Infrastructure - The Water Research Foundation · Guidance Document on Anaerobic Digester Foaming...

Guidance Document on Anaerobic Digester Foaming Prevention and Control Methods

Water Environment Research Foundation635 Slaters Lane, Suite G-110 n Alexandria, VA 22314-1177

Phone: 571-384-2100 n Fax: 703-299-0742 n Email: [email protected]

WERF Stock No. INFR1SG10a

September 2014

Guidance Document on Anaerobic DigesterFoaming Prevention and Control Methods

Infrastructure

IWA PublishingAlliance House, 12 Caxton StreetLondon SW1H 0QSUnited KingdomPhone: +44 (0)20 7654 5500Fax: +44 (0)20 7654 5555Email: [email protected]: www.iwapublishing.comIWAP ISBN: 978-1-78040-659-6/ 1-78040-659-2

Co-published by

INFR1SG10a_WEF-IWAPspread.qxd 9/9/2014 1:22 PM

GUIDANCE DOCUMENT ON ANAEROBIC DIGESTER

FOAMING PREVENTION AND CONTROL METHODS

by:

Krishna R. Pagilla, Ph.D., P.E., BCEE Bhargavi Subramanian, M.S., Ph.D. Candidate

Illinois Institute of Technology

2014

INFR1SG10a

ii

The Water Environment Research Foundation, a not-for-profit organization, funds and manages water quality research for its subscribers through a diverse public-private partnership between municipal utilities, corporations, academia, industry, and the federal government. WERF subscribers include municipal and regional water and water resource recovery facilities, industrial corporations, environmental engineering firms, and others that share a commitment to cost-effective water quality solutions. WERF is dedicated to advancing science and technology addressing water quality issues as they impact water resources, the atmosphere, the lands, and quality of life. For more information, contact: Water Environment Research Foundation 635 Slaters Lane, Suite G-110 Alexandria, VA 22314-1177 Tel: (571) 384-2100 Fax: (703) 299-0742 www.werf.org [email protected] This report was co-published by the following organization. IWA Publishing Alliance House, 12 Caxton Street London SW1H 0QS, United Kingdom Tel: +44 (0) 20 7654 5500 Fax: +44 (0) 20 7654 5555 www.iwapublishing.com [email protected] © Copyright 2014 by the Water Environment Research Foundation. All rights reserved. Permission to copy must be obtained from the Water Environment Research Foundation. Library of Congress Catalog Card Number: 2014934255 Printed in the United States of America IWAP ISBN: 978-1-78040-659-6/1-78040-659-2 This report was prepared by the organization(s) named below as an account of work sponsored by the Water Environment Research Foundation (WERF). Neither WERF, members of WERF, the organization(s) named below, nor any person acting on their behalf: (a) makes any warranty, express or implied, with respect to the use of any information, apparatus, method, or process disclosed in this report or that such use may not infringe on privately owned rights; or (b) assumes any liabilities with respect to the use of, or for damages resulting from the use of, any information, apparatus, method, or process disclosed in this report. Illinois Institute of Technology The research on which this report is based was developed, in part, by the United States Environmental Protection Agency (EPA) through Cooperative Agreement No. CR-83419201-0 with the Water Environment Research Foundation (WERF). However, the views expressed in this document are not necessarily those of the EPA and EPA does not endorse any products or commercial services mentioned in this publication. This report is a publication of WERF, not EPA. Funds awarded under the Cooperative Agreement cited above were not used for editorial services, reproduction, printing, or distribution. This document was reviewed by a panel of independent experts selected by WERF. Mention of trade names or commercial products or services does not constitute endorsement or recommendations for use. Similarly, omission of products or trade names indicates nothing concerning WERF's or EPA's positions regarding product effectiveness or applicability.

Guidance Document on Anaerobic Digester Foaming Prevention and Control Methods iii

About WERF The Water Environment Research Foundation, formed in 1989, is America’s leading independent scientific research organization dedicated to wastewater and stormwater issues. Throughout the last 25 years, we have developed a portfolio of more than $130 million in water quality research. WERF is a nonprofit organization that operates with funding from subscribers and the federal government. Our subscribers include wastewater treatment facilities, stormwater utilities, and regulatory agencies. Equipment companies, engineers, and environmental consultants also lend their support and expertise as subscribers. WERF takes a progressive approach to research, stressing collaboration among teams of subscribers, environmental professionals, scientists, and staff. All research is peer reviewed by leading experts. For the most current updates on WERF research, sign up to receive Laterals, our bi-weekly electronic newsletter. Learn more about the benefits of becoming a WERF subscriber by visiting www.werf.org.

http://www.werf.org/i/News/Laterals/a/d/Laterals/Laterals.aspx?hkey=b359886e-7b29-4e98-beae-f6198e578674

http://www.werf.org/i/Get_Involved/Benefits/a/w/Join_WERF.aspx?hkey=a259cc40-297e-4a78-82ae-1faa4a264010

www.werf.org

iv

The research conducted to develop this guidance document was funded by the Water Environment Research Foundation with additional financial support by Hazen & Sawyer (NY), Baxter & Woodman (IL), and Depuración de Aguas del Mediterráneo (DAM, Spain). The technical advisory team consists of Dr. David Jenkins (University of California, Berkeley) and Dr. André van Niekerk (Golder Associates, South Africa). Assistance to the Spanish team from DAM, Valencia, Spain (Laura Pastor) is appreciated. The support of participating utilities which provided survey responses and full-scale plant data is greatly appreciated. This guidance document was prepared by the following with input from all project team members: Research Team

Principal Investigators: Krishna R. Pagilla, Ph.D., P.E., BCEE Bhargavi Subramanian Illinois Institute of Technology

Project Team: Slawomir Hermanowicz, Ph.D. University of California, Berkeley Ignasi Rodriguez-Roda, Ph.D. Maria Casellas Fusté Institut Català de Recerca de l'Aigua (ICRA) Catalan Institute for Water Research Robert Sharp, Ph.D., P.E. Manhattan College

Amanda Poole, P.E. Derek Wold, P.E. Sean O`Dell, P.E.

Baxter & Woodman Paul Pitt, Ph.D., P.E. Hazen & Sawyer Alexandre Miot, P.E. Domenic Jolis, Ph.D., P.E. San Francisco Public Utilities – Oceanside WPCP

ACKNOWLEDGMENTS

Guidance Document on Anaerobic Digester Foaming Prevention and Control Methods v

Other Participating Utilities: Allen Deur, P.E. New York City Department of Environmental Protection Curt Goodman City of Marquette, MI Gary L. Smith City of Elmhurst, IL

James L. Huchel City of Crystal Lake, IL WERF Project Subcommittee

Andre van Niekerk, Ph.D. Golder Associates Africa (Pty) Ltd David Jenkins, Ph.D., NAE University of California, Berkeley Jose A. Jimenez, Ph.D., P.E. Brown and Caldwell William Marten, P.E., BCEE Donohue & Associates

Innovative Infrastructure Research Committee (IIRC) Members

Stephen P. Allbee (Retired) Daniel Murray Michael Royer U.S. Environmental Protection Agency Frank Blaha Water Research Foundation Kevin Hadden Orange County Sanitation District Peter Gaewski, MS, P.E. Tata & Howard, Inc. (Retired) David Hughes American Water Kendall M. Jacob, P.E. Cobb County Jeff Leighton City of Portland Water Bureau Steve Whipp United Utilities North West (Retired)

vi

Walter L. Graf, Jr. Water Environment Research Foundation Daniel M. Woltering, Ph.D. Water Environment Research Foundation – IIRC Chair

Water Environment Research Foundation Staff

Director of Research: Daniel M. Woltering, Ph.D. Senior Program Director: Amit Pramanik, Ph.D., BCEEM

Guidance Document on Anaerobic Digester Foaming Prevention and Control Methods vii

Abstract:

The development of this anaerobic digester (AD) foaming guidance document is based on the need for a specific detailed methodology that water resource recovery facilities (WRRF) personnel can follow and implement to manage or mitigate AD foam incidents. This guidance manual is the final product following a comprehensive research effort on AD foaming in full-scale WRRFs. It is the outcome of lessons learned from extensive literature review, WRRF surveys, full-scale data studies and experimental analyses. The primary goals of this document are to: 1) serve as a practical and usable tool for WRRFs, 2) present feasible alternatives that are cost-effective, 3) present large amounts of practical, focused information in a concise manner, and 4) present information of sound technical and scientific basis that can become a standard or foundation for foam management in WRRFs.

Benefits:

Provides step-by-step guidance on management and mitigation based on type of foam episodes (occasional, seasonal and persistent).

Provides general guidance on AD foam incident management and includes information on the various causes-impact-control options available.

Illustrates the benefits and concerns associated with several monitoring, mitigation, and control alternatives.

Provides “how to” information on each step of foam management – problem identification, monitoring and detection, and prevention/control of foam episodes.

Keywords: Anaerobic digestion, foaming, causes, effects, prevention, control, G. amarae, M. parvicella.

ABSTRACT AND BENEFITS

viii

Acknowledgments........................................................................................................................ iv Abstract and Benefits .................................................................................................................. vii List of Tables ................................................................................................................................ x List of Figures .............................................................................................................................. xi List of Acronyms ........................................................................................................................ xii Executive Summary ................................................................................................................ ES-1

1.0 Introduction ................................................................................................................. 1-1 1.1 Background and Basis of AD Foaming ............................................................. 1-2 1.2 Methodology of Managing Foam Episodes ....................................................... 1-3 2.0 Step 1: Symptom and Problem Identification (Diagnosis) ....................................... 2-1 3.0 Step 2: Identification of Foaming Causes/Contributors........................................... 3-1

3.1 Historical Data Evaluation ................................................................................. 3-1 3.1.1 OLR/OLR Variations to Digesters......................................................... 3-2 3.1.2 pH/Volatile Acids/Alkalinity ................................................................. 3-4 3.1.3 Gas Production/Pressure ........................................................................ 3-5 3.1.4 Temperature .................................................................................................... 3-6

3.2 Sampling for Foaming Potential Measurement and Foam Causing Constituents ............................................................................... 3-6

3.2.1 Sampling, Storage, and General Considerations .................................... 3-6 3.2.2 Experimental Protocols .......................................................................... 3-7 3.2.3 Physical Methods – Foam Potential ..................................................... 3-10 3.2.4 Biological Methods .............................................................................. 3-13

3.3 Long-Term Monitoring/Detection of Foam Events ......................................... 3-17 3.3.1 Foam Detection by Monitoring/Testing of Digesters or Contents ...... 3-17 3.3.2 Detection Using Sensors and Associated Instrumentation .................. 3-19 3.3.3 Examples of Specific Detection/Monitoring Methods ........................ 3-19

4.0 Step 3: Prevention and Control Methods .................................................................. 4-1 4.1 Sludge Disintegration Methods (WAS Pre-Treatment Methods) ...................... 4-1

4.1.1 Acid Phase Digestion ............................................................................. 4-1 4.1.2 Biological Lysis ..................................................................................... 4-2

4.2 Operational Modifications to Prevent/Control Foaming ................................... 4-5 4.2.1 Digester Feed Flow Rate and Quality Maintenance .............................. 4-5 4.2.2 Mixing .................................................................................................... 4-5 4.2.3 Liquid Level/Feed Flow Adjustment During a Foaming Event ............ 4-8

4.3 Control of the Digester Physical Features ......................................................... 4-9 4.3.1 Gas Piping .............................................................................................. 4-9 4.3.2 Foam Suppression Nozzle Installation................................................... 4-9 4.3.3 Automated Defoamer Addition ............................................................ 4-12

TABLE OF CONTENTS

Guidance Document on Anaerobic Digester Foaming Prevention and Control Methods ix

4.4 Control of Filamentous Foaming ..................................................................... 4-13 4.4.1 Control of the Secondary Treatment Process and Associated WAS Foaming ..................................................................................... 4-13 4.4.2 Influent FOG Control ........................................................................... 4-16 4.4.3 Chemical Methods ............................................................................... 4-17

4.5 Digester Foam Mitigation Recommendations ................................................. 4-17 4.5.1 Other Considerations ........................................................................... 4-17

References ................................................................................................................................. R-1

x

3-1 List of Historical Operational Data to be Reviewed ........................................................ 3-1 8 3-2 List of Physical and Biological Characterization Methods .............................................. 3-9 3-3 Example of a Foam Severity Rating Scale .................................................................... 3-12 1-19 3-4 List of Probes Used for Filamentous Organisms ........................................................... 3-15 1-22 3-5 List of Operational Parameters/Characteristics to be Monitored Long-Term ............... 3-18 1-25 3-6 Example of a Foam Severity Rating System for Utilities with Persistent Foam ........... 3-19 1-25 3-7 Summary of AD Foam Sensors ..................................................................................... 3-20 1-27 4-1 Summary of WAS Pre-Treatment Alternatives ............................................................... 4-3 1-33 4-2 Different Sludge Disintegration Methods for AD Foam Control .................................... 4-4 4-3 Typical Criteria for Anaerobic Digester Mixing Systems ............................................... 4-6 4-4 Summary of Filaments Control Alternatives in Activated Sludge Process ................... 4-14 1-44 4-5 General Do’s and Don’ts for Digester Foam Management ........................................... 4-19

LIST OF TABLES

Guidance Document on Anaerobic Digester Foaming Prevention and Control Methods xi

1-1 Possible Factors and Relationships Leading to Bubble and Foam Formation................. 1-3 2-1 Logic Flowchart of Steps Involved in a Foam Management Protocol ............................ 2-2 2-2 Logic Flowchart of Steps Involved in Control of Persistent and Seasonal Foam Incidents .... 2-3 Incidents 1-6 2-3 Logic Flowchart of Steps Involved in Control of Occasional Foam Incidents ................ 2-4 3-1 Sample Plot for Historical Data of OLR and Possible Correlation for a Foam Event..... 3-2 1-9 3-2 Representative Plot for Historical Data of OLR Variations and Shock Loads ................ 3-3 3-3 Representative Plot for Historical Data of PS:WAS Solids Ratio in Feed ...................... 3-4 3-4 Representative Plot for Historical Data Representation for Correlations Between VA/A Ratio and VS Load ................................................................................................ 3-5 3-5 Sample Plot of Gas Pressure and Transducer Levels in Digester .................................... 3-6 1-13 3-6 General Schematic of a Treatment Train Indicating Representative Sampling Locations ... 3-8 1-16 3-7 Air Stone Diffuser Attached to Tubing .......................................................................... 3-10 1-17 3-8 Connection to Air Flow Meter ....................................................................................... 3-10 3-9 Connection to Aquarium Air Pump ............................................................................... 3-11 3-10 Setup of Foam Potential Equipment .............................................................................. 3-11 1- 1-18 3-11 Sample Gram Stain Image Indicating Absence of Filaments – M. parvicella or Gordonia .............................................................................................. 3-14 3-12 Sample Gram Stain Image Indicating Presence of M. parvicella .................................. 3-14 3-13 Sample Gram Stain Image Indicating Presence of Nocardioforms ............................... 3-15 1-22 3-14 Sample FISH Analysis Image with a Stain Indicating EUB (All Bacteria) and MPA (M. parvicella) ..................................................................................................... 3-16 Presence of MPA (M. parvicella) 1-23 3-15 Sample FISH Image Indicating Absence of Both G. amarae and M. parvicella .......... 3-16 3-16 Sample FISH Analysis Image with a Stain Indicating EUB (All Bacteria) and MYC (G. amarae) .......................................................................................................... 3-17 3-17 Layout of the Foam Separator Drain Temperature Foam Monitoring Method ............. 3-23 1-30 3-18 Sample Temperature Datalogger and Sludge Level Sensor Data .................................. 3-23 1-30 3-19 Process Snap Shot of Level Transducers Indicating Runaway Pressure Levels Due to Foam Hitting the Digester Dome Cover ........................................................................ 3-24 4-1 Schematic of Digester Depth Sampling at Regular Intervals .......................................... 4-7 1-38 4-2 Schematic of Digester Depth Sampling at Regular Intervals .......................................... 4-8 1-39 4-3 Schematic of Digester Gas Piping ................................................................................. 4-10 1-41 4-4 Schematic of Possible Changes to Digester Gas Piping for Mitigation of Foam Intrusion in Gas Lines .......................................................................................... 4-10 1-41 4-5 Schematic of a Nozzle Foam Suppression System (Not to Scale)................................. 4-11 1-42 4-6 Schematic of a 2-Inch Foam Suppression Nozzle Installed in a Digester ..................... 4-11 4-7 Typical Defoamer Pumping System Block Diagram (Not to Scale) ............................. 4-12 1-43 4-8 Hunts Point Full-Scale Defoamant Addition Temporary Field Set-Up ......................... 4-13 4-9 Schematic of an Automatic SRT Controller Set-Up ...................................................... 4-15 1-46 4-10 Typical Schematic for Surface Wasting from RAS Well (Not to Scale) ....................... 4-16

LIST OF FIGURES

xii

AD Anaerobic Digester AS Activated Sludge BNR Biological Nutrient Removal CFD Computational Fluid Dynamics DCS Data Collection Systems ESD Egg-Shaped Digesters EPS Extracellular Polymeric Substances FISH Fluorescence in situ Hybridization FOG Fats, Oils, Grease FSI Foam Scum Index G Gordonia GBT Gravity Belt Thickeners HRT Hydraulic Retention Time LCFA Long Chain Fatty Acid M Microthrix MBR Membrane Bio Reactor MGD Million Gallons per Day ML Mixed Liquor MLSS Mixed Liquor Suspended Solids MPA Microthrix parvicella (Probe) MYC Mycolata (Probe) OLR Organic Loading Rate OSP Oceanside Plant PAX Poly-Aluminium Chloride Salts PS Primary Sludge PS:WAS Primary Sludge:Waste Activated Sludge (Ratio) RAS Return Activated Sludge RBC Rotating Biological Contactor SRT Solids Retention Time TS Total Solids TSS Total Suspended Solids TWAS Thickened Waste Activated Sludge U.S. EPA United State Environment Protection Agency VFA Volatile Fatty Acids VS Volatile Solids VSS Volatile Suspended Solids WAS Waste Activated Sludge

LIST OF ACRONYMS

Guidance Document on Anaerobic Digester Foaming Prevention and Control Methods xiii

WERF Water Environment Research Foundation WPCP Water Pollution Control Plant WTF Water Treatment Facility WW Wastewater WRRF Water Resource Recovery Facility WWTP Wastewater Treatment Plant

Guidance Document on Anaerobic Digester Foaming Prevention and Control Methods ES-1

EXECUTIVE SUMMARY

Anaerobic digestion (AD) has been used in water resource recovery facilities (WRRFs) for decades to stabilize waste sludge and/or to release energy from sludge in the form of biogas. However, as efficient as this process has become over the years, the issue of foaming has been plaguing the AD process for decades. AD foaming has been cited as a common problem in WRRFs, both recently and in the past. The cited causes are many, and the prevention/control methods are numerous. Much of the reported technical information is based on single plant-specific, cause-effects-control investigations. Foam is a normal phenomenon in a typical AD; however, it becomes an issue when excessive foaming occurs. Such AD foaming problems are still prevalent, persistent, and are being experienced by more WRRFs than in the past.

The end goal of this research project was to provide a guidance manual for AD foam management. The guidance manual was developed for a wide range of utility operators, as well as engineers and consultants working closely to better manage foam episodes which may otherwise have adverse consequences. Specific objectives were to:

Identify steps in managing and mitigating foam episodes. Provide tools to aid operators to monitor prevent and control foam. Provide logic flow charts (protocol) for selection of various control alternatives.

Task 1 included a comprehensive literature review. In Task 2 researchers used findings from the literature review and disseminated an AD foaming survey. During Task 3 researchers carried out full-scale investigations. The abovementioned three tasks will be published as a separate WERF final report. This guidance document derives the concepts and lessons learned from all these tasks and include new and, more importantly, practical information. It is also the final step in the overall goal to improve the understanding of AD foaming causes and control for WRRFs with varying configurations of solids and liquid processing trains, and to provide guidance to WRRFs on best management practices for AD foaming control.

Guidance Document on Anaerobic Digester Foaming Prevention and Control Methods 1-1

CHAPTER 1.0

GUIDANCE DOCUMENT ON ANAEROBIC DIGESTER FOAMING PREVENTION AND CONTROL METHODS

1.0 Introduction This guidance document on AD foaming control was prepared to assist utility personnel and engineers in mitigating and controlling AD foam incidents as an additional task under WERF’s INFR1SG10 research project. Preparation of the guidance manual is based on outcomes from a series of tasks including the following:

Task 1: Literature Review. A literature review was prepared by the project team to critically identify and evaluate the existing gaps in knowledge of AD foaming – causes, prevention, and control.

Task 2: Full-Scale Plant Survey. A survey questionnaire was prepared based on the literature review and administered to several utilities. The responses were reviewed and reconciled with the gaps identified from the literature review. Utilities for further study and parameters to investigate in full-scale were selected.

Task 3: Full-Scale Plant Studies. Full-scale studies were conducted in select plants. Final Project Report: A comprehensive report describing the tasks outlined above was

prepared earlier and it supplements this guidance document. It is published as a separate WERF report #INFR1SG10. (Pagilla and Subramanian, 2014).

This guidance document was prepared based on all of the information gathered in these three tasks and the project team’s experience with full-scale AD foaming.

The goals of this document are as follows: To identify the most appropriate steps to help operators investigate causes of AD foaming. To devise a protocol to better manage foam events by short-term or long-term mitigation

measures before they become significant operating problems. To develop relevant information that can be used by utilities during AD foam events to detect

and monitor foam events.

This document is intended as a stand-alone guidance on AD foaming. It has been prepared for use by utility operators and consultants in the field of wastewater and sludge treatment to help them make decisions about AD foaming incidents based on their plant processes. Key elements of the document include:

Logic flowcharts to be used in identifying the AD foaming causes and methods of control for a specific scenario. The result of this process is identification of the cause/treatment or control techniques that need to be evaluated for further consideration in a plant. These are general guidelines to help operators select a foam management strategy.

Summary of key features of each technology including design criteria, a list of facilities using the technology, and in some cases, schematics showing how the technology works. These are the recommended practices and procedures for each specific foaming cause.

1-2

1.1 Background and Basis of AD Foaming

AD foaming is one of the most common operating problems in WRRFs that implement sludge processing using AD. Since AD is the primary energy production method from wastewater organic contents, it is the key to the overall energy sustainability of WRRFs. Foam is a normal phenomenon in a typical AD; however it becomes an issue when excessive foaming occurs. A persistent or frequent AD foaming problem is often a significant bottleneck both for WRRF energy sustainability as well as its ability to process sludge to a safe and beneficial end product. In addition to AD of sludge from municipal wastewater treatment, other concentrated organic wastes from commercial and industrial facilities are also processed by AD to recover energy in the form of biogas.

Occurrence of filamentous foaming bacteria (mainly nocardioforms (G. amarae) and/or M. parvicella in a WRRF biological treatment process has been a key contributor or cause of AD foaming. In addition to microbiological causes, several other factors directly or indirectly influence the complex phenomenon of three-phase (solids-liquid-biogas) AD foam. It is possible to identify suspected causes and contributors for each type of AD foaming, some with factual evidence. However, pin-pointing a specific cause to the problem has been and will be challenging due to the multiple factors and causes involved in the problematic AD foam events. Both feed-related and digester process-related factors can cause foaming and/or contribute to foaming conditions in AD. The role of operating parameters including digestion temperature in AD foaming is mostly from indirect effects such as the gas production, biogas solubility, and surface tension of the liquid phase in the digester. pH and alkalinity are not possible direct causes of foaming. Figure 1-1 shows the role of all of the factors influencing AD foam formation and persistence, extrapolated from other three-phase foams. The relationships between the various groups of causes/contributors and constituents of the digesters are illustrated but correlations are not possible to predict in the case of AD foaming.

Regardless of the causes, the result of AD foaming has been significant reduction in performance, capacity, and/or operational difficulties in the liquid and sludge treatment trains. Currently there is a lack of relevant technical information resources for operators experiencing AD foaming problems. Therefore, this guidance document describes the strategy to evaluate foaming causes and effects, effects of operational and engineering modifications on foaming, and present successful measures for foaming mitigation and reduction based on full-scale data collected from WRRFs. To the best of the project team’s knowledge, such a document does not exist to date, yet it is a critical need to improve AD for enhanced energy recovery and make WRRFs more self-sufficient in terms of energy management.

Based on the literature and findings of the earlier tasks of this project, the role a cause may play (whether fundamental or supplementary) or its magnitude seems to be specific to the plant conditions. However, the information that exists in literature unduly places emphasis on some factors for both enhancing foaming and minimizing foaming and some of them have been carefully investigated in our full-scale studies. The popular opinion that all foaming has to be filamentous seems to be unfounded. While it can be agreed it is the most common cause of foaming, it is not conclusive if it is the only established primary cause of foaming.


Figure 1-1. Possible Factors and Constituents Leading to Bubble and Foam Formation.

1.2 Methodology of Managing Foam Episodes

The protocol involved in managing a foam episode is discussed in the following sections. Although monitoring and sampling has been listed as a separate step in this document, it should proceed concurrently with the other steps. Although all of these steps seem independent of each other, they are continuous and sometimes may even be an iterative process to effectively manage foam episodes and prepare for future ones. The following section describes functions required for each of these steps for reliable foam management. A logic flowchart illustrating the steps involved in a foam management protocol is presented in Figure 2-1. All of the steps outlined in this protocol are discussed in detail in this guidance document.


CHAPTER 2.0

STEP 1: SYMPTOM AND PROBLEM IDENTIFICATION (DIAGNOSIS)

Foam episodes are generally classified according to frequency and severity. Persistent foam episodes are the most severe; with the need to identify, detect and possibly predict a foam event as well as to find a permanent solution. Seasonal foam episodes are easier to predict if the utility has followed their foaming patterns and can anticipate it. Occasional and rare foaming episodes may have bigger impacts than persistent events because the utility is not prepared for it. Such utilities should increase their monitoring and try to determine operational patterns or other threshold values of parameters that may be indicative of foam. Even if a foam episode cannot be stopped, timely action can help to considerably reduce impacts and subsequent costs associated with a foam event. It is important to document all visual observations and gather operator`s inputs to determine the accurate classification of the foam. Identifying the type of problem and symptom is of utmost importance to determine a course of action to be followed for effective foam management. The following two logical flowcharts illustrate this importance by describing the steps to be taken for persistent and seasonal (Figure 2-2) and occasional/rare foam events (Figure 2-3). Though the steps of identification of cause and control/prevention are the same for persistent and seasonal episodes, the magnitude of data review, sampling and monitoring varies. Persistent foam episodes will have longer or continuous monitoring as well as extensive data review. The identification of the cause of foam may be easiest of the three cases. Identifying causes in rare/occasional events may be the most difficult as a utility may have been unprepared for foam sampling or data collection. The prevention/control step of occasional foam events over a short duration could well be controlled by defoamant addition instead of making costly equipment and/or operational changes.

2-2

Figure 2-1. Flowchart of Steps Involved in a Foam Management Protocol.

Note: Long-term monitoring (Section 3.3) proceeds in parallel with Steps 1, 2, and 3.


Figure 2-2. Logic Flowchart of Steps Involved in Control of Persistent and Seasonal Foam Incidents.

2-4

Figure 2-3. Logic Flowchart of Steps Involved in Control of Occasional Foam Incidents.


CHAPTER 3.0

STEP 2: IDENTIFICATION OF FOAMING CAUSES/CONTRIBUTION

Review of operational data and its correlation with foaming events is discussed in this section.

3.1 Historical Data Evaluation

To evaluate the historical data for determining AD foam causes researchers reviewed operational data collected during the day-to-day operations (Table 3-1). Each of the possible causes/contributors and parameters from data review are discussed in this section.

Table 3-1. Recommended List of Historical Operational Data to be Reviewed.

Parameter Item Frequency Comments

Total Solids

Digester feed Digester contents

Daily or 3 times/week

Refer to Section 3.1.1 for effects of solids on foaming.

Volatile Solids (VS)

Digester feed Digester contents

Daily or 3 times/week

VS loading aspects are discussed in Section 3.1.1.2.

OLR Digester feed

Daily OLR relationship to foam and related aspects are discussed in Section 3.1.1.

Alkalinity, Volatile Acids (or VA/A ratio)

Digester feed

Digester contents

3 times/week Section 3.1.2 discusses possible relationship between pH/Volatile Acids/Alkalinity and foaming.

Temperature

Digester feed

Digester contents

Daily Relationship between operational temperature and foaming is discussed in Section 3.1.4.

Gas Production/Pressure

Digester gas

Daily/continuous Section 3.1.3 explains gas production/pressure aspects associated with digester foam.

It is important to evaluate data for the past two to three years or the duration that the utility has been experiencing foaming for persistent and seasonal events. Days of foaming must be clearly recorded by the utility personnel. In case of occasional foaming, data on the day of foaming should be compared to normal operational data.

3-2

3.1.1 OLR/OLR Variations to Digesters

Overloading (high OLRs) could lead to imbalances in the ADs such as peak gas flow rates and cause or contribute to foaming. Organic overloading can occur for the following reasons. Increase in total feed quantity to a digester due to an uneven feed distribution among

digesters, or due to one or more digesters being taken out of service. Increase in concentration of organic material (VS) in the feed sludge at a given flow rate. Increased digestibility of the feed sludge due to composition changes of TS/VS.

3.1.1.1 Feed Flow Rate to Digesters A stable and equal sludge feed flow rate to each digester must be maintained at all times. The historical feed flow rate data to all digesters should be analyzed and compared to periods during which digester foaming occurred or was suspected to occur. If possible, the foaming events should be correlated separately with data for digesters and digesters gas collection systems, especially when problems arise from foam intrusion in gas collection systems.

3.1.1.2 VS Loading Rate to Digesters The daily average VS loading rate of digesters should be compared with the reported or suspected foaming events. Foaming events (if any) that coincide with relatively higher VS loading rates (> 0.15 lbs Volatile Suspended Solids (VSS)/ft3-d) should be determined. Metcalf and Eddy (2003) list a typical design loading rate of 0.10 to 0.30 lbs VS/ft3-d for mesophilic ADs. The individual Anaerobic Digestion Operations Manual/ Basis of Design for each WRRF should also be consulted. Though each digester has a specific threshold value above which foaming problems may occur, the above mentioned values should be used as a guideline for digester operation. Figure 3-1 provides a representative plot of OLR over two years for a utility with a past foam event that corresponds to higher loading rate. The April 2011 foaming event is evident based on the spikes in both OLR and corresponding gas produced. A 25% increase in OLR is what operators have attributed to the foaming incident. The variation in gas production is also significant during the foam period due to corresponding OLR variations. Other instances of spikes in OLR and/or increase in gas production did not correspond to foam incidents.

7/1 10/1 1/1 4/1 7/1 10/1 1/1 4/1 7/1 10/10

20000

40000

60000

80000

100000

120000

140000

Digester Gas Produced

OLR

OLR - Lower Range (Metcalf and Eddy)

OLR - Upper Range (Metcalf and Eddy)

Daily Data

Dig

es

ter

Ga

s P

rod

uc

ed

(C

F/D

ay

)

Reported Foam Event

0.00

0.05

0.10

0.15

0.20

0.25

0.30

0.35

0.40

OL

R (L

bs

VS

/CF

/Da

y)

Figure 3-1. Sample Plot for Historical Data of OLR and Possible Correlation for a Foam Event (Years 2010-2012).


3.1.1.3 Frequency of Digester Feeding/Variations in OLR

Intermittently feeding a large quantity of sludge to a digester (slug feeding) and very high and sudden spikes in OLR (shock loading) can create localized overloading inside the digester. If several digesters are in service, it should be ascertained that though the total feeding time may be different, the frequency of feeding is the same for all digesters. The variations of OLR of a digester must be within 10-20% per feed.

If foaming occurs, then the foaming episodes can be correlated to feeding frequencies to identify if it is indeed an initiator for foaming. Figure 3-2 is representative of a utility with shock loads and high variations of OLR.

6/1 8/1 10/1 12/1 2/1 4/1 6/1 8/1 10/1 12/1 2/1 4/1 6/1 8/1 10/1 12/1 2/1 4/10

20

40

60

80

100

120

140

160

OL

R (

Lb

s V

S/K

Cu

ft/

day

)

Daily Data (6/1/2009 - 4/30/2012)

ND OLR

SD OLR

Design Ave. Day (from Elmhurst Digester Design Manual)

Recommended OLR (Metcalf and Eddy, 2003)Shock Loads

Figure 3-2. Representative Plot for Historical Data of OLR Variations and Shock Loads.

3.1.1.4 Ratio of Primary Sludge to Waste Activated Sludge (PS:WAS) Solids in Feed Sludge

A high proportion of PS can increase gas production rates, leading to more gas bubbles available to cause foam in presence of surface active agents. A high proportion of waste activated sludge (WAS) in the feed sludge can also lead to foaming, especially if it contains foam-causing filaments. Thickening in gravity belt thickeners (GBTs) or other mechanical devices concentrates the foam-causing filaments in the WAS. Besides the risk of foaming, a high proportion of WAS in the digester feed not only reduces the gas production rate, but also increases concentration of less digestible solids which can stabilize the gas bubbles and cause persistent foam. A universal optimal PS:WAS solids ratio has not been established and thus needs to be monitored closely in each digester. Literature suggests that foaming could occur if the ratio of WAS to total sludge exceeds 40% (or feed PS:WAS solids ratio of 6:4) but supporting full-scale data is not available.

It is important to maintain trend charts for historical data for PS and WAS flows and TS and VS concentrations for each. Based on these flows in digester feed, foaming dates can be correlated to determine if the PS:WAS solids ratio can be considered to be a cause of foaming in

3-4

the ADs. Figure 3-3 is representative of a utility’s historical trend charts showing significant variation in the WAS content (hence PS:WAS solids ratio) in the feed sludge.

1/1 4/1 7/1 10/1 1/1 4/1 7/1 10/1 1/1 4/1 7/10.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

WA

S S

olid

s in

Dig

es

ter

Fe

ed

(%

)

Daily Data (1/1/2010 - 8/1/2012)

WAS Solids in Digester Feed

Figure 3-3. Representative Plot for Historical Data of WAS Content in Feed Sludge.

3.1.2 pH/Volatile Acids/Alkalinity With respect to AD foaming, high VAs concentration has been identified as a contributor to foaming when there is a primary cause such as filaments in the feed sludge. Alkalinity in the feed sludge or digester contents has not been directly implicated to be a primary cause of AD foaming.

The VA-to-alkalinity ratio is the parameter used to detect imbalances in an AD. This ratio should be less than 0.25 to maintain the pH required for methanogenesis, and should be less than 0.15 for stable operation of the digester. Though these numbers have been reported to vary, this parameter has been used to predict foaming by several utilities by simply looking out for widely variant values. Both VAs concentration and VA-to-alkalinity ratio monitored during the presence and absence of foaming in the digesters can indicate if VAs are contributing to the foaming. Such patterns however are not noticed in all utilities. During our full-scale case studies, in analyzing historical data, during severe and persistent foaming, no inconsistencies were observed in the VA/A ratio, which remained consistent and well within the levels mentioned.

Figure 3-4 shows a representative plot of VS load vs. VA/A ratio where in April 2011 there are spikes in both parameters, though it is unknown if they correlated to a foam event. Even though the VA/A values are well within acceptable ranges as mentioned above, there is a spike in VA/A ratios in April 2011 corresponding to the VS overload. In such cases where the VS load has caused the VA-to-alkalinity ratio to increase as in this plot, this suggests it’s possible that VAs levels themselves may simply be the supplementary factor with the VS loading as the primary contributor for the problem foam episodes in this case.


7/1 9/1 11/1 1/1 3/1 5/1 7/1 9/1 11/1 1/1 3/1 5/1 7/1 9/1 11/10.02

0.04

0.06

0.08

0.10

0.12

0.14

0.16

VA/A Ratio

VS Feed to Digester

Daily Data (7/1/2010 - 11/30/2012)

VA

/A R

ati

o

0

5000

10000

15000

20000

25000

30000

35000

VS

Fe

ed

to D

ige

ste

r (L

bs

/da

y)

Figure 3-4. Representative Plot for Historical Data of Correlations Between VA/A Ratio and VS Load.

3.1.3 Gas Production/Pressure Digester gas production and gas pressure can be used as an indicator of foaming. If a digester is foaming, high biogas production aggravates it. However, increase in gas production rate combined with inefficient mixing causes foam to rise, ultimately into the gas collection system or overflow out of the digester.

Evaluation of fluctuations in gas production measured at each digester usually can be a direct indicator of foaming. But if only combined biogas flows from all digesters are available, such combined values are not representative of gas flow fluctuations from an individual digester. It may be useful to note if the foaming events appear to have occurred during low as well as high gas production rates and detect any trends.

As a general rule, unusual spikes or decreases in gas production should be monitored. Runaway ranges in gas production or pressure levels should be monitored and checked if they correspond to foam events. A long term foam monitoring method based on gas pressure is detailed in Section 3.3.3.2. Figure 3-5 is a sample plot of both the pressure transducer level as well as the gas pressure gauge readings. In this case, the transducer level did not indicate higher levels during the foam event because it did not sense the foam layer on top of the liquid layer. Typically, evaluations of fluctuations in digester gas pressure provide good indication of foaming incidence; however it must be verified and correlated with problem foam events in each utility.

3-6

1/1 4/1 7/1 10/1 1/1 4/1 7/11.2

1.4

1.6

1.8

2.0

2.2

2.4

2.6

2.8

3.0

Transducer Level

Gas Pressure

Daily Data (2011 - 2012)

Tra

ns

du

ce

r L

ev

el (f

t)Foam Event

5.0

5.5

6.0

6.5

7.0

7.5

Ga

s P

re

ss

ure

(in) H

2O

Figure 3-5. Sample Plot of Gas Pressure and Transducer Levels in Digester.

3.1.4 Temperature Foaming in digesters could be related to temperature fluctuations due to intermittent feeding or inefficient mixing to maintain uniform contents within the digester. It is important to maintain a mesophilic temperature with as minimal variations as possible. In the event, that the digestion temperature is significantly higher during summer months, the digestion rates could increase causing high gas production rates leading to digester gas production effects on foaming. Such seasonal effects on foaming can be identified easily by correlating temperature and foam events. Seasonal effects also impact filamentous foaming; so such patterns must also be correlated to filament presence.

3.2 Sampling for Foaming Potential Measurement and Foam Causing Constituents

All day-to-day monitoring should be carried out by each utility, as it is done usually, during any special sampling to investigate AD foaming. The following sections present the details of sampling for AD foaming related investigations.

3.2.1 Sampling, Storage, and General Considerations All feed and digester content samples should be labeled with the name of the responsible party, date of collection, and identity of the sample. Samples must be collected in plastic containers, preferably sterile. Samples should be stored at 4°C until analyses. For microbiological staining procedures, activated sludge mixed liquor (ML)/WAS should be sampled into a sterile sample container in which there is an air space at least equal in volume to the sample volume. A minimum sample volume should be 25 mL. Digested sludge may not stain properly unless diluted with DI water. For Fluorescence In Situ Hybridization (FISH) analysis,


samples of activated sludge ML and anaerobically digested sludge should be collected into sterile containers and mixed with 95% ethanol (1:1 v/v) whenever possible (sample fixation), immediately after sampling, and stored at 4°C . All samples must be fixed immediately on collection; failing which, they should be kept in plastic containers in a cold storage at 4°C for no more than 48 hours. Table 3-2 lists the details of the samples and additional analyses to be conducted for AD foaming investigations.

Care must be taken to ensure that the samples analyzed correlated exactly with the daily monitoring data of the utility (VS, TS, Alkalinity, gas production, etc.). Ideally it is desirable to obtain samples at regular sampling intervals. However, the basic requirement for getting a good understanding of foaming issues would be a sampling of foaming and non-foaming incidents from the same sampling locations and same sampling instances, whenever possible.

Figure 3-6 is a general schematic showing sampling locations in the sludge processing train in a typical WRRF. Individual sampling locations in each plant may vary but the samples should be representative in nature to those listed here.

3.2.2 Experimental Protocols

In order to better understand digester foaming and to correlate foam properties to plant operational data, laboratory analyses should be performed on samples collected. These characterization methods used are either physical or biological methods (Table 3-2). Other tests can be performed as necessary.

3-8

Figure 3-6. General Schematic of a Sludge Treatment Train with Representative Sampling Locations.

Legend of the Sampling Locations/Samples: Feed Samples should be collected prior to Primary Clarifiers. A. Primary sludge (PS) sampling PS should be sampled from the outlet of the process and before any mixing/ blending tank. B. WAS sampling WAS will be sampled from the outlet of the thickening process and before any blending tank. C. Digester feed sludge sampling Feed sludge samples will be collected from an outlet after the blending tank and upstream of the digester. The feed sludge in most cases is a mixture of primary and WAS along with any hauled sludge imports each site would receive. D. Digested sludge sampling Digested sludge samples will be collected either from an overflow pipe on top of the digesters or from a pipe outlet before the centrifuges or filter presses or storage tanks, depending on each site’s available sampling point. E. Separate samples of foam (if and when available and possible to collect).

Denotes sampling location


Table 3-2. List of Physical and Biological Characterization Methods.

Test Samples Method Purpose

Physical Characterization Methods

Foam potential WAS, different ratios of PS:WAS in digester feed, digester contents.

Aeration method. Foaming potential of samples from WRRFs that have established or suspect their foaming is due to biological causes. Estimate foaming potential of different PS:WAS ratios to see how WAS may influence foaming potential in specific cases.

Biological Methods

FISH WAS, digester contents, digested sludge, foam.

Standard methods with pretreatment and extended hybridization time.

Determining filament type in WRRFs that have established or suspect their foaming is due to filaments.

Gram stain WAS, ML. Standard methods. Determining filament type in WRRFs that have established or suspect their foaming is due to filaments.

3-10

3.2.3 Physical Methods – Foam Potential (Pagilla et al., 1997) The most widely used technique for assessing the foamability of sludge is to measure foam potential. Practical difficulties exist in measurement of foaming potential/stability as it quickly loses its stability once removed from the tank. Investigation of foaming in samples requires foam that remains stable long enough to be measured under conditions that mimic as closely as possible to those experienced within the AD. For this method to be effective foam potential thresholds and foaming scales should be developed for specific plants. Their use across other plants requires observing the conditions in each case for a considerable period of time and determining foam potential values that may effectively represent non-foaming and foaming conditions.

Equipment/Materials 2 L graduated cylinders (available in any lab or lab supply store), transparent plastic air tubing (available in a pet store/aquarium supply store), aquarium air stone diffusers (available in a pet store/aquarium supply store), aquarium air pumps that can maintain air flow rate (available in a pet store/aquarium supply store), plastic fittings, and graduated ruler to measure height.

Setup of Foam Potential Equipment 1. Attach the air stone diffuser to one end of tubing (Figure 3-7).

Figure 3-7. Air Stone Diffuser Attached to Tubing.

2. Drop the tube all the way to the bottom of the cylinder so that it touches the bottom of the graduated cylinder before filling the sludge into the cylinder.

3. Connect the other end of the tubing to the outlet of the flow meter.

Figure 3-8. Connection to Air Flow Meter.


4. Connect the other outlet of the flowmeter to the pump outlet.

Figure 3-9. Connection to Aquarium Air Pump.

5. Complete setup shown in Figure 3-10.

Figure 3-10 is a picture of severely foaming digester sludge. The graduated cylinder to the far left is digester sludge (digester contents) without the addition of a defoamant or polymer. The four graduated cylinders to the right contain varying doses of defoamant.

Figure 3-10. Setup of Foam Potential Equipment.

Notes: The air stone diffuser tubing should always be at the bottom of the cylinder before pouring

the sludge in so as to not impact sample height. Air flow should be maintained at 1.5 l/min or 3.2 scfh throughout the experiment (See

procedure below). Air flow can be set by adjusting the knob on the flow meter.

3-12

Digester Foam Potential Measurement Procedure 1. Collect 1.0 L of sludge from each sampling point.

2. For each sludge sample, set up two 1 L graduated cylinder with a fine bubble diffuser hooked up to an aerator. Samples are tested in duplicate.

3. Connect a flow meter to the fine bubble diffuser tubing to regulate the air flow.

4. Pour sludge to the 200 mL mark of the graduated cylinder.

5. Measure the initial height (in cm) of the liquid in the graduated cylinder with a ruler.

6. Aerate the sludge sample in the graduated cylinder for 30 minutes at an air flow of 1.5 L/min

7. Keep track of the foam height in mL reached in the graduated cylinder throughout the 30 minutes of aeration. Record the highest level of foam reached. Make observations on the appearance of the sludge and how stable the foam appears to be. This maximum level of foam reached in the graduated cylinder is used to calculate the unstable foam ratio.

8. After the 30 minutes are complete, turn off the air and wait one minute.

9. Remeasure the height in mL of the foam in the graduated cylinders after the one minute is complete. This settled foam height in the graduated cylinder is used to calculate the stable foam ratio.

10. Foaming potential was calculated in terms of an unstable foam ratio, shown as Equation 3-1, and a stable foam ratio, shown as Equation 3-2.

(mL) Sludge Ht.of Initial(mL)Height Foam MaximumRatio Foam Unstable (3-1)

(mL) Sludge Ht.of Initial(mL)Height Foam SettledRatio Foam Stable (3-2)

Sample volumes can be used instead of heights for both values. These values should be determined long term so that foam severity scales can be developed for each plant and threshold foam values can help predict foam episodes. An example of a suggested foam severity scale used in this study to describe AD foaming is given in Table 3-3.

Table 3-3. Example of a Foam Severity Rating Scale.

Foam Rating Stable Foam Potential Ratio Unstable Foam Potential Ratio

Non-Foaming 0-0.1 0-1.0

Mild Foaming 0.1-0.3 1.0-2.0

Foaming 0.3-0.5 2.0-3.0

Severe Foaming > 0.5 > 3.0


3.2.4 Biological Methods Biological methods are used in determining the presence of foam causing filamentous microorganisms. 3.2.4.1 Gram Stain Procedure Gram stain differentiates organisms according to whether or not they can hold blue/purple stain after decolorization. Gram positive bacteria hold the color; Gram negative bacteria do not. The kit can be bought from Sigma Aldrich or any other lab chemicals supply and contains the following.

Gram #1: Crystal Violet

Gram #2: Gram’s Iodine

Gram #3: Decolorizer

Gram #4: Safranin

DI water

Procedure 1. Spread one drop of well-mixed sample evenly over approximately 50% of the area of the

microscopic slide. Air-dry the sample at room temperature. After the sample is dry it can be stored for long periods of time and stained later.

2. Apply Gram #1 for 1 min, rinse with DI water quickly. 3. Apply Gram #2 for 1 min, rinse with DI water quickly. 4. While holding the slide at a 45° angle, wash out the violet color with Gram #3 added drop-

by-drop until the violet color stops coming off the slide up to a maximum of 25 seconds. Rinse quickly with water and blot dry.

5. Apply Gram #4 for 1 min, rinse well with DI water and blot dry. 6. Examine under oil immersion at 1000X magnification with direct illumination (not phase

contrast): blue-violet is positive; red is negative. Some organisms could have a variable response.

7. Sample images are shown in Figures 3-11, 3-12, and 3-13.

3.2.4.2 FISH Analysis FISH is a phylogenic staining technique using labeled nucleotide probes to target

ribosomal RNA of microbial cells in fixed samples. The method involves application of oligonucleotide probes to permeabilized whole microbial cells. The probes that are designed to specifically target narrow to broad phylogenetic groups enter the cells and specifically hybridize their complementary target sequence in ribosomes. Cells containing hybridized probes are observed under epifluorescent microscope and the target organisms can be detected by the characteristic fluorescence. Probes for common foaming causing filaments are listed in Table 3-4. The standard protocols are modified specifically for identification of filamentous bacteria such as mycolata (genera Nocardia) and Microthrix parvicella (MPA).

3-14

Figure 3-11. Sample Gram Stain Image Indicating Absence of Filaments – M. parvicella or Nocardioforms.

Figure 3-12. Sample Gram Stain Image Indicating Presence of M. parvicella.


Figure 3-13. Sample Gram Stain Image Indicating Presence of Nocardioforms.

Table 3-4. List of Probes Used for Filamentous Organisms.

Target Organism

Probe

Sequence and Flurophore

Pretreatment

Formamide concentration

(%)

Mycolata Myc657 /5Cy3/AGTCTCCCCTGYAGTA Acid hydrolysis 30

Gordonia (G) (Nocardia)

Gor596 /56-FAM/TGCAGAATTTCACAGACGACGC Acid hydrolysis 20

Microthrix parvicella MPAmix Lysozyme+ Achromopeptidase +/ acid hydrolysis+ Extended Hybridization time.

20

MPA60 /5Cy3/GGATGGCCGCGTTCGACT

MPA223 /5Cy3/GCCGCGAGACCCTCCTAG

MPA645 /5Cy3/CCGGACTCTAGTCAGAGC

Bacteria EUB338 GCTGCCTCCCGTAGGAGT/3-6FAM/ 20-35

Standard FISH protocols can be found in several sources (Oerther et al., 2001; Amann et al., 2008). Slides are observed with Olympus BH2-RFC microscope equipped with mercury lamp and following dichromatic filters:

Green – Olympus custom made filter cube (exciter D480/30x, dichroic mirror DM500, and barrier D535/40m)

Red – Omega filter set XF101-2 (exciter 525AF45, dichromic mirror 560DRLP, and barrier 565ALP)

3-16

Examine under oil immersion at 1000X magnification with fluorescent illumination, preferably in complete darkness. Minimize exposure to illumination by blocking the light path when not directly examining the sample. Sample FISH images are presented in Figures 3-14, 3-15, and 3-16.

Figure 3-14. Sample FISH Analysis Image with a Stain Indicating EUB (All Bacteria) and Presence of MPA (M. Parvicella)

(Both 1000X Epifluorescent Illumination).

Figure 3-15. Sample FISH Image Indicating Absence of Both G. amarae and M. parvicella.


Figure 3-16. Sample FISH Analysis Image with a Stain for EUB (All Bacteria) and MYC (G. amarae). Variable Fluorescent Response of G. amarae – Yellow Results in the Overlap of EUB and MYC Signals.

Dark Orange is a Result of Single MYC Fluorescent Signal (Both 1000X Epifluorescent Illumination).

3.3 Long-Term Monitoring/Detection of Foam Events

Monitoring and detecting digester foam is a practical challenge. Early detection of foam is important so that it does not become a major problem event and to reduce the impacts of foaming incidents.

Table 3-5 lists the parameters/characteristics that should be measured during a foam episode in utilities with seasonal/occasional foaming. For utilities with persistent foaming, it should be carried out long term to determine the threshold values for foam initiation. These parameters could serve as possible indicators for foam events.

There is widespread notion that foam within the digester cannot be sensed reliably and that conditions inside digesters make it difficult to sense foam. The nature of the foam also creates problems with detection. Over time a thick layer of conducting material builds up in the head space. Such build-up causes fouling of sensors that may be installed in digesters, indicating the need for robust components in the digesters. In the absence of instrumentation, utility personnel can observe patterns in operational data or other signs in digester operation that can possibly serve as an indication of foam, a guide for which is discussed in the following section.

3.3.1 Foam Detection by Monitoring and Testing of Digesters or Contents Foam detection patterns may or may not be noticed in all plant(s) ADs unless and until the

foaming event causes operational problems or foam is visually observed. Monitoring of fluctuations in feed patterns or simply monitoring feeding patterns can help understand and reduce foam incidents. AD plants can also predict their foaming incidents by monitoring the digester feed and digested sludge. Seasonal temperature variations help in predicting foaming due to WAS

3-18

filaments where the episodes are fairly predictable with foaming in winter or spring in some plants.

In the ADs where foam usually enters the gas lines and disrupts gas collection and treatment, usually operators would be unaware that the foam is reaching the gas line until it happens. However, one utility found an easy and reliable way to automatically detect when foam enters the gas line and before it disrupts the gas handling/cleaning operations downstream in the gas line. This method is based on foam separator drain water temperature sensing and is discussed in the following section.

Another practical indicator based on gas production is large variability in operating pressures in some ADs. The pressures would fluctuate drastically with severe foam spilling out of the digester covers. Pressure release occurred with dozens of pressure swings occurring each day in a plant’s ADs. During normal operation, the digesters were operated at 8 inches of water column with only mild foaming. Other easy and possible observations that should be considered by plant operators for foam indication include change in appearance of digester supernatant, spikes in gas production and sudden drops in gas production in various utilities.

Other strategies include use of sight glasses on digesters. While an economical and simple option, conditions inside digesters make it difficult visually to spot foam. The use of a sludge-judge/zone sampler is also a viable option to sample different lengths of a digester to detect foam (see Section 4.2.2.2). It is important to ensure that the sludge judge is used to sample at different intervals above the liquid level to detect foam.

Table 3-5. Threshold Limits of Operational Parameters/Characteristics to be Monitored Long-Term.

Parameter Threshold Limits

Digester Organic Loading Rates (OLR)

0.10 to 0.15 lbs VS/day/ft3 of the digester volume. OLR variations to the digesters should be maintained lesser than 20%. Specific OLRs must be estimated from digester operational data and consistent levels maintained. OLR above which foam occurs should be recorded.

PS:WAS Solids Ratio Ratio of PS:WAS on a solids basis should be monitored. Ratio above which foam occurs should be recorded.

VA/A Ratio

0.1 to 0.4 indicate a healthy digester. Values above 0.4 indicate upset conditions. Very high variations in VA/A should be monitored. Ratio above which foam occurs should be recorded.

Temperature Mesophilic range – Rapid fluctuations in operational temperature should be avoided. If foam is seasonal, ambient temperature variations must be recorded.

Gas Production Rates

Digester specific. Spikes or decreases in gas production should be monitored. Runaway ranges in gas production or pressure levels should be monitored and checked if they correspond to foam events.

Foam Potential Digester specific. Utilities with persistent foam episodes should measure foam potential and identify threshold values based on long term measurements. Scales of foam magnitude similar to Table 3-6 could help utilities predict their foam episodes and control them effectively.

Mixing Frequency and Power

Digester specific. Not possible to optimize without tracer or CFD model of specific digester and mixer type. Effectiveness monitored with VSR, gas produced and digester depth profiling (TS, temperature, VA/A ratio).


Table 3-6. Example of a Foam Severity Rating Scale.

Foam Rating Stable Foam Potential Ratio Unstable Foam Potential Ratio

Non-Foaming 0-0.1 0-1.0

Mild Foaming 0.1-0.3 1.0-2.0

Foaming 0.3-0.5 2.0-3.0

Severe Foaming > 0.5 > 3.0

3.3.2 Detection Using Sensors and Associated Instrumentation The main challenge in the detection of foam in ADs by sensors is the presence of the foam layer at the surface. Typical instruments only measure the level of liquid in the digester, and will not be effective during foam events where the foam layer increases while the liquid layer underneath remains unchanged or increases very little. The most common way to address this option would be to use a combination of two sensors – one installed at the top (Radar, ultrasound, etc.) and the other at the bottom (mostly a pressure sensor) to work in conjunction with each other to determine foam levels. RADAR indicator at the top and pressure level indicators at the bottom of the digesters have been used successfully in a few digesters.

Table 3-7 lists the common foam sensors available commercially for potential consideration in ADs.

3.3.3 Examples of Specific In-House Foam Detection/Monitoring Methods

Several utilities have been monitoring their ADs for foam and have established foam detection/monitoring systems that have served as early warning systems in the case of AD foaming. Two such systems are discussed in this section. These methods could potentially be implemented in other utilities easily. Preliminary evaluations and monitoring of the utility for a considerable period of time during foam and non-foam conditions should be carried out to ascertain that such in-house systems are indeed effective in each specific case.

3-20

Table 3-7. Summary of AD Foam Sensors.

Sensor Technology Use in AD Foaming Full-Scale Installations

Comments

Impedance measurements. The foam sensor operates by passing a small alternating current through the foam under test and measures impedance.

Yes; The impedance of the material being sensed is used to determine when foam or liquid is present.

Unknown The pricing is dependent on the length of the sensor required (determined by the design of the digester) and the required fitting for inserting the probe.

Acoustic waves of high power and low frequency

Unknown; Presence of gases in digester headspace will affect the speed of sound and cause ineffective detection (Vanrolleghem and Lee, 2003).

N/A Manufacturers detail possibility of use in ADs.

RADAR measurement sensor Yes. Full scale installations report effective sensing of digester foam.

1. IQ160 installed in Joint Water Pollution Control Plant (JWPCP) located in Carson, CA. 2. SIEMENS Sitrans LR200 installed in Truckee Meadow Water Reclamation Facility in Reno, NV.

RADAR liquid level indicator was installed in addition to pressure level indicators installed on the bottom of the digesters. Under no foam conditions the two liquid level indicators would read the same level. During a foam event the radar indicates the foam as liquid level and would show the foam level increasing, and the pressure level indicator remains unchanged. Thickness of foam layer on the sludge is the difference in the pressure indicator and the radar liquid levels.

Ultrasonic detection for foam Only detects liquid levels. Possibly ineffective for foam. Absorption of the signal by the CO2, CH 4 and H2S gases in the headspace has been reported (Ackman et al., 2006).

Prior to RADAR, Joint Water Pollution Control Plant (JWPCP) had ultrasonic detectors in their digesters.

Presence of dust, vapor and gases etc. interferes with performance.

Liquid level measurements – conductivity switches; differential pressure transducers; capacitance measurements (Vanrolleghem and Lee, 2003)

Differential pressure and ultrasonic equipment give a continuous signal, the latter being more precise but also sensitive to foam.

Most common sensors present in digesters.

Again, the issue is sensing the foam layer on top of the liquid layer, which can be overcome by using a pressure sensor at the bottom of digester in addition to any of these sensors on the top. Thickness of foam layer on the sludge is the difference in the pressure indicator and the top level measurement.


Table 3-7. Summary of AD Foam Sensors.

Sensor Technology Use in AD Foaming Full-Scale Installations

Comments

Float – It contains a small ball which floats, indicating foam level. It also provides a seal on the outlet of gas collection valve. This float ball will prevent the foam entering the gas line eliminating the need to drain the foam.

Used in beer fermenters and large Storage kegs. Possibility of use in digesters.

N/A

Fairly simple equipment. Moving parts may need special Construction for service inside digester.

Laser Possibility of use in digester. N/A Presence of solids can scatter laser beam and backscatter the laser light.

Thermal Possibility of use in digester. N/A Thermal conductivities of interfaces involved need to be vastly different so that equipment can be calibrated to sense level of foam layer.

Phase Difference Sensors/Vibrating Switches/Tuning Forks

Possibility of use in digester. N/A Material buildup can cause fouling and prevent operation.

3-22

3.3.3.1 Foam Separator Drain Temperature Difference Gas/foam separators utilize water sprays that drain the foam and help collection of the gas from the top. The strategy includes monitoring the trap-drain temperature to identify the occurrence of foaming events in real time. Presence/absence of foam has been detected using foam separator trap-drain temperature differences between the spray water and that of the digester foam entering the gas trap.

An example of this method that has been used successfully in Oceanside plant (OSP) in San Francisco, CA is shown in in Figure 3-17. The gas line at the top of each digester has a sampling line, which is connected to a pressure sensor. This sensor records the gas pressure in the digester head space in inches of water column. In case of floating covers, the gas pressure in the digester head space is controlled by the weight of the floating cover on the gas holding tank. A gas flow meter is located further down the gas line, after the gas has flowed through the foam separator down to the basement of the digester complex. A level sensor on the discharge sludge line located 5’ above the draw-off valve at the bottom of the digester measures the sludge level in the digesters. The level sensor measures the hydrostatic pressure exerted by the sludge column in the discharge sludge line and expresses it in feet of water column. The level sensor is calibrated using the density of pure water at 95°F. This sensor does not potentially measure the effective density of the sludge, severely complicating the detection of foaming events.

A new real time measurement technique was developed for SF’s OSP to identify foaming events when the foam enters the gas line and hence foam separator drain. A temperature probe has been placed in the foam separator drain. Because of the large temperature difference between the recycled water (W3) used to shower the gas (55-72°F) and digester sludge (95°F), foam solids mixing with the foam separator water flow produced measurable changes in temperature, which indicates foaming. The accuracy of this method should be verified visually and by comparing the temperature probe data with the digester level data. The temperature of the water showered onto the foam should increase as the measured digester level increases. This is illustrated by a snapshot from the datalogger systems wherein the temperature greater than 72°F indicates that foam/sludge solids are reaching the digesters gas line (Figure 3-18). This threshold indicator temperature will vary in each specific utility based on process and ambient conditions.

The accuracy of this method should be verified visually and by comparing the temperature probe data with the digester level data for historical time periods, to ensure that the monitoring method effectively detects foam episodes in other plants.


Figure 3-17. Layout of the Foam Separator Drain Temperature Foam Monitoring Method.

Figure 3-18. Sample Temperature Datalogger and Sludge Level Sensor Data.

Vertical Arrows Indicate Temperature Differences Correlating Past Foam Events. (DCS – Data Collection Systems).

3-24

3.3.3.2 Foam Monitoring and Sensing by Pressure/Level Sensors Foam levels in the digesters can be monitored by means of pressure/level sensors in the

digesters. This method has been used successfully in Marquette WRF in Marquette, MI. Figure 3-19 is a process screen shot of the level transducers in Marquette. The yellow line indicates secondary Digester 3 level and the green and red lines indicate levels in primary Digesters 1 and 2. The highpoint in the yellow line indicates that foam had expanded into the digester domed ceiling causing overshooting of the pressure sensor to off-chart levels. Utility personnel can potentially monitor these levels to predict foaming to determine if their digesters are foaming before the foam starts to overflow from the digesters, thus averting major foam episodes.

Figure 3-19. Process Snap Shot of Level Transducers Indicating Runaway Pressure Levels

Due to Foam Hitting the Digester Dome Cover.

Foam Event


CHAPTER 4.0

STEP 3: PREVENTION AND CONTROL METHODS

Based on the historical data analyses as well as the laboratory analyses, the primary causes or contributors for the digester foaming can be reasonably determined in order to implement mitigation and prevention measures. In the practice of AD foaming control and prevention, various methods have been used, sometimes without a strong scientific basis. Merely tweaking operational parameters such as feed rates and temperatures have worked in a few cases and failed in many. The most common and possibly the most effective methods used are modifications to operation of processes with respect to AD and secondary treatment facilities.

As the causes of foaming outlined have been classified to be related either to feed characteristics including presence of foam-causing microorganisms, or operational factors, the control methods address these factors. Broadly, the most commonly used methods are classified into three categories, each addressed in this section – feed sludge disintegration or hydrolysis (physical/chemical/mechanical methods) to destroy filaments in WAS, modification of operational conditions to minimize conditions conducive to foaming, and addition of chemical antifoaming/defoaming agents to control foam that has occurred.

Control strategies can be further classified as specific or non-specific methods. The non-specific methods comprise sludge disintegration techniques such as application of hydrogen peroxide or chlorination. Any method whose effects are temporary and do not remove the root cause of the problem are termed non-specific. Specific methods are preventive methods that can offer long term control of foaming by removing the root cause of the problem. If digester foaming causes remain unknown for any reason, non-specific methods may be useful in those cases.

4.1 Sludge Disintegration Methods (WAS Pre-Treatment Methods)

Certain types of sludge disintegration could help mitigate digester foaming if the feed sludge characteristics are the primary cause of AD foaming. In case of filamentous foaming, these methods might prove to be completely specific, as most of these methods can lyse and hydrolyze the cells to various extents. Before feeding to the ADs, the filamentous sludge can be pre-treated to destroy filament cells. Even if complete destruction of filaments does not take place, reducing the number of filaments to a level where filamentous foaming does not upset digesters seems to be achieved by these means. Sludge disintegration can be mechanical, physical or chemical as outlined in this section. Sludge disintegration methods are summarized in Table 4-1.

4.1.1 Acid Phase Digestion (Biological Lysis) Biological lysis of filamentous sludge can be accomplished in an acid-phase digester prior to feeding the AD; this method has been shown to reduce the filament count in sludge due to cellular destruction. Observations at other utilities indicate that the acid phase digestion is effective in reducing the count of G filaments. Fate of M. parvicella filaments in acid phase digestion is unknown. However, it is critical to establish the feed rate of the acid phase sludge into the gas phase digester where it does not cause foaming as several acid phase plants also are

4-2

known to experience foaming, arising from operational issues. Filaments that are hydrolyzed still retain some foaming properties until they are converted into soluble, non-foaming products. In addition to filament destruction, two-phase digestion allows increased VS destruction, higher biogas production, and lower sludge production. In conjunction with surface wasting, acid phase digestion can provide the necessary filamentous foam destruction prior to AD to mitigate AD foaming.

4.1.2 Physical Lysis These methods involve physical destruction of or imparting physical damage to the filament cells. The effectiveness of a physical lysis process is evaluated in terms of its ability to completely destroy the filament rather than just killing it because even the non-viable filament fragments tend to cause foaming in digesters. Technologies listed in Table 4-1 are the common ones available for AD foam prevention, with varying degree of success in foaming control.

4.1.2.1 Considerations for Sludge Disintegration Alternatives Separate pre-treatment of WAS to destroy filaments can be achieved only in utilities where it is not mixed with the PS prior to the treatment or co-settled in the primary clarifiers. Due to high capital and operating costs sludge pre-treatment technologies should be considered only after pilot scale demonstration of their effectiveness for each specific case. A summary of alternatives with potential for destroying foam-causing filaments or having a successful full-scale operation is listed in Table 4-2.


Table 4-1. Summary of WAS Pre-Treatment Alternatives.

Mitigation Alternative

Advantage

Disadvantage

Compatible with Biological

Nutrient Removal

(BNR) Process

Acid phase digestion Biologically reduced filament count.

Increase in VAs and in gas production.

Increased VA loading to second stage Ads.

Yes

Ultrasonic cavitation

Reduction in filaments

Increase in gas production

Reduction in sludge quantity.

High energy demand.

Need for specialized maintenance.

Not observed to reduce foam-causing filaments.

Yes

Electroporation (OpenCEL)

Damage or breakage of filament cell membranes.

Increase in gas production.

High energy demand.

High mechanical complexity.


Unknown if it mitigates AD foaming.

Yes

Mechanical cavitation

(Crown® Sludge Disintegration

System from Siemens)

High filament destruction.


Reduction in sludge quantity.

High energy demand.

High mechanical complexity.


Yes

Patented systems (THP from Cambi, or Biothelys from Veolia)

Destruction of foam-causing filaments claimed.


Increase in cake

dewaterability.

High energy demand


Yes

4-4

Table 4-2. Different Sludge Disintegration Methods for AD Foam Control.

Mechanical Methods Suggested Mechanisms Successes, Failures,

or Limitations Applicability in Full-Scale Utilities

Thermal hydrolysis (commercial manufacturers Cambi and Kruger)

Solubilizes the organic fraction of the sludge by elevated temperature and pressure.

No full-scale thermal hydrolysis installations in the U.S.

Thermal hydrolysis processes would be effective at breakdown of foaming biomass, due to the extreme pressures and temperatures employed. However, like other physical lysis technologies reviewed, significant energy input as well as operation at elevated pressure and temperature are required.

Direct steam injection Mixes precisely metered amounts of steam directly with a liquid or slurry, providing an instantaneous transfer of heat from steam to the liquid.

It is uncertain whether M. parvicella filament destruction will be achieved with direct steam injection. No full-scale installations in USA but one in Norway.

Method is specific towards G. amarae.

Pasteurization (commercial manufacturers Eco-Therm (Ashbrook) and BioPasteur (Kruger)

Both systems heat thickened sludge to 70°C for a minimum of 30 minutes to provide pathogen reduction.

One full-scale installation in the U.S.

Uncertain if M. parvicella filament destruction will be achieved.

Electric-pulsing (OpenCel) Focused high-voltage pulses of electricity to rupture the cellular membranes.

The only successful full-scale installation is at the Mesa Northwest Treatment Plant (Mesa, AZ).

Factors considered while evaluating this technology are the high energy demands, high mechanical complexity, need for specialized maintenance and common concerns related to using a proprietary technology. Unknown if foam causing filaments will be destroyed.

The Crown sludge disintegration system (Siemens) and Micro Sludge (Paradigm Environ. Technol.)

Cavitation through different means.

No full scale installations of Crown Sludge in the U.S. Micro Sludge has full-scale installations in New Zealand and Germany.

Both manufacturers claim the destruction of foam-forming filamentous organisms. Pressure drop causes cavitation and cell destruction. WAS is mixed, homogenized, pressurized, and forced through a disintegration nozzle, causing the cell structure to rupture.

Ultrasonic cavitation (Sonolyzer system (EIMCO), the DIRK power ultrasound system, and the Sonix system (Sonico)

Ultrasonic shock waves rupture the bacterial cell walls and reduce the particle size distribution of the sludge.

Two full-scale demonstration trials using the Sonix system have been completed in the U.S. Several full-scale installations of ultrasonic systems in Kavlinge WWTP and Gasslossa WWTP in Sweden.

Lower sludge disposal and increased biogas production. Changes some sludge physicochemical properties. Destroys the sludge-bulking filaments and not the foam-causing filaments. Reduction of AD foaming due to filaments has been claimed in some pilot- and full-scale installations.


4.2 Operational Modifications to Prevent or Control Foaming

Proper digester operational practices are essential for efficient operation of ADs and to control excessive foaming. Even if operational practices such as feed flow rate, feed quality, and mixing may not be identified as predominant factors causing foaming, such practices will minimize the magnitude of foaming that could be initiated by the filamentous bacteria or other primary causes.

4.2.1 Digester Feed Flow Rate and Quality Maintenance Following are the considerations for maintaining the feed flow rate and quality to the digesters to reduce the risk of foaming.

For the digester feed containing PS and WAS, the average VS loading rate should be maintained between 0.10 to 0.15 lbs VS/day/ft3 of the digester volume. OLR variations to the digesters should be maintained to lesser than 20% of the average rate. Regulating feed frequency can help in establishing a constant level of OLR to the digesters and equalize gas production rate that can mitigate foaming to some extent.

PS and WAS should be analyzed at least once a day for their TS and VS concentrations to track and evaluate variations in the OLR and in the PS:WAS solids ratio. Daily trend charts for the PS:WAS solids ratio should be maintained and updated, to keep track of any high variations in organic loading to the digesters.

TS concentration in digester feed should be maintained at consistent levels to prevent VS loading rate variations. A higher concentration may reduce the digester’s mixing performance and allow accumulation of thick sludge and grit at its bottom. Greater mixing intensity to compensate for high feed TS concentration could contribute to foaming and should be avoided. The solids concentration in the digester feed can be controlled at the gravity belt thickener.

If fats, oils, grease (FOG) and/or other hauled waste inputs are added to the digester, their feed to the digester should be as consistent as possible; controlling any slug feed of high strength wastes to the digesters.

All known industrial inputs should be monitored and recorded. Utilities should consider testing of feed sludge samples on periodic basis for foaming

potential so that proactive actions can be taken to control foam using other preventive measures outlined in this guidance document. This is especially important for utilities with sources of surface active material from commercial inputs in their feed streams.

4.2.2 Mixing Although, the importance of mixing is clear from many studies, its effect on foaming of

ADs is still poorly understood, and there is much conflict in the literature regarding the optimal mixing for AD. Continuous mixing is a contributor to foaming if other causes of foaming are present or aggravates foaming once it is initiated.

Mixing performance in ADs has been evaluated using the active and inactive regions of mixing in the digester, investigated with tracer studies and/or computational fluid dynamic (CFD) modeling (Vesvikar et al., 2005). However, this parameter alone cannot describe all types of mixing, since some are more effective than others in maintaining homogeneity in the digester. There are no defined standardized performance criteria for effectiveness of digester mixing, except these typical design parameters as listed in literature (Table 4-3). These design parameters

4-6

do not take into account sludge rheology as well as factor that mixing in AD is already accomplished via natural sources.

Table 4-3. Typical Criteria for AD Mixing Systems.

Mixing Criteria Type of Mixing System Values References

Unit power, HP/1,000 cf digester volume

Mechanical systems 0.2 to 0.3 Tchobanoglous et al., 2003; Appels et al., 2008

Unit gas flow, cfm/1,000 cf digester volume

Gas mixing, unconfined 4.5 to 5 Appels et al., 2008

Unit gas flow, cfm/1,000 cf

Gas mixing, confined 5 to 7 Appels et al., 2008

Energy input density, W/m3 Gas mixing 8 Tchobanoglous et al.,

2003; Appels et al., 2008

Velocity gradient G, s-1 All

50 to 80 Tchobanoglous et al., 2003; Appels et al., 2008

Turnover time, minutes

Confined gas mixing and mechanical systems

20 to 30 Tchobanoglous et al., 2003; Appels et al., 2008.

4.2.2.1 Mixing Optimization Since intermittent mixing seems to be most optimal in foaming ADs, shutting off the mixing system for a certain interval of time can help to control the magnitude of foaming. However, if the mixing system’s downtime is long, grit may accumulate at the bottom of the digesters and reduce the effective digester volume. Upon restarting the mixing system, the mixing energy may be insufficient to re-suspend the settled solids. Reduced mixing may also cause short-circuiting of sludge resulting in not meeting regulatory requirements for Class B sludge. Any changes to the mixing frequency should be as gradual as possible. Prior to shutting off mixers for extended periods of time, evaluations to digester performance in terms of VSR and gas production and depth profiles (if possible) should be carried out and monitored vigorously through the time they are not in operation. Procedure for digester depth sampling is described as follows.

4.2.2.2 Depth Sampling of Digesters Measurement of digester sludge TS/TVS values and temperature at different depths is used to assess the homogeneity of the digester and thus mixing efficiency. This task requires a minimum of two individuals for sampling, measurement and recording of data. Equipment/Materials Zone Sampler (sludge judge), thermometer, non-sparking wrench, labeled sampling bottles, appropriate personal protection equipment (PPE). Detailed Procedure 1. Carefully open the digester sampling port to slowly vent the internal pressure. If a wrench is

necessary, make sure it is a non-sparking wrench. 2. Gently lower the zone sampler through the sampling port to predefined depth to sample the

digester sludge. (Depth interval of 10ft from the top could be used and successive depths are 20ft, 30ft, 40ft …. till bottom is reached, depending upon sampler type ). Some samplers are marked with black tape at 5ft or 10ft intervals. Figure 4-1 is a schematic of an Egg-shaped digester (ESD) showing sampling locations along the depth. Figure 4-2 is a schematic of a


cylindrical digester showing the sampling locations as well as the values of TS and temperature along the depth.

3. Transfer sludge quickly from sampler to sampling bottles for immediate temperature measurement for every depth sampled.

4. Repeat the above steps until all designated depths have been sampled. 5. When finished, ensure the sampling port is tightly closed; otherwise sludge can rise through

the port and overflow out of the digester. 6. Perform TS/TVS as usual and any other analyses that may be required.

Figure 4-1. Schematic of Digester Depth Sampling at Regular Intervals.

4-8

Figure 4-2. Schematic of Digester Depth Sampling at Regular Intervals.

A modeling and/or tracer study may be undertaken to optimize the digesters’ mixing strategy. Computational fluid dynamics (CFD) modeling of mixing patterns in the digesters should be undertaken to evaluate mixing and foaming inter-relationship for each specific case. Complex three-phase transient models can help evaluate a foaming incident when the system is unstable. Such a model might help establish patterns between sludge rheology, mixing and foaming in digesters. The mixing strategy could then be modified to mitigate foaming as well as to improve mixing under normal operation. Scale up of pilot-scale mixing studies should be treated with utmost caution as they may not be most optimum for AD foaming although they can be optimum for AD performance and operation.

4.2.3 Liquid Level and Feed Flow Adjustment During a Foaming Event During a foaming incident, feed flow to the affected digester should be reduced and the operating liquid level inside the digester should be lowered. Based on headspace limitations above the normal liquid level, an operating level should be set such that foam building up would not overflow or enter gas lines. Draw-off lines in digesters can be used for level control and for prevention of the rising foam entering the gas collection system. At the same time, the feed flow to the digester should be reduced. The normal feed flow and operating liquid level should be resumed after the foaming incident.


4.3 Control of the Digester Physical Features

This section deals with modifications to the digesters that may be mechanical (addition of foam breakers, sprays, etc.) or changes to digester design (e.g., gas collection piping changes) to mitigate/control foaming or its effects.

4.3.1 Gas Piping If the capacity of the gas collection system is not sufficient to collect the biogas during high production rates, gas accumulates inside the digester headspace. Such high production and accumulation of gas could be accompanied by foaming inside the digester. Rapid fluctuations and unusually high values in digester gas pressure could be indicative of foaming. The most common problems with foaming are the intrusion of foam inside gas collection systems preventing gas collection and use.

Maintaining a constant pressure by allowing condensate and biogas to be quickly and effectively removed can contribute to foam mitigation. The system needs to be designed to allow the condensate to be quickly and effectively removed from the gas collection piping system. If gas/foam separators are used, they should be frequently checked for clogging. Most gas piping changes will not mitigate foaming but can ensure foam does not enter gas lines. Configuration of the gas collection system also affects the magnitude of foaming problems. In digesters with flat roofs and short lengths of the gas collection piping, it is possible that the foam is transported to the gas scrubbers more quickly. Gas piping should be at a higher distance from the roof, with higher slopes to deter foam from reaching gas collection systems. Changes to the gas piping configuration will not eliminate foaming in the digesters. However these measures can limit the foam from entering into the gas scrubbers and are a viable foam prevention measure. Figure 4-3 shows the configuration of a digester that has piping on a domed roof of an AD. Figure 4-4 shows the changes in piping in order to minimize foam in gas piping.

4.3.2 Foam Suppression Nozzle Installation Sludge spray nozzles at the surface of the AD are viable methods of foam control. Recirculated sludge flows from strategically placed spray nozzles help physically break the foam layer on the top of the sludge inside the digester. Sludge spray nozzles can be retrofitted to the existing sludge recirculation pumps or dedicated pumps could be used based upon available capacity. A detailed evaluation of pump capacity and nozzle placement in the digester is required for each specific case. A schematic of a typical sludge spray nozzle system is shown in Figure 4-5. Figure 4-6 shows the schematic of a single nozzle used in a foam suppression system. Sludge spray nozzle systems can be installed in conjunction with a foam detection control system to automatically control the pump or valve operation based on the foam level in the digester. Table 3-7 gives list of commercially available foam detectors and applicability to full-scale digester use.

Commercially available foam suppression nozzles could also be installed.

4-10

Figure 4-3. Schematic of Digester Gas Piping.

Figure 4-4. Schematic of Possible Changes to Digester Gas Piping for Mitigation of Foam Intrusion in Gas Lines.

Domed Roof

Pipe Slope is flat Distance from roof top

Domed Roof

Distance from roof top

Pipe Slope is increased


Figure 4-5. Schematic of a Nozzle Foam Suppression System. (Not to Scale)

Figure 4-6. Schematic of a 2-Inch Foam Suppression Nozzle Installed in a Digester.

Sludge Recirculation Pump (existing or new)

4-12

4.3.3 Automated Defoamer Addition Use of defoamers or anti-foaming chemicals is an effective control measure for utilities experiencing occasional AD foam episodes. Due to the operating costs associated with their use, as well as the fact that prolonged use decreases their effectiveness, defoamers should be used as remedial strategy to control foam after the foam event has begun or only very occasionally. Pilot demonstrations of defoamer effectiveness are necessary to determine appropriate defoamer type and dosage for each specific AD or plant.

A typical assembly for using defoamer as shown in Figure 4-7 includes a container that holds the chemical, a chemical dosing pump, a dosing pipe and a valve. The defoamer can be dosed at a single or multiple points directly into the digester, or into the suction side of the digester recirculation piping to ensure proper mixing. Figure 4-8 shows an example of a temporary field set-up in our full-scale study. A metering pump can be used to connect to the defoamer tank or container. Automatic dosing systems are also available where the foam sensor sends a signal to the controller to start defoamer pumping after the foam is detected. The use of defoamers in conjunction with a suitable automated foam detector/sensor is an effective foam control strategy, irrespective of the cause of the foam episode.

An automatic foam detector can be used by itself or in conjunction with the defoamant feed (see Section 4.4.3.2 for defoamers). But sensors should be pilot-tested in each case before installation. Table 3-7 gives list of commercially available foam detectors and applicability to full-scale digester use. If foaming is periodical or occasional, defoamers can be used successfully to control the foaming and this strategy can be a viable option for emergency digester foam control.

Figure 4-7. Typical Defoamer Pumping System Block Diagram. (Not to Scale)


Figure 4-8. Hunts Point Full-Scale Defoamant Addition Temporary Field Set-Up.

4.4 Control of Filamentous Foaming

A summary of alternatives to mitigate filaments associated foaming in the activated sludge (AS) process and their applicability is presented briefly in Table 4-4. The biological filament control methods that can be implemented to reduce or prevent filamentous foaming in the AS process are discussed in this section. For more detailed discussion on these methods, refer to literature including Jenkins et al., 2004.

4.4.1 Control of the Secondary Treatment Process and Associated WAS Foaming

Selection against foam-forming microorganisms through operational control becomes more complex in BNR systems where it is important to keep the system under strict balance to promote the growth of nitrifying organisms.

4.4.1.1 Solids Retention Time (SRT) Control Reducing the SRT can inhibit nocardioforms and M. parvicella growth but can also wash out nitrifying bacteria. In many cases, selective removal of the foam is also carried out (discussed later this section), hence removing organisms that caused the foaming problems. This in effect, reduced the SRT of the foam-causing filaments while maintaining a high enough SRT to achieve nitrification by bulk of the non-foaming AS. The filament growth may also be slowed by operating the secondary treatment process at or close to the minimum SRT required to meet the final effluent permits. Such operation requires a close control and monitoring of the SRT.

Control of the SRT in aeration basins can be accomplished by installation of an SRT meter for automatic sludge wasting. Automatic SRT control accounts for the continuous variations of solids in the aeration tanks and in the waste stream instead of daily readings. Such meters maintain the SRT close to the set/desired value. Schematic of a setup is shown in Figure 4-9. This measure should be considered in combination with other steps for G control in the AS process.

Defoamer Solution

Line to Digester Recirculation

4-14

Table 4-4. Summary of Filaments Control Alternatives in AS Process.

Mitigation Alternative Advantage Disadvantage Compatible with BNR Process

SRT control and reduction

Reduction in slow growing filaments such as Nocardia.

Improved process control

May affect nitrification and sludge handling capability

No

Use selectors (anoxic or anaerobic or aerobic) (Discussed in Section 4.4.1.2)

Can be implemented at all locations where foam can be separated from AS

Not proven for reducing all foam-causing filaments

Yes

Surface wasting of aeration tank foam, followed by separate treatment

Filament reduction in digester feed

Separate handling and treatment of surface wasted foam required

Yes

Use of oxidizing chemicals (chlorine or hydrogen peroxide)

Foam control and some reduction of filaments

Ineffective in several cases.

High dose kills useful organisms

High dose breaks floc releasing more filaments

Yes

Use of defoamers or polymers

Foam control

Polymers cause filament flocculation

Temporary solution

No reduction in filaments

Does not mitigate digester foaming since filaments are not reduced

Yes

Co-settling of WAS should be avoided in plants plagued with filamentous growth problems as the unsettled filaments will be unintentionally recycled to the AS process in the primary effluent. This, in effect, selectively increases the specific SRT of the filaments even though the bulk AS SRT is decreased.

4.4.1.2 Selectors Selectors are not explained here in detail, as that information is available elsewhere (Pagilla et al., 1996 b; Jenkins et al., 2004). Selectors have been the most common method to control G filaments in the AS process. Use of anoxic selectors aids control of G filaments. However anaerobic or anoxic selectors do not help inhibit M. parvicella growth, especially in the presence of long chain fatty acids (LCFA) in the wastewater, due to the organism’s ability to uptake these compounds for growth. Temporary selectors can also be carried out during seasonal filamentous foam events by turning off blowers in the aeration basins; though this operation is energy inefficient.


Figure 4-9. Schematic of an Automatic SRT Controller Set-Up.

4.4.1.3 Surface Wasting Surface removal of foam-causing filaments from the aeration tanks and other areas in the AS process can be considered to preferentially washout hydrophobic filamentous microorganisms from the mixed liquor suspended solids (MLSS). Removal of this foam would prevent recirculation of these filaments back to the aeration basins and their carry-over to ADs.

Even if SRT control cannot be carried out effectively, surface wasting from the aeration basin surface would remove a major portion of these filaments. Such foam should be removed by a surface wasting system and should be separately treated for filament removal before it is returned to the main treatment train. A schematic of a typical surface wasting system that could be installed in any return activated sludge (RAS) wells before sludge return to the aeration basins is shown in Figure 4-10. Similar adjustable weirs and skimmers can be used in the aeration basin channels.

Surface wasting can serve as the first line of defense against foam in AD. The following design objectives should be considered for the surface wasting.

Physically remove the biological foam from aeration basin surfaces to solids handling facilities.

Remove foam from the AS and RAS channels, etc. by surface wasting of foam. Isolate the surface waste stream from the recycle sludge streams. Avoid returning the waste stream to the primary or secondary treatment systems. Typical variations in surface water level in different channels where surface wasting is

practiced must be considered. If filaments are always present in AS, surface wasting must be considered even before any

significant foam appears in the AS, because threshold for filamentous foam in AD are much lower than in AS.

Surface wasting for filament control is a physical method for controlling G filaments and may not completely eliminate them. This control method works as long as the rate of filaments

4-16

removal by surface-wasting is maintained higher than the rate of increase of these filaments in the aeration basin (either by growth or recirculation).

Figure 4-10. Typical Schematic for Surface Wasting from RAS Well. (Not to Scale)

4.4.2 Influent FOG Control Filaments especially M. parvicella are known to grow well on LCFAs from FOG, and so a control of FOG in the aeration tanks influent could reduce filament growth in the AS system. Such reduction is possible by source control (e.g., hauled FOG), by improved removal in the primary treatment, or removal of lipid compounds by a pretreatment method such as floatation. Hauled FOG co-digested in the digesters is a better option than feeding it to the liquid treatment process where it could enter the aeration tanks if not removed in the primary clarifiers. In aeration tanks, under the conditions prevailing in anaerobic, anoxic and aerobic selector tanks, only a portion of LCFA is removed. The remaining LCFA under the completely mixed conditions prevailing at the aeration zone would stimulate M. parvicella and G growth. Currently, no cost-effective method exists that can effectively remove LCFA from influent water and treat it aerobically. Carry-over of FOG materials into aeration tanks causes additional oxygen demand in the aeration tanks and can also promote filament growth in the foam layer where the FOG accumulates. If FOG is fed to digesters, it must be fed at a steady rate and a maximum loading rate beyond which foam occurs should be estimated from historical operational data especially for plants who suspect their foam episodes may be due to feed quality.


4.4.3 Chemical Methods Where physical/chemical and/or operational means have been ineffective in control of foam, often antifoaming chemicals have been employed, with varying success. Anti-foaming agents or defoamers could be a potential solution for plants that experience very few and infrequent occurrence of foaming problems in AD.

4.4.3.1 Oxidizing Chemicals Chlorine breaks down cells and releases extracellular polymeric substances (EPS) or

biosurfactants produced by the microorganisms. Increase in chlorine dose may increase foam potential in both AS and AD, due to increased breakdown of the filaments from the sludge floc structure by the chlorine. Chemical compounds could also be harmful to the other micro-organisms in sludge. For this reason, frequent doses of chlorine should be avoided. Though chlorine may be used for bulking control, it should not be used for foaming control, since it could exacerbate the foam in the downstream digesters.

Other chemical treatment methods include addition of oxidizing chemicals such as hydrogen peroxide (H2O2) attacks the filament sections that are outside the floc structure and hence dosage must be controlled closely as to prevent damage to the other microorganisms. Such chemicals are directly added on top of the foam.

4.4.3.2 Antifoams/Defoamers Defoamers or antifoams can be used to control foam in the AS system. They are generally sprayed on top of the foam. Defoamers or polymers are best applied as a short term remedial control since long-term, continuous use can be expensive along with long-term process impacts. With respect to G. amarae, antifoams can also be used initially to control the foaming, but it is not recommended for continuous use as they are traditionally mixtures of hydrophobic liquids and solids that may lose effectiveness if continually applied. In most cases, M. parvicella foaming does not seem to be mitigated by antifoam dosages.

4.4.3.3 Polymers/Salts Certain coagulants and flocculating polymers are specific to mitigating M. parvicella foam but non-specific to foam caused by G. amarae MYC. Poly-Aluminium Chloride Salts (PAX) -14 is the most popularly used polymer in this regard. Similar to defoamers, they should be used only occasionally.

4.5 Digester Foam Mitigation Recommendations

A combination of prevention, mitigation and control methods listed in this guidance manual are recommended for AD foam control depending on their applicability to specific AD systems experiencing foaming. A majority of these methods to eliminate or minimize foaming are cost beneficial compared to most sludge disintegration techniques. The following general do`s and don’ts for digester operational controls should be followed.

4.5.1 Other Considerations Other AD foam management considerations include preventive measures such as daily sampling, analysis, data review, and process control adjustments. Though long-term monitoring has been listed as a separate step in this manual, it should proceed concurrently with day-to-day operations. Foam is a normal phenomenon in a typical AD; however, it becomes an issue when

4-18

excessive foaming occurs. Foam control is feasible if the operator has adequate time and resources to monitor the system. Monitoring and control involves:

Adequate training – The operators and related personnel must be adequately trained to understand and control the digester performance.

Monitoring and operation protocol – A digester sampling protocol must be developed for routine operation of the digesters, and the staff must meet regularly to discuss data trends and determine operational modifications. Optimal process conditions such as stable temperature, uniform feed rates (both solids and flow), and operation of any foam mitigation equipment are important operational practices and should be incorporated into standard operating protocols.

Full-scale foam detection by monitoring and testing of digesters or its contents – Monitoring of the several parameters listed in this guidance document can help utility operators look out for unusual or inconsistent values or patterns. If these are recurrent and correlating to foam, they may serve as a foam detection and warning system.

Effective plant monitoring and AD foam documentation is an integral part of foam management.

Table 4-5. General Do’s and Don’ts for Digester Foam Management.

Do’s in Digester Operation Don’ts in Digester Operation

Continue a stable digester feed flow and quality during normal operation.

Lower digester liquid level and feed flow during active foaming.

Install sludge spray nozzles if the existing sludge recirculation system pumps have excess capacity to discharge sludge through proposed sludge spray nozzles during foaming events.

If the existing sludge recirculation system does not have excess capacity to retrofit spray nozzles, install defoamer addition system to mitigate digester foaming.

Analyze and modify digester mixing strategy, and continue using intermittent mixing during active foaming.

Consider continuous surface wasting of filament-rich foam and WAS to minimize the growth of filaments in the AS process.

Consider selectors to minimize the growth of filaments in the AS process.

Do not add chlorine or other oxidants to control foam-causing filaments in the WAS and AS as it is detrimental for foam control in the downstream digesters (Pagilla et al., 1998).

Minimize recycle of filaments to the AS process from WAS and scum throughout the plant by not returning the surface waste from aeration basins to primary or secondary treatment streams (Pagilla et al., 1998).

Do not recycle WAS foam that may contain filaments to the headworks (Pagilla et al., 1998).

Do not mix continuously when increased foam is present in the digester.

Guidance Document on Anaerobic Digester Foaming Prevention and Control Methods R-1

REFERENCES

Ackman, P. and Le, T. Installation of radar level instruments in anaerobic digesters. Proceedings of the 79th Annual Water Environment Federation Technical Exposition and Conference. 2006. 4564-4574.

Amann, R. and Fuchs, B. Single-cell identification in microbial communities by improved fluorescence in situ hybridization techniques. Nat Rev Microbiol. 2008.6, 339-348.

Appels, L., Baeyens, J., Degrève, J., and Dewil, R. Principles and potential of the anaerobic digestion of waste-activated sludge. Progr. Energy and Combustion Science. 2008. 34, 755-781.

Applied Technologies and Carollo Engineers, Solids handling facilities plan 11th Addition to NSWWTP, prepared for Madison Sewer District. 2009.

Gerardi, M.H. The microbiology of anaerobic digesters. Wastewater microbiology series. Willey-Interscience, New Jersey, 2003.

Jenkins, D., Richard, M.G., and Daigger, G.T. Manual on the causes and control of activated sludge bulking, foaming, and other solids separation problems, 3rd edition. Lewis Publishers, New York. 2004. Oerther, D.B., De Los Reyes III, F.L., De Los Reyes, M.F., and Raskin, L. Quantifying filamentous microorganisms in activated sludge before, during, and after an incident of foaming by oligonucleotide probe hybridizations and antibody staining. Water Res. 2001. 35, 3325-3336.

Pagilla, K.R., Craney, K.C., and Kido, W.H. Aerobic thermophilic pretreatment of mixed sludge for pathogen reduction and Nocardia control. Water Environ. Res. 1996 a. 68, 1093-1098.

Pagilla, K.R., Jenkins, D., and Kido, W.H. Nocardia control in activated sludge by classifying selectors. Water Environ. Res. 1996 b. 68, 235-239.

Pagilla, K.R., Craney, K.C., and Kido, W.H. Causes and effects of foaming in anaerobic sludge digesters. Water Sci. Technol. 1997. 36, 463-470.

Pagilla, K.R., Jenkins, D., and Kido, W.H. Nocardia effects in waste activated sludge. Water Sci. Technol. 1998.38, 49-54.

Pagilla, K.R., Sood, A., and Kim, H. Nocardia amarae foaming due to biosurfactant production. Water Sci. Technol. 2002. 46, 519-524.

Pagilla, K. and Subramanian, B. Wastewater treatment anaerobic digester foaming prevention and control methods. Project No. INFR1SG10. Water Environment Research Foundation, Alexandria, VA. 2014.

Pitt, P. and Jenkins, D. Causes and control of Nocardia in activated sludge. Res. J. Water Pollut. Control Fed. 1990. 62, 143-150.

Tchobanoglous, G., Franklin, L., Burto, H., and Stense, D. Wastewater engineering: treatment and reuse. Metcalf & Eddy, Inc. 2003.

Vanrolleghem, P. and Lee, D.S. On-line monitoring equipment for wastewater treatment processes: state of the art. Automation in Water Quality Monitoring. 2003. 47, 1-34.

R-2

Verhoff, F.H., Tenney, M.W., and Echelberger, Jr. W.F. Mixing in anaerobic digestion. Biotechnol. Bioeng. 1974. 16, 757-770.

Vesvikar , M.S. and Al-Dahhan, M.H. Flow pattern visualization in a mimic anaerobic digester using CFD. Biotechnol. Bioeng. 2005. 89, 719-732.

Zickefoose, C. and Hayes, R.B.J. Anaerobic sludge digestion: operations manual. EPA 430/9–76-001. 1976. U.S. EPA, Washington, D.C.

WERF Subscribers

WASTEWATER UTILITY

Alabama Montgomery Water Works

& Sanitary Sewer Board

Alaska Anchorage Water &

Wastewater Utility Arizona Avondale, City of Glendale, City of Peoria, City of Phoenix Water Services

Department Pima County Wastewater

Reclamation Department Tempe, City of

Arkansas Little Rock Wastewater

California Central Contra Costa

Sanitary District Corona, City of Crestline Sanitation District Delta Diablo Dublin San Ramon Services

District East Bay Dischargers

Authority East Bay Municipal Utility

District Encino, City of Fairfield-Suisun Sewer

District Fresno Department of

Public Utilities Inland Empire Utilities

Agency Irvine Ranch Water District Las Gallinas Valley

Sanitary District Las Virgenes Municipal

Water District Livermore, City of Los Angeles, City of Montecito Sanitation

District Napa Sanitation District Novato Sanitary District Orange County Sanitation

District Palo Alto, City of Riverside, City of Sacramento Regional

County Sanitation District

San Diego, City of San Francisco Public

Utilities, City and County of

San Jose, City of Sanitation Districts of Los

Angeles County Santa Barbara, City of Santa Cruz, City of Santa Rosa, City of Silicon Valley Clean Water South Coast Water District

South Orange County Wastewater Authority

Stege Sanitary District Sunnyvale, City of Thousand Oaks, City of Union Sanitary District West Valley Sanitation

District

Colorado Aurora, City of Boulder, City of Greeley, City of Littleton/Englewood

Wastewater Treatment Plant

Metro Wastewater Reclamation District

Platte Canyon Water & Sanitation District

Connecticut Greater New Haven

WPCA

District of Columbia DC Water

Florida Fort Lauderdale, City of JEA Hollywood, City of Miami-Dade County Orange County Utilities

Department Palm Beach County Pinellas County Utilities Reedy Creek Improvement

District St. Petersburg, City of Tallahassee, City of Toho Water Authority

Georgia Atlanta Department of

Watershed Management

Augusta, City of Clayton County Water

Authority Cobb County Water

System Columbus Water Works Gwinnett County

Department of Water Resources

Macon Water Authority Savannah, City of

Hawaii Honolulu, City & County of

Idaho Boise, City of

Illinois Greater Peoria Sanitary

District Metropolitan Water

Reclamation District of Greater Chicago

Sanitary District of Decatur

Indiana Jeffersonville, City of

Iowa Ames, City of Cedar Rapids Water

Pollution Control Facilities

Des Moines, City of Kansas Johnson County

Wastewater Louisville and Jefferson

County Metropolitan Sewer District

Olathe, City of Overland Park, City of

Kentucky Sanitation District No. 1

Louisiana Sewerage & Water Board

of New Orleans

Maine Bangor, City of Portland Water District

Maryland Anne Arundel County Howard County Bureau of

Utilities Washington Suburban

Sanitary Commission

Massachusetts Boston Water & Sewer

Commission Upper Blackstone Water

Pollution Abatement District

Michigan Ann Arbor, City of Detroit, City of Gogebic-Iron Wastewater

Authority Holland Board of Public

Works Saginaw, City of Wayne County Department

of Public Services Wyoming, City of

Minnesota Metropolitan Council

Environmental Services Rochester, City of Western Lake Superior

Sanitary District

Missouri Independence, City of Kansas City Missouri

Water Services Department

Metropolitan St. Louis Sewer District

Nebraska Lincoln Wastewater &

Solid Waste System Nevada Henderson, City of New Jersey Bergen County Utilities

Authority Ocean County Utilities

Authority

New York New York City Department

of Environmental Protection

North Carolina Charlotte-Mecklenburg

Utilities Durham, City of Metropolitan Sewerage

District of Buncombe County

Old North State Water Company Inc.

Orange Water & Sewer Authority

Raleigh, City of

Ohio Akron, City of Avon Lake Municipal

Utilities Columbus, City of Metropolitan Sewer District

of Greater Cincinnati Montgomery County Water

Services Northeast Ohio Regional

Sewer District Summit County

Oklahoma Oklahoma City Water &

Wastewater Utility Department

Tulsa, City of

Oregon Albany, City of Bend, City of Clean Water Services Gresham, City of Lake Oswego, City of Oak Lodge Sanitary District Portland, City of Water Environment

Services

Pennsylvania Philadelphia, City of,

Water Department University Area Joint

Authority

South Carolina Beaufort - Jasper Water &

Sewer Authority Charleston Water System Greenwood Metropolitan

District Mount Pleasant

Waterworks Spartanburg Water Sullivan’s Island, Town of

Tennessee Cleveland Utilities Murfreesboro Water &

Sewer Department Nashville Metro Water

Services Texas Austin, City of Dallas Water Utilities Denton, City of

WERF Subscribers El Paso Water Utilities Fort Worth, City of Houston, City of San Antonio Water System Trinity River Authority

Utah Salt Lake City Department

of Public Utilities

Virginia Alexandria Renew

Enterprises Arlington County Fairfax County Fauquier County Hampton Roads Sanitation

District Hanover County Henrico County Hopewell Regional

Wastewater Treatment Facility

Loudoun Water Lynchburg Regional

Wastewater Treatment Plant

Prince William County Service Authority

Richmond, City of Rivanna Water & Sewer

Authority

Washington Everett, City of King County Department

of Natural Resources & Parks

Puyallup, City of Seattle Public Utilities Sunnyside, Port of Yakima, City of

Wisconsin Green Bay Metro

Sewerage District Kenosha Water Utility Madison Metropolitan

Sewerage District Milwaukee Metropolitan

Sewerage District Racine Water &

Wastewater Utility Sheboygan, City of Stevens Point, City of Wausau Water Works

Australia/New Zealand

Water Services Association of Australia

Canada Calgary, City of EPCOR Lethbridge, City of Regina, City of Toronto, City of Winnipeg, City of

STORMWATER UTILITY

California Monterey, City of San Diego County

Department of Public Works

San Francisco Public Utilities, City & County of

Santa Rosa, City of Sunnyvale, City of

Colorado Aurora, City of Boulder, City of

Florida Orlando, City of

Iowa Cedar Rapids Water

Pollution Control Facilities Des Moines, City of

Kansas

Overland Park, City of

Pennsylvania

Philadelphia, City of, Water Department

Tennessee

Chattanooga Stormwater Management

Washington

Bellevue Utilities Department

Seattle Public Utilities

STATE AGENCY

Connecticut Department of Environmental Protection

Fresno Metropolitan Flood Control District

Harris County Flood Control District

Kansas Department of Health & Environment

Ohio River Valley Sanitation Commission

Urban Drainage & Flood Control District, CO

CORPORATE

AECOM Alan Plummer Associates

Inc. American Cleaning Institute Aqua-Aerobic Systems Inc. Atkins Black & Veatch

Corporation Brown and Caldwell Burns & McDonnell Carollo Engineers, P.C. CDM Smith CH2M HILL CRA Infrastructure &

Engineering

D&B/Guarino Engineers LLC

Effluential Synergies LC EMA Inc. ENVIRON International

Corporation Environmental Operating

Solutions Inc. Evoqua Water

Technologies Gannett Fleming Inc. GeoSyntec Consultants GHD Inc. Global Water Advisors Inc. Greeley & Hansen LLC Hazen & Sawyer P.C. HDR Inc. HNTB Corporation Holmes & McGrath Inc. Infilco Degremont Inc. Jacobs Engineering

Group Inc. KCI Technologies Inc. Kelly & Weaver P.C. Kennedy/Jenks Consultants Larry Walker Associates LimnoTech Malcolm Pirnie, the Water

Division of ARCADIS MaxWest Environmental

Systems McKim & Creed Michael Baker, Jr. Inc. MWH NTL Alaska Inc. Parametrix Inc. Praxair Inc. Pure Technologies Ltd. Ross Strategic Stone Environmental Inc. Stratus Consulting Inc. Synagro Technologies Inc. Tata & Howard Inc. Tetra Tech Inc. The Cadmus Group Inc. The Low Impact

Development Center Inc. URS Corporation Versar, Inc. Westin Engineering Inc. Wright Water

Engineers Inc. Zoeller Pump Company

Australia CSIRO

Austria Sanipor Ltd.

Canada Associated Engineering O2 Environmental Inc. Trojan Technologies Inc.

Norway Aquateam Cowi AS

INDUSTRY

American Water Anglian Water Services

Ltd. Chevron Energy

Technology Company Dow Chemical Company DuPont Company Eastman Chemical

Company Eli Lilly & Company FMC Corporation InSinkErator Johnson & Johnson Merck & Company Inc. Procter & Gamble

Company Suez Environnement United Utilities North West United Water Services LLC VandCenter Syd Veolia Water North

America List as of 9/10/14

Chair

Terry L. Johnson, Ph.D.,

P.E., BCEE

Water Consulting, LLC

Vice-Chair

Rajendra P. Bhattarai, P.E.,

BCEE

Austin Water Utility

Thomas C. Granato, Ph.D.

Metropolitan Water

Reclamation District of

Greater Chicago

Donald Gray (Gabb),

Ph.D., P.E., BCEE

East Bay Municipal

Utility District

Robert Humphries, Ph.D.

Water Corporation of

Western Australia

David Jenkins, Ph.D.

University of California

at Berkeley

Mark W. LeChevallier,

Ph.D.

American Water

Ted McKim, P.E. BCEE

Reedy Creek

Energy Services

Elizabeth Southerland,

Ph.D.

U.S. Environmental

Protection Agency

Paul Togna, Ph.D.

Environmental Operating

Solutions, Inc.

Art K. Umble, Ph.D., P.E.,

BCEE

MWH Global

Kenneth J. Williamson,

Ph.D., P.E.

Clean Water Services

Chair

Catherine R. Gerali

Metro Wastewater

Reclamation District

Vice-Chair

Kevin L. Shafer

Metro Milwaukee

Sewerage District

Secretary

Eileen J. O’Neill, Ph.D.

Water Environment

Federation

Treasurer

Brian L. Wheeler

Toho Water Authority

Paul L. Bishop, Ph.D., P.E.,

BCEE

University of

Rhode Island

Glen Daigger, Ph.D., P.E.,

BCEE, NAE

CH2M Hill

Scott D. Dyer, Ph.D.

The Procter & Gamble

Company

Philippe Gislette

Degrémont,

Suez-Environnement

Julia J. Hunt, P.E.

Trinity River Authority

of Texas

Terry L. Johnson, Ph.D.,

P.E., BCEE

Water Consulting, LLC

Jim Matheson

Oasys Water

Ed McCormick, P.E.

Water Environment

Federation

James Anthony (Tony)

Parrott

Metropolitan Sewer

District of Greater

Cincinnati

Cordell Samuels

Regional Municipality

of Durham, ON

Interim Executive Director

Lawrence P. Jaworski,

P.E., BCEE

WERF Research Council

WERF Board of Directors

Method of Payment: (All orders must be prepaid.)

q C heck or Money Order Enclosedq V i s a q M a s t e r c a r d q A m e rican Express

______________________________________________________

______________________________________________________

To Order (Subscribers Only):

To Order (Non-Subscribers):

S h i p p i n g & H a n d l i n g :

Amount of Order United States Canada & Mexico All Others

* m i n i mum amount for all orders

Stock # P r o d u c t Quantity Unit Price To t a l

Postage &Handling

VA Residents Add 5% Sales Tax

Canadian ResidentsAdd 7% GST

Up to but not more than:

More than $200.00

Add:

Add 20% of order

Add:

Add 20% of order

$7.50* 8.00 8.50 9.0010.0011.00

13.00 15.00 18.00

$9.509.509.50

18.0018.0018.0024.0035.0040.00

Add:50% of amount40% of amount

$20.0030.0040.0050.0060.0080.00

100.00150.00200.00

W E R F P r o d u c t O r d e r F o r m

Account No. Exp. Date

Signature

TOTAL

Log on to www. werf.org and clickon “Publications.”

Phone: 571-384-2100 Fa x : 703-299-0742

WERFAttn: Subscriber Services635 Slaters LaneAlexandria, VA 22314-1177

Make checks paya ble to the Water Environment Research Foundation.

(

7

Non-subscribers may order WERFpublications either through WERFor IWAP (www.iwapublishing.com).Visit WERF’ s website at www.werf.orgfor details.

As a benefit of joining the Water Environment Research Foundation, subscribers are entitled to receive one complimentary c o py of all finalr e p o rts and other products. Additional copies are ava i l a ble at cost (usually $10). To order your complimentary c o py of a report, please wri t e“ f r e e ” in the unit price column. WERF keeps tra ck of all orders. If the charge differs from what is shown here, we will call to confirm the totalb e fore processing.

________________________________________________________________________________________________

________________________________________________________________________________________________

________________________________________________________________________________________________

________________________________________________________________________________________________

________________________________________________________________________________________________

Name Title

Organization

Address

City State Zip Code Country

Phone Fax Email

GuidanceDocumentonAnaerobicDigesterFoaming

Preventionand

ControlMethods

Water Environment Research Foundation635 Slaters Lane, Suite G-110 n Alexandria, VA 22314-1177

Phone: 571-384-2100 n Fax: 703-299-0742 n Email: [email protected]

WERF Stock No. INFR1SG10a

October 2014

Guidance Document on Anaerobic DigesterFoaming Prevention and Control Methods

Infrastructure

IWA PublishingAlliance House, 12 Caxton StreetLondon SW1H 0QSUnited KingdomPhone: +44 (0)20 7654 5500Fax: +44 (0)20 7654 5555Email: [email protected]: www.iwapublishing.comIWAP ISBN: 978-1-78040-659-6/1-78040-659-2

Co-published by

INFR1SG10a_WEF-IWAPspread.qxd 9/9/2014 1:22 PM Page 1

Infrastructure - The Water Research Foundation · Guidance Document on Anaerobic Digester Foaming...

Documents

Transcript of Infrastructure - The Water Research Foundation · Guidance Document on Anaerobic Digester Foaming...