Influence of vaginal microbiota on toxic shock syndrome toxin-1

1

Influence of vaginal microbiota on toxic shock syndrome toxin-1 production by 1

Staphylococcus aureus. 2

3

Roderick MacPhee (1,2), Wayne L. Miller (1), Greg Gloor (3), John K. McCormick 4

(1,2), Jeremy Burton (1,2) and Gregor Reid (1,2) 5

6

1. Canadian Research & Development Centre for Probiotics, Lawson Health Research 7

Institute, 268 Grosvenor Street, London, Ontario, N6A 4V2, Canada. 8

2. Department of Microbiology & Immunology, The University of Western Ontario, 9

London, Ontario, N6A 5C1, Canada. 10

3. Department of Biochemistry, The University of Western Ontario, London, Ontario, 11

N6A 5C1, Canada. 12

* Address for Correspondence: Gregor Reid, Canadian Research & Development 13

Centre for Probiotics, Lawson Health Research Institute, 268 Grosvenor St., N6A 4V2, 14

London, Ontario, Canada. E-mail: [email protected]. Tel: 519-646-6100 x 65256 Fax: 15

519-646-6031 16

17

18

19

20

21

22

23

24

25

26

27

Copyright © 2013, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02908-12 AEM Accepts, published online ahead of print on 11 January 2013

on January 9, 2019 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

2

28

29

30

31

Abstract 32

Menstrual toxic shock syndrome (TSS) is a serious illness that afflicts women of 33

pre-menopausal age worldwide, and arises from vaginal infection by Staphylococcus 34

aureus and concurrent production of toxic shock syndrome toxin-1 (TSST-1). Studies 35

have illustrated the capacity of lactobacilli to reduce S. aureus virulence, including 36

TSST-1-suppression. We hypothesized that an aberrant microbiota characteristic of 37

pathogenic bacteria would induce an increased production of TSST-1 and that this might 38

represent a risk factor for the development of TSS. A S. aureus TSST-1 reporter strain 39

was grown in the presence of vaginal swab contents collected from women with a 40

clinically healthy vaginal status, an intermediate status, and those diagnosed with 41

bacterial vaginosis (BV). Bacterial supernatant-challenge assays were also performed to 42

test the effects of aerobic vaginitis (AV)-associated pathogens towards TSST-1 43

production. While clinical samples from healthy and BV women suppressed toxin 44

production, in vitro studies demonstrated that Streptococcus agalactiae and 45

Enterococcus spp. significantly induced TSST-1 production, while some Lactobacillus 46

spp. suppressed it. The findings suggest that women colonized by S. aureus and with 47

aerobic vaginitis (AV), but not BV, may be more susceptible to menstrual-TSS and 48

would most benefit from prophylactic treatment. 49

50

51

52


.asm.org/

Dow

nloaded from

http://aem.asm.org/

3

Introduction 53

Toxic shock syndrome (TSS) is a systemic illness characterized by extensive T-54

cell proliferation throughout the body. This leads to systemic inflammation and 55

concurrent health problems, including rash formation, multiple organ failure and 56

potentially death. Menstrual-TSS is a form of the disease prominent in pre-menopausal 57

women, afflicting approximately 1 in every 100,000 women in the Western world (1, 2). 58

This condition arises from vaginal infection by Staphylococcus aureus and subsequent 59

production of toxic shock syndrome toxin-1 (TSST-1), a superantigen thought to be 60

unique with the capability of crossing the vaginal epithelial layer (3, 4). It is estimated 61

that 70% of women in North America use tampons (5), and although the rates of 62

menstrual-TSS have dropped significantly since the early 1980’s, it remains crucial to 63

better understand the pathogenesis of this condition to prevent its re-emergence. 64

Production of TSST-1, encoded by the tst gene, is regulated in large part by the 65

agr system of S. aureus (6), a well-characterized quorum sensing system (7) that 66

regulates many secreted and surface expressed virulence factors (8). Activation of this 67

system is regulated by several factors, including the SarA protein (9, 10), RAP/RIP 68

proteins (11) and alternative sigma-factor B (σB ) (12). Much research has been placed 69

on investigating the nature of TSST-1 production in response to environmental cues that 70

may be present in the vagina. For instance, Yarwood and Schlievert (13) revealed that 71

elevated oxygen levels in the presence of carbon dioxide are necessary for TSST-1 72

production. It is also well established that a neutral pH of 6.5-7.0, which is found in 73

aberrant vaginal conditions, is optimal for production of this toxin, in contrast to a healthy 74

vaginal pH of 4.5 (14, 15). It is therefore readily apparent that the vaginal environment, 75


.asm.org/

Dow

nloaded from

http://aem.asm.org/

4

characteristic of fluctuating gas levels and pH, could influence the degree to which 76

colonized S. aureus produce TSST-1. However, little research has been conducted to 77

evaluate the putative role of the residing vaginal microbiota, which arguably shapes this 78

environment as a whole. 79

The vaginal microbiota consists largely of Lactobacillus species, which produce 80

lactic acid and other antimicrobial metabolites that prevents the overgrowth of 81

opportunistic pathogens (16). These bacteria have been shown to inhibit the growth of 82

several urogenital pathogens, including S. aureus (17, 18). Furthermore, the vaginal 83

probiotic strain L. reuteri RC-14 has been shown to produce cyclic dipeptides capable of 84

suppressing TSST-1 production in S. aureus (19), suggesting that indigenous vaginal 85

lactobacilli may protect the host from menstrual-TSS progression. 86

Changes in the vaginal environment render the vaginal microbiota susceptible to 87

constant fluctuations in its members. This occasionally leads to depletion in the 88

lactobacilli population and a subsequent increase in pathogenic bacteria, resulting in 89

bacterial vaginosis (BV) or aerobic vaginitis (AV). BV is characterized by the overgrowth 90

of strict anaerobic bacteria including Gardnerella vaginalis, Atopobium vaginae, 91

Prevotella bivia and Leptotrichia amnionii (20, 21), and has been associated with 92

increased susceptibility to sexually transmitted infections, preterm labour (22) and pelvic 93

inflammatory disease (23, 24). In contrast, AV is characterized by the overgrowth of 94

enteric aerobic and facultative anaerobic commensals such as Escherichia coli, 95

Streptococcus agalactiae, Enterococcus faecalis and S. aureus (25) and is an 96

inflammatory condition that can often lead to pregnancy complications (26-29). 97


.asm.org/

Dow

nloaded from

http://aem.asm.org/

5

The aim of the present study is to investigate a potential relationship between the 98

vaginal microbiota and TSST-1 production by S. aureus, and thus the susceptibility to 99

menstrual-TSS. We hypothesize that an aberrant microbiota that alters the vaginal pH 100

and environment will lead to increased production of TSST-1, and thus might represent 101

a risk factor for the development of TSS. In contrast, we believe that TSST-1 production 102

will be suppressed in a healthy vaginal environment dominated by Lactobacillus 103

species. If this link between the vaginal microbiota and TSST-1 production is 104

established, it may be feasible to control toxin production of S. aureus by altering the 105

vaginal microbiota through the application of exogenous bacteria. 106

107

Materials and Methods 108

Clinical Study 109

Details of the clinical study were reviewed and approved by the Health Sciences 110

Research Ethics Board at the University of Western Ontario. Participants were provided 111

with a package detailing all relevant information of the study, including an in-depth 112

explanation of the clinical procedure, and signed a consent form prior to sample 113

collection. 114

Recruitment of pre-menopausal women between the ages of 18-40 years with BV 115

as well as healthy controls took place in London, Ontario and was based on a selective 116

criteria designed to ensure that the vaginal samples reflected a representative 117

microbiota of the general female pre-menopausal population. Recruitment posters were 118

placed in various locations in London, Ontario, including The University of Western 119

Ontario and local hospitals and medical clinics. The poster emphasized a target 120


.asm.org/

Dow

nloaded from

http://aem.asm.org/

6

audience of premenopausal women with a suspected history of BV. Participants were 121

excluded if they had reached menopause, had a urogenital infection other than BV in 122

the past 6 months, were pregnant, had a history of gonorrhoea, chlamydia, estrogen-123

dependent neoplasia, abnormal renal function or pyelonephritis, were taking prednisone, 124

immune-suppressive agents or antimicrobial medication, or had undiagnosed abnormal 125

vaginal bleeding. Participants were asked to refrain from oral or vaginal intercourse and 126

consuming probiotic supplements or foods for 48 hours prior to the clinical visit. No 127

participants were menstruating at time of the clinical visit. At the conclusion of the study, 128

a total of 34 participants were recruited: 11 healthy, 10 intermediate and 13 BV, with a 129

mean age of 24.6 years. None of the subjects were diagnosed with AV nor had a 130

microbiome indicative of this condition. 131

Weekly clinics were held at the Victoria Family Medical Centre (London, Ontario) 132

over a 6-month period. A total of 7 samples were collected from each participant at a 133

single time point: one pHem-alert applicator (Gynex) was used to detect the vaginal pH; 134

three CultureSwab polyester-tipped swabs (BD Biosciences) were used for bacterial 135

isolation (for diagnosis of BV by Nugent score, for bacterial DNA and RNA collection); 136

two ESwabs (Copan) were processed for culturing the organisms; and one cytobrush 137

(Cooper Surgical) was processed for vaginal epithelial cell RNA. Swabs were inserted 138

approximately 5 cm into the vaginal canal, pressed against the wall and rotated 4 times. 139

The microbial status was assessed through the Nugent scoring method (30). A 140

CultureSwab polyester-tipped swab (BD Biosciences) was pressed against the vaginal 141

wall and smeared onto a glass microscope slide, heat-fixed and Gram-stained. Four 142

fields of view were chosen at random at a magnification of 1,000 X, and bacterial 143


.asm.org/

Dow

nloaded from

http://aem.asm.org/

7

numbers from each were recorded. A participant was diagnosed as having BV if the 144

Nugent score was 7-10 and if they had a vaginal pH greater than 4.5. All participants 145

with a healthy Nugent score of 0-3 had a pH that was equal to or less than 4.5. 146

Sequencing by Illumina 147

Bacteria were collected on a CultureSwab polyester-tipped swab (BD 148

Biosciences) which was immediately placed in 700 µL RNAprotect (Qiagen). The tube 149

was vortexed for 5 sec, swab discarded and the solution stored at -20°C. DNA isolation 150

was performed using the InstaGene matrix (Bio-Rad) DNA preparation kit according to 151

the manufacturers’ instructions. The collected DNA was stored at -20°C and was used 152

as DNA template for subsequent PCR reactions. 153

PCR was carried out in 50 µL reactions consisting of 40 µL master mix and 10 µL 154

template (or 10 µL Milli-Q H20 [Millipore] for negative control). The master mix consisted 155

of 1X PCR buffer (Invitrogen), 1.7 mM MgCl2, 210 µM dNTPs, 640 nM forward and 156

reverse primer, 0.05 U/µL Platinum Taq Polymerase (Invitrogen) and Milli-Q H20 157

[Millipore]. Amplification was done using eubacterial primers flanking the V6 region of 158

the 16S rRNA gene: V6-F (5’-CAACGCGARGAACCTTACC -3’) and V6-R (5’-159

ACAACACGAGCTGACGAC -3’). The PCR reactions were carried out in a Mastercycler 160

(Eppendorf) under the following annealing temperature touchdown program: 94°C for 2 161

min, followed by 10 cycles of 94°C for 45 sec, 61°C-51°C for 45 sec (each cycle 162

dropping by 1°C), 72°C for 45 sec, and then 15 cycles of 94°C for 45 sec, 51°C for 45 163

sec, 72°C for 45 sec, and ending with a final elongation step of 72°C for 2 min. PCR 164

products (5 µL) were mixed with 1 µL 6X Loading Dye and loaded onto a 1.5% agarose 165

gel. The gel was then viewed under UV light in an AlphaImager (Alpha Innotech 166


.asm.org/

Dow

nloaded from

http://aem.asm.org/

8

Corporation). The ImageJ program was used to quantify the brightness of each DNA 167

band so that equal amounts of each sample were added to the subsequent Illumina 168

reaction. DNA samples were then sent for Illumina sequencing at The Next-Generation 169

Sequencing Facility in The Centre for Applied Genomics at the Hospital for Sick 170

Children in Toronto, Canada. Data analysis of the sequencing reads was performed 171

according to our colleagues’ protocol (31). 172

Luminescence Assay 173

Vaginal samples were collected from participants using the ESwab (Conan) swab 174

and transport system containing 1 mL liquid Amies medium. Following sample 175

collection, the ESwab was submerged into the Amies medium for 2 hours at room 176

temperature followed by a 10 sec vortex at high speed. The swab was removed and 177

discarded. The ESwab solution was aliquoted 2 x 350 µL and centrifuged at 10,000 rpm 178

for 5 min. The supernatants were transferred to a fresh tube and stored at -80°C, which 179

was later used for the in vitro luminescence assay. 180

A culture of a reporter strain of S. aureus MN8, containing the cloning vector 181

pAmilux with an incorporated promoter for tst, was grown in brain heart infusion (BHI) 182

media with 10 µg/µL chloramphenicol overnight at 37°C with a shaking speed of 250 183

rpm (19, 32). The culture was diluted to an OD600 of 0.02 with a) supernatant from the 184

clinical sample, b) Amies transport medium or c) BHI, of which the latter two acted as 185

controls. Next, 200 µL of the subculture was grown for 16 hr in a Fluoroskan Ascent FL 186

luminometer (Thermo) where luminescence production was detected from the activated 187

tst promoter every 30 min. Another 200 µL of the same subculture was grown in a 188


.asm.org/

Dow

nloaded from

http://aem.asm.org/

9

Bioscreen C Reader (MTX Lab Systems) at 37°C with continuous shaking for 24 hr to 189

monitor growth of the bacteria. 190

Bacterial Cultures and Conditions for Supernatant Challenge Assay 191

All bacterial strains used in the supernatant challenge assay, along with respective 192

growth conditions, are listed in Table 1. These bacteria were obtained from either ATCC 193

or previous clinical isolations. The bacterial strains were divided into 3 groups for 194

analysis: healthy, AV-associated and BV-associated bacteria. The S. aureus MN8 strain 195

was selected as a prototype of menstrual-TSS strains, as it has been isolated from a 196

pre-menopausal woman suffering from the condition (33). All aerobic bacteria were 197

cultured in shaking conditions for 16 hr at 37°C and then sub-cultured to an OD600 of 198

0.02 using their growth media. The sub-cultures were grown for 12 hr. The lactobacilli 199

were grown in anaerobic conditions using the GasPak EZ system (Becton-Dickenson) 200

for 24 hr at 37°C and sub-cultured for an additional 24 hr, starting at an OD600 of 0.02. 201

The strict anaerobes, Atopobium vaginae and Prevotella bivia were cultured and sub-202

cultured in a Forma anaerobic chamber (Model 1025, Thermo) for 48 hr at 37°C to allow 203

for growth into stationary phase. Sub-cultures underwent centrifugation at 3500 x g for 204

10 min at 4°C and the supernatants were transferred to a fresh tube. The pH of the 205

supernatants were determined and adjusted to that of the S. aureus MN8 supernatant 206

(pH 5.95), sterilized via filtration using 0.2 µm filters, transferred to a clean tube and 207

frozen at -20°C for no longer than 1 week. Next, S. aureus MN8 cultures were grown for 208

16 hr and sub-cultured starting at an initial OD600 of 0.02 in half BHI and half 209

supernatant of the challenger bacteria. The sub-cultures were grown for 16 hr at 37°C in 210

shaking conditions and were then centrifuged at 3500xg for 10 min at 4°C. Sub-cultures 211


.asm.org/

Dow

nloaded from

http://aem.asm.org/

10

were also grown in a Multiskan Ascent Plate Reader (Thermo-Scientific) to detect OD600 212

values to ensure similar S. aureus growth across the various conditions. The 213

supernatants were subsequently used for real-time PCR. 214

Quantitative Real-Time PCR 215

A culture of S. aureus MN8 challenged with supernatants from the other bacteria (as 216

described previously) was grown from an initial OD600 of 0.02 for 16 hr. Ten millilitres of 217

RNAprotect (Qiagen) was added to 5 mL culture, and the solution was vortexed and 218

incubated for 10 min at room temperature, then centrifuged at 6000 x g for 20 min at 219

4°C. The supernatant was then discarded and the pellet stored at -80°C. To isolate 220

bacterial RNA, the pellet was suspended in 5 mL lysis solution (10 mM Tris-HCl, 1 mM 221

EDTA [pH 8.0] and 50 µg/mL lysostaphin) and vortexed. The solution was incubated for 222

10 min at 37°C then centrifuged at 6000 x g for 20 min. Isolation of RNA from the pellet 223

was performed using TRIzol (Invitrogen) in accordance with the manufacturers’ 224

instructions. 225

Contaminants were removed from the RNA samples using the RNeasy Mini Kit 226

(Qiagen). RNA products were viewed via electrophoresis in a 1% agarose gel using 1X 227

TBE, stained with ethidium bromide and viewed under UV light in an AlphaImager 228

(Alpha Innotech Corporation). The RNA concentration and quality in the samples were 229

then determined through a biophotometer (Eppendorf) (RNA quality cut-off: 260/280 ≥ 230

1.8; 260/230 ≥ 1.6). Five hundred nanograms of RNA from each sample was used as a 231

template for reverse transcription PCR. Conversion to cDNA was done using the 232

Multiscribe Reverse Transcriptase mix (Invitrogen). The reactions were carried out in a 233


.asm.org/

Dow

nloaded from

http://aem.asm.org/

11

Mastercycler (Eppendorf) with the following program: initial step of 25°C for 10 min, 234

followed by 37°C for 120 min, and a final step of 85°C for 5 min. 235

The cDNA samples were used as templates for real-time PCR reactions. Primers 236

included tst-f (5’- CTGATGCTGCCATCTGTGTT -3’) and tst-r (5’- 237

GTAAGCCCTTTGTTGCTTGC -3’) for expression of the tst gene, and rpoB-f (5’- 238

TCCTGTTGAACGCGCATGTAA -3’) and rpoB-r (5’-GCTGGTATGGCTCGTGATGGTA-239

3’) for expression of the rpoB housekeeping gene. The iQ SYBR Green Supermix (Bio-240

Rad) was used to carry out 20 µL reactions, which were composed of the following: 10 241

µL 2X iQ SYBR Green Supermix, 1 µL of each primer at 10 µM, 7 µL RNase-free H2O 242

and 1 µL cDNA template. Reactions were run in a Rotor –Gene 6000 thermocycler 243

(Corbett) under the following program: an initial melting ramp from 72°C to 95°C, 244

followed by 40 cycles of 95°C for 10 sec, 60°C for 15 sec and 72°C for 20 sec, ending 245

with a hold at 95°C for 10 min. Data was analyzed using the Rotor-Gene 6000 Series 246

Software 1.7 (Corbett). Expression of tst by S. aureus in each condition was compared 247

to tst expression when S. aureus was grown in media alone. For the purpose of 248

comparison, the control expression was set at 100%. Overall, the supernatant challenge 249

experiment was performed three times, with each run having three technical replicates 250

starting from the reverse transcription stage. 251

A series of standards were created to quantify gene expression during data 252

analysis. A sub-culture of S. aureus MN8 was grown for 12 hr, and total DNA isolated 253

using InstaGene matrix (Bio-Rad). PCR was carried out in 50 µL reactions consisting of 254

the following components: 10X PCR buffer, 1.7 mM MgCl2, 210 mM dNTPs mix, 640 255

nM of each primer (tst and rpoB primer pairs used for real-time PCR), 5U Platinum Taq 256


.asm.org/

Dow

nloaded from

http://aem.asm.org/

12

DNA Polymerase (Invitrogen), 5 µL template and Milli-Q H20 [Millipore] to reach 50 µL. 257

Amplification was performed in a Mastercycler (Eppendorf) using the following program: 258

94°C for 1 min, followed by 30 cycles of 94°C for 45 sec, 60°C for 45 sec and 72°C for 259

45 sec, and a final elongation step of 72°C for 2 min. Products were viewed via 260

electrophoresis in a 1% agarose gel using 1X TBE, stained with ethidium bromide and 261

viewed under UV light in an AlphaImager (Alpha Innotech Corporation). Concentration 262

of DNA in each sample was determined through spectrophotometry, and a series of 263

standards were made ranging from 5000 ng/µL to 5 x 10-9 ng/µL. These standards were 264

used as templates in the real-time PCR reactions to construct standard curves with 265

known concentrations of DNA. 266

Statistical Analysis 267

Statistical analysis was performed on the real-time PCR data using the GraphPad 268

Prism® 4 program. Gene expression of the various conditions was compared to the 269

control using one-way ANOVA analysis with a Dunnett’s multiple comparison test. 270

Changes in gene expression were considered significant for p values <0.05. The 271

standard error of the mean (SEM) for each condition tested was displayed on the bar-272

plots. 273

Results 274

Vaginal microbiota profile of pre-menopausal women 275

A clinical study was undertaken to collect vaginal samples and determine the 276

microbiomes of women with and without BV, for subsequent comparison of their effects 277

on TSST-1 production in S. aureus. The vaginal microbiota of participants were 278


.asm.org/

Dow

nloaded from

http://aem.asm.org/

13

determined through 16S rRNA sequencing by Illumina, and bacterial DNA from 21 279

participants was successfully isolated and amplified for sequencing (9 healthy, 5 280

intermediate and 7 BV). The vaginal microbiota of healthy versus BV participants were 281

very distinct. The predominant species associated with healthy and intermediate 282

samples was L. crispatus (50.7% and 41.6%, respectively) followed by L. iners (27.4% 283

and 20.5%, respectively), with an average species abundance of 3.6 species per 284

sample (Figure 1). Other bacterial species, including those associated with BV, were 285

present in relatively low abundance in these subjects. Three outliers were present 286

among these samples, having diversities of 11, 12 and 17 species per sample. One 287

intermediate sample had no L. iners or L. crispatus (at ≥1% abundance), but instead 288

consisted of L. jensenii, L. gasseri/johnsonii and G. vaginalis of nearly equal 289

abundances. Participants assigned to the BV group, however, had a predominant 290

Gardnerella vaginalis population (average abundance of 49.7%), along with Leptotrichia 291

amnionii (3.9%) and Atopobium vaginae (3.7%). The BV samples had a higher bacterial 292

species diversity than healthy and intermediate, with an average of 10.5 species per 293

sample. 294

Expression of tst in S. aureus in women with and without bacterial vaginosis 295

In order to investigate the ability of the different vaginal environments to influence 296

the production of TSST-1, vaginal samples collected from non-pregnant, pre-297

menopausal subjects in London, Ontario were tested against cultures of the reporter 298

strain S. aureus MN8/pAmilux-Ptst to monitor activity of the tst promoter (reflecting tst 299

expression). Samples from all three vaginal states (healthy, intermediate and BV) were 300

tested in this luminescence assay, and following 16 hours of growth, expression of tst in 301


.asm.org/

Dow

nloaded from

http://aem.asm.org/

14

S. aureus was found to be completely suppressed from all 3 sample categories, as 302

illustrated in Figure 2A. However, samples from two healthy participants were found to 303

have no effect and only some inhibition on tst expression (Figure 2B and 2C, 304

respectively). Total protein levels were determined via a bicinchoninic acid (BCA) assay 305

in these two samples, as well as in three samples demonstrating strong inhibition (data 306

not shown). Results showed similar protein levels in all the samples, regardless of anti-307

tst activity, suggesting that the lack of suppression observed in these samples were 308

likely not due to the absence of host proteins in these two samples. 309

TSST-1 production in response to bacteria associated with BV, AV and a healthy 310

microbiota 311

In order to investigate whether vaginal bacterial species have an influence on TSST-312

1 production, cultures of S. aureus MN8 were challenged with supernatants of AV-313

associated, BV- associated and healthy-associated bacteria, and tst expression was 314

monitored by real-time PCR. These bacterial strains were obtained through commercial 315

means or previous clinical isolations. The probiotic strain L. reuteri RC-14 was also 316

included in the experiment, as this strain has been shown to suppress TSST-1 317

production (12). Growth of S. aureus in these conditions was monitored and grew to 318

similar OD600 values (data not shown). Bacteria used to challenge S. aureus were 319

separated into 3 groups for data analysis: lactobacilli, AV-associated and BV-320

associated. Several Lactobacillus species were found to significantly decrease tst 321

expression (Figure 3A). L. johnsonii, L. jensenii and L. gasseri decreased tst expression 322

by 54%, 59% and 49%, respectively (p<0.05). The probiotic strains L. rhamnosus GR-1 323

and L. reuteri RC-14 decreased expression by 57% and 72%, respectively (p<0.05). 324


.asm.org/

Dow

nloaded from

http://aem.asm.org/

15

Interestingly, L. iners and L. crispatus (the most common vaginal residents) did not 325

significantly decrease tst expression. 326

In general, the AV-associated bacteria increased tst expression. Secreted 327

products from S. agalactiae significantly increased tst expression 3.7-fold relative to S. 328

aureus grown in BHI (p<0.05) (Figure 3B). E. faecalis and E. faecium increased tst 329

expression 1.7- and 1.9-fold, respectively, while E. coli did not affect expression. 330

However, these latter changes in gene expression were not statistically significantly 331

when compared to the control of S. aureus grown in BHI. Interestingly, we acquired 332

preliminary data showing that S. aureus challenged with a combination of S. agalactiae 333

and L. reuteri RC-14 supernatants, as well as with S. agalactiae and L. jensenii 334

supernatants, expressed basal levels of the tst gene, suggesting a dampening effect 335

from the lactobacilli (data not shown). 336

Finally, the BV-associated organisms slightly decreased tst expression. In 337

particular, G. vaginalis, A. vaginalis and P. bivia decreased expression by 15%, 16% 338

and 27%, respectively (the latter of which was deemed statistically significant) (Figure 339

3C), when compared to tst expression S. aureus grown in half BHI and half VDMP. 340

Discussion 341

To our knowledge, this study is the first report of indigenous vaginal bacteria 342

altering TSST-1 production in S. aureus. In particular, several species of Lactobacillus 343

significantly suppressed tst expression, including L. gasseri and L. jensenii, which are 344

common vaginal residents, and L. johnsonii which is a gut commensal occasionally 345

found in the vagina. Surprisingly, however, L. iners and L. crispatus did not demonstrate 346


.asm.org/

Dow

nloaded from

http://aem.asm.org/

16

tst suppression. We confirmed anti-TSST-1 activity from the vaginal probiotic strain L. 347

reuteri RC-14, but also that L. rhamnosus GR-1, another vaginal probiotic strain, was 348

capable of suppressing this toxin. 349

An interesting discovery was that aerobic bacteria induced tst expression. During 350

menses, increased oxygen levels and a neutral pH would increase the chances of 351

TSST-1 production (13-15), and the presence of neighboring aerobic bacteria may be 352

enough for S. aureus to secrete a threshold level of the toxin, leading to disease 353

progression. The finding that S. agalactiae (group B Streptococcus: GBS) significantly 354

induced expression by more than 3-fold was particularly interesting considering the 355

seemingly-symbiotic relationship between this species and S. aureus. Multiple studies 356

have found that S. agalactiae inhibits Lactobacillus spp. and G. vaginalis without 357

inhibiting S. aureus (34-36) and that S. aureus colonization was significantly associated 358

with colonization by S. agalactiae in a population of pregnant women (37). Our findings 359

thus illustrate another way in which GBS could promote the virulence of S. aureus. In 360

the context of menstrual-TSS, women with AV who are colonized predominantly with 361

these two species might be at a higher risk of developing the disease; elevated oxygen 362

levels in the vagina would presumably induce TSST-1 production in S. aureus (13), and 363

the presence of GBS may further perpetuate toxin production. If this relationship were to 364

hold true in suitable animal studies, the application to human of certain Lactobacillus 365

species intra-vaginally may be worth considering since they can displace S. aureus and 366

S. agalactiae from vaginal epithelial cells (38). 367

A number of Lactobacillus species tested (L. jensenii, L. gasseri, L. johnsonii) 368

suppressed tst expression in the supernatant challenge assay, in addition to the vaginal 369


.asm.org/

Dow

nloaded from

http://aem.asm.org/

17

probiotic strain L. reuteri RC-14 which is known to confer this effect (19). Screening 370

these supernatants for the cyclic dipeptides linked to L. reuteri RC-14 is underway to 371

determine whether this or another substance is responsible for the tst-suppression. 372

Surprisingly, L. rhamnosus GR-1, another vaginal probiotic strain, also suppressed the 373

toxin. A study by Laughton et al. (2006) found that this strain, in contrast to L. reuteri 374

RC-14, was not able to suppress the RNAIII-initiating P3 promoter in S. aureus Newman 375

(39). This suggests that the inhibitory effect on tst seen by L. rhamnosus GR-1 was not 376

due to inhibition of agr but perhaps from altered SarA activity, as this regulator has been 377

shown to bind and activate the tst promoter directly (10). Lastly, L. iners and L. 378

crispatus, the predominant vaginal residents of healthy women, did not demonstrate 379

anti-tst activity. Considering the rare nature of menstrual-TSS, this suggests that other 380

factors are at play in preventing S. aureus in the vagina from secreting this toxin, such 381

as vaginal metabolites from the host. Nevetheless, this finding will aid in identifying 382

putative tst-suppressing factor(s) secreted by the other Lactobacillus members by 383

comparing their secretory products under the experimental conditions. 384

The complete content of vaginal swabs from women of a healthy, BV and 385

intermediate status were introduced to cultures of the reporter strain S. aureus 386

MN8/pAmilux-Ptst. Monitoring the luminescence produced from this strain allowed us to 387

monitor tst promoter activity in real time during the growth of S. aureus. It was 388

discovered that samples from all three vaginal states were able to significantly suppress 389

tst expression. However, the microbiota-sequencing data showed that these samples 390

had high abundances of L. iners, L. crispatus and G. vaginalis¸ all of which failed to 391

suppress tst in the challenge assay of the present study. This supports the idea that the 392


.asm.org/

Dow

nloaded from

http://aem.asm.org/

18

majority of pre-menopausal women have host-derived factors that prevents the 393

development of menstrual-TSS. Identifying host-derived vaginal metabolites shared 394

among both healthy and BV women will be important for shedding light on putative 395

candidate compounds to test. It is important to note that two samples from the healthy 396

group failed to show any suppression, which illustrates that there may be a sub-397

population of women who would benefit from TSST-1-suppressive agents more so than 398

the general population. Interestingly, these were the same healthy samples to show 399

increased bacterial diversity, and although no unique bacteria were identified within the 400

samples, this suggests that an altered vaginal environment may contribute to increased 401

menstrual-TSS susceptibility. The suppression of tst expression in response to BV 402

samples was surprising, as these samples had pH’s greater than 4.5, with some as high 403

as 6.0, which is more conducive to TSST-1 production (14). However, the effect of pH 404

would likely be minimized as the transport medium used to preserve contents of the 405

swabs contained various buffering agents. Levels of oxygen and carbon dioxide would 406

not likely contribute to suppression, as all samples were exposed to atmospheric 407

conditions during collection and preparation. 408

The vaginal microbiota profiles of women recruited here were similar to those 409

seen in other studies, in that L. iners, L. crispatus and G. vaginalis made up the core 410

members of the microbiota (21, 40). However, the microbiota of the subjects varied from 411

person to person, regardless of health status. For instance, 4 of the 5 intermediate 412

samples consisted primarily of L. crispatus and L. iners, while the other was composed 413

of L. jensenii, L. gasseri/johnsonii and G. vaginalis. As well, although healthy vaginal 414

samples typically contain less diverse populations compared to BV, very complex 415


.asm.org/

Dow

nloaded from

http://aem.asm.org/

19

populations were seen in two healthy samples (17 and 12 species per sample) and one 416

intermediate sample (11 species per sample) compared to the other samples (average 417

of 3.6 species per sample). Members of these populations included Streptococcus and 418

Enterococcus spp. Therefore, healthy women into which S. aureus colonize may already 419

be colonized with a diverse population of bacteria, some of which may release 420

compounds that induce TSST-1 production. 421

Overall, this study has shown that the vaginal environment of women with BV and 422

with a healthy background is able to suppress TSST-1, which is consistent with the rare 423

occurrence of menstrual-TSS. However, samples from a few subjects of the clinical 424

study failed to suppress the toxin, which illustrates a sub-population of women who may 425

be more susceptible to developing this condition. Identifying the factor(s) responsible for 426

the observed suppression will help identify a target population of pre-menopausal 427

women who would benefit most from prophylactic options, such as the application of 428

exogenous lactobacilli. Perhaps the biggest finding of this study was that aerobic 429

bacteria, including S. agalactiae, E. faecalis and E. faecium, had a TSST-1-inducing 430

effect on S. aureus. This suggests that women with AV or a complex aerobic microbiota, 431

which is occasionally seen during menses, may be at an increased risk of menstrual-432

TSS and would benefit most from a vaginally-applied probiotic.433


.asm.org/

Dow

nloaded from

http://aem.asm.org/

20

References 434

1. Centres for Disease Control and Prevention. [Summary of notifiable diseases-United 435

States, 2009]. Published May 13, 2011 for MMWR 2009; 58(53):[inclusive page 436

numbers]. 437

2. Gaventa S, Reingold AL, Hightower AW, Broome CV, Schwartz B, Hoppe C, et al. 438

Active surveillance for toxic shock syndrome in the United States, 1986. Rev Infect Dis. 439

1989; 11 Suppl 1:S28-34. 440

3. Davis CC, Kremer MJ, Schlievert PM, Squier CA. 2003. Penetration of toxic shock 441

syndrome toxin-1 across porcine vaginal mucosa ex vivo: permeability characteristics, 442

toxin distribution, and tissue damage. Am J Obstet Gynecol; 189:1785-1791. 443

4. Schlievert PM, Jablonski LM, Roggiani M, Sadler I, Callantine S, Mitchell DT, Ohlendorf 444

DH, Bohach GA. Pyrogenic toxin superantigen site specificity in toxic shock syndrome 445

and food poisoning in animals. Infect Immun. 2000; 68(6): 3630-4. 446

5. Shands KN, Schmid GP, Dan BB, Blum D, Guidotti RJ, Hargrett NT, et al. Toxic-shock 447

syndrome in menstruating women: association with tampon use and Staphylococcus 448

aureus and clinical features in 52 cases. N Engl J Med. 1980; 303(25): 1436-42. 449

6. Recsei P, Kreiswirth B, O’Reilly M, Schlievert P, Gruss A, Novick RP. Regulation of 450

exoprotein gene expression in Staphylococcus aureus by agar. Mol Gen Genet. 1986; 451

202(1): 58-61. 452

7. Novick RP, Geisinger E. Quorum sensing in staphylococci. Annu Rev Genet. 2008; 42: 453

541-64. 454

8. Dunman PM, Murphy E, Haney S, Palacios D, Tucker-Kellogg G, Wu S, Brown EL, 455

Zagursky RJ, Shlaes D, Projan SJ. Transcription profiling-based identification of 456


.asm.org/

Dow

nloaded from

http://aem.asm.org/

21

Staphylococcus aureus genes regulated by the agr and/or sarA loci. J Bacteriol. 2001; 457

183(24): 7341-53. 458

9. Chien Y, Cheung AL. Molecular interactions between two global regulators, sar and agr, 459

in Staphylococcus aureus. J Biol Chem. 1998; 273(5): 2645-52. 460

10. Andrey DO, Renzoni A, Monod A, Lew DP, Cheung AL, Kelley WL. Control of the 461

Staphylococcus areus toxic shock tst promoter by the global regulator SarA. J Bacteriol. 462

2010; 192(22): 6077-85. 463

11. Korem M, Sheoran AS, Gov Y, Tzipori S, Borovok I, Balaban N. Characterization of 464

RAP, a quorum sensing activator of Staphylococcus aureus. FEMS Microbiol Lett. 2003; 465

223(2): 167-75 466

12. Nicholas RO, Li T, McDevitt D, Marra A, Sucoloski S, Demarsh PL, Gentry DR. Isolation 467

and characterization of a sigB deletion mutant of Staphylococcus aureus. Infect Immun. 468

1999; 67(7): 3667-9. 469

13. Yarwood JM, Schlievert PM. Oxygen and carbon dioxide regulation of toxic shock 470

syndrome toxin 1 production by Staphylococcus aureus MN8. J Clin Microbiol. 2000; 471

38(5):1797-803. 472

14. Sarafian SK, Morse SA. Environmental factors affecting toxic shock syndrome toxin-1 473

(TSST-1) synthesis. J Med Microbiol. 1987; 24(1):75-81. 474

15. Wong AC, Bergdoll MS. Effect of environmental conditions on production of toxic shock 475

syndrome toxin 1 by Staphylococcus aureus. Infect Immun. 1990; 58(4):1026-9. 476

16. Lamont RF, Sobel JD, Akins RA, Hassan SS, Chaiworapongsa T, Kusanovic JP, 477

Romero R. The vaginal microbiome: new information about genital tract flora using 478

molecular based techniques. BJOG 2011; 118(5): 533-49. 479


.asm.org/

Dow

nloaded from

http://aem.asm.org/

22

17. Voravuthikunchai SP, Bilasoi S, Supamala O. Antagonistic activity against pathogenic 480

bacteria by human vaginal lactobacilli. Anaerobe 2006; 12(5-6): 221-6. 481

18. Otero MC, Nader-Macías ME. Inhibition of Staphylococcus aureus by H2O2-producing 482

Lactobacillus gasseri isolated from the vaginal tract of cattle. Anim. Reprod. Sci. 2006; 483

96(1-2): 35-46. 484

19. Li J, Wang W, Xu SX, Magarvey NA, McCormick JK. Lactobacillus reuteri-produced 485

cyclic dipeptides quench agr-mediated expression of toxic shock syndrome toxin-1 in 486

staphylococci. Proc Natl Acad Sci 2011; 108(8):3360-5. 487

20. Fredricks DN, Fiedler TL, Marrazzo JM. Molecular identification of bacteria associated 488

with bacterial vaginosis. N Engl J Med 2005; 353(18):1899-911. 489

21. Hummelen R, Fernandes AD, Macklaim JM, Dickson RJ, Changalucha J, Gloor GB, 490

Reid G. Deep sequencing of the vaginal microbiota of women with HIV. PLoS One 2010; 491

5(8):e12078. 492

22. Holst E, Goffeng AR, Andersch B. Bacterial vaginosis and vaginal microorganisms in 493

idiopathic premature labor and association with pregnancy outcome. J Clin Microbiol. 494

1994; 32(1): 176-86. 495

23. Gomez LM, Sammel MD, Appleby DH, Elovitz MA, Baldwin DA, Jeffcoat MK, Macones 496

GA, Parry S. Evidence of a gene-environment interaction that predisposes to 497

spontaneous preterm birth: a role for asymptomatic bacterial vaginosis and DNA 498

variants in genes that control the inflammatory response. Am J Obstet Gynecol 2010; 499

202(4):386.e1-6. 500


.asm.org/

Dow

nloaded from

http://aem.asm.org/

23

24. Ness RB, Kip KE, Hillier SL, Soper DE, Stamm CA, Sweet RL, Rice P, Richter HE. A 501

cluster analysis of bacterial vaginosis-associated microflora and pelvic inflammatory 502

disease. Am J Epidemiol 2005; 162(6): 585-90. 503

25. Donders GG, Vereecken A, Bosmans E, Dekeersmaecker A, Salembier G, Spitz B. 504

Definition of a type of abnormal vaginal flora that is distinct from bacterial vaginosis: 505

aerobic vaginitis. BJOG 2002; 109(1):34-43. 506

26. Carey JC, Klebanoff MA. Is a change in the vaginal flora associated with an increased 507

risk of preterm birth? Am J Obstet Gynecol. 2005; 192(4): 1341-6. 508

27. Donders GG, Van Calsteren K, Bellen G, Reybrouck R, Van den Bosch T, Riphagen I, 509

Van Lierde S. Predictive value for preterm birth of abnormal vaginal flora, bacterial 510

vaginosis and aerobic vaginitis during the first trimester of pregnancy. BJOG 2009; 511

116(10): 1315-24. 512

28. Hay PE, Lamont RF, Taylor-Robinson D, Morgan DJ, Ison C, Pearson J. Abnormal 513

bacterial colonisation of the genital tract and subsequent preterm delivery and late 514

miscarriage. BMJ 1994; 308(6924): 295-8. 515

29. Rezeberga D, Lazdane G, Kroica J, Sokolova L, Donders GG. Placental histological 516

inflammation and reproductive tract infections in a low risk pregnant population in Latvia. 517

Acta Obstet Gynecol Scand. 2008; 87(3): 360-5. 518

30. Nugent RP, Krohn MA, Hillier SL. Reliability of diagnosing bacterial vaginosis is 519

improved by a standardized method of gram stain interpretation. J Clin Microbiol. 1991; 520

29(2): 297-301. 521


.asm.org/

Dow

nloaded from

http://aem.asm.org/

24

31. Gloor GB, Hummelen R, Macklaim JM, Dickson RJ, Fernandes AD, MacPhee R, Reid 522

G. Microbiome profiling by illumina sequencing of combinatorial sequence-tagged PCR 523

products. PLoS One 2010; 5(10):e15406. 524

32. Mesak LR, Yim G, Davies J. Improved lux reporters for use in Staphylococcus aureus. 525

Plasmid 2009; 61(3):182-7. 526

33. Schlievert PM, Blomster DA. Production of staphylococcal pyrogenic exotoxin type C: 527

influence of physical and chemical factors. J Infect Dis. 1983; 147(2):236-42. 528

34. Carson HJ, Lapoint PG, Monif GR. Interrelationships within the bacterial flora of the 529

female genital tract. Infect Dis Obstet Gynecol. 1997; 5(4): 303-9. 530

35. Chaisilwattana P, Monif GR. In vitro ability of the group B streptococci to inhibit gram-531

positive and gram-variable constituents of the bacterial flora of the female genital tract. 532

Infect Dis Obstet Gynecol. 1995; 3(3): 91-7. 533

36. Monif GR. Semiquantitative bacterial observations with group B streptococcal 534

vulvovaginitis. Infect Dis Obstet Gynecol. 1999; 7(5): 227-9. 535

37. Chen KT, Huard RC, Della-Latta P, Saiman L. Prevalence of methicillin-sensitive and 536

methicillin-resistant Staphylococcus aureus in pregnant women. Obstet Gynecol. 2006; 537

108(3 Pt 1):482-7. 538

38. Zárate G, Nader-Macias ME. Influence of probiotic vaginal lactobacilli on in vitro 539

adhesion of urogenital pathogens to vaginal epithelial cells. Lett Appl Microbiol. 2006; 540

43(2): 174-80. 541

39. Laughton JM, Devillard E, Heinrichs DE, Reid G, McCormick JK. Inhibition of expression 542

of a staphylococcal superantigen-like protein by a soluble factor from Lactobacillus 543

reuteri. Microbiology 2006; 152(Pt 4): 1155-67. 544


.asm.org/

Dow

nloaded from

http://aem.asm.org/

25

40. Zozaya-Hinchliffe M, Lillis R, Martin DH, Ferris MJ. Quantitative PCR assessments of 545

bacterial species in women with and without bacterial vaginosis. J Clin Microbiol. 2010; 546

48(5):1812-9. 547

548

549

550

551

552

553

554

555

556

557

558

559

560

561

562

563

564

565

566

567

568


.asm.org/

Dow

nloaded from

http://aem.asm.org/

26

569

570

571

572

Table 1. Bacterial strains used for supernatant challenge assay. 573

Bacteria Source Growth Media/Conditions Staphylococcus aureus MN8 Clinical Isolate BHI/aerobic

Escherichia coli J96 Clinical Isolate BHI/aerobic Streptococcus agalactiae ATCC

13813 ATCC BHI/aerobic

Enterococcus faecalis ATCC 33186

ATCC BHI/aerobic

Enterococcus faecium ATCC 19434

ATCC BHI/aerobic

Atopobium vaginae BAA-55 Reid Culture

Collection

Vaginally-Defined Medium + 0.5% Proteose Peptone (VDMP)/anaerobic

Prevotella bivia 29303 Reid Culture Collection

VDMP/anaerobic

Gardnerella vaginalis Clinical Isolate VDMP/anaerobic Lactobacillus crispatus ATCC

33820 ATCC de Man, Rogosa and Sharpe

(MRS)/anaerobic Lactobacillus jensenii ATCC

25258 ATCC MRS/anaerobic

Lactobacillus johnsonii DSM20553

DSM MRS/anaerobic

Lactobacillus gasseri ATCC 33323

ATCC MRS/anaerobic

Lactobacillus reuteri RC-14 Clinical Isolate MRS/anaerobic Lactobacillus rhamnosus GR-1 Clinical Isolate MRS/anaerobic

Lactobacillus iners AB-1 Clinical Isolate MRS/anaerobic 574

575

576

577

578

579


.asm.org/

Dow

nloaded from

http://aem.asm.org/

27

580

581

Figure 1. Vaginal microbiota of 21 subjects recruited from the clinical study, as 582

determined through 16S rRNA sequencing by Illumina. Vaginal state determined 583

via Nugent Scoring; score of 1-3 is healthy, 4-6 is intermediate, and 7-10 is BV. 584

Each column represents a participant (marked by their corresponding ID 585

number), with each coloured bar representing a type of bacteria. 586

587


.asm.org/

Dow

nloaded from

http://aem.asm.org/

28

588

Figure 2. Luminescence activity of S. aureus MN8 tst gene in response to 589

vaginal swab contents from women of varying vaginal health (healthy, 590

intermediate and BV). (A) Vaginal samples from all 3 health groups were 591

capable of suppressing tst expression, as shown by three representative 592

samples. (B, C) Two healthy clinical samples failed to suppress tst expression. 593

S=Staphylococcus aureus MN8; #=Participant ID number; TM=Transport 594

Medium, the medium in which the swabs were preserved. 595


.asm.org/

Dow

nloaded from

http://aem.asm.org/

29

596

597

598

599

600

601

602

603

604

605

606

607

608

609

610

611

612

613

614

615

616

617

Figure 3. Fold change in gene expression of tst in S. aureus MN8 in response to 618

supernatants from lactobacilli (A), AV-associated (B) and BV-associated (C) bacteria, as 619

detected by real-time PCR. * indicates p<0.05. 620

621

Media

E. coli

E. faecalis

E. faecium

S. agalactiae

0

50

100

150

200

250

300

350

400

450

500

550*

Re

lativ

e ts

t Ex

pre

ssi

on

Media

L. rhamnosus G

R-1

L. reuteri RC-14

L. johnsonii

L. jensenii

L. gasseri

L. crispatus

L. iners

0

10

20

30

40

50

60

70

80

90

100

110

120

Re

lativ

e ts

t Ex

pre

ss

ion

Media

G. vaginalis

A. vaginalis

P. bivia

0

10

20

30

40

50

60

70

80

90

100

*

Source of Supernatant

Re

lati

ve

tst E

xp

res

sio

n

A

B

C

*


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Influence of vaginal microbiota on toxic shock syndrome toxin-1

Documents

Transcript of Influence of vaginal microbiota on toxic shock syndrome toxin-1