., 2006; Hojo et al., 2008). It is also the major causal agent for midrib rot

in butterhead lettuce in Belgium (Cottyn et al., 2009; Pauwelyn et al., 2011). Dark brown to

black green discoloration and rotting of the inner head leaves are typical symptoms of

midrib rot. Crops become infected by contaminated seed, infected crop-residuals from

previous cultivation, weeds or by contaminated irrigation water (Pauwelyn et al., 2011).

Many plant-associated, mostly plant-pathogenic, Pseudomonas spp. are known to produce

lipopeptide phytotoxins (Bender et al., 1999). These characteristic CLPs allow Pseudomonas

spp. to interact with many different environments. Seven lipopeptides have been discovered

to be synthetized by P. cichorii, such as the cichopeptins and cichofactins (Pauwelyn, 2012).

Cichopeptins are corpeptin–like compounds of which the function has not yet been

unraveled (Pauwelyn, 2012). Cichofactins A and B are linear lipopeptides with a linear lipid

chain (10 C and 12 C) linked to a peptide of 8 amino acids (Pauwelyn et al., 2013). Recent

study demonstrated the role of both lipopeptides in the swarming ability, biofilm production

and virulence of P. cichorii SF1-54 (Pauwelyn et al., 2013). A deletion mutant in cifAB of the

bacterium was constructed. The cifAB-deletion mutant was impaired of swarming motility,

but had an enhanced biofilm production. Besides, the chicofactin-deficient mutant also

exhibited reduced virulence and caused less rotten midribs compared to the wild type.

However, it is not clear whether lipopeptides produced by P. cichorii are regulated by the

GacS/GacA regulatory system or not. Because not all pathogenicity factors are solely

regulated by GacS/GacA, but also other virulence mechanisms exists such as the type III

secretion system, TTSS (Hueck, 1998; Galán and Collmer, 1999; Cornelis and Van Gijsegem,

2000). This syringe-like mechanism is required in many circumstances for the translocation

18

of virulence factors directly into the cytosol of eukaryotic cells. TTSS is also reported to, aside

causing disease, instigate a hypersensitive respons (HR) in plants. In the case of P. cichorii a

site specific hrpL-deletion mutant of SF1-54 was created (Pauwelyn, 2013). The hrc/hrp

regulates the production of the TTSS proteins. Consequently, the hrpL-deletion mutant

retained its pathogenicity on butterhead lettuce, but this does not exclude importance of

the TTSS in other virulence pathways such as towards animals, and more specifically insects.

Interestingly there are also traces of insecticidal activity by P. cichorii. In the study by

Robinson (2011) P. cichorii was selected due to its efficient cultivation in vitro and flexibility

towards mutagenesis. The wild type of P. cichorii caused approximately 76% mortality in

comparison with 10% with sterile water. Afterwards the bacterium was subjected to the

creation of a mutant library. Of the 912 mutants obtained, 105 appeared to cause reduced

mortality. Repeats and further investigation enabled the researcher to isolate 18 mutants

which significantly increased Galleria mellonella survival rate. To identify the transposon-

insertion mutants, a PCR was performed and the results were blasted for homologous genes.

Unfortunately, no putative genes encoding for insect-toxins were discovered, although the

homologous genes showed evidence of chemotaxis and motility to be key for the

pathogenicity of the bacterium. Robinson discovered that a methyl-accepting chemotaxis

protein-deficient (MCP) mutant showed reduced insecticidal activity. MCPs are

transmembrane proteins that allow bacteria to detect extracellular concentrations and

consequently swim towards rising levels of attractants (i.e. nutrients) or away from

repellants (i.e. toxins).

2.2.5 Novel Nigerian fluorescent pseudomonads NNC1-NNC8, NSE1-NSE5

From a screening of healthy cocoyam located nearby areas infected by Cocoyam Root Rot

Disease (CRRD), a oomycete pathogen from cocoyam, pseudomonads were collected from

the rhizosphere and found to exhibit antifungal control (Olorunleke, personal

communication). All strains belong to the P. putida group. The Pseudomonas strains NNC1 to

NNC8 were isolated from cocoyam cultivated in tropical savanna zone (7 months rainfall/yr).

The NSE strains were collected from an oil-producing region in the tropical rainforest (9

months rainfall/yr), exposed to frequent flooding. From all strains NNC3, NNC5b, NNC6,

19

NNC7, NNC8 and NSE1 were discovered to produce cyclic lipopeptides that showed

antagonism against several fungal pathogens (Olorunleke, personal communication).

2.3 Model insects

2.3.1 Galleria mellonella

Thanks to the rearing with little effort, the easy handling and the typical immune system,

Galleria mellonella L., or greater wax moth, has become a model organism for in vivo

pathogenicity testing of microbial pathogens. Understanding the insect’s immune system is

of key importance to designing more effective methods or evaluating novel insecticides

(Clarkson and Charnley, 1996, Kavanagh and Reeves, 2004). Moreover, G. mellonella proved

to be a potent alternative to animal testing after the homology between the insect and

mammalian innate immune system had been recognized (Salzet, 2001)

The cellular immune systems provide three types of defense mechanisms after infection

(Kavanagh and Reeves, 2004). Phagocytosis executed by specific haemocytes is very similar

to the mammalian phagocytosis. Particles accumulating after infection with the pathogens

are recognized and after an intracellular cascade, the foreign bodies are being incorporated.

A enzymatical demolition follows afterwards. Other mechanisms of haemocytes to counter

invading microorganisms are the nodulation and encapsulation. Encapsulation mostly

targets larger structures. Haemocytes surround the invader and aggregate.

Humoral immune systems support the insect’s defense substantially. The polymerization of

clottable proteins present in the haemolymph or released by haemocytes tries to immobilize

microbes. A typical symptom of infected larvae is the black discoloration. Melanization is

responsible for this effect. Deposition of melanin on the microbe is an important mechanism

against a wide range of pathogens. An inactive form of the enzyme responsible for the

synthesis of melanin is present in haemocytes (Ratcliffe, 1985; Soderhall and Cerenius,

1998). After rupture, the enzyme is released and actively transported to the cuticle

surrounding the wound. Cleavage by a protease activates the enzyme and formation of

melanin by oxidation and polymerization of phenols follows. The melanin then reacts with

molecules on the foreign surfaces leading to its immobilization.

20

2.3.2 Spodoptera littoralis

Spodoptera littoralis (Boisduval) is a very polyphagous lepidopteran which infests a large

range of economically important crops such as corn, cotton, tomato, pepper, rice, tobacco,

etc. (HYPP INRA, 2013) The insect originates from the northern part of Africa, but its

distribution is expanding. Although several Spodoptera spp. are considered as quarantine

organisms in the European Union (EPPO A1 list and A2 list), farmers from the Mediterranean

area regularly encounter S. littoralis, mainly in greenhouses (EPPO, 2013). Considering S.

littoralis into pathogenicity assay would add valuable information due to the economic

importance of the insect.

21

3. MATERIALS AND METHODS

3.1 Materials

3.1.1 Media

In order to decide which medium is more appropriate for the bacteria tested, both ‘King’s B’

(KB) and ‘Luria-Bertani’ (LB) media were used for bacterial growth and subsequently used in

a virulence assay. KB was prepared as described by King et al. (1954). The media were

autoclaved during 21 minutes at 121°C and 103.4 kPa. Eventually LB (Sambrook & Russell,

2001) served as growth medium for conservation plates as well as for overnight liquid

cultures. Cell suspensions were diluted in potassium phosphate buffers (PB, 50 mM, pH = 7)

to stabilize their environment during the length of the experiment. Formula 1 was used to

standardize concentrations at 620 nm for Pseudomonas cichorii and mutants and formula 2

for Pseudomonas sp. CMR12, mutants and Nigerian strains.

( ) (formula 1) ( ) (formula 2)

3.1.2 Bacteria and culture conditions

To function as P. cichorii representatives, the Belgian strain SF1-54 and strain NCPPB 907

were selected. P. cichorii NCPPB 907 is also the bacterial strain used in the thesis of Robinson

(2011) to which the insecticidal features were attributed. P. cichorii SF1-54 is the highly

virulent causal agent of midrib rot isolated in Belgian glasshouse-cultured butterhead lettuce

(Cottyn et al., 2009; 2011). The disease suppressive bacterium Pseudomonas CMR12a, which

through genome comparison was proven to possess a gene of a large insect-toxin named

FitD, was chosen for the experiments and its derived mutants were included. All strains are

listed in Table 1.

22

To conserve and maintain the Pseudomonas spp. and their mutants, the bacterial strains

were routinely refreshed and grown on LB plates during 24 h at 28°C. Afterwards, the plates

were placed in a refrigerator at 4°C. For the experiments, tubes containing 3 ml of LB broth

were inoculated with the appropriate bacterium. The tubes were then placed overnight on

an orbital shaker at 28°C at 150 rpm.

Table 1: List of all bacterial strains, plasmids and primers used in this study

Name Description Reference/Source

Pseudomonas cichorii NCPPB 907 Wild type strain, Nif

R (Robinson, 2011)

907-MCP::Tn5 Insertion mutant strain for methyl-chemotaxis protein, NifR (Robinson, 2011)

907-MCP::Tn5(pMCP) Complement strain of 907-MCP, NifR, Gm

R This study

SF1-54NalR Wild type strain, Nal

R (Cottyn et al., 2011)

SF1-54-cifAB Cichofactin deficiënt-mutant of SF1-54 (Pauwelyn, 2012)

SF1-54-cipA Cichopeptin deficiënt-mutant of SF1-54 (Huang et al., unpublished)

SF1-54-cifAB-cipA Deletion mutant of SF1-54 deficient for cichopeptin and cichofactin

(Huang et al., unpublished)

SF1-54-gacS Mutant strain in GacS regulator (Huang et al., unpublished)

SF1-54-hrpL HrpL-deletion mutant of SF1-54 (Pauwelyn, 2012)

Pseudomonas spp. CMR5c Wild type strain (Perneel et al., 2007) CMR12a Wild type strain (Perneel et al., 2007) CMR12a-CLP1 Mutant strain in sessilin production, insertion in CLP1

biosynthesis genes GmR

(D’aes et al., 2011)

CMR12a-CLP2 Mutant strain in motilin production, GmR (D’aes et al., 2012)

CMR12a-CLP1-CLP2 Mutant strain in both CLP1- and CLP2- production (D’aes et al., 2012)

CMR12a-Phz Phenazine-deficient mutant strains; deletion in Phz biosynthesis operon

(D’aes et al., 2011)

CMR12a-GacA Spontaneous mutant strain in GacA regulator (Pham et al., 2008)

NNC1, 2 ,3, 4, 5, 5b, 6, 7, 8

Wild type strains (Olorunleke et al., unpublished)

NSE1, 2, 3, 4, 5 Wild type strains (Olorunleke et al., unpublished)

Escherichia coli

E. coli S17-1 Chemical competent cells for plasmid insertion through conjugation

(Simon et al., 1983)

Plasmid pBBR1MCS-5 Vector used for complementation , Gm

R (Kovach et al., 1995)

Primers (5’3’) MCP-F CCGAAGCTTCAACGAAAGCCAGGCCGACCTTG This study MCP-R CCGCTCGAGTTTGTCCGCGAGCCAAGCCTG This study Pmcfecofw AACACCAGTTGAGCAGCCAGTGGATACCGA Péchy-Tarr et al., 2008 Pmcfevorev TGGTAGGCCTTGTCCAGGGTGTCGAAGTAA Péchy-Tarr et al., 2008

23

3.1.3 Insects

3.1.3.1 Rearing of Galleria mellonella

To maintain a population of Galleria mellonella under laboratory circumstances an artificial

diet is required. In the Laboratory of Agrozoology of Ghent University a modification of the

diet proposed by Balasz (1985) is used. The separate ingredients with corresponding

quantities are shown in Table 2. The last 4 ingredients are mixed in a large bowl. The first 4

ingredients are heated beforehand. If the beeswax is melted entirely, the liquid can be

added carefully to the solid blend. The ingredients are mixed thoroughly and kneaded into

“bread” loafs immediately. The loafs are cooled down for a half day before being stored in a

sealed recipient to avoid dehydration and placed in the refrigerator. Slices of 2 to 4 cm can

be fed to the larvae.

Table 2: Ingredients needed for the artificial diet of Galleria mellonella

Ingredient Quantity

Glycerol 500 ml

Beeswax 500 g

H2O 250 ml

Liquid honey 250 g

Wheat grain/flour mix 1750 g

Sugar 750 g

Brewer’s yeast 150 g

Powdered milk 500 g

Once the rearing system for G. mellonella is set up, it does not require much effort to

maintain. A glass aquarium measuring approximately 50 x 30 x 25 cm shelters the adults.

Substrate containing the pupae are placed inside and the aquarium is closed with a lid

consisting of a wide mesh screen. Then a fine mesh textile screen and a sheet of paper are

placed on top of the lid (Figure 1). Through the fine mesh the adults can bore their ovipositor

and lay eggs on the paper. On top of all, a board serves as counterweight to offer some

resistance during oviposition and to avoid escaping. Every 4 to 5 days the sheet of paper

containing the eggs is collected and replaced. With this method, an aquarium can shelter

more or less 100 adults over a period of 1 to 1.5 months.

24

Figure 1: Illustration of components necessary for rearing of Galleria mellonella; a: transparent aquarium covered with lid with metal grid, textile and paper. Inside pupae are placed. Resulting adults can be maintained in the aquarium during

1 month; b: boxes with hatched eggs and feed are stored on top of each other and placed in a tray with water to keep larvae from escaping; c: Double sided box for larvae and feed with ventilation holes.

When the papers are gathered, they can be cut into smaller pieces containing eggs and put

in a plastic box. The lid of the box holds ventilation openings sealed with a fine metal grid

(Figure 1). A small slice of diet is added with the papers. The box goes then in a well heated

incubation room (>25°C) with a photoperiodic regime to 16 L:8 D (light-darkness). After one

week, the very small first-instar larvae hatch out and start consuming the feed. Once a

sufficient amount of larvae have hatched, the box is translocated to another incubation

room with lower temperatures of 23°C to 25°C. Every two to three days, maintenance of the

boxes is necessary. The larvae live in a substrate composed of their excrements and silk,

where will also pupate eventually. If a box contains too many larvae, population should be

split into two boxes. Per clean box a new slice of feed is added in proportion to the

population size. If condensation occurs it means the boxes are overcrowded and they should

be split or the ventilation holes are blocked. Condensation increases the risk of fungal

growth and eventually decreases the quality of the larvae. When storing the boxes again,

they are placed in a tray filled with water (Figure 1). The water surrounding the rearing

containers assures no G. mellonella larvae escape during the rearing. When stacking the

boxes a lid of a Petri-dish is recommended to be placed between the boxes to prevent

blocking the air circulation.

25

3.1.3.2 Rearing of Spodoptera littoralis

For an ideal growth of Spodoptera littoralis under laboratory conditions, environmental

parameters have to be adapted to the specific requirements of the insect. The temperature

is set to 25±1°C, relative humidity to 70±5% and the photoperiodic regime to 16 L:8 D. Adult

moths are kept in Plexiglas containers (25 cm x 25 cm x 38 cm). The lid has a large opening

sealed with a loose veiling allowing air to circulate sufficiently and avoid escaping. Adults are

fed a 2 % honey water solution. To recover eggs, paper is attached to the sides of the

container. Folded paper in the center also allows egg deposition as the moths prefer laying

eggs in shade.

Table 3: Recipe for the Spodoptera littoralis artificial diet

Ingredient Quantity

Water 2600 ml

Agar 38 g

Sorbic acid 8 g

Nipagin 4 g

Polenta (cornmeal) 300 g

Wheatgerm 120 g

Brewer's yeast 100 g

Casein 20 g

Wesson's salt mixturea 14 g

Ascorbic acid (vit. E) 18 g

Vitamin mixtureb 80 µg

a Wesson’s salt mixture contains: CaCO3 1,55 g, CuSO4_5H2O 0,0029 g, FePO4 0,1103 g, MnCl2

0,0015 g, MgSO4 0,675 g, KAI(SO4) 0,0007 g, KCl 0,9 g, KH2PO4 2,325 g, KCl 0,0038 g, NaCl 0,785 g, NaF 0,0043 g, Ca3(PO4)2 1,12 g. b Vitamin mixture is detailed in Table 4

Once the eggs are harvested, they are sterilized in 10% formaldehyde fumes during 20

minutes and placed in small boxes (20 cm x 15 cm x 5 cm), closed with a half-open lid sealed

with paper tissue. After four days the first caterpillars hatch from the eggs. The caterpillars

are then transferred with a soft paintbrush to a larger container (12 cm x 20 cm x 30 cm)

capped by a veiling tied with an elastic band. The larvae feed on an artificial diet based on

the diet described by Hoffman and Lawson (1964). In the Laboratory of Agrozoology, Ghent

26

University, the recipe is slightly modified. Agar is added to boiling water. Before completing

the mixture with the other ingredients as indicated in Table 3 and Table 4, the water

temperature should decrease to about 60°C so the vitamins would not be destroyed. All

ingredients are mixed thoroughly with a blender. Food in the boxes should be refreshed

daily and, if necessary, boxes should be cleaned.

Table 4: Proportions of vitamin mixture

Vitamin Proportion Thiamine (vit. B1) 0.23

Riboflavin (vit. B2) 0.5

Niacine (vit. B3) 1

Pantothetic acid (vit. B5) 1

Pyridoxin (vit. B6) 0.23

Folic acid (vit. B9) 0.02 Biotin (vit. H)

0.02

When the caterpillars reach their last stages (L5 and L6 stadium), they are moved to an open

container filled with dry grass. This permits the caterpillars to hide and moult into pupae.

The pupae are then collected, sterilized with 10% formaldehyde fumes and placed in a Petri-

dish for incubation. When the first adults appear, the pupae are placed in the large Plexiglas

container to repeat the cycle. During every step the population should be kept at low density

to avoid cannibalism and spreading of diseases.

3.2 Methods

3.2.1 Virulence assays

3.2.1.1 Injectable toxicity

To examine the effect of the wild type strains and the mutants, a virulence assay was carried

out. The injectable toxicity of a test organism is tested after injection of the microorganism

into the insect body cavity (hemocoel). The larvae are best inoculated between the two last

proleg pairs (Kavanagh and Reeves, 2004). The base of the prolegs can be separated by

applying gentle pressure at the sides of the insect and after the injection, the wound will

27

reseal after releasing the larvae. To perform the injection on the Galleria mellonella larvae a

27 G 3/4” 0.4 mm x 19 mm needle (BD Microlance) was used on a 1 ml syringe (BD Plastipak).

Each larva is injected with 10 µl of the solution. The bacterial suspension is prepared from an

overnight culture (at 28°C). To separate the bacteria from the supernatant, they are

centrifuged during 5 minutes at 3000 rpm. After resuspending the pellet in sterile PB, the

different investigated strains are set to equal concentrations by measuring the OD at 620 nm

and diluting the initial solution. To validate, the assay was always accompanied with an

injection of the sterile buffer or medium as a negative control (Kavanagh and Reeves, 2004).

A party of “uninoculated” larvae was kept as an additional control to exclude death due to

other causes than the injection. The larvae are handled with care to avoid expression of

stress proteins (Kavanagh and Reeves, 2004). After the injection, the G. mellonella are held

individually in a Petri-dishes of 6 cm diameter. Varying with the tests and depending on the

availability of larvae, several replicates were done. In general one treatment involved 30

replicates. For the length of the experiment, the larvae are stored in the incubation room at

ambient temperature between 25°C to 27°C.

To standardize testing, an experiment including bacteria grown overnight in both LB and KB

media and with only culture filtrate was executed on G. mellonella larvae, so any effect from

the medium could be excluded. Tubes with 3 ml of both KB and LB broth were inoculated

and put in the shaker overnight. The culture was separated from the medium after

centrifugation and set to the desired concentration. The residue after the centrifugation was

filtered with a 0.22 µm Millex GP filter unit to sterilize the solution entirely. This solution is

most likely to contain a variety of secondary metabolites synthesized overnight. Both the

diluted culture and the culture filtrate were then injected.

In order to optimize future experiments, the influence of dose concentration and growing

medium was evaluated beforehand on G. mellonella larvae. After centrifugation at 3000 rpm

for 5 minutes, the pellet of bacteria was resuspended in sterile potassium phosphate buffer

(PB). The bacterial suspension was optically adjusted to make up a dilution series of 3

concentrations from 1 x 109 CFU/ml to 1 x 107 CFU/ml for P. cichorii strains SF1-54, NCPPB

907 and 907-MCP. Due to a different formula used to calculate the optical density, the series

for Pseudomonas CMR12a was set up as 8 x 108 CFU/ml, 8 x 107 CFU/ml, 8 x 105 CFU/ml, 8 x

28

104 CFU/ml or 8 x 103 CFU/ml. As a negative control, larvae were injected with sterile

phosphate buffer.

3.2.1.2 Oral toxicity

To examine the oral toxicity, test insects are provided with food inoculated with the

bacterial suspension under investigation. Because the diet given to G. mellonella contains a

low amount of moisture, it will not lend ideally for inoculation and survival of bacteria and

thus an alternative for oral toxicity assays was sought. Several reports (Ruffner et al., 2012)

established S. littoralis oral toxicity trials and demonstrated reliable results. The aggressive

feeding nature denoting the economic importance of the insect, allows assays to be

performed commendably as the caterpillars devour the wet, agar-based diets rapidly and

completely. During this research S. littoralis caterpillars are placed individually in a small

Petri-dish (6 cm diameter) together with an artificial food pellet of 0.5 ± 0.1 cm² and 1 ± 0.1

g. This food pellet is then inoculated with 20 µl bacterial suspension of 5 x 107 cfu/ml (i.e. 1 x

108 cfu/pellet). After two days the Petri-dishes are cleaned with filter paper to remove

moisture and excrements. Afterwards fresh non-treated food is provided to the caterpillars.

3.2.1.3 Scoring

The scoring of treatment effect on G. mellonella after the virulence assays was done by

visual observations based on their color and movement after applying an external physical

stimulus. The external stimulus was done after pressing a needle or tweezers gently on the

caterpillar’s head (cephalon). Healthy larvae remain white-yellow colored and react heavily

to physical stimulation. Infected larvae discolor from spotted or light brown to entirely dark

brown. Sick larvae still move but only react softly to the stimulus. Dead insects stay

motionless and are colored dark brown to black (Figure 2)

Figure 2: Reference for scoring Galleria mellonella after injection; a: healthy white-yellow colored moving larvae; b: sick, slightly discolored moving larvae; c: dead, entirely brown or blackened motionless larvae

29

To evaluate S. littoralis trials, only healthy and dead caterpillars could easily be distinguished

due to their natural low activity and dark colored cuticle. However if a larva died, its

appearance discolored to dark-green or black and it lost its body turgor entirely. Occasionally

the cadaver is covered in a mucous substance. To verify, reaction to poking with tweezers or

needle was still done.

3.2.2 PCR procedure and DNA analysis

In order to confirm the presence of the locus encoding for the insecticidal toxin FitD, a

colony PCR was executed. The PCR method corresponds with a standard procedure for

colony PCR (Sambrook & Russell, 2001). Pmcfecofw and Pmcfecorev primer pair will isolate

and multiply any fitD locus (Péchy-Tarr et al., 2008). For PCR preparation a GoTaq DNA

Polymerase kit (Promega, Leiden, NL) was utilized. The protocol consisted of 30 cycles of 1

minute at 94°C, 1.5 minute at 56°C and 1 minute/kb at 72°C. 10 minutes at 94°C before and

72°C after the 30 cycles started and ended the protocol. The PCR product was run through a

gel according to standard gel electrophoresis technique.

Amplified fragments were then purified using the Omega Bio-Tek cycle-pure kit (Omega Bio-

Tek, Norcross, USA) according to the E.Z.N.A. Cycle Pure Kit centrifugation protocol. The

nucleotide sequences were determined at the laboratories of LGC genomics (LGC Genomics

GmbH, Berlin, GER)

3.2.3 Construction of complement strain of Pseudomonas cichorii 907-MCP::Tn5

To complement P. cichorii 907-MCP mutant, we used a standard technique to construct a

plasmid carrying MCP gene (pMCP). Both the MCP gene fragment and the pBBR1MCS-5

plasmid are cut with HindIII and XhoI restriction enzymes and ligated. The ligated product

was introduced into E. coli S17-1 by heat shock at 42°C for 90 to get E. coli S17-1

transformants carrying recombinant plasmids. The plasmid pMCP was confirmed by

restriction enzyme mapping and PCR. Afterwards P. cichorii 907-MCP::Tn5 cells were

conjugated with E. coli S17-1(pMCP) on a LB plate at 28°C for 24 hours and transconjugants

were screened on KB plates with 20 ppm gentamycin. After 48 hours, colonies were picked

30

and streaked on fresh KB plate with 20 ppm gentamycin and 100 ppm nitrofurantoin to

select for the newly constructed complement strain 907-MCP::Tn5(pMCP) and eliminate E.

coli.

3.2.4 Bacterial colonization

An increased bacterial presence inside G. mellonella after injection would indicate a

successful bacterial colonization. To observe the bacterial development, concentrations in

the larvae were determined two days post inoculation (2 dpi). Bacterial cell suspension of

8000 cfu/ml was prepared and injected with 10 µl in G. mellonella final instar larvae. After a

period of 48 hours, 100% mortality occurred and 5 larvae were randomly chosen. With a

sterile mortar and pestle the larvae were macerated in sterile potassium phosphate buffer

until a homogeneous blend was obtained. Dilution series were prepared from the mixture

and streaked on LB plate containing 100 ppm nitrofurantoin to select for pseudomonads

(Gillman et al., 2002). Larvae injected with sterile PB were included to act as a negative

control and to exclude populations indigenous to the insect’s bacterial community.

3.2.5 Statistical analysis

The first step of the statistical analysis was to transform the visual scoring of the toxic effect

on the exposed caterpillars into numerical values. Depending on the desired outcome two

scoring methods are were applied. When mortality of G. mellonella or S. littoralis was

scored, the values only deviated between 0 and 1 so binary analysis could be implemented

(mortality-scoring system). When the rate of the disease was to be included in the tests a

more extensive scoring method was applied. If differences between sick, healthy and dead

larvae could be seen adequately, which was only the case for G. mellonella, three scores

were used: 0 for healthy, 1 for sick, 2 for dead (“disease-scoring” system).

Scores obtained after tests were processed using the statistical program SPSS Statistics 21

for Windows (IBM Corporation, Armonk, New York). No data found met the conditions of

normality and homogeneity of variances, consequently non-parametric tests were

performed. At specific time points, different data were compared by a non-parametric test

of 2 independent samples followed by a Mann-Whitney comparison to determine

31

significance. All significance levels were accepted at a confidence interval of 95% (alpha ≤

0,05).

With pre-set procedures in SPSS, the best fit for mortality curves could be estimated using

Hosmer & Lemeshow Goodness of Fit. LD50-values were calculated with probit analysis. At 22

hours post inoculation different lethal doses were determined. Mortality of larvae from the

control treatment group never exceeded 5% in all assays. Further LT50 values were estimated

using survivorship analysis (Kaplan-Meier) at different concentrations.

32

4. RESULTS

4.1 Pseudomonas cichorii

4.1.1 Introduction

In order to assess the insect toxicity of Pseudomonas cichorii strains SF1-54 and NCPPB 907

we performed several virulence assays on Galleria mellonella larvae. NCPPB 907 is a P.

cichorii strain with known insect toxicity (Robinson, 2011). In a mutant screen performed by

Robinson (2011), the MCP-mutant of NCPPB 907 (NCPPB 907-MCP::Tn5) showed a reduced

effect against G. mellonella larvae, revealing an important role of MCP in insect toxicity.

The SF1-54 strain can cause midrib rot on butterhead lettuce in Belgium (Cottyn et al., 2009).

Several virulence factors produced by strain SF1-54, such as cichofactins and cichopeptins,

have been described as playing an important role in the disease development (Pauwelyn,

2012; Pauwelyn et al., 2013). Up to date only cichofactins (cif) were demonstrated to be

involved in swarming ability, biofilm production and virulence (Pauwelyn et al., 2013). The

importance of cichopeptins is on-going studied. The production of both cichofactin and

cichopeptins could be regulated by GacS/GacA regulatory system. Another common protein

complex in many Gram negative bacteria, also in Pseudomonas cichorii sp., is the type III

secretion system (TTSS). In many cases, a TTSS has been shown to be of key importance in

the virulence of the bacteria towards their host (Hensel et al., 1998, Coburn et al., 2007). In

P. cichorii the TTSS is regulated by the alternative sigmafactor HrpL.

In this study, we wanted to confirm the insect toxicity and the importance of MCP to the

toxicity of NCPPB 907 towards G. mellonella. Secondly we tried to unravel more about

secondary metabolites and regulatory systems involved in the insecticidal activity of SF1-54

towards Galleria wax moth larvae.

33

4.1.2 Effects of culture media of P. cichorii against G. mellonella

To optimize the toxicity assays, several trials were performed with different culture media.

Each bacterial strain was grown overnight in KB and LB broth medium. The procedure for an

injectable toxicity assay was followed with a bacterial suspension standardized to a 10-fold

dilution of an overnight concentration: 1 x 108 cfu/ml or 1 x 106 cfu/larva. Since the trial was

only for preliminary test for screening, only 10 replicates were performed. Although no

significant differences could be found individually, the average total number of surviving G.

mellonella larvae was significantly higher for KB than LB (Table 5). We therefore compared

effects from all bacteria grown in LB to the effects from all bacteria grown in KB (except the

Mock treatment). Based on this preliminary test that bacteria grown in LB medium showed

higher insecticidal activity than bacteria grown in KB, we decided to culture P. cichorii in LB

liquid medium.

Table 5: Number of surviving G. mellonella larvae per treatment of bacterial suspension grown overnight in different

media (KB and LB) at 1 day post inoculation. A star (*) indicates a significant differences according to the Mann-Whitney non-parametric test using P≤0.05 (n=10 individually; n=30 on total).

Day 1

LB KB

Mock 10/10 10/10

SF1-54 7/10 9/10

907 7/10 8/10

ΔMCP 6/10 10/10

Total 20/30 27/30 *

4.1.3 Insect toxicity of P. cichorii after injection in G. mellonella

We investigated whether or not a dose-dependent effect exists for P. cichorii. Wax moth

larvae were injected with bacterial suspensions at final concentrations of 1 x 106 cfu/larva, 1

x 105 cfu/larva and 1 x 104 cfu/larva (20 larvae per treatment), according to the standard

injectable toxicity procedure. Survival rate was monitored after 1, 2 and 3 days using the

mortality-scoring system. The wild type strains SF1-54 and NCPPB 907 and the MCP mutant

of strain NCPPB 907 were included in the dilution series. At none of the inspection times

100% mortality was reached (Figure 3). At the lowest concentration (1 x 104 cfu/larva) no

mortality could be observed. At a concentration of 1 x 105 cfu/larva no significant difference

among treatments was found. At the highest concentration of 1 x 106 cfu/larva, the results

34

let us observe differences amongst the treatments. Figure 3 shows that the Belgian wild type

strain SF1-54 is less toxic in comparison to the strain NCPPB 907. At 1 day post inoculation

(dpi) 50% mortality occurred in the collection of larvae injected with NCPPB 907, while no

dead larvae were found injected with SF1-54. The mortality caused by NCPPB 907 leveled at

approximately 60%, meaning that with the applied doses approximately 40% would still

survive. When comparing the NCPPB 907 and NCPPB 907-MCP::Tn5 no significant difference

was found although mortality on day 1 was higher for the wild type than for NCPPB 907-

MCP::Tn5.

A: 1 x 106 cfu/larva B: 1 x 10

5 cfu/larva

Figure 3: Effect of concentration of Pseudomonas cichorii SF1-54, 907, 907-MCP and Mock (negative control) on the mortality of G. mellonella at different time points. Observations were made every 24 hours and rated according to the mortality-scoring system. Two concentrations were included, 1 x 10

6 (a) and 1 x 10

5 cfu/larva (b). The negative control

treatment with phosphate buffer never caused any significant mortality (0%). Significant differences were calculated at P≤0.05 using the Mann-Whitney non-parametric test (data are means, n=20).

A: 1 x 106 cfu/larva in LB B: 1 x 10

6 cfu/larva in PB

Figure 4: Mortality of Galleria mellonella after injection with Pseudomonas cichorii SF1-54, 907, 907-MCP. Observations were made every 24 hours and rated according to the Galleria mortality-scoring system. Two treatments were included of bacterial suspension; One directly diluted from the overnight culture to 1 x 10

6 cfu/insect (a) and one resuspended in

PB to equal concentration of 1 x 106 cfu/insect (b). The negative control treatment (mock) with LB medium (a) or

phosphate buffer (b) never caused any significant mortality (0%). Significant differences were calculated at P≤0.05 using the Mann-Whitney non-parametric test (data are means, n=20).

a

b

ab

a ab'

b' b'

a'

ab"

b" b"

a" 0%

10%20%30%40%50%60%70%

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

day 1 day 2 day 3

Mo

rtal

ity

of

G. m

ello

nel

la

a a a a

a a

a a

a a

a a 0%1%2%3%4%5%6%

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

day 1 day 2 day 3

Mo

rtal

ity

of

G. m

ello

nel

la

bc

c

ab

a

b'

b'

a'

a'

b" b"

b"

a" 0%

20%

40%

60%

80%

100%

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

day1 day2 day5

Mo

rtal

ity

of

inje

cted

G.

mel

lon

ella

ab

b b

a

b' b' b'

a'

b" b" b"

a" 0%

20%

40%

60%

80%

100%

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

day1 day2 day5

Mo

rtal

ity

of

inje

cted

G.

mel

lon

ella

35

To study the effect of culture medium on the toxicity towards G. mellonella, a virulence

injection assay was conducted on 20 wax moth larvae. Bacterial suspension was prepared

from an LB overnight culture. One portion of the trial consisted of bacteria diluted directly

from the overnight culture (Figure 4a), and another part of resuspended bacteria in PB

(Figure 4b). Both suspensions were standardised to 1 x 108 cfu/ml or 1 x 106 cfu/insect. In LB,

a significant difference was found on day 1 and day 2 between NCPPB 907 and NCPPB 907-

MCP::Tn5, but at day 5, effects were no longer significantly different. NCPPB 907 did not

differ significantly from SF1-54 at any time point. In PB all treatment caused similar effects.

Both wild types perfomed worse than in LB while the MCP mutant caused ca. 20% higher

mortality.

A: 106 cfu/larva in LB B: 10

6 cfu/larva in PB

Figure 5: Mean disease-score of Galleria mellonella after injection with Pseudomonas cichorii SF1-54, 907, 907-MCP. Observations were made every 24 hours and rated according to the Galleria disease-scoring system. Two treatments were included of bacterial suspension; One directly diluted from the overnight culture to 10

6 cfu/insect (a) and one

resuspended in PB to equal concentration of 106 cfu/insect (b). The negative control treatment (mock) with LB medium

(a) or phosphate buffer (b) never caused any significant mortality (0%). Significant differences were calculated at P≤0.05 using the Mann-Whitney non-parametric test (data are means, n=20).

We analyzed the data also using the disease-scoring system. No significant differences

among the strains were observed when they were resuspended in PB (Figure 5). However a

significant lag in disease was observed for NCPPB 907-MCP::Tn5 in comparison to both other

wild type strains when diluted in LB broth directly from the overnight culture. A reduction of

ca. 70% of the score is observed when comparing wild type to the MCP mutant on day 1 and

50% on day 2. When proceeding in time, the wild type inflicted more damage than NCPPB

907-MCP::Tn5 until day 5, but differences became smaller. From day 2 on, all treatments

b b

a

a

c' c'

b'

a'

c" c"

b"

a" 0

0,5

1

1,5

2

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

day1 day2 day5

Mea

n d

isea

se-s

core

of

inje

cted

G. m

ello

nel

la

b b b

a

b' b' b'

a'

b" b" b"

a" 0

0,5

1

1,5

2

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

SF1

-54

90

7

90

7-M

CP

Mo

ck

day1 day2 day5

Mea

n d

isea

se-s

core

of

inje

cted

G. m

ello

nel

la

36

differed from the negative control. The two wild types did not differ significantly at any

point. Due to the more apparent differences between the different treatments, the disease-

score system was used during the further progress of this study.

4.1.4 Role of MCP in insect toxicity caused by strain NCPPB 907

To verify whether the reduction in mortality caused by P. cichorii NCPPB 907-MCP::Tn5

mutant is actually linked to the elimination of MCP, we constructed a complement of the

MCP mutant strain carrying the MCP gene again to include into the toxicity assay with wax

moth larvae. This was realized as described previously in paragraph 3.2.3. The toxicity assay

consisted of 30 larvae per treatment which were injected with 10-fold overnight dilution of 8

x 106 cfu/ larva, this in order to observe the effects more rapidly compared to the 1 x 106

cfu/larva. When analyzing the results (Figure 6), the distinctions were again not so clear. The

negative control did not cause any disease compared to the treatments. Injection with the

complemented strain 907-MCP::Tn5(pMCP) caused similar effects as the wild type bacteria

and the MCP mutant as no significant differences between the treatments could be

observed at any of the observation times.

Figure 6: Toxicity assay with Pseudomonas cichorii 907, its MCP mutant (together with suspended plasmid) and the

constructed complement strain injected in Galleria mellonella. After 16, 20 and 24 hours post injection the larvae were scored using the previously described scoring method for Galleria mellonella. The larvae were injected with 8 x 10

6

cfu/insect suspended in LB. A negative control of LB injections was included. Significant differences were calculated at P≤0.05 using the Mann-Whitney non-parametric test (data are mean; n=30).

4.1.5 Role of virulence factors from P. cichorii SF1-54 in the toxicity to G. mellonella

In the case of P. cichorii SF1-54 we decided to check the effect of known virulence factors

and the importance of specific regulatory systems on insect toxicity. We assumed swarming

a

b b b

a'

b' b'

b'

a"

b" b" b"

0

0,5

1

1,5

2

Mo

ck

90

7

90

7-M

cp+P

90

7-M

cp-m

cp

Mo

ck

90

7

90

7-M

cp+P

90

7-M

cp-m

cp

Mo

ck

90

7

90

7-M

cp+P

90

7-M

cp-m

cp

16 hpi 20 hpi 24 hpi

Mea

n d

isea

se-s

core

of

iinje

cted

G.

mel

lon

ella

37

and biofilm production could have an influence on the toxicity of P. cichorii towards target

cells, hence the CipA , CifAB deficient and double mutants were included in the tests.

Additionally two known regulatory systems playing a key role in several pathogenicity

pathways of different Pseudomonas spp. were also examined. All bacteria were cultured in

LB broth overnight and concentration set to 1 x 106 cfu/larva. The G. mellonella larvae were

scored every 24 hours according to the disease-scoring system.

Figure 7: Toxicity assay on Galleria mellonella with Pseudomonas cichorii SF1-54 and different mutant exploring the importance of several virulence factors. Every 24 hours the larvae were scored using the disease-scoring system for Galleria mellonella. The larvae were injected with 10

6 cfu/insect suspended in LB. A negative control of LB injections

(mock) was included. Significant differences were calculated at P≤0.05 using the Mann-Whitney non-parametric test (data are means, n=30).

After one day effects of all treatments were significantly different to the larvae injected with

the negative control. However differences between treatments were less obvious (Figure 7).

The average scores from the different treatments all ranged within a narrow interval of 1.2

to 1.8. Nonetheless the wild type SF1-54, SF1-54-∆cifAB and SF1-54-∆hrpL can be grouped as

showing lower average scores and are significantly different from the group of SF1-54-∆cipA

and SF1-54-∆gacS with higher average scores. SF1-54-∆cifAB∆cipA had an average score in

between the two groups. On the other days the different groups continued showing

significant differences although they were even less apparent. Only SF1-54-∆cipA differs

distinctly from other treatments on day 2 and day 3, showing the highest mortality. None of

the treatments indicated a reduced pathogenicity compared to the wild type.

cd bc

ef

cde

def

bc

a

bcd' cd'

e'

bcd'

cd'

bc'

a'

b" b"

c" b"

c"

b"

a" 0

0,2

0,4

0,6

0,8

1

1,2

1,4

1,6

1,8

2

SF1

-54

Δci

fAB

Δci

pA

Δci

pA

/Δci

fAB

ΔG

acS

ΔH

rpL

Mo

ck L

B

SF1

-54

Δci

fAB

Δci

pA

Δci

pA

/Δci

fAB

ΔG

acS

ΔH

rpL

Mo

ck L

B

SF1

-54

Δci

fAB

Δci

pA

Δci

pA

/Δci

fAB

ΔG

acS

ΔH

rpL

Mo

ck L

B

day 1 day 2 day 3

Mea

n d

isea

se s

core

of

inje

cted

G. m

ello

nel

la

38

4.2 Pseudomonas CMR12a

4.2.1 Introduction

Pseudomonas CMR12a is a bacterium with biocontrol properties isolated from the roots of

red cocoyam in Cameroon (Perneel et al., 2007). The wide array of exoproducts produced by

CMR12a have been suggested to attribute to this biocontrol characteristic. CMR12a

synthesizes biosurfactants and phenazines. Two biosurfactants CLP1 and CLP2 (renamed

sessilin and motilin) regulate biofilm production and swarming ability by the bacteria (D’aes,

2011). The mode of action of phenazines for CMR12a are still unclear, but it shown to

possess anti-fungal activity. In CMR12a both CLPs and phenazines are controlled by the

GacS/GacA regulatory system. In addition CMR12a also carries a gene called fitD, which has

been shown to have insecticidal activity in P. protegens CHA0 (Ruffner et al., unpublished).

4.2.2 Effect of culture media of Pseudomonas CMR12a against G. mellonella

The effect of the medium on CMR12a insect toxicity was tested, following the same

procedure as for P. cichorii. A high dose of CMR12a (106 cfu/larva) was injected into wax

moth larvae. Differences between the media could not be confirmed as at 12 hours after

inoculation no larvae remained alive (data not shown). Hence it was assumed that CMR12a

cultured overnight in both LB and KB was sufficiently active to perform experiments. For

further trails we decided to culture CMR12a in LB broth medium.

4.2.3 Effect of concentration of Pseudomonas CMR12a on insect toxicity to G. mellonella

A dose-dependent relationship was investigated to learn more about the insecticidal

potential of CMR12a. From 12 hpi, scoring of G. mellonella was assessed, taking into account

the sick larvae (disease-scoring system). Each experiment of 30 larvae was injected with 80,

800 or 8000 cfu/ larva. All injections were sufficient to cause 100% mortality at 36 hpi (data

not shown). At lower concentrations, reactions of the larvae were lower and more variable.

According to the results obtained from the virulence assay of both CMR12a wild type (wt)

and CMR12a-ΔGacA we can clearly observe a trend as at higher doses 100% mortality could

be reached within shorter incubation times (Figure 8). Surprisingly the gacA-mutant of

CMR12a showed a higher mortality rate throughout the duration of the whole experiment

39

(Figure 8). Based on the LT50 estimated from the data, an average lead of 2 to 3 hours was

found for the gacA-mutant (Table 6). The LT50 value for gacA-mutants ranged from 18 to 20

hours at 8000 cfu/insect and is estimated as 22 hours at a concentration of 800 cfu/insect.

At a concentration of 80 cfu/insect no LT50 could be estimated since the observations did not

allow a good fit of the probit or logit functions and mortality of 50% was not reached within

24 hpi. LT50 of CMR12a was estimated on 23 hours and 24 hours for injection of bacterial

suspension at respectively 8000 and 800 cfu/larva.

Figure 8: Effect of different concentrations of Pseudomonas CMR12 wild type (a) and gacA deletion mutant of CMR12a

(b) on Galleria mellonella larvae. Observations were held from 12 hours to 24 hours post inoculation and scored

according to the disease-scoring system. Three concentrations were injected from 8000 (dark grey diamonds ), 800 (light grey squares ) and 80 cfu/larva (medium grey triangles). One Mock treatment of PB was included as a negative control (grey circles ). Significant differences were calculated at each time point with P≤0.05 using the Mann-Whitney

non-parametric test (data are means; n=30).

Table 6: Lethal time (hours) for 50% mortality (LT50) of G. mellonella exposed to both CMR12a wild type and CMR12a-

GacA at two concentrations (800 and 8000 cfu/insect), with 95% confidence interval.

cfu/insect LT50 (h) 95% confidence interval

CMR12a 800 24 24 32

8000 23 22 24

ΔGacA 800 22 22 22

8000 20 18 20

When analyzing the lethal dosages for different strains, a similar trend is observed (

Table 7). Approximately twice as many bacteria of CMR12a are needed to obtain 50%

mortality at 20 hpi as for the gacA-mutant: 1.2 x 104 cfu/insect are necessary for CMR12a

and 5.3 x103 cfu/larva for CMR12a-GacA. The value of the LD50 for CMR12 at 22 hours after

injection was estimated to be 7.9 x 103 cfu/insect compared to an approximately 10-fold

lower LD50 for the gacA-mutant, 5.7 x 102 cfu/ insect. To reach 50% mortality after one day

40

1.5 x102 cfu/insect is already sufficient for CMR12a-GacA , while 8.3 x102 cfu/ larva are

needed for CMR12a. Confidence intervals could not always be determined due to low

number concentrations.

Table 7: Lethal dose injected per insect (cfu/insect) for 50% mortality (LD50) of G. mellonella exposed to both CMR12a

wild type and CMR12a-GacA at different hours post injection (hpi), with 95% confidence interval.

Hpi Estimated LD50 Confidence interval

lower upper

CMR12a 20 1.20 x 104 - -

22 7.92 x 103 - -

24 8.32 x 102 - -

CMR12a-GacA 18 8.45 x 103 - -

20 5.28 x 103 4.29 x 103 6.40 x 103

22 5.67 x 102 -1.07 x 102 6.89 x 102

24 1.58 x 102 - -

4.2.4 Insect toxicity of Pseudomonas CMR12a after injection in G. mellonella

Impaired of the production of several virulence factors such as phenazine and the CLPs,

toxicity to G. mellonella was thought to be reduced for CMR12a-GacA. But the dilution

series of CMR12a showed otherwise. A lag in mortality of approximately 2 hours was

observed in comparison to the gacA-mutant. We then compared anti-insect activities of

different mutant strains that do not produce several exo-products like CLP1, CLP1 and Phz

(D’aes et al., 2011; D’aes, 2012). Injection of 8000 cells per Galleria larva kills all insects

within 32 hours. Less than 4% of the negative controls showed indications of illness during

the evaluation period.

41

Figure 9: Distribution of disease-scores from the toxicity assay with Galleria mellonella larvae exposed to Pseudomonas sp. CMR12a and mutants. 30 larvae were injected with 8000 cfu/insect (in PB) and observed after 12 hours during a

period of 12 hours in intervals of 2 hours. Scoring was performed according to the disease-scoring system. The different

mutant treatments included CMR12a-CLP1, CLP2, CLP1-CLP2, GacA and Phz. Larvae injected with sterile PB served as the control treatments. Significant differences were calculated at P≤0.05 using the Mann-Whitney non-parametric test

(n=30)

As shown in Figure 9 strain CMR12a-GacA stands out and causes considerably more sick

and dead larvae more rapidly than the other strains. This higher mortality indicates a

stronger entomopathogenic effect of CMR12a-GacA. At each time point, there were

significant differences between CMR12a-GacA and the wild type and most of the mutant

strains. After 20 hours, the average score of 1.47 was almost double to the average score of

the wild type strain CMR12a (score of 0.8) due to the higher amount of dead larvae. This

observation agrees with the previous results. When injected with the CLP1 mutant, impaired

of sessilin production (D’aes et al., 2012), a delay in affliction was observed compared to the

wild type at 20 hpi and 24 hpi. This may indicate a decrease in toxicity for the CLP1-deficient

mutant. In terms of mortality CMR12a-GacA killed 96.7% of the Galleria larvae after 22

hours while the parental strain and CLP2 mutant only caused 16.7% mortality (equivalent

score of 1.967 for GacA mutant and 1.133 for CMR12a and CLP2 mutant). The other strains,

CMR12a-CLP1, CLP1-CLP2 and Phz showed even a lower score, 0.967, 1.067 and 1.033

respectively. At 24 hpi none of the larvae injected with the GacA mutant survived. Although

when injected with other strains the majority of larvae had gotten sick, a lower numbers of

larvae died (score ranged from 1.8 to 1.75). After one day, the CLP2 mutant could not cause

the same mortality level as the wild type and was significantly lower (1.6). Also the virulence

of CLP1 mutant was notably reduced compared with all strains (to 1.3). All dead larvae had

42

the same floppy symptoms representative for the loss of body turgor and a black melanized

cuticle.

Figure 10: Distribution of disease-scores from toxicity assay on Galleria mellonella injected with culture filtrate. Twenty larvae were included in the test and scored according to the disease-scoring system. Significant differences were

calculated at P≤0.05 using the Mann-Whitney non-parametric test (n=20).

Larvae injected with a culture filtrate could give suggestions concerning exo-proteins

expressed naturally and their anti-insect activity. Although Péchy-Tarr et al. (2008) did not

demonstrate activity of the culture filtrate from P. protegens CHA0, our trials showed

different results for the Pseudomonas CMR12a (Figure 10). Initially the culture filtrate of

both the wild type and the phenazine mutant were toxic for the larvae while GacA was

impaired of its anti-insect trait. However, on day 2, half of the test population did not survive

exposure to GacA culture filtrate. From day 2 on, no more significant differences were

seen. This indicated the slow effect of the components still present in the culture filtrate of

GacA. All treatments differed from the negative control larvae injected with sterile LB,

indicating clearly the existence of molecules in the filtrate interfering with the insects.

4.2.5 Oral insect toxicity of Pseudomonas CMR12a to S. littoralis

Preliminary injection analysis on S. littoralis larvae displayed similar insecticidal activity of

the wild type CMR12a as towards G. mellonella (data not shown). For oral toxicity trails we

used fourth-instar Spodoptera larvae for the practical reasons previously described. Infecting

the larvae was realized through artificial diet pellets inoculated with fresh cultured bacterial

b b b b b b a b b a a a

1dpi 2dpi 3dpi

02468

101214161820

CM

R1

2a

ΔP

hz

ΔG

acA

Mo

ck L

B

CM

R1

2a

ΔP

hz

ΔG

acA

Mo

ck L

B

CM

R1

2a

ΔP

hz

ΔG

acA

Mo

ck L

B

Nu

mb

er o

f in

ject

ed G

. mel

lon

ella

alive

sick

dead

alive

sick

dead

alive

sick

dead

alive

sick

dead

Reeks13

43

suspension at 1 x 108 cfu/pellet. In two experiments with 30 larvae (total of 60 larvae), no

significant differences were found between the treatment and a control of sterile LB. The

mortality-score was always between 0 and 2%. Although CMR12a did not show apparent

oral toxicity towards S. littoralis larvae under our experimental conditions, we still cannot

exclude the oral toxicity of CMR12a to insects.

4.2.6 Bacterial colonization of Pseudomonas CMR12a in G. mellonella

As demonstrated previously, even at doses as low as 80 cfu/insect, and probably also at

lower doses, a 100% mortality against Galleria can be reached (Figure 8). Hence it was

interesting to investigate whether the bacteria could multiply inside the insects host and

thus colonize the insect tissue. One day after infecting the larvae with 8 x 103 cfu/larva, 5

dead specimens were chosen. The population of CMR12a increased with approximately five

log units as compared to initial concentrations to the level of 5.67 x 108 cfu/larva.

4.3 Nigerian strains

4.3.1 Introduction

All Nigerian strains collected from healthy cocoyam roots demonstrated antifungal

biocontrol properties and belong to the P. putida group (Olorunleke, personal

communication). Although originating from similar environments and gathered in same

group, they have very different characteristics. Assessing the insect toxicity of the strains

was thought to be of value in the further characterization of the different strains.

4.3.2 Results

While exploring the biocontrol properties of the novel African strains, we believed it might

be of interest to investigate their possible insecticidal activity. We therefore tested the

different strains at various concentrations through direct injection against Galleria larvae.

Preliminary examinations at very high concentrations (10 fold dilution of overnight culture)

showed varying mortality from different strains (Figure 11). Due to the low number of

replicates (n=5) no conclusive results could be extracted. In accordance with this experiment

we conducted another trial at standardized concentrations suspended in PB (80 cfu/insect

44

and 8000 cfu/insect). In contrast with the previous test at very high concentrations, all larvae

survived infection with the bacteria at low concentration (data not shown). Although at

higher concentration (8000 cfu/insect) not much changed in relation to the lower

concentration, one strain stands out: NSE1 (Figure 12). Infection with CMR12a served as a

positive control and injection with PB as a negative mock treatment. To observe any effects

from NSE1 we need to wait longer than for the more potent CMR12a. Up to day 3, all larvae

survived inoculation by NSE1. Later, the number of living larvae slowly decreased to 11 out

of 15 on day 3, 8 on day 3 and 3 on day 7 when the experiment ended. Other treatments did

not differ significantly from the negative mock injection.

Day 1 Day 2

Figure 11: Number of dead Galleria larvae after injection with CMR12a and several novel African pseudomonads. 5 larvae were injected per treatment with a 10 fold diluted overnight culture of bacteria. Sterile PB was included as a control.

Data is shown per increasing time interval.

Figure 12: Number of dead Galleria larvae after injection with CMR12a and several novel African pseudomonads. 15 larvae were injected per treatment with 8000 bacteria per insect. Sterile PB was included as a control. Data is shown per

increasing time interval.

0

1

2

3

4

5

CM

R1

2a

CM

R5

c

NN

C1

NN

C2

NN

C3

NN

C4

NN

C5

NN

C6

NN

C7

NSE

1

NSE

2

NSE

3

NSE

4

Mo

ck P

B

Nu

mb

er o

f d

ead

G. m

ello

nel

la

alive

sick

dead

0

1

2

3

4

5

CM

R1

2a

CM

R5

c

NN

C1

NN

C2

NN

C3

NN

C4

NN

C5

NN

C6

NN

C7

NSE

1

NSE

2

NSE

3

NSE

4

Mo

ck P

B

Nu

mb

er o

f d

ead

G. m

ello

nel

la

alive

sick

dead

CMR12a

NSE1

Other

NNC1, NNC5, Control

0

2

4

6

8

10

12

14

16

14 hpi 24 hpi 38 hpi 46 hpi 64 hpi 72hpi 4dpi 7dpi

Nu

mb

er o

f d

ead

G. m

ello

nel

la

larv

ae

CMR12aNNC1NNC2NNC3NNC4NNC5NNC6NNC7NNC8NSE1NSE3NSE4NSE5MOCK PB

45

4.4 PCR and sequence analysis

We screened several novel pseudomonad strains to investigate bacteria with putative

insecticidal activity. It was interesting to investigate the existence of fitD gene in the

pseudomonads which were tested. The PCR amplification yielded a single amplicon when

the fitD locus was found in 5 strains. In addition to CMR12a, putative fitD fragment was also

amplified from CMR5c, NNC1, NNC2 and NSE3. The amplicons from those strains together

with NNC3, NNC6, NSE2 and NSE5 were purified and sent for sequencing. After sequencing,

results were blasted in NCBI database in order to compare and link to available known

sequences (NCBI, 2013).

Figure 13: PCR product of various plant associated pseudomonads pictured on gel electrophoresis agar gel stained with ethidium bromide.

From the photo of the gel (Figure 13) and its relation to CMR12a, our strong conjecture that

CMR5c also carries the fitD locus was confirmed by sequencing and found in the NCBI

database. At protein level, 99% query cover and 85% maximum identity was attained with

the cytotoxin FitD of Pseudomonas chlororaphis O6. Furthermore other sequence

comparisons strengthened this finding. 99% coverage was also found for the cytotoxin FitD

from Pseudomonas chlororaphis subsp. aureofaciens 30-84 (Loper et al., 2012) and the FitD

toxin of Pseudomonas fluorescens Pf-5 (Paulsen et al., 2005), respectively with 84% and 81%

maximum protein identity. Suspicions for Pseudomonas NNC1, NNC2 and NSE3 could not be

46

linked to any known insecticidal proteins such as FitD like in CMR5c and CMR12a. However

the three sequences delivered equal results. For all strains highest similarity was found to a

hypothetical protein described in Vodovar et al. (2006) named PSEEN2812 originating from

P. entomophila L48. The sequence matched respectively 82%, 80% and 80% protein identity

and covered 59%, 61% and 61% of the PSEEN2821 sequence. Unfortunately, the function of

PSEEN2812 is unknown. Second highest matches were found in the hypothetical proteins

PMI31-06547 from Pseudomonas sp. GM78 and PMI31-03438 from Pseudomonas sp. CM55,

both yielding 59% query coverage and 76% maximum identity for all sequences. The

sequences from NNC3 and NNC6 could be used to compare with the database, and the

results show a very high similarity to the gene for acyl CoA dehydrogenase from

Pseudomonas putida; 99% query coverage and 96% maximum identity for NNC3 and 98%

query coverage and 94% maximum identity for NNC6. Other matches all resulted in high

similarity (>90% coverage and identity) in acyl CoA dehydrogenase. PCR products from the

other strains were not good enough for sequencing because the amount was too low or non-

specific amplicons were obtained.

47

5. DISCUSSION

5.1 Pseudomonas cichorii

Up to date, no literature reported that Pseudomonas cichorii possesses any insecticidal

activity, except for Robinson’s thesis (2011). According to a reduced insecticidal activity by

the methyl-accepting chemotaxis protein-deficient (MCP) mutant of P. cichorii NCPPB 907,

Robinson suggested that chemotaxis plays an important role in the mechanism to attack

insect larvae. MCPs are chemotaxis sensing molecules and assure an efficient sensing of

environmental gradients and guide the bacteria towards more optimal conditions. It is

unclear whether the reduced toxicity of the MCP mutant resulted from less production of

virulence factors or if it was just a result of the lower efficiency of movement which

consequently caused lower virulence.

Future prospect should be to examine the potential of P. cichorii as a producer of biocontrol

components against soil-inhabiting insects, but the first step and the aim of this study was to

confirm the insect toxicity and verify the importance of the alleged toxicity factors. Before

conducting experiments on a larger scale, we wanted to consider external factors, like the

medium used for bacterial growth, and optimize the procedure. The procedure is a toxicity

assay where ultimate instar G. mellonella larvae are injected with 10 µl of bacterial

suspension. When comparing the influence of the medium on the total number of larvae,

results showed a higher mortality when the bacteria were grown in LB. It is unclear how this

culture condition is contributing to enhanced virulence and whether LB improved or KB

decreased the bacterial activity.

Assessing the toxicity of two P. cichorii wild types, SF1-54 and NCPPB 907, and the MCP-

deficient mutant was first performed by injecting G. mellonella larvae at different

concentrations. Only at high concentrations (106 cfu/insect) could NCPPB 907 and the MCP-

mutant cause significantly higher mortality in comparison to the negative control. This

indicates that a high number of bacteria are necessary for an effective infection within 3

48

days. In this viewpoint, it would be interesting to clarify further whether P. cichorii can

actually survive in insect hemocoel at lower concentrations and can proliferate within a

longer period.

Although we observed a lower effect by the SF1-54 wild type than by NCPPB 907 and the

mutant, in a second experiment at equal concentration but under different conditions, we

found a different result. In this second experiment we injected one group of G. mellonella

larvae with a bacterial suspension at 106 cfu/insect directly diluted from the overnight

culture and one group with bacterial cells resuspended in PB. In this test SF1-54 clearly

performed better when only diluted from overnight mixture compared to when

resuspended in PB. Additionally, the NCPPB 907 strain also showed the same phenomenon.

A plausible reason is that we underestimated the effect the centrifugation has on P. cichorii

when harvesting the bacteria from the overnight culture. It is proven that centrifugation

damages the bacteria significantly in that way that a period of regeneration is necessary

(D’hondt, 2011). In addition, recovery of sublethal injuries will only happen under nutrient-

rich conditions (LB) and when injuries are not severe. In all other cases, repair is too costly

and the cell will undergo apoptosis for the well-being of the surviving cells (D’hondt, 2011).

This could result in the lack of difference observed between the wild type and the mutants.

The effect of the different treatments was most clear in larvae injected with bacteria directly

diluted from the overnight culture on the second day. Both wild types significantly caused

higher mortality than the MCP-mutant. Also on day 1 did NCPPB 907 cause more dead larvae

than the MCP-mutant. Although the data were very variable and we can’t find out which

concentration of P. cichorii was used by Robinson (2011) for experiments, our findings still

can confirm the results from Robinson (2011) and suggest an important role of MCP in insect

toxicity.

To verify this assumption, we constructed the complementary strain of the MCP mutant.

With this complementary strain we tested the importance according to the postulate of

Koch, which says that if a specific factor is eliminated, its effect will disappear. If, when this

factor is restored, the effect is observed again, then this factor was undoubtedly the cause of

this effect. So if this complement strain would regain full toxicity towards G. mellonella

larvae, it would confirm that MCP is of importance in the virulence of P. cichorii NCPPB 907.

49

However, from the results of the only one experiment, no conclusions could be made as no

significant differences were found between the wild type and the mutant, nor between the

mutant and its complement. Thus we need to repeat this experiment again under well

controlled conditions because the results are highly influenced by experimental conditions.

In every toxicity assay, the MCP-mutant of NCPPB 907 remained causing residual mortality

which would suggest additional factors are important for insect virulence. Aside several

virulence factores such as lipopeptides (cichopeptins and cichopeptins), P. cichorii can also

use a Type III secretion system (TTSS) to infect host cells. The production of some

lipopeptides could be regulated by the GacS/GacA regulatory system and synthesis of the

TTSS is encoded and regulated by hrp/hrc genes and HrpL, respectively. The effect of TTSS or

lipopeptides on virulence of P. cichorii SF1-54 on G. mellonella larvae was examined. We

expected that the bacteria impaired of an important factor of its virulence mechanisms

would cause a reduced mortality, but surprisingly, no significant reduction in comparison to

the wild type strain SF1-54 was observed. Interestingly, the cichopeptin-deficient mutant

significantly caused more dead larvae than SF1-54, indicating that the cipA-deleted mutant

has a stronger effect on insect larvae. Moreover, the gacS-deleted mutant, showed no

significant difference from the wild type but it did cause higher mortality than several other

mutants. Since more larvae died from both the mutants impaired of cichopeptin production,

we assume that the production of the lipopeptide demands too much of the energy of

bacteria to function optimally to attack the insect host. Otherwise, cichopeptins may also

trigger the defense mechanisms of G. mellonella against P. cichorii. When the cichopeptin is

absent, the bacteria could by-pass the defense mechanism more easily and thus cause

disease more rapidly. Ultimately, since the HrpL deficient mutant did not show a significant

reduction in toxicity, we can conclude that the TTSS is not necessary for the pathogenicity of

P. cichorii towards G. mellonella.

5.2 Pseudomonas sp. CMR12a

In recent studies, P. protegens CHA0 was proven to be a bacterium with very powerful

insecticidal activity and was able to kill larvae of G. mellonella, S. littoralis and Manduca

sexta within a short time span and at very low concentrations (Péchy-Tarr et al, 2008;

50

Ruffner et al , 2012). Further investigation elucidated the role of a novel protein in the insect

toxicity. The protein is called FitD and is located in the fit gene cluster (Péchy-Tarr et al.,

2008; 2012). The relevance of FitD has been demonstrated as the fitD-mutant showed a

reduced effect and the non-toxic E. coli constructed to express the FitD rendered the

bacterium able to kill Galleria larvae. A study to unravel the evolutionary web of related

pseudomonads and other species in relation to this FitD toxin, indicated that the toxin was

clearly proper to two pseudomonad groups: the chlororaphis- and protegens-group.

Interestingly, Pseudomonas sp. CMR12a, member of none of these groups, also carried the

fitD gene. This was confirmed by our PCR results as well. A short time and a low amount was

sufficient for CHA0 to kill G. mellonella. 30 cells per larvae enabled CHA0 to cause 50%

mortality (LT50) at 38 hours post injection and 100% after 40 hours. The LT50 for a

concentration of 300 cells per insect was 30 hours. CMR12a however, needed much less

time to cause 100% mortality. At a concentration of 800 cells per insect, the LT50 was

estimated at 24 hours after injection. Even when injected at a dose of 80 cells per insect

would a 100% mortality be reached before 32 hours post injection. With these results,

CMR12a is demonstrated to possess major insecticidal activity compared to CHA0. Different

theories could be approached. Although both Pseudomonas strains are effective biocontrol

agents against many plant diseases and efficient plant root colonizers, it is possible that

CMR12a has a faster metabolism and can adopt more rapidly to the insect environment. For

instance, the bacterium could set its focus on the formation of specific insect toxins, through

different, less energetically costly, pathways than CHA0. It is also tempting, since both

bacteria produce a wide array of secondary exoproducts, to appoint additional compounds

as actors to sustain or enhance anti-insect activity. In that point of view it is plausible that

CMR12a expresses virulence factors that enhance the efficiency of known toxins like FitD or

that it addresses multiple mechanisms to attack insects, other than CHA0. The assumption of

multiple insecticidal exoproducts produced by CHA0 is confirmed by the fact that, after

injection with FitD-deficient mutants, a significant residual mortality against G. mellonella

remained. The known insect pathogens Photorhabdus spp. and Xenorhabdus spp. also use

multiple mechanisms as a strategy to kill insect hosts, hence it reasonable to think that

CMR12a carries, aside the fitD gene, accessory genes that contribute to the insecticidal

activity. Moreover, our results show that the culture filtrate of the wild type also killed the

larvae from G. mellonella, indicating not only phenazines or other GacS/GacA regulated

51

supplementary compounds in the filtrate, but also supplementary unknown factors cause

mortality to Galleria larvae. In addition we also demonstrated that, like Photorhabdus spp.,

Xenorhabdus spp. and P. protegens CHA0, CMR12a can infect and grow inside the insect

body.

Conducting a toxicity assay with different mutants of CMR12a, deficient in the production of

known virulence factors (i.e. cyclic lipopeptides, CLP1 and CLP2, and phenazines, Phz), could

clarify the relevance of those virulence factors. The gacA-mutant of CMR12a, impaired of the

GacA component in the GacS/GacA two-component regulatory system responsible for the

production of various secondary metabolites, showed clear increased mortality throughout

the whole experiment. A similar effect as for CHA0, described by de Werra et al. (2009), may

be the underlying cause of this phenomenon. The researchers found that the production of

gluconic acid by CHA0 completely or partially inhibited the production of the anti-fungal

componants PLT and DAPG. Therefore we may assume that the elimination of some specific

products normally produced through the GacS/GacA two-compound regulatory system in

CMR12a, would enhance the production of either FitD or another unknown molecule and

consequently improve the insecticidal capacity of CMR12a against G. mellonella. Another

phenomenon observed in CHA0, is the occurrence of spontaneous GacS/GacA mutants with

an initial faster growth under laboratory conditions (Bull et al., 2001). The study

demonstrated that in mixtures of the wild type with gacA mutants in a nutrient-rich

environment, the mutant population would increase temporarily while the wild type

decreased. It suggested that the loss of gacA function can offer a selective advantage on

strain CHA0 under laboratory conditions (Bull et al., 2001). This phenomenon is also

observed for E. coli and is called “growth advantage in stationary phase” (GASP) (Zambrona

and Kolter, 1996). From our results we could assume GASP also occurs for gacA-mutants of

CMR12a when injecting in the, although hostile but nutrient rich, insect hemocoel.

Beside the increased insecticidal activity of the gacA-mutant we observed a significant

reduction of dead larvae injected with CLP1-mutants. CLP1 or sessilin is necessary for an

efficient biofilm formation of the bacteria. These results indicate that the ability to attach to

a surface and develop a larger dense bacterial community embedded in a extracellular

matrix is of greater importance, unlike P. cichorii NCPPB 907, where motility is of particular

52

relevance for an effective anti-insect function (Robinson, 2011). But we found a

contradictory result in relation with the double mutant, where the expression of both CLP1

and CLP2 is completely abolished, we did not see a decline in mortality. If CLP1 were of

significant importance it would imply that both the single CLP1 mutant as the double mutant

would be reduced in their ability to infect insect larvae. That the CLP1 mutants overproduce

phenazine is another factor that has to be taken into account (D’aes, 2012). However, as

there are no significant differences between the wild type and the phenazine-mutant,

reduced/higher phenazine levels cannot be held responsible for the reduction in virulence.

Although siderophores, like phenazines, are often important for the survival inside the host,

results from the toxicity assay and injection with culture filtrate both indicated that

phenazines produced by CMR12a were of no significant importance for its virulence. It is not

uncommon that the inactivation of a potent phenazine had no effect. In other studies,

pyocyanin, another phenazine, was also shown not to be important in the virulence of P.

aeruginosa and P entomophila against Bombyx mori and Drosophila melanogaster,

respectively (Chieda et al., 2007; Vallet-Gely et al., 2010).

For practical biocontrol purpose against plant tissue feeding insects it is of particular interest

to evaluate the oral insecticidal activity of the specific bacteria. The actual way insects are

infected with entomopathogenic bacteria is orally and thus many barriers need to be

crossed by the bacteria to eventually cause disease and ultimately death. Direct injection,

bypassing all initial natural interaction and resistance barriers, allows us to assess the

effective toxicity once inside the hemocoel, but it neglects any of those primer barriers.

Ruffner et al. (2012) already demonstrated oral toxicity from CHA0 against and S. littoralis

using a diet pellet coated with the bacterium. Approximately 8% of the larvae exposed to the

food pellets survived upon ingestion and an LT50 was estimated to ca. 3.5 days. According to

our assays with artificial food diet inoculated with CMR12a, no apparent death to the

Spodoptera caterpillars was observed within a time span of 7 days. As shown by Ruffner et

al. (2012) in an experiment with Fit toxin expressing E. coli, we know that the toxin itself is

not sufficient for oral toxicity and other factors, which are most likely lacking in CMR12a, are

necessary for full oral toxicity.

53

5.3 Nigerian Pseudomonas spp.

After the field survey it was the aim to determine the phylogeny of the different

pseudomonad strains isolated and to screen for interesting metabolites in terms of

biocontrol properties (Olorunleke, personal communication). With our findings we can

further differentiate the novel strains based on the capacity to kill wax moth larvae. At a 10

fold dilution from overnight culture mortality of G. mellonella occurred. However, when

changing to lower dosages (8000 cfu/insect), no more dead larvae were seen, except for

larvae injected with strain NSE1. Up to date there are no known differences, in relation to

the production of specific metabolites, between NSE1 and other strains that could indicate

for a virulence factor against G. mellonella. NSE 1 produces cyclic lipopeptides from the

viscosin-group, but it is not the only strain, so we can exclude this CLP from potential

insecticidal toxins, although it may still play a role in de virulence pathway (Olorunleke,

personal communication). To further investigate the importance of the cyclic lipopeptide,

the construction of a mutant is necessary to conduct complementary toxicity assays.

It not clear why NSE1 would be able to express insect toxins, but it is a property not

uncommon in the putida-group (Mahar et al., 2005). Nevertheless it is a useful finding to

compare to closely related strains. For instance, a locus sequencing of housekeeping genes

(rpoB, rpoD and recA) indicated a close relation between strains NNC8 and NSE1

(Olorunleke, personal communication). Although similarity based on maximum parsimony

only showed 50%, the strains could be grouped and show many similarities. Before, no

differences in sequence could be observed as a phenotypical attribute of the strain, but from

our results we can now add toxicity towards G. mellonella for NSE1, while NNC8 is not toxic.

Although at lower concentrations for the majority of the Nigerian strains no mortality was

observed against exposed wax moth larvae, we verified the presence of a fitD gene through

PCR and sequencing using the proposed primer from Péchy-Tarr et al. (2008). After

comparing the sequences to the NCBI database, we found the best matches with genes

encoding the hypothetical protein PSEEN2812 or acyl CoA dehydrogenase from various

pseudomonads. Analyzing the hypothetical protein excluded any likeliness to the FitD

protein. Although we cannot exclude the possibility that the protein may be involved in any

pathogenicity mechanisms since it is found in known entomopathogenic bacteria such as P.

54

entomophila, it is very unlikely that the targeted hypothetical protein PSEEN2812 is an insect

toxin, due to the vigorously mining of the genome for interesting secondary metabolites. In

addition, separating the PCR product produced in some cases multiple amplicons (NNC3,

NNC5, NNC66, NNC7, NNC8, NSE1, NSE3). Both observations contribute to our conclusion

that the used primers may not be as specific outside of the protegens and chlororaphis group

as thought before.

Although the DNA sequencing did not generate promising results for the novel Nigerian

strains, we did discover the presence of the fitD gene in CMR5c. This observations has never

been made before. To further investigate the potential of CMR5c as a biocontrol agent

against insects, it is of interest to submit CMR5c to similar tests as CMR12a.

55

6. CONCLUSIONS

P. cichrrii strains NCPPB 907, SF1-54, Pseudomonas sp. CMR12a and novel Nigerian

pseudomonads have partially been evaluated on their ability to serve as biocontrol agents

against insect pests. Both wild type strains of P. cichorii NCPBB 907 and SF1-54 showed

variable results under different experimental conditions and could only achieve satisfactory

mortality against G. mellonella at very high concentrations equal or higher than 106 cfu/

insect. These are concentrations very unlikely to occur under natural conditions. All results

summarized indicate that neither strain would be adequate as an effective control measure

in agriculture. In addition, we tested whether the mortality could be a result of known

virulence factors. Although the MCP-mutant of NCPPB 907 was shown to be reduced in

insecticidal activity, we could not prove to inverse the effect with a complemented strain.

With SF1-54 and various mutants impaired in known virulence factors, we reveal that

cichopeptins have a negative effect on the toxicity, but its exact role in the toxicity pathway

is still unknown. Repeats of the experiments with the MCP mutant of NCPPB 907 and

evaluation of the survival of the wild type strains inside the insect host are interesting

directions to further investigate the toxicity pathway of P. cichorii. Also examining the role of

cichopeptin could generate valuable information to what the exact function of the

lipopeptide may be.

In contrast to P. cichorii, we discovered that Pseudomonas CMR12a would be a very potent

biocontrol microorganism. The development inside the insect host, short time and low

dosage necessary to reach 100% mortality (LT50 = 32 hours for 80 cfu/insect) imply an

effective insecticidal mechanism of CMR12a. PCR and sequence-analysis demonstrate the

presence of the known FitD toxin. However, residual mortality of mutants and of the culture

filtrate indicates that CMR12a produces additional insecticidal components to the known

insect toxin FitD. We demonstrate a reduction in mortality of wax moth larvae injected with

the CLP1 mutant, but, since CLP12 did not show similar effect, even though the mutant is

impaired of CLP1 production as well, no conclusive explanation could be given. Also, the

toxicity of the gacA mutant was higher than the wild type. We hypothesize that this is either

the result of the annulation of the production of inhibitory components or a result of GASP.

56

The only disadvantage, in accordance to the biocontrol potential of CMR12a, is the inability

of the bacterium to infect insect larvae after ingestion. Because of the lack of oral toxicity of

CMR12a, application of the bacterium on the plant rhizosphere would not affect the

development of soil-borne insect pests. Nevertheless, further exploration of the genome and

expressed metabolites from CMR12a are an interesting path for further investigation. The

construction of fitD mutant is key to evaluate the function of various virulence factors to a

larger extent. Continuing this research could lead to the discovery of novel proteins, useful

for agricultural application as a formulated insecticide.

Aiming to further characterize the novel Nigerian pseudomonad strains, we could hardly

differentiate the strains based on insecticidal activity. At a concentration of 8 x 104 cfu/

larvae, only NSE1 could kill G. mellonella larvae adequately. PCR and DNA-sequencing could

not generate useful results regarding the presence of the fit gene. Further examination

indicated that the proposed primers are most likely not specific enough for the indication of

fitD gene once outside the target groups of P. protegens and P. chlororaphi. Nevertheless,

from the toxicity assay we were able to distinct NNC8 and NSE1 from each other based on

phenotypical characteristics, their insect toxicity, although they are classified as closely

related strains. Aside from NSE1, the novel Nigerian strains would not be effective biocontrol

measures against insects.

57

7. REFERENCES

Amir, H., & Alabouvette, C. (1993). Involvement of soil abiotic factors in the mechanisms of soil suppressiveness to fusarium wilts. Soil Biology and Biochemistry, 25(2), 157–164. doi:10.1016/0038-0717(93)90022-4

Anzai, Y., Kim, H., Park, J., Wakabayashi, H., & Oyaizu, H. (2000). Phylogenetic affiliation of the pseudomonads based on 16S rRNA sequence. International Journal of Systematic and Evolutionary Microbiology, 50, 1563–1589.

Aysan, Y., Sahin, S., Ulke, G., & Sahin, F. (2003). Bacterial rot of lettuce caused by Pseudomonas cichorii in Turkey. Plant Pathology, 52, 782.

Balàsz, A. (1958). Nutritional and nervous factors in the adaptation of Galleria mellonella to artificial diet. Acta Biologica Academiae Scientiarum Hungaricae, 9, 47-69.

Bender, C. L., Alarcón-Chaidez, F., & Gross, D. C. (1999). Pseudomonas syringae Phytotoxins : Mode of Action , Regulation , and Biosynthesis by Peptide and Polyketide Synthetases. Microbiology and molecular biology reviews, 63(2), 266–292.

Benítez, T., Rincón, A. M., Limón, M. C., & Codón, A. C. (2004). Biocontrol mechanisms of Trichoderma strains. International microbiology : the official journal of the Spanish Society for Microbiology, 7(4), 249–60. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/15666245

Bode, H. B. (2009). Entomopathogenic bacteria as a source of secondary metabolites. Current Opinion in Chemical Biology, 13(2), 224–30. doi:10.1016/j.cbpa.2009.02.037

Bowen, D., Rocheleau, T. A., Blackburn, M., Adreev, O., Golubeva, E., Bhartia, R., & ffrench-Constant, R. H. (1998). Insecticidal Toxins from the Bacterium Photorhabdus luminescens. Science, 280(5372), 2129–2132. doi:10.1126/science.280.5372.2129

Bravo, A., & Soberón, M. (2008). How to cope with insect resistance to Bt toxins? Trends in Biotechnology, 26(10), 573–9. doi:10.1016/j.tibtech.2008.06.005

Bravo, A., Gill, S. S., & Soberón, M. (2007). Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control. Toxicon : official journal of the International Society on Toxicology, 49(4), 423–35. doi:10.1016/j.toxicon.2006.11.022

Bravo, A., Likitvivatanavong, S., Gill, S. S., & Soberón, M. (2011). Bacillus thuringiensis: A story of a successful bioinsecticide. Insect Biochemistry and Molecular Biology, 41(7), 423–31. doi:10.1016/j.ibmb.2011.02.006

Bull, C.T., Duffy, B., Voisard, C., Défago, G., Keel, C. & Haas, D. (2001). Characterization of spontaneous gacS and gacA regulatory mutants of Pseudomonas fluorescens biocontrol strain CHA0. Antonie van Leeuwenhoek 79, 327—36.

Challacombe, J. F., Altherr, M. R., Xie, G., Bhotika, S. S., Brown, N., Bruce, D., Campbell, C. S., et al. (2007). The complete genome sequence of Bacillus thuringiensis Al Hakam. Journal of Bacteriology, 189(9), 3680–1. doi:10.1128/JB.00241-07

Chieda, Y., Iiyama, K., Yasunaga-Aoki, C., Lee, J. M., Kusakabe, T., & Shimizu, S. (2005). Pathogenicity of gacA mutant of Pseudomonas aeruginosa PA01 in the silkworm, Bombyx mori. FEMS microbiology letters, 244(1), 181–6. doi:10.1016/j.femsle.2005.01.032

58

Chin-A-Woeng, T. F. C., Bloemberg, G. V., & Lugtenberg, B. J. J. (2003). Phenazines and their role in biocontrol by Pseudomonas bacteria. New Phytologist, 157(3), 503–523. doi:10.1046/j.1469-8137.2003.00686.x

Christou, P., Capell, T., Kohli, A., Gatehouse, J. a, & Gatehouse, A. M. R. (2006). Recent developments and future prospects in insect pest control in transgenic crops. Trends in Plant Science, 11(6), 302–8. doi:10.1016/j.tplants.2006.04.001

Clarkson, J.M. and Charnley, A.K. (1996). New insights into the mechanisms of fungal pathogenesis in insects. Trends in Microbiology, 4, 197-203.

Coburn, B., Sekirov, I., & Finlay, B. B. (2007). Type III secretion systems and disease. Clinical microbiology reviews, 20(4), 535–49. doi:10.1128/CMR.00013-07

Compant, S., Clément, C., & Sessitsch, A. (2010). Plant growth-promoting bacteria in the rhizo- and endosphere of plants: Their role, colonization, mechanisms involved and prospects for utilization. Soil Biology and Biochemistry, 42(5), 669–678. doi:10.1016/j.soilbio.2009.11.024

Compant, S., Duffy, B., Nowak, J., Clément, C., & Barka, E. A. (2005). Use of Plant Growth-Promoting Bacteria for Biocontrol of Plant Diseases : Principles , Mechanisms of Action , and Future Prospects. Applied and Environmental Microbiology, 71(9), 4951–4959. doi:10.1128/AEM.71.9.4951

Cook, R. J., & Rovira, A. D. (1976). The Role of Bacteria in the Biological Control of Gaeumannomyces graminis by Suppressive Soils. Soil Biology & Biochemistry, 8, 269–273.

Cook, R.J. (2003). Take-all of wheat. Physiological and Molecular Plant Pathology, 62(2), 73–86. doi:10.1016/S0885-5765(03)00042-0

Cornelis, G. R., & Van Gijsegem, F. (2000). Assembly and function of type III secretory systems. Annual Review of Microbiology, 54, 735–774.

Cornelis, P. (2010). Iron uptake and metabolism in pseudomonads. Applied Microbiology and Biotechnology, 86(6), 1637–45. doi:10.1007/s00253-010-2550-2

Cottyn, B., Baeyen, S., Pauwelyn, E., Verbaendert, I., De Vos, P., Bleyaert, P., Höfte, M., et al. (2011). Development of a real-time PCR assay for Pseudomonas cichorii, the causal agent of midrib rot in greenhouse-grown lettuce, and its detection in irrigating water. Plant Pathology, 60(3), 453–461. doi:10.1111/j.1365-3059.2010.02388.x

Cottyn, B., Heylen, K., Heyrman, J., Vanhouteghem, K., Pauwelyn, E., Bleyaert, P., Van Vaerenbergh, J., et al. (2009). Pseudomonas cichorii as the causal agent of midrib rot, an emerging disease of greenhouse-grown butterhead lettuce in Flanders. Systematic and Applied Microbiology, 32(3), 211–25. doi:10.1016/j.syapm.2008.11.006

D’aes, J. (2012). Biological activity and regulation of cyclic lipopeptides and phenazines produced by biocontrol strain Pseudomonas CMR12a. PhD thesis, Ghent University, Belgium. (p. 223).

D’aes, J., De Maeyer, K., Pauwelyn, E., & Höfte, M. (2010). Biosurfactants in plant-Pseudomonas interactions and their importance to biocontrol. Environmental Microbiology Reports, 2(3), 359–372. doi:10.1111/j.1758-2229.2009.00104.x

D’aes, J., Hua, G. K. H., De Maeyer, K., Pannecoucque, J., Forrez, I., Ongena, M., Dietrich, L. E. P., et al. (2011). Biological control of Rhizoctonia root rot on bean by phenazine- and cyclic lipopeptide-producing Pseudomonas CMR12a. Phytopathology, 101(8), 996–1004. doi:10.1094/PHYTO-11-10-0315

59

Daborn, P. J., Waterfield, N., Silva, C. P., Au, C. P. Y., Sharma, S., & Ffrench-Constant, R. H. (2002). A single Photorhabdus gene, makes caterpillars floppy (mcf), allows Escherichia coli to persist within and kill insects. Proceedings of the National Academy of Sciences of the United States of America, 99(16), 10742–7. doi:10.1073/pnas.102068099

De Bruijn, I., De Kock, M. J. D., Yang, M., De Waard, P., Van Beek, T. a, & Raaijmakers, J. M. (2007). Genome-based discovery, structure prediction and functional analysis of cyclic lipopeptide antibiotics in Pseudomonas species. Molecular Microbiology, 63(2), 417–28. doi:10.1111/j.1365-2958.2006.05525.x

De Maagd, R. A., Bravo, A., & Crickmore, N. (2001). How Bacillus thuringiensis has evolved specific toxins to colonize the insect world. Trends in Genetics : TIG, 17(4), 193–9. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11275324

de Weger, L. A., Van der Bij, A. J., Dekkers, L. C., Simons, M., Wijffelman, C. A., & Lugtenberg, B. J. J. (1995). Colonization of the rhizosphere of crop plants by plant-beneficial pseudomonads. FEMS Microbiology Ecology, 17, 221–228.

De Werra, P., Péchy-Tarr, M., Keel, C., & Maurhofer, M. (2009). Role of gluconic acid production in the regulation of biocontrol traits of Pseudomonas fluorescens CHA0. Applied and environmental microbiology, 75(12), 4162–74. doi:10.1128/AEM.00295-09

Devi, K. K., & Kothamasi, D. (2009). Pseudomonas fluorescens CHA0 can kill subterranean termite Odontotermes obesus by inhibiting cytochrome c oxidase of the termite respiratory chain. FEMS Microbiology Letters, 300(2), 195–200. doi:10.1111/j.1574-6968.2009.01782.x

Devine, G. J., & Furlong, M. J. (2007). Insecticide use: Contexts and ecological consequences. Agriculture and Human Values, 24(3), 281–306. doi:10.1007/s10460-007-9067-z

D’hondt, L. (2011). Flow cytometry in plant pathology: a case study on Pseudomonas cichorii. PhD thesis, Ghent University, Belgium. (p. 205)

Döring, G., & Pier, G. B. (2008). Vaccines and immunotherapy against Pseudomonas aeruginosa. Vaccine, 26(8), 1011–24. doi:10.1016/j.vaccine.2007.12.007

Driscoll, J.A., Brody, S.L., Kollef, M.H. (2007). The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections. Drugs, 67, 351—68.

Driscoll, W. W., Pepper, J. W., Pierson, L. S., & Pierson, E. a. (2011). Spontaneous Gac mutants of Pseudomonas biological control strains: cheaters or mutualists? Applied and environmental microbiology, 77(20), 7227–35. doi:10.1128/AEM.00679-11

Dubuis, C., Keel, C., & Haas, D. (2007). Dialogues of root-colonizing biocontrol pseudomonads. European Journal of Plant Pathology, 119(3), 311–328. doi:10.1007/s10658-007-9157-1

Duchaud, E., Rusniok, C., Frangeul, L., Buchrieser, C., Givaudan, A., Taourit, S., Bocs, S., et al. (2003). The genome sequence of the entomopathogenic bacterium Photorhabdus luminescens. Nature Biotechnology, 21(11), 1307–13. doi:10.1038/nbt886

EUROPEAN UNION (1991). Directive 91/414/EEC of the European Parliament and of the Council of 15 July 1991 – Concerning the placing of plant protection products on the market. European Parliament and Council, Brussels.

Evenson, R. E., & Gollin, D. (2003). Assessing the impact of the green revolution, 1960 to 2000. Science, 300, 758–762. doi:10.1126/science.1078710

60

FAO (2013). http://www.fao.org/agriculture/crops/core-themes/theme/pests/ipm/en/ (last consulted on 4/05/2013)

ffrench-Constant, R. H., & Bowen, D. (1999). Photorhabdus toxins: novel biological insecticides. Microbiology, 2, 284–288.

ffrench-Constant, R. H., & Waterfield, N. R. (2006). Ground control for insect pests. Nature Biotechnology, 24(6), 660–661.

ffrench-Constant, R. H., Dowling, A., & Waterfield, N. R. (2007). Insecticidal toxins from Photorhabdus bacteria and their potential use in agriculture. Toxicon : Official Journal of the International Society on Toxicology, 49(4), 436–51. doi:10.1016/j.toxicon.2006.11.019

Galán, J. E., & Collmer, A. (1999). Type III Secretion Machines: Bacterial Devices for Protein Delivery into Host Cells. Science, 284(5418), 1322–1328. doi:10.1126/science.284.5418.1322

Gilman, eds.: Hardman, J. G., Limbird, L. E.; consul. ed.: Alfred Goodman (2002). Goodman & Gilman's the Pharmacological Basis of Therapeutics (12th ed.). New York: McGraw-Hill. pp. Chapter 52.

Goodrich-Blair, H., & Clarke, D. J. (2007). Mutualism and pathogenesis in Xenorhabdus and Photorhabdus: two roads to the same destination. Molecular microbiology, 64(2), 260–8. doi:10.1111/j.1365-2958.2007.05671.x

Gouge, D. H., & Snyder, J. L. (2006). Temporal association of entomopathogenic nematodes (Rhabditida: Steinernematidae and Heterorhabditidae) and bacteria. Journal of Invertebrate Pathology, 91(3), 147–57. doi:10.1016/j.jip.2005.12.003

Gutiérrez-Mañero, F. J., Ramos-Solano, B., Probanza, A., Mehouachi, J., Tadeo, F. R., & Talon, M. (2001). The plant-growth-promoting rhizobacteria Bacillus pumilus and Bacillus licheniformis produce high amounts of physiologically active gibberellins. Physiologia Plantarum, 111, 206–211.

Haas, D., & Défago, G. (2005). Biological control of soil-borne pathogens by fluorescent pseudomonads. Nature reviews. Microbiology, 3(4), 307–19. doi:10.1038/nrmicro1129

Haas, D., & Keel, C. (2003). Regulation of antibiotic production in root-colonizing Peudomonas spp. and relevance for biological control of plant disease. Annual Review of Phytopathology, 41(63), 117–53. doi:10.1146/annurev.phyto.41.052002.095656

Hajek, A. E., McManus, M. L., & Delalibera, I. (2007). A review of introductions of pathogens and nematodes for classical biological control of insects and mites. Biological Control, 41(1), 1–13. doi:10.1016/j.biocontrol.2006.11.003

Hartmann, A., Rothballer, M., & Schmid, M. (2007). Lorenz Hiltner, a pioneer in rhizosphere microbial ecology and soil bacteriology research. Plant and Soil, 312(1-2), 7–14. doi:10.1007/s11104-007-9514-z

Hensel, M., Shea, J. E., Waterman, S. R., Mundy, R., Nikolaus, T., Banks, G., Vazquez-Torres, a, et al. (1998). Genes encoding putative effector proteins of the type III secretion system of Salmonella pathogenicity island 2 are required for bacterial virulence and proliferation in macrophages. Molecular microbiology, 30(1), 163–74. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9786193

Hillocks, R. J. (2012). Farming with fewer pesticides: EU pesticide review and resulting challenges for UK agriculture. Crop Protection, 31(1), 85–93. doi:10.1016/j.cropro.2011.08.008

Hoffmann, J. D., & Lawson, F. R. (1964). Preliminary studies on mass-rearing of the tobacco hornworm. Journal of Economic Entomology, 57, 178-82.

61

Höfte, H., De Greve, H., Seurinck, J., Jansens, S., Mahillon, J., Ampe, C., Vandekerckhove, J., et al. (1986). Structural and functional analysis of a cloned delta endotoxin of Bacillus thuringiensis berliner 1715. European Journal of Biochemistry: FEBS, 161(2), 273–80. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/3023091

Hojo, H., Koyanagi, M., Tanaka, M., Kajihara, S., Ohnishi, K., Kiba, A., & Hikichi, Y. (2008). The hrp genes of Pseudomonas cichorii are essential for pathogenicity on eggplant but not on lettuce. Microbiology, 154(Pt 10), 2920–8. doi:10.1099/mic.0.2008/021097-0

Hueck, C. J. (1998). Type III Protein Secretion Systems in Bacterial Pathogens of Animals and Plants Type III Protein Secretion Systems in Bacterial Pathogens of Animals and Plants. Microbiology & Molecular Biology Reviews, 62(2), 379–433.

Hultberg, M., Bengtsson, T., & Liljeroth, E. (2010). Late blight on potato is suppressed by the biosurfactant-producing strain Pseudomonas koreensis 2.74 and its biosurfactant. BioControl, 55(4), 543–550. doi:10.1007/s10526-010-9289-7

Hurst, M. R. H., Glare, T. R., Jackson, T. A., & Ronson, C. W. (2000). Plasmid-Located Pathogenicity Determinants of Serratia entomophila, the Causal Agent of Amber Disease of Grass Grub , Show Similarity to the Insecticidal Toxins of Photorhabdus luminescens. Journal of Bacteriology, 182(18), 5127–5138.

James, C. (2009). Global status of Commercialized biotech / GM Crops : 2009. ISAAA Briefs, (41).

Joo, G.-J., Kim, Y.-M., Lee, I.-J., Song, K.-S., & Rhee, I.-K. (2004). Growth promotion of red pepper plug seedlings and the production of gibberellins by Bacillus cereus, Bacillus macroides and Bacillus pumilus. Biotechnology Letters, 26(6), 487–91. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/15127789

Jousset, A., Rochat, L., Lanoue, A., Bonkowski, M., Keel, C., & Scheu, S. (2011). Plants respond to pathogen infection by enhancing the antifungal gene expression of root-associated bacteria. Molecular Plant-Microbe Interactions : MPMI, 24(3), 352–8. doi:10.1094/MPMI-09-10-0208

Jousset, A., Rochat, L., Scheu, S., Bonkowski, M., & Keel, C. (2010). Predator-prey chemical warfare determines the expression of biocontrol genes by rhizosphere-associated Pseudomonas fluorescens. Applied and Environmental Microbiology, 76(15), 5263–8. doi:10.1128/AEM.02941-09

Khalid, a., Arshad, M., & Zahir, Z. a. (2004). Screening plant growth-promoting rhizobacteria for improving growth and yield of wheat. Journal of Applied Microbiology, 96(3), 473–480. doi:10.1046/j.1365-2672.2003.02161.x

Kiba, A., Takata, O., Ohnishi, K., & Hikichi, Y. (2006). Comparative analysis of induction pattern of programmed cell death and defense-related responses during hypersensitive cell death and development of bacterial necrotic leaf spots in eggplant. Planta, 224(5), 981–94. doi:10.1007/s00425-006-0277-1

Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson, G. T., Farris, M. A., Roop II, R. M., & Peterson, K. M. (1995). Four new derivatives of the broad-host-range cloning vector pBBR1MCS , carrying different antibiotic-resistance cassettes. Gene, 166, 175–176.

Le, C. N., Kruijt, M., & Raaijmakers, J. M. (2012). Involvement of phenazines and lipopeptides in interactions between Pseudomonas species and Sclerotium rolfsii, causal agent of stem rot disease on groundnut. Journal of Applied Microbiology, 112(2), 390–403. doi:10.1111/j.1365-2672.2011.05205.x

Li, J., Hu, K., & Webster, J. M. (1999). Antibiotics from Xenorhabdus spp. and Photorhabdus spp. Chemistry of heterocyclic compounds, 34(11), 1331–1339.

62

Liu, D., Burton, S., Glancy, T., Li, Z.-S., Hampton, R., Meade, T., & Merlo, D. J. (2003). Insect resistance conferred by 283-kDa Photorhabdus luminescens protein TcdA in Arabidopsis thaliana. Nature Biotechnology, 21(10), 1222–8. doi:10.1038/nbt866

Loper, J. E., & Gross, H. (2007). Genomic analysis of antifungal metabolite production by Pseudomonas fluorescens Pf-5. European Journal of Plant Pathology, 119(3), 265–278. doi:10.1007/s10658-007-9179-8

Loper, J. E., Hassan, K. a, Mavrodi, D. V, Davis, E. W., Lim, C. K., Shaffer, B. T., Elbourne, L. D. H., et al. (2012). Comparative genomics of plant-associated Pseudomonas spp.: insights into diversity and inheritance of traits involved in multitrophic interactions. PLoS genetics, 8(7), e1002784. doi:10.1371/journal.pgen.1002784

Lucas García, J. a., Probanza, a., Ramos, B., Colón Flores, J. J., & Gutiérrez Mañero, F. J. (2004). Effects of Plant Growth Promoting Rhizobacteria (PGPRs) on the Biological Nitrogen Fixation, Nodulation, and Growth of Lupinus albus l. cv. Multolupa. Engineering in Life Sciences, 4(1), 71–77. doi:10.1002/elsc.200400013

Maddula, V. S. R. K., Pierson, E. a, & Pierson, L. S. (2008). Altering the ratio of phenazines in Pseudomonas chlororaphis (aureofaciens) strain 30-84: effects on biofilm formation and pathogen inhibition. Journal of Bacteriology, 190(8), 2759–66. doi:10.1128/JB.01587-07

Mahar, A. N., Darban, D. A., Gowen, S. R., Hague, N. G. M., Jan, N. D., Munir, M., & Mahar, A. Q. (2005). Use of entomopathogenic bacterium Pseudomonas putida (Enterobacteriaceae) and it’s secretion against greater wax moth, Galleria Mellonella pupae. Journal of Entomology, 2(1), 77–85.

Maringoni, A. C., Theodoro, G. F., Ming, L. C., Cardoso, J. C., & Kurozawa, C. (2003). First report of Pseudomonas cichorii on turmeric ( Curcuma longa ) in Brazil. Plant Pathology, 52, 794.

Mavrodi, D. V, Blankenfeldt, W., & Thomashow, L. S. (2006). Phenazine compounds in fluorescent Pseudomonas spp. biosynthesis and regulation. Annual Review of Phytopathology, 44, 417–45. doi:10.1146/annurev.phyto.44.013106.145710

Mavrodi, D. V, Parejko, J. a, Mavrodi, O. V, Kwak, Y.-S., Weller, D. M., Blankenfeldt, W., & Thomashow, L. S. (2013). Recent insights into the diversity, frequency and ecological roles of phenazines in fluorescent Pseudomonas spp. Environmental microbiology, 15(3), 675–86. doi:10.1111/j.1462-2920.2012.02846.x

Mavrodi, D. V, Peever, T. L., Mavrodi, O. V, Parejko, J. a, Raaijmakers, J. M., Lemanceau, P., Mazurier, S., et al. (2010). Diversity and evolution of the phenazine biosynthesis pathway. Applied and Environmental Microbiology, 76(3), 866–79. doi:10.1128/AEM.02009-09

Mazzola, M. (2002). Mechanisms of natural soil suppressiveness to soilborne diseases. Antonie van Leeuwenhoek, 81(1-4), 557–64. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12448751

Mazzola, M. (2004). Assessment and management of soil microbial community structure for disease suppression. Annual Review of Phytopathology, 42, 35–59. doi:10.1146/annurev.phyto.42.040803.140408

Mazzola, M., De Bruijn, I., Cohen, M. F., & Raaijmakers, J. M. (2009). Protozoan-induced regulation of cyclic lipopeptide biosynthesis is an effective predation defense mechanism for Pseudomonas fluorescens. Applied and Environmental Microbiology, 75(21), 6804–11. doi:10.1128/AEM.01272-09

Nielsen-LeRoux, C., Gaudriault, S., Ramarao, N., Lereclus, D., & Givaudan, A. (2012). How the insect pathogen bacteria Bacillus thuringiensis and Xenorhabdus/Photorhabdus occupy their hosts. Current Opinion in Microbiology, 15(3), 220–31. doi:10.1016/j.mib.2012.04.006

63

Oerke, E.-C. (2006). Crop losses to pests. The Journal of Agricultural Science, 144(01), 31–43. doi:10.1017/S0021859605005708

Oerke, E.-C., & Dehne, H.-W. (2004). Safeguarding production—losses in major crops and the role of crop protection. Crop Protection, 23(4), 275–285. doi:10.1016/j.cropro.2003.10.001

Oerke, E-C., Dehne, H-W., Schönbeck, F., & Weber, A. (1994). Crop production and crop protection: estimated losses in major food and cash crops (First edition). Amsterdam. 808 p.

Olcott, M. H., Henkels, M. D., Rosen, K. L., Walker, F. L., Sneh, B., Loper, J. E., & Taylor, B. J. (2010). Lethality and developmental delay in Drosophila melanogaster larvae after ingestion of selected Pseudomonas fluorescens strains. PloS one, 5(9), e12504. doi:10.1371/journal.pone.0012504

Ongena, M., & Jacques, P. (2008). Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends in Microbiology, 16(3), 115–25. doi:10.1016/j.tim.2007.12.009

Paulsen, I. T., Press, C. M., Ravel, J., Kobayashi, D. Y., Myers, G. S. a, Mavrodi, D. V, DeBoy, R. T., et al. (2005). Complete genome sequence of the plant commensal Pseudomonas fluorescens Pf-5. Nature biotechnology, 23(7), 873–8. doi:10.1038/nbt1110

Pauwelyn, E. (2012). Epidemiology and pathogenicity mechanisms of Pseudomonas cichorii, the causal agent of midrib rot in greenhouse-grown butterhead lettuce (Lactuca sativa L.). PhD thesis, Ghent University, Belgium. (p. 211)

Pauwelyn, E., Huang, C., Ongena, M., Leclère, V., Jacques, P., Bleyaert, P., Budzikiewicz, H., et al. (2013). New Linear Lipopeptides Produced by Pseudomonas cichorii SF1-54 Are Involved in Virulence , Swarming Motility , and Biofilm Formation. Molecular Plant-Microbe Interactions : MPMI, 26(5), 585–598.

Pauwelyn, E., Vanhouteghem, K., Cottyn, B., De Vos, P., Maes, M., Bleyaert, P., & Höfte, M. (2011). Epidemiology of Pseudomonas cichorii, the Cause of Lettuce Midrib Rot. Journal of Phytopathology, 159(4), 298–305. doi:10.1111/j.1439-0434.2010.01764.x

Péchy-Tarr, M., Borel, N., Kupferschmied, P., Turner, V., Binggeli, O., Radovanovic, D., Maurhofer, M., et al. (2012). Control and host-dependent activation of insect toxin expression in a root-associated biocontrol pseudomonad. Environmental Microbiology. doi:10.1111/1462-2920.12050

Péchy-Tarr, M., Bruck, D. J., Maurhofer, M., Fischer, E., Vogne, C., Henkels, M. D., Donahue, K. M., et al. (2008). Molecular analysis of a novel gene cluster encoding an insect toxin in plant-associated strains of Pseudomonas fluorescens. Environmental Microbiology, 10(9), 2368–86. doi:10.1111/j.1462-2920.2008.01662.x

Pedigo, L. P. (2002). Entomology and pest management (4th edition). PublisherUpper Saddle River, N.J. : Prentice Hall, 742 p.

Perneel, M., D’hondt, L., De Maeyer, K., Adiobo, A., Rabaey, K., & Höfte, M. (2008). Phenazines and biosurfactants interact in the biological control of soil-borne diseases caused by Pythium spp. Environmental Microbiology, 10(3), 778–88. doi:10.1111/j.1462-2920.2007.01501.x

Perneel, M., Heyrman, J., Adiobo, a, De Maeyer, K., Raaijmakers, J. M., De Vos, P., & Höfte, M. (2007). Characterization of CMR5c and CMR12a, novel fluorescent Pseudomonas strains from the cocoyam rhizosphere with biocontrol activity. Journal of Applied Microbiology, 103(4), 1007–20. doi:10.1111/j.1365-2672.2007.03345.x

64

Pham, T.H., Boon, N., Aelterman, P., Clauwaert, P., De Schamphelaire, L., Van Haecke, L., et al. (2008). Metabolites produced by Pseudomonas spp. Enable a Gram-positive bacteriam to achieve extracellular electron transfer. Applied Microbiology & Biotechnology, 6, 1119-1129.

Piccoli, P., Travaglia, C., Cohen, A., Sosa, L., Cornejo, P., Masuelli, R., & Bottini, R. (2010). An endophytic bacterium isolated from roots of the halophyte Prosopis strombulifera produces ABA, IAA, gibberellins A1 and A3 and jasmonic acid in chemically-defined culture medium. Plant Growth Regulation, 64(2), 207–210. doi:10.1007/s10725-010-9536-z

Pingali, P. L. (2012). Green revolution: impacts, limits, and the path ahead. Proceedings of the National Academy of Sciences of the United States of America, 109(31), 12302–12308. doi:10.1073/pnas.0912953109

Raaijmakers, J. M., & Mazzola, M. (2012). Diversity and natural functions of antibiotics produced by beneficial and plant pathogenic bacteria. Annual Review of Phytopathology, 50, 403–24. doi:10.1146/annurev-phyto-081211-172908

Raaijmakers, J. M., De Bruijn, I., & De Kock, M. J. D. (2006). Cyclic lipopeptide production by plant-associated Pseudomonas spp.: diversity, activity, biosynthesis, and regulation. Molecular plant-microbe interactions : MPMI, 19(7), 699–710. doi:10.1094/MPMI-19-0699

Raaijmakers, J. M., De Bruijn, I., Nybroe, O., & Ongena, M. (2010). Natural functions of lipopeptides from Bacillus and Pseudomonas: more than surfactants and antibiotics. FEMS Microbiology reviews, 34(6), 1037–62. doi:10.1111/j.1574-6976.2010.00221.x

Ramette, A., Frapolli, M., Fischer-Le Saux, M., Gruffaz, C., Meyer, J.-M., Défago, G., Sutra, L., et al. (2011). Pseudomonas protegens sp. nov., widespread plant-protecting bacteria producing the biocontrol compounds 2,4-diacetylphloroglucinol and pyoluteorin. Systematic and Applied Microbiology, 34(3), 180–8. doi:10.1016/j.syapm.2010.10.005

Ramette, A., Moënne-Loccoz, Y., & Défago, G. (2003). Prevalence of fluorescent pseudomonads producing antifungal phloroglucinols and/or hydrogen cyanide in soils naturally suppressive or conducive to tobacco black root rot. FEMS Microbiology Ecology, 44(1), 35–43. doi:10.1111/j.1574-6941.2003.tb01088.x

Ramos, I., Dietrich, L. E. P., Price-whelan, A., & Newman, D. K. (2010). Phenazines affect biofilm formation by Pseudomonas aeruginosa in similar ways at various scales. Research in Microbiology, 161(3), 187–191.

Ratcliffe, N. (1985). Invertebrate immunity - a primer for the non-specialist. Immunology Letters, 10, 253-270.

Raymond, B., Johnston, P. R., Nielsen-LeRoux, C., Lereclus, D., & Crickmore, N. (2010). Bacillus thuringiensis: an impotent pathogen? Trends in Microbiology, 18(5), 189–94. doi:10.1016/j.tim.2010.02.006

Robinson, G. (2011). Identification of insect toxins produced by bacterial pathogens. Master thesis, Reading University, United Kingdom. (p. 96).

Ruffner, B., Péchy-Tarr, M., Ryffel, F., Hoegger, P., Obrist, C., Rindlisbacher, A., Keel, C., et al. (2012). Oral insecticidal activity of plant-associated pseudomonads. Environmental Microbiology. doi:10.1111/j.1462-2920.2012.02884.x

Ryu, C.-M., Hu, C.-H., Locy, R. D., & Kloepper, J. W. (2005). Study of mechanisms for plant growth promotion elicited by rhizobacteria in Arabidopsis thaliana. Plant and Soil, 268(1), 285–292. doi:10.1007/s11104-004-0301-9

Sambrook, J. & Russell, D.W. (2001). Molecular Cloning, a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

65

Sanguin, H., Sarniguet, a, Gazengel, K., Moënne-Loccoz, Y., & Grundmann, G. L. (2009). Rhizosphere bacterial communities associated with disease suppressiveness stages of take-all decline in wheat monoculture. The New Phytologist, 184(3), 694–707. doi:10.1111/j.1469-8137.2009.03010.x

Santoyo, G., Del Carmen Orozco-mosqueda, M. ., & Govindappa, M. (2012). Mechanisms of biocontrol and plant growth-promoting activity in soil bacterial species of Bacillus and Pseudomonas : a review. Biocontrol Science and Technology, 22(8), 855–872.

Senthilkumar, M., Madhaiyan, M., Sundaram, S., & Kannaiyan, S. (2009). Intercellular colonization and growth promoting effects of Methylobacterium sp. with plant-growth regulators on rice (Oryza sativa L. Cv CO-43). Microbiological Research, 164(1), 92–104. doi:10.1016/j.micres.2006.10.007

Serra-Wittling, C., Houot, S., & Alabouvette, C. (1996). Increased soil suppressiveness to Fusarium wilt of flax after addition of municipal solid waste compost. Soil Biology and Biochemistry, 28(9), 1207–1214. doi:10.1016/0038-0717(96)00126-5

Siddiqui, Z. A., & Mahmood, I. (1999). Role of bacteria in the management of plant parasitic nematodes: A review. Bioresource Technology, 69, 167–179.

Simon, R., Priefer, U., and Pühler, A. (1983) A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Biotechnology, 1, 784–794.

Smalla, K., Sessitsch, A., & Hartmann, A. (2006). The rhizosphere: “soil compartment influenced by the root”. FEMS Microbiology Ecology, 56(2), 165. doi:10.1111/j.1574-6941.2006.00148.x

Soderhall, K. and Cerenius L. 1998. Role of phenoloxidase-activating system in invertebrate immunity. Current Opinion on Immunology, 10, 23-28.

Souza, J. T. De, Boer, M. De, Waard, P. De, Beek, T. A. Van, & Raaijmakers, J. M. (2003). Biochemical , Genetic , and Zoosporicidal Properties of Cyclic Lipopeptide Surfactants Produced by Pseudomonas fluorescens. Applied and Environmental Microbiology, 69(12), 7161–7172. doi:10.1128/AEM.69.12.7161

Stutz, E. ., Défago, G., & Kern, H. (1986). Naturally occuring fluorescent pseudomonads involved in suppression of black root rot of tabacco. Phytopathology, 76, 181–185.

Thomashow, L. S., & Weller, D. M. (1988). Role of a phenazine antibiotic from Pseudomonas fluorescens in biological control of Gaeumannomyces graminis var. tritici. Journal of Bacteriology, 170(8), 3499–508. Retrieved from http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=211320&tool=pmcentrez&rendertype=abstract

Tran, H., Ficke, A., Asiimwe, T., Höfte, M., & Raaijmakers, J. M. (2007a). Role of the cyclic lipopeptide massetolide A in biological control of Phytophthora infestans and in colonization of tomato plants by Pseudomonas fluorescens. The New Phytologist, 175(4), 731–42. doi:10.1111/j.1469-8137.2007.02138.x

Tran, H., Kruijt, M., & Raaijmakers, J. M. (2007b). Diversity and activity of biosurfactant-producing Pseudomonas in the rhizosphere of black pepper in Vietnam. Journal of Applied Microbiology, 104(3), 839–51. doi:10.1111/j.1365-2672.2007.03618.x

Vaeck, M., Reynearts, A., Höfte, H., Jansens, S., De Beuckeleer, M., Dean, C., Zabeau, M., Van Montagu, M. & Leemans, J. (1987). Transgenic plants protected from insect attack. Nature, 328, 33-37. doi:10.1038/328033a0

66

Vallet-Gely, I., Opota, O., Boniface, A., Novikov, A., & Lemaitre, B. (2010). A secondary metabolite acting as a signalling molecule controls Pseudomonas entomophila virulence. Cellular microbiology, 12(11), 1666–79. doi:10.1111/j.1462-5822.2010.01501.x

Verma, M., Brar, S. K., Tyagi, R. D., Surampalli, R. Y., & Valéro, J. R. (2007). Antagonistic fungi, Trichoderma spp.: Panoply of biological control. Biochemical Engineering Journal, 37(1), 1–20. doi:10.1016/j.bej.2007.05.012

Vodovar, N., Vallenet, D., Cruveiller, S., Rouy, Z., Barbe, V., Acosta, C., Cattolico, L., et al. (2006). Complete genome sequence of the entomopathogenic and metabolically versatile soil bacterium Pseudomonas entomophila. Nature biotechnology, 24(6), 673–9. doi:10.1038/nbt1212

Waterfield, N. R., Bowen, D. J., Fetherston, J. D., Perry, R. D., & ffrench-Constant, R. H. (2001). The tc genes of Photorhabdus: a growing family. Trends in Microbiology, 9(4), 185–91. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11286884

Waterfield, N. R., Ciche, T., & Clarke, D. (2009). Photorhabdus and a host of hosts. Annual Review of Microbiology, 63, 557–74. doi:10.1146/annurev.micro.091208.073507

Waterfield, N. R., Sanchez-Contreras, M., Eleftherianos, I., Dowling, A., Yang, G., Wilkinson, P., Parkhill, J., et al. (2008). Rapid Virulence Annotation (RVA): identification of virulence factors using a bacterial genome library and multiple invertebrate hosts. Proceedings of the National Academy of Sciences of the United States of America, 105(41), 15967–72. doi:10.1073/pnas.0711114105

Weller, D. M. (2007). Pseudomonas biocontrol agents of soilborne pathogens: looking back over 30 years. Phytopathology, 97(2), 250–6. doi:10.1094/PHYTO-97-2-0250

Weller, D. M., Landa, B. B., Mavrodi, O. V, Schroeder, K. L., De La Fuente, L., Blouin Bankhead, S., Allende Molar, R., et al. (2007). Role of 2,4-diacetylphloroglucinol-producing fluorescent Pseudomonas spp. in the defense of plant roots. Plant Biology (Stuttgart, Germany), 9(1), 4–20. doi:10.1055/s-2006-924473

Weller, D. M., Raaijmakers, J. M., Gardener, B. B. M., & Thomashow, L. S. (2002). Microbial populations responsible for specific soil suppressiveness to plant pathogens. Annual Review of Phytopathology, 40, 309–48. doi:10.1146/annurev.phyto.40.030402.110010

Zambrano, M. M., and R. Kolter. 1996. GASPing for life in stationary phase. Cell 86:181–184.

Zhou, Y., Choi, Y.-L., Sun, M., & Yu, Z. (2008). Novel roles of Bacillus thuringiensis to control plant diseases. Applied Microbiology and Biotechnology, 80(4), 563–72. doi:10.1007/s00253-008-1610-3

Insect toxicity in plant associated fluorescent pseudomonads

Documents

Transcript of Insect toxicity in plant associated fluorescent pseudomonads