doi: 10.1098/rsif.2012.0546, 3455-3468 first published online 15 August 20129 2012 J. R. Soc. Interface

 Lulu Han, Zhengwei Mao, Jindan Wu, Yuying Zhang and Changyou Gao cellspolyelectrolyte multilayers on migration of smooth muscle Influences of surface chemistry and swelling of salt-treated  

Supplementary data

l http://rsif.royalsocietypublishing.org/content/suppl/2012/08/08/rsif.2012.0546.DC1.htm

"Data Supplement"

Referenceshttp://rsif.royalsocietypublishing.org/content/9/77/3455.full.html#ref-list-1

This article cites 69 articles, 12 of which can be accessed free

Subject collections (167 articles)biomaterials   �

 Articles on similar topics can be found in the following collections

Email alerting service hereright-hand corner of the article or click Receive free email alerts when new articles cite this article - sign up in the box at the top

http://rsif.royalsocietypublishing.org/subscriptions go to: J. R. Soc. InterfaceTo subscribe to

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

J. R. Soc. Interface (2012) 9, 3455–3468

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

*Author for c

Electronic sup10.1098/rsif.2

doi:10.1098/rsif.2012.0546Published online 15 August 2012

Received 10 JAccepted 24 J

Influences of surface chemistry andswelling of salt-treated polyelectrolytemultilayers on migration of smooth

muscle cellsLulu Han, Zhengwei Mao, Jindan Wu, Yuying Zhang

and Changyou Gao*

MOE of Key Laboratory of Macromolecular Synthesis and Functionalization, Departmentof Polymer Science and Engineering, Zhejiang University, Hangzhou 310027,

People’s Republic of China

The cell migration plays a crucial role in a variety of physiological and pathological processesand can be regulated by the cell–substrate interactions. We found previously that the poly(sodium 4-styrenesulphonate) (PSS)/poly(diallyldimethylammonium) chloride (PDADMAC)multilayers post-treated in 1–5 M NaCl solutions result in continuous changes of their physico-chemical properties such as thickness, chemical composition, surface charge, swelling ratioand wettability. In this study, the responses of human smooth muscle cells (SMCs) onthese salt-treated multilayers, particularly the governing factors of cellular migration thatoffer principles for designing therapeutics and implants, were disclosed. The cell migrationrate was slowest on the 3 M NaCl-treated multilayers, which was comparable with that ontissue culture plates, but it was highest on 5 M NaCl-treated multilayers. To elucidate theintrinsic mechanisms, cell adhesion, proliferation, adhesion and related gene expressionswere further investigated. The SMCs preferred to attach, spread and proliferate on thePSS-dominated surfaces with well-organized focal adhesion and actin fibres, especially onthe 3 M NaCl-treated multilayers, while were kept round and showed low viability on thePDADMAC-dominated surfaces. The relative mRNA expression levels of adhesion-relatedgenes such as fibronectin, laminin and focal adhesion kinase, and migration-related genessuch as myosin IIA and Cdc42 were compared to explain the different cellular behaviours.These results reveal that the surface chemistry and the swelling of the salt-treated multilayersgovern the cell migration behaviours.

Keywords: cell migration; polyelectrolyte multilayers; post treatment;smooth muscle cells; swelling

1. INTRODUCTION

One of the major challenges in regenerative medicine andtissue engineering is to optimize the material–cell inter-actions, and upon successful optimization, cell adhesion,proliferation, migration and differentiation can be modu-lated in a controlled manner. Cell adhesion, proliferationand differentiation behaviours on substrates are influencedby surface physico-chemical properties such as topographyor roughness, hydrophobicity and hydrophilicity, charge,chemical groups, types of ligands and stiffness [1–6]. How-ever, cell migration behaviours on different materials,which are essential for understanding the tissue regener-ation process and for developing regenerative materials,are less understood. Previous studies show that cellmigration is mediated through interactions with the

orrespondence (cygao@mail.hz.zj.cn).

plementary material is available at http://dx.doi.org/012.0546 or via http://rsif.royalsocietypublishing.org.

uly 2012uly 2012 3455

surface-bound extracellular matrix proteins, growth factorsand small ligands, such as collagen [7], fibronectin [8], lami-nin [9], VEGF [10], bFGF [11] and RGD [12,13]. Besides,cell migration also can be dominated by the chemical andphysical properties of the substrates. For example, Webbet al. found that the migration rate of MC3T3-E1 osteo-blasts is significantly slower on the thiol surfacecompared with the oxidized thiol, quaternary amine andmethyl surfaces [14]. Pelham & Wang [6] and Lo et al.[15] showed that cell motility can be governed purely bythe substrate rigidity. In general, cells on flexible substratesdisplay a larger migration rate and can move from the softregion towards the rigid side of the substrate. Morerecently, we found that the cell mobility rate is increasedinitially along with the increase in poly (ethylene glycol)(PEG) amount on the surface, and reaches maximumvalues at a moderate grafting mass between 300 and500 ng cm22 [16].

Among the various surface engineering methods, thelayer-by-layer assembly, refined by Decher in the 1990s

This journal is q 2012 The Royal Society

3456 Migration of SMCs on multilayers L. Han et al.

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

[17], can be diversely used to tailor substrate propertiesand is particularly suitable to address material–cellinteractions [18,19]. For example, different depositionparameters of the polyelectrolyte multilayers (PEMs),such as the type of polyelectrolytes [20,21], tempera-ture [22], pH [23] and salt concentrations [24,25],have great impacts on hydration, swelling and mobilityof the polymer chains. Consequently, the chemicalcomposition, stability, surface functional groups, thick-ness, stiffness, hydration degree and surface roughnessare varied, which in turn show different performancein terms of cell adhesion, proliferation and differen-tiation [23,26–28]. So far, both cell attractive and cellresistive PEMs have been made by using differentbuilding blocks [29–31]. Moreover, Picart et al.[32,33] found that the cell adhesion, proliferation anddifferentiation also strongly depend on the mechanicalproperties of PEMs. Those multilayers containingnatural polysaccharides such as poly (L-lysine)/hyalur-onan are usually highly hydrated, and thereby canresist cell adhesion. By contrast, the cells can adhereonto the cross-linked PEMs as a result of stiffnessenhancement.

Multilayers composed of strong polyelectrolytes ofpoly(sodium 4-styrenesulphonate) (PSS)/poly(diallyl-dimethylammonium) chloride (PDADMAC) havebeen employed either alone or by integration of othercomponents so as to modify the surface of the bio-materials. For example, gelatin was coated on thePSS/PDADMAC multilayers-modified nanofibres toimprove L929 mouse fibroblast adhesion [34]. ThePSS/PDADMAC multilayers also are used to regulateprimary hepatocytes, which prefer to attach andspread on PSS but not on the PDADMAC surface, ina protein-free medium [2,35]. Mendelsohn et al. [26]compared the PSS/PDADMAC multilayers con-structed with and without extraneous salt, and foundthat the PEMs assembled with salt are more cytophobicowing to a much less dense ionic cross-linking character.Recently, we found that the physico-chemical proper-ties of the PSS/PDADMAC multilayers could beeffectively modulated by post-treatment with differentconcentrations of NaCl solutions [36]. For the multi-layers-1 M and multilayers-2 M (the multilayerspost-treated with 1 and 2 M NaCl solutions, respectively),the original structures and properties of the multilayersare mostly retained, with a PDADMAC-dominated andpositively charged surface and larger swelling ratiosin water. The hardly swollen multilayers-3 M, by con-trast, have a PSS-dominated and negatively chargedsurface as a result of a larger loss of PDADMAC. Forthe multilayers-4 and 5 M, PSS becomes abundant onthe surface and the swelling ratios are quite high,especially for the multilayers-5 M, which shows the high-est hydration extent in water. These salt-treatedmultilayers with different physico-chemical properties(chemical composition, surface charge and hydrationdegree) are expected to show different performances inregulating cell migration as will be shown in this pioneer-ing study, obtaining a comprehensive view of theparameters governing cell migration.

The human vascular smooth muscle cells (SMCs) areessential for blood vessels, especially during vessel

J. R. Soc. Interface (2012)

remodelling in physiological conditions such as pregnancyand exercise, or after vascular injury [37]. In some vascu-lar surgeries, SMC migration may induce thrombosis andintimal hyperplasia, especially revascularization for smalldiameter blood vessel tissue engineering [38]. Hence,regulation of SMC motility on biomaterials is critical tothe performance of blood-contacting implants and vascu-lar tissue engineering scaffolds. For example, SMCsdisplay a distinct morphology in softer scaffolds withmore fibre looping, resulting in a stronger cell migrationability and enhanced healing effect in a rat abdominalwall replacement model [39].

In this work, the physico-chemical properties of thesalt-treated multilayers in phosphate-buffered saline(PBS) and cell-culture medium will be studied, inwhich the cells are cultured and thereby these propertiesare intrinsically tied with the cell responses. Themigration behaviours of SMCs are then monitoredin situ on these salt-treated multilayers. Cell adhesion,organization of focal adhesions and cytoskeleton, aswell as adhesion and migration-related gene expressionare characterized to reveal the mediating mechanism.This study will clarify cellular migration behaviours onsubstrates with different physico-chemical properties,which is of paramount importance to elucidate thefactors governing cell migration and in turn to applythe principles to the development of novel biomaterials.

2. EXPERIMENTAL SECTION

2.1. Materials

Polyethyleneimine (PEI, Mw ¼ 25 kDa), PDADMAC(Mw ¼ 200–350 kDa), PSS (Mw ¼ 70 kDa), fluoresceindiacetate (FDA) and propidum iodide (PI) wereobtained from Sigma-Aldrich. The water used in thiswork was purified by a Milli-Q water system (Millipore,USA). All the polyelectrolytes were prepared to a finalconcentration of 1 mg l21 aqueous solutions. PEI wasdissolved in water, and PSS and PDADMAC were sup-plemented with 1 M NaCl. Quartz, glass and siliconwafers were cleaned in piranha solution (7 : 3 v/v%H2SO4/H2O2). After rinsed with water, they weredried under a smooth stream of N2.

2.2. Multilayer assembly

To ensure the successful adsorption, a precursory layerof PEI was deposited on the silicon wafers. PSS andPDADMAC were then alternately assembled by auto-dipping at 208C. Between alternate exposures to thetwo kinds of polymer solutions for 20 min, there werethree rinses with 0.1 M NaCl solutions for 3 min. Inthe last step, the films were immersed in triple-distilledwater for at least 5 min to eliminate the adsorbed salt.A total of seven bilayers were assembled and themultilayers are expressed as (PSS/PDADMAC)7.

2.3. Post-treatment of the multilayers inNaCl solutions

The (PSS/PDADMAC)7 multilayers were incubated in1–5 M NaCl solutions at room temperature for 2 h and

Migration of SMCs on multilayers L. Han et al. 3457

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

were then rinsed with water and dried under a smoothstream of N2, respectively. Because the PEMs wereassembled in the 1 M NaCl solution, the physico-chemical properties of the pristine PEMs are identicalto the multilayers-1 M [36,40].

2.4. Spectroscopic ellipsometry

The thickness of the multilayers was determined in airand liquid (water or PBS) from a spectroscopic ellips-ometer (model M2000D, J. A. Woollam Inc., Lincoln,NE, USA) at an incident angle of 758 within a wave-length range of 300–1700 nm and 300–1100 nm,respectively. The thickness was calculated from the ellip-sometric parameters, D and c, using a Cauchy model.The swelling ratio was defined as the ratio of multilayerthicknesses in wet and dry states, respectively.

2.5. Water contact angle measurement

The surface static contact angles of the multilayers weremeasured directly by dropping 1 ml of ultrapure waterusing a Kruss DSA 100 system at ambient temperature.

2.6. Surface charge properties

The surface zeta potentials of the multilayers weremeasured in 10 mM NaCl, using Delsa Nano Serieszeta potential/submicron particle size analysers (Beck-man Coulter, USA), via electrophoresis technology.

2.7. Cell culture

The human vascular SMCs were obtained from the CellBank of Typical Culture Collection of Chinese Acad-emy of Sciences (Shanghai, China). The cells weremaintained in a regular growth medium consisting ofhigh-glucose DMEM (Gibco, USA) supplementedwith 10 per cent foetal bovine serum (FBS, SijiqinInc., Hangzhou, China), 100 U ml21 penicillin and100 mg ml21 streptomycin and cultured at 378C in a5 per cent CO2 humidified environment.

2.8. Cell migration

Before cell culture, the salt-treated multilayers weresterilized under UV light for 1 h. The SMCs were thenplated on the salt-etched multilayers at a low cell den-sity (5 � 103 cells cm22) in order to minimize theinfluence of cell–cell interactions. Approximately 12 hafter the cell plating in 10 per cent FBS DMEM, thecell migration was in situ recorded using a time-lapsephase-contrast microscope (IX81, Olympus) equippedwith an incubation chamber (378C and 5% CO2

humidified atmosphere).The SMC trajectories were reconstructed from the

centre positions of individual cells over the whole obser-vation time. The cell migration distance (S) anddisplacement (D) was calculated by IMAGEPRO Plus soft-ware according to the following equations at 1 h timeintervals over the observation time of 24 h (t). Here,the SMC trajectories and migration rate (n ¼ S/t) arecalculated only from viable cells, because the deadcells are unable to spread and migrate. Hence, the

J. R. Soc. Interface (2012)

fraction of migrated cells is equal to the ratio of livecells (for detail, see §2.9 cell adhesion).

S ¼Xt

i¼1

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiðxi � xi� 1Þ2 þ ðyi � yi� 1Þ2

q

and

D ¼ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffix2

t þ y2t

q;

where xi (or yi) and xi2 1 (or y i 2 1 ) represent x-axis(or y-axis) coordinates of cell centre positions at the iand i21 time, respectively. x0 and y0 values are setas 0. At least 15 cells were calculated for each sample.

2.9. Cell adhesion

The cells were seeded on the multilayer surfaces at a den-sity of 2.5 � 104 cm22 with or without 10 per cent FBS.Four hours later, the slides were rinsed with PBS. Afterthe cells were stained by a mixture of 5 mg ml21 FDA(for living cells) and 20 mg ml21 PI (for dead cells) for20 min, they were gently rinsed with PBS for two timesand subjected to livability analysis under a fluorescencemicroscope (PBS was streamed down along the wall ofthe well to avoid washing away the dead cells). Theratio of live cells is defined as the (live cell number/totalcell number) � 100%, which also can be regarded as thefraction of migrated cells. For the cell adhesion study,the cells cultured for 4 h in 10 per cent FBS growthmedium were stained by FDA and counted under the flu-orescence microscope. A total of 40 observations from10 positions on each of four samples were adopted tocalculate the ratio of live cells on each type of multilayers.

2.10. Cell proliferation

Cell proliferation was characterized by cell number, MTT(3-(4,5-dimethyl) thiazol-2-yl-2,5-dimethyl tetrazoliumbromide) and cell cycle assays. Briefly, the cells wereplated at a density of 2.5 � 104 cm22. Four hours, 24 hand 48 h later, the cell number was determined by sto-chastic count after FDA staining. A total of 40observations from 10 positions on each of four sampleswere adopted to calculate the cell number. For theMTT assay, after the cells were cultured on the multi-layers at determined time intervals, 50 ml MTT(5 mg ml21) was added to each well. Four hours later,the dark blue formazan crystals generated by the mito-chondrial dehydrogenase in the cells were dissolved bydimethyl sulphoxide (DMSO), and the absorbance at570 nm was measured by a microplate reader (Model550, Bio Rad). The results were averaged from four par-allel samples. For quantification of the cell cycle, afterculture on the multilayers for 24 h, the cells were carefullyrinsed twice by PBS, and then trypsinized and fixed over-night in 75 per cent ethanol at 2208C. After thetreatments with a mixture of RNase, PI and Trition X-100 for 30 min, the samples were analysed by flow cyto-metry (FACS Calibur, Becton Dickinson BD) withexcitation at 488 nm and a 560 nm band pass filter forred fluorescence of PI. A total of 1� 104 cells were ana-lysed for each sample, and the results were averagedfrom four parallel samples.

Table 1. Primer sequences and PCR product lengths for fibronectin, laminin, FAK, myosin IIA, Cdc42 and GAPDH.

gene primer sequence length

fibronectin 50 CCTGGCACTTCTGGTCAGCAAC 30 133 bp50 CCTACATTCGGCGGGTATGGTC 30

laminin 50 CACCTATGTGCGTCTCAAGTTCC 30 170 bp50 GCTGCTCGTCCCCTCCTGT 30

FAK 50 CTCCTGGTGCAATGGAGCGAGTAT 30 183 bp50 GCAGGTGACTGAGGCGGAATC 30

myosin IIA 50 CGAAGAGGTAGATGGCAAAGCGGAT 30 105 bp50 GGGAGGCTGTGGTGTCTGTCT 30

Cdc42 50 GCTGGGACTACAGGTCATCATCAGAT 30 106 bp50 CAACAGCACCATCGCCCACAACA 30

GAPDH 50 CTGCTCCTCCTGTTCGACAGT 30 100 bp50 CCGTTGACTCCGACCTTCAC 30

3458 Migration of SMCs on multilayers L. Han et al.

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

2.11. Organization of focal adhesions andcytoskeleton

Fluorescent staining of actin, vinculin and cell nucleiwas carried out to study the cell morphology, spreadingarea and focal adhesion. Briefly, after culture in themedium containing 10 per cent FBS for 4 or 24 h, theSMCs were carefully washed with PBS and then fixedfor 30 min with 4 per cent paraformaldehyde at 378C.The cells were further treated for 10 min with 0.5%(v/v) Triton X-100/PBS at 48C so as to increase thepermeability of the cell membrane. After rinsing withPBS for three times, they were incubated in 1 percent bovine serum albumin (BSA)/PBS for 30 minand then in a mouse monoclonal antibody againsthuman vinculin (Sigma) for 1 h. After washing twicein 1 per cent BSA/PBS, they were further stainedwith FITC-labelled goat anti-mouse IgG (Beyotime,China), rhodamine phalloidin (Invitrogen) and DAPI(Sigma) for 1 h, followed by three washes in PBS.A total of 60 cells on each type of multilayers wereobserved under a confocal laser scanning microscope(CLSM, LSM 510, Carl Zeiss). The images were ana-lysed with LSM Image Browser software to determinethe cell spreading extent and average cell area.

2.12. Real-time RT-PCR analysis

Real-time quantitative reverse transcription polymerasechain reaction (real-time RT-PCR) analysis was con-ducted to examine the expression profiles of adhesionand migration-specific genes for fibronectin, laminin,focal adhesion kinase (FAK), myosin IIA and Cdc42in the SMCs. Briefly, after the cells were cultured onthe multilayers for 24 h, total RNA was extractedusing Trizol reagent (Invitrogen, USA), according tothe manufacturer’s instructions and quantified byusing a biophotometer (Eppendorf, Germany). In eachsample, 2 mg RNA was used for reverse transcriptionunder standard conditions using M-MLV Reverse Tran-scriptase cDNA synthesis kit (Promega, USA). Theresulting cDNA was used as a template in subsequentPCR amplifications. The primer sequences used in thisstudy are listed in table 1. Glyceraldehyde-3-phosphate

J. R. Soc. Interface (2012)

dehydrogenase (GAPDH) was used as the endogenousreference housekeeping gene. The real-time PCR reac-tions were carried out with the SYBR Premix Ex-TaqKit (Takara, Japan) and iQ qPCR system (Bio Rad,USA). The relative gene expression values were calcu-lated with the comparative DDCT (threshold cycle)method, and normalized to the housekeeping gene.

2.13. Statistical analysis

The data are expressed as mean+ standard deviation(s.d.). The statistical significance between groups wasdetermined by one-way analysis of variance (ANOVA)in the Origin software. The Tukey means comparisonmethod was performed, and the statistical significancewas set as p , 0.05.

3. RESULTS

3.1. Physico-chemical properties of salt-treatedmultilayers

The salt post-treatment is a simple, quick, nontoxic andversatile way to modulate the structures and propertiesof PSS/PDADMAC multilayers. The physico-chemicalproperties of the multilayers treated with NaCl sol-utions of different concentrations are summarized intable 2. The molar ratios of PSS/PDADMAC multi-layers were enhanced along with the increase in saltconcentrations. Meanwhile, the surface chemistry waschanged from positive PDADMAC domination below2 M NaCl to negative PSS domination above 3 MNaCl. The zeta potentials of the multilayers treatedwith 1, 2, 3, 4 and 5 M salt solutions were þ40, þ25,247, 239 and 229 mV, respectively [36]. The absolutevalues of the zeta potentials were obviously decreasedafter the multilayers were incubated in a serum-containing medium owing to the adsorption of serumproteins. However, no charge reversal was found, andthe values kept around þ15–20 mV for the multi-layers-1 and 2 M, and -15 mV for the multilayers-3, 4and 5 M, respectively. The water contact angles wereinitially decreased along with the increase of salt con-centrations until 3 M NaCl (328), and then increased

Table 2. The physico-chemical properties of (PSS/PDADMAC)7 multilayers after being treated by 1, 2, 3, 4 and 5 M NaCl,respectively.

samplesa 1 M 2 M 3 M 4 M 5 M

surface-dominated polyelectrolytes PDADMAC PDADMAC PSS PSS PSSzeta potentials (mV) þ41+ 10 þ26+8 247+9 238+ 9 229+ 3zeta potentials in DMEM/10% FBS (mV) þ21+ 5 þ11+5 215+5 213+ 4 216+ 4water contact angle (8) 64+ 6 52+8 32+7 47+ 10 52+ 8roughness in PBS (nm) 11.0+ 1.7 4.1+1.3 3.6+2.2 6.4+ 0.1 4.6+ 0.4dry thickness (nm) 182+ 2 172+1 142+1 89+ 2 30+ 5thickness in PBS (nm) 428+ 21 255+3 185+1 188+ 14 154+ 74swelling ratio in PBS 2.3+ 0.1 1.5+0 1.3+0 2.1+ 0.2 5.1+ 0.2swelling ratio in water 5.4+ 1.4 3.4+1.4 1.3+0 4.3+ 1.4 7.7+ 1.3dry thickness after immersion in DMEM/10% FBS (nm) 218+ 4 197+14 158+9 104+ 9 59+ 6swelling ratio in DMEM/10% FBS 2.0+ 0.1 1.4+0.1 1.2+0.1 1.8+ 0.4 4.6+ 0.4dry thickness after incubation in DMEM/ 10% FBS for 2

days (nm)210+ 14 192+12 161+11 118+ 8 68+ 10

aThe data of surface-dominated polyelectrolytes, zeta potentials, roughness in PBS, dry thicknesses and swelling ratios inwater were cited from Han et al. [36]. To test the physico-chemical properties of the multilayers in cell culture environment,the salt-treated multilayers were immersed into DMEM/10% FBS for 4 h at 378C, if not otherwise stated.

Migration of SMCs on multilayers L. Han et al. 3459

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

again (528 for the multilayers-5 M). The overall rough-ness (RMS) of the multilayers in PBS was varied withina small range, i.e. 11.0+ 1.7, 4.1+ 1.3, 3.6+ 2.2, 6.4+0.1 and 4.6+ 0.4 nm for the multilayers-1, 2, 3, 4 and5 M, respectively [36]. The dry thicknesses of the multi-layers treated with 1, 2, 3, 4 and 5 M NaCl solutionsmeasured by ellipsometry were 182, 172, 142, 89 and30 nm, respectively. The thickness in air was confirmedfurther by atomic force microscopy, verifying the accu-racy of the ellipsometry data [41]. Therefore, significantmass loss occurred along with the increase in NaCl con-centrations. After the multilayers were immersed inDMEM/10 per cent FBS medium for 2 h, their drythicknesses increased to 218, 197, 158, 104 and 59 nm,respectively, confirming the serum protein absorptionon the multilayers. The larger amount of proteinadsorption on the multilayers-1 M might be attributedto the fact that the proteins could penetrate into thebulk of the positively charged and highly swollenPEMs [42]. After immersion in cell culture mediumfor 2 d, the thicknesses of the multilayers were notreduced, suggesting that the multilayers were stablein vitro and suitable for cell culture. After salt treat-ment, the swelling ratios of the multilayers in bothwater and PBS declined along with the increase ofsalt concentration until 3 M, and then increasedsignificantly at higher concentrations of salt solutions(table 2). The swelling ratio in water also fits wellwith the results obtained by QCM measurement in aprevious report [36]. This trend was unchanged afterthe multilayers were immersed in the DMEM/10 percent FBS medium, but the absolute values of the swel-ling ratios were reduced slightly because some of thewater in the multilayers was replaced after proteinadsorption [43].

3.2. Cell migration

Cell migration is a dynamic process of cell adhesion anddetachment on a surface. A time-lapse phase-contrastmicroscope was used to record the in situ cell migration

J. R. Soc. Interface (2012)

trajectories during 24 h culture (figure 1a), accordingto which the cell migration rate was calculated (figure1b). The cell movement on the multilayers wasrandom, which was confirmed by the almost 0 net cellmigration velocities in x- and y-directions (see the elec-tronic supplementary material, figure S1). Because thedead cells do not contribute to the migration, they arenot considered in the migration study. Namely, thefraction of migrated cells is equal to the live-cell ratioshown in figure 2a. After 24 h, almost all the cells onthe multilayers-1, 2, 4 and 5 M migrated a longer dis-tance (S) than their characteristic length (L; fordetail see the electronic supplementary material,figure S2), namely the fraction of S . L was 100 percent. This fraction dropped to 28 per cent and 40 percent on TCPS and the multilayers-3 M, respectively.Moreover, the fractions of cells whose migration displa-cement (D) was larger than their characteristic length(D . L) were 60, 64, 0, 80 and 85 per cent on the multi-layers-1, 2, 3, 4 and 5 M, respectively. The fraction onTCPS was 32 per cent. The migration rate (figure 1b)was slowest on the multilayers-3 M (4.8+2 mm h21),which was closest to that on the TCPS (3.6+1.3 mmh–1) and the multilayers-2 M (6.0+1.7 mm h21) (p .

0.05). Cell migration rate was significantly improved toapproximately 9–10 mm h21 on the multilayers-1 Mand the multilayers-4 M (p , 0.05), and reached thehighest value of 16.8+5.3 mm h21 on the multilayers-5 M (p , 0.05).

In addition, the relative cell migration ability (S/L)was introduced because the cells had a different charac-teristic length on the various salt-treated multilayers(see the electronic supplementary material, figure S2).As shown in figure 1c, in general, the relative cellmigration ability had a similar alteration trend tothat of the cell migration rate (figure 1b), except thatthe range of variation was enlarged. After 24 hmigration, the cells on the multilayers-3 M moved asimilar distance to their characteristic length (see theelectronic supplementary material, figure S2, approx.100 mm), which is similar to those on the TCPS and

–200 –100 0 100 200

–200

–100

0

100

200

Y (

µm)

X (µm)

1 M 3 M 5 M

(b)

(a)

*

*

–200 –100 0 100 200

–200

–100

0

100

200

X (µm)

Y (

µm)

–200 –100 0 100 200

–200

–100

0

100

200

X (µm)

Y (

µm)

***

* **

*

*

(c)

**

**

**

***

30

25

20

15

10

cell

rate

(µm

h–1

)

5

0TCPS 1

NaCl concentration (M)2 3 4 5

10

8

6

4

rela

tive

mig

ratio

n ab

ility

2

0TCPS 1

NaCl concentration (M)2 3 4 5

Figure 1. Cell migration on the salt-treated (PSS/PDADMAC)7 multilayers. (a) Random cell migration trajectories on the multi-layers post-treated with 1, 3 and 5 M NaCl solutions, respectively. (b) Cell migration rates averaged from greater than or equal to15 cells on TCPS and the salt-treated multilayers. (c) The relative migration ability of cells on TCPS and the salt-treated multi-layers. The relative migration ability is defined as the ratio of cell migration distance to its characteristic length. Asterisks indicatesignificant difference, which is determined by one-way analysis of variance (ANOVA) in the Origin software. The statisticalsignificance of asterisks is set as p , 0.05 and the Tukey means comparison method is performed.

3460 Migration of SMCs on multilayers L. Han et al.

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

the multilayers-2 M ( p . 0.05). By contrast, the rela-tive cell migration ability was significantly enhancedon the multilayers-4 M ( p , 0.05), and furtherenhanced to a greater extent on the multilayers-1 Mand multilayers-5 M ( p , 0.05) with a ratio of 4.2+1.0 and 5.7+ 1.4 (see the electronic supplementarymaterial, figure S2, approx. 50 mm and approx.75 mm), respectively. All the results reveal that the cellmobility on the salt-treated multilayers is reduced initiallyuntil 3 M, and then increased again. The lowest cell mobi-lity is found on the multilayers-3 M, which is similar tothat on the TCPS.

3.3. Cell adhesion

Cell adhesion has a significant influence on cellmigration, because the SMCs must attach to the sub-strate and then form protrusion to migrate. In order toexplore the mechanism of cell migration, the adhesionof SMCs on the multilayers was quantitatively examinedin the presence and absence of FBS [44]. In the absenceof serum, two sharp contrast results were obtained(figure 2a): all the cells were dead on the PDADMAC-dominated surfaces (the multilayers-1, 2 M), but werealive on the PSS-dominated surfaces (the multilayers-3,4, 5 M). In the presence of 10 per cent FBS, the livecell ratios on the multilayers-1 and 2 M were improvedto 71+7% and 93+3%, respectively, while keptunchanged (100%) on the PSS-dominated surfaces (p, 0.05) (figure 2a). In all other experiments, the resultswere obtained in the presence of 10 per cent FBS toensure adequate cell viability.

Cell spreading was further observed and quantifiedby cell adhesion area after cell seeding for 4 h (see the

J. R. Soc. Interface (2012)

electronic supplementary material, figure S3 andfigure 2b). The SMCs kept round on all the PDAD-MAC-dominated surfaces, with very small spreadingareas, i.e. 235+ 106, and 301+ 181 mm2 per cell onthe multilayers-1 and 2 M, respectively. By contrast,the cell spreading area on the multilayers-3 M(2168+ 1508 mm2) was largest, and then decreased to1053+ 964 mm2 and 1067+ 722 mm2 ( p , 0.05) onthe multilayers-4 and 5 M, respectively. After the cul-ture time was extended to 24 h, the cell spreadingarea on all the multilayers was improved to someextent, but the relative values between each otherkept unchanged (figure 2b).

3.4. Cell proliferation

The cell proliferation was quantified by cell number(figure 2c), MTT assay (figure 2d) and cell cycle analy-sis (figure 2e). During the first 4 h, the cell numbers onall the multilayers were very close to each other, excepta significant higher number on the multilayers-3 M( p , 0.05) (figure 2c). After 24 and 48 h, the cell num-bers were increased on all the sample surfaces, but weremore significant on the multilayers treated with 3, 4 and5 M NaCl solutions ( p , 0.05). Again, the multilayers-3 M had a significantly larger number of cells regardlessof the culture time ( p , 0.05). The cell viability showeda similar pattern as that of the cell number, i.e. higheston the multilayers-3 M at both 24 and 48 h ( p , 0.05).However, compared with its doubled cell number, theviability (figure 2d) was increased only about 25 percent. This inconsistency is likely caused by the largernumber of cells, the so-called inhibitory effect by cellconfluence [45].

without FBS 10% FBS

0

25

50

75

100liv

ing

cell

ratio

(%

)

1 M 2 M 3 M 4 M 5 M

(b)(a)

4h 24h0

1000

2000

3000

4000

5000

area

(pe

r ce

ll), (

µm2 )

*

* *

**

*

**

(d)(c)

24 h 48 h0

0.15

0.30

0.45

0.60

0.75

0.90

OD

at 5

70 n

m

*

*

4 h 24 h 48 h0

20 000

40 000

60 000

80 000

100 000

cell

num

ber

(cm

–2)

*

*

*

*

*

**

*

*

**

*

**

***

*

* **

* *

**

**

**

**

***

* * ****

* **

* *

* **

**

(e)

0

25

50

75

100

rela

tive

perc

enta

ge (

%)

NaCl concentration (M)

G0/G1 S G2/M

1 2 3 4 5TCPS

****

***

**

*

Figure 2. SMCs adhesion and proliferation on the multilayers post-treated with different NaCl solutions. (a) The ratio of livingSMCs cultured on the multilayers for 4 h with and without FBS, respectively. The live and dead cells were distinguished by FDAand PI staining. (b) Cell spreading area, (c) cell number and (d) OD value of the SMCs on the multilayers after being cultured inDMEM/10 per cent FBS for different periods of time. (e) Cell cycle analysis of G0/G1, S and G2/M phases of SMCs incubatedfor 24 h on TCPS and the multilayers post-treated with 1, 2, 3, 4 and 5 M salt solutions, respectively. Asterisks indicate signifi-cant difference, which is determined by one-way analysis of variance (ANOVA) in the Origin software. The statistical significanceof asterisks is set as p , 0.05 and the Tukey means comparison method is performed.

Migration of SMCs on multilayers L. Han et al. 3461

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

The cell cycle is a series of events that can induce celldivision and duplication, comprising interphase (gap1,G1), synthesis (S), gap2 (G2) and mitosis (M) phases[46]. Generally, three stages are discerned: G0/G1, Sand G2/M. Only one set (2n for SMCs) and duplicateset (4n) of DNAs are present during the G0/G1 andG2/M phases, respectively, whereas an intermediateamount (2n–4n) can be found during S phase [47].The cells cultured on the TCPS for 24 h displayed alarge portion of S and G2/M phases (figure 2e),suggesting active DNA synthesis and cell duplication.On all the sample surfaces, only the cells culturedon the multilayers-3 M exhibited a very similar dis-tribution of cell phases as those on the TCPS( p . 0.05), demonstrating its good cell compatibility.

J. R. Soc. Interface (2012)

By contrast, the cells cultured on the multilayers-1and 2 M were mostly trapped in the G0/G1 phase,although their S and G2/M phases were increasedslightly at a higher NaCl concentration. When thecells were cultured on the multilayers-4 and 5 M, theirG0/G1 phase were further decreased but still signifi-cantly higher than those of cells cultured on theTCPS and the multilayers-3 M (p , 0.05).

3.5. Organization of focal adhesionsand cytoskeleton

The physical links between the outside and inside of acell are mainly tuned by integrins [48]. The focal adhe-sions contain a high concentration of activated and

3462 Migration of SMCs on multilayers L. Han et al.

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

engaged integrins. Basically, the cell migration rate isinversely correlated with the cell focal adhesions,which are tuned by cytoskeleton reorganization andintracellular signalling, and are commonly required forthe other cellular events such as cell adhesion, spread-ing, survival, proliferation and differentiation [49,50].The focal adhesions after cell migration for 12 h (orseeding for 24 h) were investigated by staining vinculin(associated with focal adhesions) and F-actin (themajor membrane-cytoskeletal protein in focal adhe-sions; figure 3). On the multilayers-3 M, some largevinculin clusters (figure 3c(ii), arrow indicated) wereclearly visible, indicating that many focal adhesion pla-ques in the cells are assembled and then matured to bemore stable structures, which can also be observed forthe well spreading cells cultured on TCPS or glass[51]. The actin filaments of cells on the multilayers-3 M were clustered and distributed throughout theentire area of the cell, displaying actin stress fibres ofhigh tension (figure 3c(iii)). Some focal adhesion pla-ques could also be observed on the multilayers-4 and5 M (figure 3d(ii),e(ii), arrow indicated), but most ofthem preferentially localized to the leading edge. More-over, actin stress fibres as those on the multilayers-3 Mcould not be observed (figure 3d(iii),e(iii)), but the for-mation of actin branches could be observed at the cellleading edge, which can drive the formation of abroad lamellipodia and protrusion in the direction ofmigration. In contrast, neither distinct focal adhesionplaques nor stressed actin fibres were observed on themultilayers-1 and 2 M (figure 3a,b). However, actinpolymerization was formed to produce some cellprotrusions, especially on the multilayers-1 M.

3.6. Gene expression

The cellular response is mediated by the geneexpression. Fibronectin and laminin are two majorextracellular matrix glycoproteins governing celladhesion, spreading and migration, and FAK is anintracellular kinase localizing to focal adhesions andregulating both cellular adhesion and antiapoptotic sur-vival signalling [52,53]. Figure 4a shows that therelative mRNA levels of fibronectin, laminin and FAKfor the cells cultured on the multilayers-1 M were mark-edly decreased to 14 per cent, 21 per cent and 27 percent of those on TCPS ( p , 0.05), respectively. ThemRNA levels of laminin and FAK were obviouslydecreased for the cells cultured on the multilayers-3and 5 M, but the mRNA level of fibronectin wasenhanced compared with that on TCPS.

Myosins comprise a family of ATP-dependent motorproteins and are best known for their roles in musclecontraction and involvement in a wide range of othereukaryotic motility processes. Myosin II is the sub-family and responsible for producing tension betweenthe front and the rear of a cell from the interactionwith actin filaments [54,55]. Cdc42 is active towardthe leading edge of migrating cells and regulates cellpolarity [56]. Both inhibition and global activation ofCdc42 can disrupt the directionality of migration [57].Figure 4b shows that the mRNA levels of myosin IIA,an important protein in myosin II family, was

J. R. Soc. Interface (2012)

significantly enhanced for the cells cultured on the mul-tilayers-3 M but significantly weakened for the cellscultured on the multilayers-1 and 5 M ( p , 0.05). ThemRNA level of Cdc42 was obviously decreased for thecells cultured on the multilayers-3 M but slightlyincreased for the cells cultured on the multilayers-1and 5 M ( p , 0.05).

4. DISCUSSION

The earlier-mentioned results demonstrate a V-shapepattern of SMC migration rate or relative migrationability and other related cellular events as a functionof salt concentration during multilayer treatment. TheSMCs migrate slowest on the multilayers-3 M, whichare closest to those on TCPS, with the best spreadingmorphology and abundant focal adhesion plaques. Bycontrast, the cells migrate fastest on the multilayers-5 M. Migration can be modulated by many factors,including the existence of soluble and immobilizedchemical cues and substrate properties [7,15,58].Taking all the results into consideration, the multilayerstructures and properties such as surface chemistry,zeta potential, hydrophilicity and swelling may have sig-nificant influences on the different cell performance.Here the surface morphology shall not be taken into con-sideration because of its smaller variation (smaller than10 nm) and the less relevant fact of monotonous decreaseof surface roughness. Also, Lampin et al. reported thatthe roughness has less influence on cell migration [59].

Usually, cell motility is directly influenced by the for-mation and presence of focal adhesions. In order tomigrate, a cell is required to form new adhesion pointson its front (cell leading edge), and simultaneously torelease the old ones in its rear [54]. These new adhesionpoints driven by actin polymerization are regarded asprotrusions, which can extend and become lamellipodiaor filopodia, and then be stabilized through focaladhesions [60]. Hence, for the cells cultured on the mul-tilayers-4 and 5 M, the actin fibres were polymerized atthe cell leading edge, accompanying the formation offocal adhesion plaques (shown by large vinculin clus-ters). These results reveal that the lamellipodia areformed and the focal adhesion plaques serve as tractionsites for migration, both of which improve the cellmigration rate (figure 3d,e). By contrast, for the cellscultured on the multilayers-3 M, many larger focaladhesion plaques were observed inside the cells (figure3c(ii), arrow indicated), and the actin stress fibrescrossed through the whole cell. The focal adhesionsassembled significantly in most area of the cells cancause tight adhesion, disrupt release of the rear, andthereby inhibit cell motility and result in the slowestmigration rate [50]. This result is consistent with thefact that the over-expression of vinculin reduces cellmotility, whereas generally the cells expressing lowervinculin migrate much faster [61]. However, for thecells on the multilayers-1 and 2 M, the cell protrusionsdriven by actin polymerization and low expression ofvinculin may promote cell movement to someextent (figure 3a,b), but their weak focal adhesionsimpair cell motility and cause a slower migration

(a)

(b)

(c)

(d )

(e)

(iii)

front

rear

(i) (ii)

(iii)(ii)(i)(i)

front

rear

front

rear

(iii)(ii)(i)(i)

(iii)(ii)(i)(i)

(iii)(ii)(i)(i)

Figure 3. Morphology and focal contact formation of the SMCs cultured on the salt-treated multilayers for 24 h. RepresentativeCLSM images of SMCs on the multilayers treated with (a) 1, (b) 2, (c) 3, (d) 4 and (e) 5 M NaCl solutions, respectively.(a(i)–e(i)) Merge fluorescence images of vinculin (green), actin (red) and nucleus (blue). (a(ii)–e(ii)) and (a(iii)–e(iii)) vinculinand actin in a single cell, respectively. Arrows in (c(ii)), (d(ii)) and (e(ii)) indicate areas of large focal adhesion plaques. Two-headarrows indicate the polarity of the SMCs, and the texts illustrate the cell front (cell leading edge) and rear.

Migration of SMCs on multilayers L. Han et al. 3463

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

rate than that on the multilayers-5 M. Therefore, cellmotility can be largely improved at moderate focaladhesion.

J. R. Soc. Interface (2012)

However, why are the focal adhesions significantlydifferent among the cells cultured on the salt-treatedmultilayers? The cell adhesion results reveal that all

fibronectin laminin FAK

0

50

100

150

rela

tive

gene

exp

ress

ion

(TC

PS a

s 10

0)

multilayer-1 Mmultilayer-3 Mmultilayer-5 M

myosin IIA Cdc420

50

100

150

multilayer-1 M multilayer-3 M multilayer-5 M

(b)(a)

***

**

*

* **

**

*

Figure 4. Gene expression analysis of SMCs cultured on TCPS and the salt-treated multilayers for 24 h. (a) Cell adhesion-relatedgenes of fibronectin, laminin and FAK, and (b) migration-related genes of myosin IIA and Cdc42 detected by real-time quanti-tative RT-PCR. The data were normalized to those control cells cultured on TCPS. Asterisks indicate significant differenceat p , 0.05.

3464 Migration of SMCs on multilayers L. Han et al.

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

the SMCs cultured on the PSS-dominated surfaces havebetter performance than those on the PDADMAC-dominated surfaces (figure 2), confirming that the sur-face chemistry takes a major role in cell response such aslive-cell ratio, spreading area, cell adhesion number andproliferation. In the serum-free culture medium, all thecells were dead on the PDADMAC-dominated surfaces(figure 2a; multilayers-1 and 2 M). It is known that theunbound segments of positive PDADMAC may extrudeinto the medium, and severely disturb the structuresand functions of cell membranes as a result of combi-nation with the negative membrane proteins andphospholipids, leading to severe cytotoxicity [62,63].In the culture medium containing serum proteins,some of the unassociated segments of PDADMACmight be blocked by the adsorbed proteins, leading tothe reduction of cytotoxicity. Nevertheless, the posi-tively charged surface after protein adsorption stillcauses cell death to some extent (table 2) and themost severe down regulation of FAK (figure 4a). Thisresult is also in good agreement with that of the cellcycle analysis (figure 2e), because the cells culturedon the PDADMAC-dominated multilayers are mostlytrapped in the G0/G1 phase. Therefore, the cells thatspread poorly on these surfaces produce a low level ofgenes for FAK and fibronectin (figure 4a), leading tothe lower expression of focal adhesion-related proteins,i.e. vinculin (figure 3a,b). By contrast, the negativelycharged surfaces dominated by PSS can interact withthe cells and proteins in a more friendly way, andbetter maintain the natural conformation of the serumproteins. Thus, the cells produce a higher level of genesfor fibronectin and FAK (figure 4a), and the focaladhesion-related proteins (figure 3c,d).

The surface chemistry has substantial influences oncell behaviours. Many surfaces with specific chemicalcompositions have been prepared and used to elucidatetheir influences on cell adhesion and migration. Theextracellular matrix (ECM) proteins, peptides and cellgrowth factors such as collagen [7], fibronectin [8], lami-nin [9], VEGF [10], bFGF [11] and RGD [12,13] canbind to the receptors on the cell surface, initiate intra-cellular signalling pathways and finally regulate cellfunctions. Therefore, they are widely used to enhancethe cell adhesion and other functions. Other synthetic

J. R. Soc. Interface (2012)

surfaces with different functional groups can also regu-late cell behaviours. For example, human fibroblastsadhere stronger on carboxyl and amine than methyl,polyethylene glycol (PEG) and hydroxyl-terminatedsurfaces [64]. The osteoblasts migrate slower on thiolsurfaces compared with oxidized thiol, quaternaryamine and methyl surfaces [14]. In this study, wefound that surfaces with positive charge, which inducecell apoptosis, can reduce cell mobility. Here, appar-ently the sulphonate group plays a major role in goodcell adhesion and spreading.

With the same surface chemistry, the SMCs stillshow the best focal adhesion and spreading on the mul-tilayers-3 M than on the other two PSS-dominatedsurfaces (multilayers-4 and 5 M). Other factors mustcome into play. Previous works demonstrate that sur-face wettability has a significant impact on cellbehaviour, as evidenced by the fact that the cellsusually grow well on a substrate with a contact angleof 50–708 [65]. In this study, the water contact angleof the multilayers-5 M is near 508, but the cell growthis not as good as that on the multilayers-3 M (contactangle of 328). Therefore, the wettability of the multi-layers is not a major governing factor in our system.Besides, the thickness and stiffness/swelling may havesignificant influences on the cell behaviours. A stifferunderlying film has a smaller critical mechanosensingthickness for cells [66]. For example, when the PSS/PDADMAC multilayers are assembled in water with alow hydrated structure, the critical mechanosensingthickness for cells is less than 80 nm [67]. However,this critical thickness is enlarged to 1–2 mm or moreon the soft gels [68]. In other words, the compositionsof the multilayers play an important role too. Takinginto the fact that cell adhesion on the thinner multi-layers-5 M was poorer than that on the thickermultilayers-3 M, one can conclude that the swellingratio or stiffness of the salt-treated multilayers plays astronger role although the effect of thickness on cellmigration cannot be absolutely excluded. In principle,the anchorage-dependent cells such as SMCs mustadhere onto a substrate with enough strength beforeany other cellular events. On very soft surfaces suchas the highly hydrated and swollen one, the substratecannot provide strong enough adhesion force for the

migration direction

rear retraction

negative and dehydrated surface (multilayers-3 M): slow migration

polarity

polarity

focal adhesion plaques

new adhesions

actin polymerization

nucleus

polarity

negative and highly hydrated surface (multilayers-5 M): fast migration

positive and hydrated surface (multilayers-1 M): medium migration

actin filaments

(c)

(b)

(a)

Figure 5. Scheme of the SMCs migration behaviours on the multilayers with different surface charge and swelling properties.(a) The SMCs have a moderate migration rate on the positively charged and hydrated surface (the multilayers-1 M). (b) TheSMCs migrate slowest on the negatively charged and dehydrated surface (the multilayers-3 M). (c) The SMCs migrate fasteston the negatively charged and highly hydrated surface (the multilayers-5 M).

Migration of SMCs on multilayers L. Han et al. 3465

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

cells to anchor and spread. By contrast, a rigid substratecan provide enough adhesion force [6,69]. As shown intable 2, the multilayers-3 M displays the smallest swel-ling ratio, implying that it has the strongest stiffness inthe culture medium. Therefore, the smallest swelling be-haviour of the multilayers-3 M should play a major rolein the best cell adhesion and proliferation, and themost obvious focal adhesion plaques in the cells. A pre-vious study found that on the polyacrylamide hydrogelwith a mechanical gradient and different concentrationsof collagen (type I), the chemical signals have a moredominant role in regulating fibroblasts movement [67].The present results demonstrate, however, thatboth the surface chemistry and swelling property arethe governing factors for cell migration.

The cycle of cell migration can be divided into fourphases: polarization, protrusion, traction and dis-assembly. When the cells extend their protrusions, cellpolarity must take place, implying a difference in thefront and rear of the cell [50,54]. Hence, besides focaladhesion, the expression of related genes on polarizationand protrusion was analysed. Cdc42 can promote actinpolymerization and then regulate cell polarity. As amaster regulator of cell polarity, Cdc42 in cells culturedon the multilayers-1 and 5 M is upregulated (figure 4b),inducing cell polarity and formation of protrusions inthe cell front (figure 3a,e, texts and two headsarrows). Hence, more obvious lamellipodia on the mul-tilayers-1 and 5 M can be observed, which should beresponsible for the faster cell migration. Comparatively,the expression level of Cdc42 in the cells cultured on themultilayers-3 M is reduced, implying the weak polariz-ation and restriction on formation of protrusions inthe cell front. This is consistent with the immunostain-ing results (figure 3c(i)). Compared with thosenormally polarized cells with ruffled and fan-shapedprotrusions at the leading edge and a traction point at

J. R. Soc. Interface (2012)

the rear, the front and rear in these low polarized cellsare not easily distinguished, which can explain theslower mobility on the multilayers-3 M. The cells onthe multilayers-3 M display upregulated myosin IIAlevel, which is consistent with their highly spreadingmorphology because myosin II can promote the gener-ation of tension between the front and back of acell [54,55].

5. CONCLUSION

The study of cell migration behaviours on biomaterialssurface is of paramount importance because it canreveal many physiological and pathological eventsand eventually guide the design of biomaterials withbetter performance in tissue regeneration. In this work,the physico-chemical properties of the PSS/PDADMACmultilayers were modulated by post-treatment with1–5 M NaCl solutions. These resulting thin films werestable in the cell culture medium. We found that boththe surface chemistry and swelling property, but notthe surface roughness and surface wettability, playprimary roles in cell migration.

On the positively charged surface (figure 5a, themultilayers-1 and 2 M), the SMCs have lower viabilityand smaller spreading extent owing to the surface cyto-toxicity generated by the interactions of positivelycharged polymer chains and negatively charged cellmembrane. Hence, the expression level of vinculin,FAK and fibronectin is reduced. Actin polymerizationoccurs in the front of lamellipodia, and thereby thecell polarity takes place and Cdc42 is upregulated. Asa result of the weaker adhesion and enhanced polarity,SMCs have a moderate migration rate. The cellsprefer to spread and proliferate on the PSS-dominatedsurfaces that are negatively charged (multilayers-3,

3466 Migration of SMCs on multilayers L. Han et al.

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

4 and 5 M), showing higher expression of fibronectinand FAK. In particular, the dehydrated multilayers-3 M can provide a strong adhesion force for the cellsto anchor, so that the cell actin filaments distributethroughout the cells with well-organized focal adhesionplaques, resulting in stronger cell adhesion (figure 5b).The downregulation of Cdc42 causes lower cell polarity.Hence, the cells display the slowest cell mobility, whichis comparable with that on TCPS control. The samenegatively charged but highly hydrated surface suchas the multilayers-5 M, however, can effectively pro-mote cell mobility (figure 5c). Actin fibres are formedat the cell leading edge, yielding broad lamellipodiaand protrusions in the direction of migration. Mean-while, most of the focal adhesion plaques localize onthe leading edge, which is consistent with the upregula-tion of Cdc42, leading to a stronger forward force.Therefore, the cells migrate fastest on this surface.

These basic principles may provide a profound under-standing of cell–materials interactions and newguidelines for the design of advanced biomaterials inregenerative medicine. For example, in some vascular sur-geries, the excessive migration of SMCs results inrestenosis and intimal hyperplasia, especially for smalldiameter blood vessel tissue engineering. In this situation,dehydrated and negatively charged surfaces such as themultilayers-3 M could be used to reduce the cell migrationrate. In other cases, stronger SMC migration ability onbiomaterials can enhance tissue regeneration such as inan abdominal wall replacement model. In this regard,highly swelling and negatively charged surfaces such asthe multilayers-5 M could be an optimal choice.

This study was financially supported by the Natural ScienceFoundation of China (20934003), and the National BasicResearch Program of China (2011CB606203).

REFERENCES

1 Sagvolden, G., Giaever, I., Pettersen, E. O. & Feder, J.1999 Cell adhesion force microscopy. Proc. Natl Acad.Sci. USA 96, 471–476. (doi:10.1073/pnas.96.2.471)

2 Kidambi, S., Lee, I. & Chan, C. 2004 Controlling primaryhepatocyte adhesion and spreading on protein-free poly-electrolyte multilayer films. J. Am. Chem. Soc. 126,16286–16287. (doi:10.1021/ja046188u)

3 Kidambi, S., Udpa, N., Schroeder, S. A., Findlan, R., Lee,I. & Chan, C. 2007 Cell adhesion on polyelectrolyte multi-layer coated polydimethylsiloxane surfaces with varyingtopographies. Tissue Eng. 13, 2105–2117. (doi:10.1089/ten.2006.0151)

4 Mehrotra, S., Lynam, D., Maloney, R., Pawelec, K. M.,Tuszynski, M. H., Lee, I., Chan, C. & Sakamoto, J. 2010Time controlled protein release from layer-by-layer assembledmultilayer functionalized agarose hydrogels. Adv. Funct.Mater. 20, 247–258. (doi:10.1002/adfm.200901172)

5 Engler, A., Bacakova, L., Newman, C., Hategan, A., Grif-fin, M. & Discher, D. 2004 Substrate compliance versusligand density in cell on gel responses. Biophys. J. 86,617–628. (doi:10.1016/S0006-3495(04)74140-5)

6 Pelham, R. J. & Wang, Y. L. 1997 Cell locomotion andfocal adhesions are regulated by substrate flexibility.Proc. Natl Acad. Sci. USA 94, 13 661–13 665. (doi:10.1073/pnas.94.25.13661)

J. R. Soc. Interface (2012)

7 Raines, E. W. 2000 The extracellular matrix can regulatevascular cell migration, proliferation, and survival:relationships to vascular disease. Int. J. Exp. Pathol. 81,173–182. (doi:10.1046/j.1365-2613.2000.00155.x)

8 Smith, J. T., Tomfohr, J. K., Wells, M. C., Beebe, T. P.,Kepler, T. B. & Reichert, W. M. 2004 Measurement ofcell migration on surface-bound fibronectin gradients.Langmuir 20, 8279–8286. (doi:10.1021/la0489763)

9 Dertinger, S. K. W., Jiang, X. Y., Li, Z. Y., Murthy, V. N. &Whitesides, G. M. 2002 Gradients of substrate-boundlaminin orient axonal specification of neurons. Proc.Natl Acad. Sci. USA 99, 12 542–12 547. (doi:10.1073/pnas.192457199)

10 Liu, L. Y., Ratner, B. D., Sage, E. H. & Jiang, S. Y.2007 Endothelial cell migration on surface-density gradi-ents of fibronectin, VEGF, or both proteins. Langmuir23, 11 168–11 173. (doi:10.1021/la701435x)

11 DeLong, S. A., Moon, J. J. & West, J. L. 2005 Covalentlyimmobilized gradients of bFGF on hydrogel scaffolds fordirected cell migration. Biomaterials 26, 3227–3234.(doi:10.1016/j.biomaterials.2004.09.021)

12 DeLong, S. A., Gobin, A. S. & West, J. L. 2005 Covalentimmobilization of RGDS on hydrogel surfaces to directcell alignment and migration. J. Control Release 109,139–148. (doi:10.1016/j.jconrel.2005.09.020)

13 Guarnieri, D., De Capua, A., Ventre, M., Borzacchiello, A.,Pedone, C., Marasco, D., Ruvo, M. & Netti, P. A. 2010Covalent immobilized RGD gradient on PEG hydrogel scaf-fold influences cell migration parameters. Acta Biomater. 6,2532–2539. (doi:10.1016/j.actbio.2009.12.050)

14 Webb, K., Hlady, V. & Tresco, P. A. 2000 Relationshipsamong cell attachment, spreading, cytoskeletal organiz-ation, and migration rate for anchorage-dependentcells on model surfaces. J. Biomed. Mater. Res. 49,362–368. (doi:10.1002/(SICI)1097-4636(20000305)49:3,

362::AID-JBM9.3.0.CO;2-S)15 Lo, C. M., Wang, H. B., Dembo, M. & Wang, Y. L.

2000 Cell movement is guided by the rigidity of the sub-strate. Biophys. J. 79, 144–152. (doi:10.1016/S0006-3495(00)76279-5)

16 Wu, J., Mao, Z. & Gao, C. 2011 Controlling the migrationbehaviors of vascular smooth muscle cells by methoxy poly(ethylene glycol) brushes of different molecular weight anddensity. Biomaterials 33, 810–820.

17 Decher, G. 1997 Fuzzy nanoassemblies: toward layeredpolymeric multicomposites. Science 277, 1232–1237.(doi:10.1126/science.277.5330.1232)

18 Richert, L., Lavalle, P., Vautier, D., Senger, B., Stoltz,J. F., Schaaf, P., Voegel, J. C. & Picart, C. 2002 Cellinteractions with polyelectrolyte multilayer films. Bioma-cromolecules 3, 1170–1178. (doi:10.1021/bm0255490)

19 Tang, Z. Y., Wang, Y., Podsiadlo, P. & Kotov, N. A. 2006Biomedical applications of layer-by-layer assembly: frombiomimetics to tissue engineering. Adv. Mater. 18,3203–3224. (doi:10.1002/adma.200600113)

20 Elbert, D. L., Herbert, C. B. & Hubbell, J. A. 1999 Thinpolymer layers formed by polyelectrolyte multilayer tech-niques on biological surfaces. Langmuir 15, 5355–5362.(doi:10.1021/la9815749)

21 Hubsch, E., Ball, V., Senger, B., Decher, G., Voegel, J. C. &Schaaf, P. 2004 Controlling the growth regime of polyelectro-lyte multilayer films: changing from exponential to lineargrowth by adjusting the composition of polyelectrolyte mix-tures. Langmuir 20, 1980–1985. (doi:10.1021/la0361870)

22 Tan, H. L., McMurdo, M. J., Pan, G. Q. & Van Patten,P. G. 2003 Temperature dependence of polyelectrolytemultilayer assembly. Langmuir 19, 9311–9314. (doi:10.1021/la035094f)

Migration of SMCs on multilayers L. Han et al. 3467

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

23 Thompson, M. T., Berg, M. C., Tobias, I. S., Rubner,M. F. & Van Vliet, K. J. 2005 Tuning compliance ofnanoscale polyelectrolyte multilayers to modulate celladhesion. Biomaterials 26, 6836–6845. (doi:10.1016/j.biomaterials.2005.05.003)

24 Dubas, S. T. & Schlenoff, J. B. 2001 Swelling and smooth-ing of polyelectrolyte multilayers by salt. Langmuir 17,7725–7727. (doi:10.1021/la0112099)

25 Guzman, E., Ritacco, H., Rubio, J. E. F., Rubio, R. G. &Ortega, F. 2009 Salt-induced changes in the growth ofpolyelectrolyte layers of poly(diallyl-dimethylammoniumchloride) and poly(4-styrene sulfonate of sodium). SoftMatter 5, 2130–2142. (doi:10.1039/b901193e)

26 Mendelsohn, J. D., Yang, S. Y., Hiller, J., Hochbaum, A. I. &Rubner, M. F. 2003 Rational design of cytophilic andcytophobic polyelectrolyte multilayer thin films. Biomacro-molecules 4, 96–106. (doi:10.1021/bm0256101)

27 Hillberg, A. L., Holmes, C. A. & Tabrizian, M. 2009Effect of genipin cross-linking on the cellular adhesionproperties of layer-by-layer assembled polyelectrolytefilms. Biomaterials 30, 4463–4470. (doi:10.1016/j.biomaterials.2009.05.026)

28 Hu, Y., Cai, K., Luo, Z. & Jandt, K. D. 2010 Layer-by-layer assembly of b-stradiol loaded mesoporous silicananoparticles on titanium substrates and its implicationfor bone homeostasis. Adv. Mater. 22, 4146–4150.(doi:10.1002/adma.201000854)

29 Swiston, A. J., Cheng, C., Um, S. H., Irvine, D. J., Cohen,R. E. & Rubner, M. F. 2008 Surface functionalization ofliving cells with multilayer patches. Nano Lett. 8,4446–4453. (doi:10.1021/nl802404h)

30 Hu, Y., Cai, K., Luo, Z., Zhang, R., Yang, L., Deng, L. &Jandt, K. D. 2009 Surface mediated in situ differentiationof mesenchymal stem cells on gene-functionalized titaniumfilms fabricated by layer-by-layer technique. Biomaterials30, 3626–3635. (doi:10.1016/j.biomaterials.2009.03.037)

31 Zhu, Y. B., Gao, C. Y., He, T., Liu, X. Y. & Shen, J. C.2003 Layer-by-layer assembly to modify poly(L-lacticacid) surface toward improving its cytocompatibility tohuman endothelial cells. Biomacromolecules 4, 446–452.(doi:10.1021/bm025723k)

32 Richert, L., Boulmedais, F., Lavalle, P., Mutterer, J.,Ferreux, E., Decher, G., Schaaf, P., Voegel, J. C. &Picart, C. 2004 Improvement of stability and cell adhesionproperties of polyelectrolyte multilayer films by chemicalcross-linking. Biomacromolecules 5, 284–294. (doi:10.1021/bm0342281)

33 Schneider, A. et al. 2006 Polyelectrolyte multilayers witha tunable Young’s modulus: influence of film stiffness oncell adhesion. Langmuir 22, 1193–1200. (doi:10.1021/la0521802)

34 Dubas, S. T., Kittitheeranun, P., Rangkupan, R.,Sanchavanakit, N. & Potiyaraj, P. 2009 Coating of poly-electrolyte multilayer thin films on nanofibrous scaffoldsto improve cell adhesion. J. Appl. Polym. Sci. 114,1574–1579. (doi:10.1002/app.30690)

35 Kidambi, S., Sheng, L. F., Yarmush, M. L., Toner, M.,Lee, I. & Chan, C. 2007 Patterned co-culture of primaryhepatocytes and fibroblasts using polyelectrolyte multi-layer templates. Macromol. Biosci. 7, 344–353. (doi:10.1002/mabi.200600205)

36 Han, L.,Mao, Z., Wuliyasu, H.,Wu, J.,Gong, X.,Yang,Y.&Gao, C. 2012 Modulating the structure andproperties of poly(sodium 4-styrenesulfonate)/poly (diallyldimethylammo-nium chloride) multilayers by concentrated salt solutions.Langmuir 28, 193–199. (doi:10.1021/la2040533)

37 Owens, G. K., Kumar, M. S. & Wamhoff, B. R. 2004Molecular regulation of vascular smooth muscle cell

J. R. Soc. Interface (2012)

differentiation in development and disease. Physiol. Rev.84, 767–801. (doi:10.1152/physrev.00041.2003)

38 Hong, Y., Ye, S. H., Nieponice, A., Soletti, L., Vorp, D. A. &Wagner, W. R. 2009 A small diameter, fibrous vascularconduit generated from a poly(ester urethane)urea andphospholipid polymer blend. Biomaterials 30, 2457–2467.(doi:10.1016/j.biomaterials.2009.01.013)

39 Hashizume, R., Fujimoto, K. L., Hong, Y., Amoroso, N. J.,Tobita, K., Miki, T., Keller, B. B., Sacks, M. S. & Wagner,W. R. 2010 Morphological and mechanical characteristicsof the reconstructed rat abdominal wall following use of awet electrospun biodegradable polyurethane elastomerscaffold. Biomaterials 31, 3253–3265. (doi:10.1016/j.biomaterials.2010.01.051)

40 Han, L. L., Zhou, J., Gong, X. & Gao, C. Y. 2009 Solvent-assisted polymer micro-molding. Chinese. Sci. Bull. 54,2193–2204. (doi:10.1007/s11434-009-0212-5)

41 Han, L. L., Zhou, J., Gong, X., Yang, J. & Gao, C. Y. 2010Force-free patterning of polyelectrolyte multilayers undersolvent assistance. Macromol. Mater. Eng. 295,716–725. (doi:10.1002/mame.201000008)

42 Salloum, D. S. & Schlenoff, J. B. 2004 Protein adsorptionmodalities on polyelectrolyte multilayers. Biomacromole-cules 5, 1089–1096. (doi:10.1021/bm034522t)

43 Tristan, F., Palestino, G., Menchaca, J. L., Perez, E.,Atmani, H., Cuisinier, F. & Ladam, G. 2009 Tunableprotein-resistance of polycation-terminated polyelectrolytemultilayers. Biomacromolecules 10, 2275–2283. (doi:10.1021/bm900453s)

44 Allen, L. T. et al. 2006 Surface-induced changes inprotein adsorption and implications for cellular phenoty-pic responses to surface interaction. Biomaterials 27,3096–3108. (doi:10.1016/j.biomaterials.2006.01.019)

45 Muller, G., Behrens, J., Nussbaumer, U., Bohlen, P. &Birchmeier, W. 1987 Inhibitory-action of transforminggrowth-factor-beta, on endothelial-cells. Proc. Natl Acad.Sci. USA 84, 5600–5604. (doi:10.1073/pnas.84.16.5600)

46 van Kooten, T. G., Whitesides, J. F. & von Recum, A. F.1998 Influence of silicone (PDMS) surface texture onhuman skin fibroblast proliferation as determined by cellcycle analysis. J. Biomed. Mater. Res. 43, 1–14. (doi:10.1002/(SICI)1097-4636(199821)43:1,1::AID-JBM1.3.0.CO;2-T)

47 Mao, J. S., Cui, Y. L., Wang, X. H., Sun, Y., Yin, Y. J., Zhao,H. M. & De Yao, K. 2004 A preliminary study on chitosanand gelatin polyelectrolyte complex cytocompatibilityby cell cycle and apoptosis analysis. Biomaterials 25,3973–3981. (doi:10.1016/j.biomaterials.2003.10.080)

48 Stevens, M. M. & George, J. H. 2005 Exploring and engin-eering the cell surface interface. Science 310, 1135–1138.(doi:10.1126/science.1106587)

49 Lee, J., Chu, B. H., Chen, K. H., Ren, F. & Lele, T. P. 2009Randomly oriented, upright SiO2 coated nanorods forreduced adhesion of mammalian cells. Biomaterials 30,4488–4493. (doi:10.1016/j.biomaterials.2009.05.028)

50 Wong, J. Y., Velasco, A., Rajagopalan, P. & Pham, Q.2003 Directed movement of vascular smooth musclecells on gradient-compliant hydrogels. Langmuir 19,1908–1913. (doi:10.1021/la026403p)

51 Lou, P. J., Chiu, M. Y., Chou, C. C., Liao, B. W. & Young,T. H. 2010 The effect of poly (ethylene-co-vinyl alcohol)on senescence-associated alterations of human dermalfibroblasts. Biomaterials 31, 1568–1577. (doi:10.1016/j.biomaterials.2009.11.048)

52 Colognato, H. & Yurchenco, P. D. 2000 Form andfunction: the laminin family of heterotrimers. Dev. Dyn.218, 213–234. (doi:10.1002/(SICI)1097-0177(200006)218:2,213::AID-DVDY1.3.0.CO;2-R)

3468 Migration of SMCs on multilayers L. Han et al.

on November 4, 2012rsif.royalsocietypublishing.orgDownloaded from

53 Pankov, R. & Yamada, K. M. 2002 Fibronectin at a glance.J. Cell Sci. 115, 3861–3863. (doi:10.1242/jcs.00059)

54 Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A.,Ginsberg, M. H., Borisy, G., Parsons, J. T. & Horwitz,A. R. 2003 Cell migration: integrating signals from frontto back. Science 302, 1704–1709. (doi:10.1126/science.1092053)

55 Fournier, M. F., Sauser, R., Ambrosi, D., Meister, J. J. &Verkhovsky, A. B. 2010 Force transmission in migratingcells. J. Cell Biol. 188, 287–297. (doi:10.1083/jcb.200906139)

56 Itoh, R. E., Kurokawa, K., Ohba, Y., Yoshizaki, H.,Mochizuki, N. & Matsuda, M. 2002 Activation of Racand Cdc42 video imaged by fluorescent resonance energytransfer-based single-molecule probes in the membrane ofliving cells. Mol. Cell Biol. 22, 6582–6591. (doi:10.1128/MCB.22.18.6582-6591.2002)

57 Etienne-Manneville, S. & Hall, A. 2002 Rho GTPases in cellbiology. Nature 420, 629–635. (doi:10.1038/nature01148)

58 Carter, S. B. 1967 Haptotaxis and mechanism of cellmotility. Nature 213, 256. (doi:10.1038/213256a0)

59 Lampin, M., WarocquierClerout, R., Legris, C., Degrange,M. & SigotLuizard, M. F. 1997 Correlation between sub-stratum roughness and wettability, cell adhesion, andcell migration. J. Biomed. Mater. Res. 36, 99–108.(doi:10.1002/(SICI)1097-4636(199707)36:1,99::AID-JBM12.3.0.CO;2-E)

60 Lauffenburger, D. A. & Horwitz, A. F. 1996 Cellmigration: a physically integrated molecular process. Cell84, 359–369. (doi:10.1016/S0092-8674(00)81280-5)

61 Fernandez, J. L. R., Geiger, B., Salomon, D. & Benzeev, A.1992 Overexpression of vinculin suppresses cell motility inBALB/c 3T3 cells. Cell Motil. Cytoskel. 22, 127–134.(doi:10.1002/cm.970220206)

J. R. Soc. Interface (2012)

62 Fischer, D., Li, Y. X., Ahlemeyer, B., Krieglstein, J. &Kissel, T. 2003 In vitro cytotoxicity testing of polycations:influence of polymer structure on cell viability and hemo-lysis. Biomaterials 24, 1121–1131. (doi:10.1016/S0142-9612(02)00445-3)

63 Murata, H., Koepsel, R. R., Matyjaszewski, K. & Russell,A. J. 2007 Permanent, non-leaching antibacterial surfaces.2: how high density cationic surfaces kill bacterial cells.Biomaterials 28, 4870–4879. (doi:10.1016/j.biomaterials.2007.06.012)

64 Faucheux, N., Schweiss, R., Lutzow, K., Werner, C. &Groth, T. 2004 Self-assembled monolayers with differentterminating groups as model substrates for cell adhesionstudies. Biomaterials 25, 2721–2730. (doi:10.1016/j.biomaterials.2003.09.069)

65 Brocchini, S., James, K., Tangpasuthadol, V. & Kohn, J.1997 A combinatorial approach for polymer design. J. Am.Chem. Soc. 119, 4553–4554. (doi:10.1021/ja970389z)

66 Maloney, J. M., Walton, E. B., Bruce, C. M. & Van Vliet,K. J. 2008 Influence of finite thickness and stiffness oncellular adhesion-induced deformation of compliant sub-strata. Phys. Rev. E 78, 041923. (doi:10.1103/PhysRevE.78.041923)

67 Hale, N. A., Yang, Y. & Rajagopalan, P. 2010 Cellmigration at the interface of a dual chemical–mechanicalgradient. Acs Appl. Mater. Interfaces 2, 2317–2324.(doi:10.1021/am100346k)

68 Sen, S., Engler, A. J. & Discher, D. E. 2009 Matrix strainsinduced by cells: computing how far cells can feel. Cell.Mol. Bioeng. 2, 39–48. (doi:10.1007/s12195-009-0052-z)

69 Discher, D. E., Janmey, P. & Wang, Y. L. 2005 Tissue cellsfeel and respond to the stiffness of their substrate. Science310, 1139–1143. (doi:10.1126/science.1116995)