The EMBO Journal vol. 1 3 no. 7 pp. 1 636 - 1644, 1994

The basis for germline specificity of the hobotransposable element in Drosophila melanogaster

Brian R.Calvil and William M.Gelbart2Department of Cellular and Developmental Biology, HarvardUniversity, Cambridge, MA 02138, USA'Present address: Carnegie Institution of Washington, Baltimore,MD 21210, USA2Corresponding authorCommunicated by F.Kafatos

This paper is dedicated to the memory of Barbara McClintockPrevious results suggested that the hobo transposableelement is active predominantly in the germline ofDrosophila. We investigate germline restriction of hobotransposition by testing in vitro modified elements fortheir ability to mobilize marked elements in vivo.Although intact hobo elements are germline specific, anhsp70 promoter-hobo transposase fusion is active in thesoma. Analysis of the hsp7O-promoted transcript does notprovide evidence for splicing. Moreover, the hobopromoter confers germilne bias to a highly sensitivereporter, A2-3 P transposase. These results indicate thathobo transposition is germline specific due to regulationof transposase production at the level of transcription.Thus, although hobo is similar to the P transposableelement in organization and tissue specificity, it differsin the underlying mechanism governing germline specificactivity.Key words: Drosophilalgermline/hobolP element/transposon

IntroductionIt is over 40 years since Barbara McClintock describedgenetic instability in maize due to the action of the Activator(Ac) transposable element (McClintock, 1948, 1952). Sincethat time transposable elements have been found in virtuallyevery organism studied. Genetic and molecular investigationsof transposable elements have reformed thinking aboutgenomic organization and dynamics, and have revealed avariety of insights into the possibilities for biologicalregulation.Although over-replication relative to the host is critical

to a transposable element's persistence and spread, in mostcases controls on replication exist to reduce deleteriouseffects on the host [for reviews see Kleckner (1990) andSmith and Corces (1991)]. Most transposable elements haveone or more mechanisms to dampen their level of activity.These regulatory mechanisms can act by limiting functionaltransposase or by acting on the transposition reaction. Forelements within multicellular organisms, one aspect of thiscontrol can involve tissue specific transposition. Here weexamine the regulation of the hobo transposable element ofDrosophila, and compare the basis for its germline specificactivity with that of the related P transposable element.The hobo and P transposable elements in Drosophila both

belong to the Ac family of elements (O'Hare and Rubin,1636

1983; Streck et al., 1986; Calvi et al., 1991). Both P andhobo are - 3 kb in length, exist in full-length and internallydeleted forms, have short terminal inverted repeats of limitedsequence similarity between the two elements, produce atrans-acting transposase that is thought to catalyze a DNA-mediated transposition reaction (Kaufman and Rio, 1992),and create an 8 bp duplication of host DNA upon insertion.The transposases of the two elements, however, do not haveamino acid sequence similarity (Streck et al., 1986; Calvietal., 1991).The P element is among the most intensively investigated

of all eukaryotic transposable elements [for reviews seeEngels (1989) and Rio (1991)]. P activity is restricted tothe germline due to regulated RNA splicing (Laski et al.,1986; Rio et al., 1986). In germline cells three introns arespliced out of the P transcript leading to the production oftransposase. In contrast, in the soma the third intron is notremoved, and, due to the presence of a stop codon withinthis intron, a truncated protein without transposase activityis produced. This differential splicing is due to somaticfactors that inhibit splicing of the P third intron (Laski andRubin, 1989; Siebel and Rio, 1990; Siebel et al., 1992).Our earlier work characterizing hobo-mediated genetic

instability at the decapentaplegic (dpp) locus revealed anadditional similarity with P in that hobo activity appears tobe largely restricted to the germline [for reviews seeBlackman et al. (1987) and Blackman and Gelbart (1989)].However, sporadic observations from our laboratory andothers suggest that in some rare cases hobo may be activein the soma at very low frequency (Lim, 1981, 1988;Yannopoulos et al., 1983, 1987). Interpretation of theseresults was hampered because these earlier studies relied onstrains containing numerous, unmarked hobo elements. Inthis report, we use marked, nonautonomous target elementsand in vitro modified sources of hobo transposase to examinegermline specificity of hobo activity. Our results indicatethat, like P, hobo activity is restricted to the germline bylimitation of transposase to this tissue. We present evidencethat, unlike the P element, germline specificity is due toregulation of hobo transposase production at the level oftranscription.

ResultsHFL1 is a 3 kb hobo clone derived from the dppdblk strainwhich contains hobo germline activity but little if any somaticactivity (Blackman et al., 1987). The ability of HFL1 tocatalyze germline transformation in injection assays indicatesthat it encodes hobo transposase (Blackman et al., 1989).Our sequence analysis of HFL1 revealed a 1.9 kb openreading frame (ORF1) that comprises the majority of hobo[base pairs (bp) 307-2289], and is similar in predictedamino acid sequence to the transposases of the Activator andTam3 transposable elements. The numbering of the hobosequence follows that analysis with + 1 corresponding to the

© Oxford University Press

hobo germline specificity

base pair of the element. We showed that, althoughsequences 3' of ORFI are dispensable, frameshifts withinORFI inactivate transposase (Calvi et al., 1991) (Figure 1).The only other ORF that may be required for transposaseproduction is the upstream, 96 bp long ORFO (bp 208 -303)which is separated from ORFI by a single in-frame stopcodon. ORFO contains the first potential initiator codon morethan 30 bp 3' of the hobo TATA box consensus which residesat position 107 of HFL1. 60 bp 5' of the TATA consensus,hobo contains a sequence that resembles the CAAT boxconsensus. There is no further evidence, however, that thisregion contains the hobo promoter.

Tissue specificity of hobo element activityTo overcome the problems of multiple copy number andinstability inherent in studying natural transposable elements,we have developed a system whereby hobo transposasesources, rendered immobile by removal of their terminirequired in cis for transposition, are introduced back intothe genome via P element transformation (Calvi et al.,1991). The subsequent transformants are genetically marked

IS-} 11H

I."

Fig. 1. Schematic representation of sources of h(their activity in the germline and soma. For clarihobo segments are shown (see Materials and meidescription). All derivatives are based upon the thobo clone HFL1 (Blackman et al., 1989; Calviis shown on top with nucleotide positions of releHBL1 is identical to HFL1 except for a 106 bpwhich does not affect transposase production butstable in the presence of hobo transposase (Calviis a fusion of the heat-inducible hsp70 promoter(UT) leader sequences (-245 to +207 of hsp70site of transcription) to position 147 of hobo, 40hobo TATA consensus, thereby retaining ORFOHBL1 and HSH2 contain hobo 3' UT sequence zsignals. The nucleotide coordinates for the endposequences present are shown above the elements.as a striped box, and ORFI as a shaded box. Arboxes represent the terminal inverted repeats.

and stable, and can be tested for hobo transposase productionby their ability to mobilize marked hobo elements in trans.The assay we employ here relies on mobilization of

H[w+, hawl] (hawl), a hobo element marked with themini-white gene. hawl does not produce transposase, butis mobilized if provided with the enzyme in trans (non-autonomous). Expression of mini-white, a derivative of thewhite gene, within hawl is sensitive to genomic position(Pirrotta et al., 1985). Different genomic insertion sites ofhawl impart different levels of pigment to the eye. Fliescontaining a null mutation at the white locus and a giveninsertion of haw have anywhere from faint yellow to darkred eyes. As white expression is cell autonomous, somatictransposition or excision of hawl in the soma duringdevelopment can result in mosaic eye pigmentation. To detecthobo activity in the male germline, we monitor transpositionof haw 1 from the X chromosome to the autosomes, detectedas father to son transmission of the initially X-linked mini-white marker gene (Calvi et al., 1991; Materials andmethods).

Germline specificity of an intact hobo transposasesourceAs an essentially wild-type source of hobo transposase, we

St'1in.1 ( i'>r rnIiis have constructed a derivative of HFL1, the element P[ry+,HBLl] (P-Hobbled or P-HBL1) (Figure 1). This element

+ contains a small deletion of the 3' end of hobo, renderingit stable but leaving transposase coding regions intact (Calviet al., 1991). P-HBLl displayed transposase activity onlyin the germline. When present with two copies of hawl on

- + the X chromosome, different insertions of P-HBLl catalyzedone or more transpositions in 15-18% of the male germlinestested (Table I). P-HBLl was also active in female germline

+ + (unpublished data). In contrast, independent of genomicposition, P-HBLl was not active in somatically derived eye

obo transposase and tissue as indicated by the absence of mosaic eye pigmentationity, only hsp70 and in flies containing the two hawl elements on the Xthods for a complete chromosome and any of three independent insertions of P-

et al., 1991), which HBL1 (Table I). P-HBLI was also germiine specific whenvant landmarks. P- tested for mobilization of hawl from other genomic positions3' terminal deletion (unpublished data).renders the element Given the similarities in organization and tissue specificityet al., 1991). HSH2 between hobo and P, we first wanted to investigate theand 5' untranslated possibility that hobo activity is restricted to the germline bybp downstream of the regulated RNA splicing. However, Northern analysis, cDNAand ORF1. Both P- library screening, PCR cDNA production, and RNaseand polyadenylation protection of strains containing P-HBLI or naturallyORFO iS represented occurring hobo elements failed to detect hobo RNA, and thusrowheads within the were uninformative about hobo transcript structure and the

question of splicing regulation.

Table I. Assay of P-HBL1 activity in the soma and germline

Transposase source Soma Germline

Adults Mosaic Germlines Germlines withscored adults tested transpositionb

P[ry+, HBLl](CyO-1)a 2215 0 200 30 (15%)P[ry+, HBLl](7M3-1) 1686 0 150 26 (17%)P[ry+, HBLl](CyO-2) 1536 0 50 9 (18%)

aThe first designation in parentheses indicates the chromosomal linkage of the insertion and the second the line number for that chromosome.bGemnlines with transposition were those that gave rise to one or more exceptional G2 w+ males.1637

" 11,

I:IA N " , .z q

Ci -A >

- 1"

-, " -Z-:1.

B.R.Calvi and W.M.Gelbart

Production of transposase under control of the hsp7OpromoterOur inability to detect hobo transcript raised the possibilitythat transcriptional control might be the basis for hobogermline specificity. The rarity of hobo RNA could be theresult of a low level of transcription only in the few germlinecells of the fly. If this model were correct, then replacementof the hobo promoter with an inducible promoter should leadto somatic as well as germline activity. The 5' end of hobowas replaced by the heat-inducible hsp70 promoter and 5'untranslated leader (UT). This construct, P[ry+, HSH2](heat shock hobo2 or HSH2), removes the first 147 bp ofhobo, and fuses the 5' UT of hsp70 to a point 40 bpdownstream of the putative hobo TATA box (Figure 1).To test the ability of the HSH2 construct to confer activity

in the soma, animals containing HSH2 and two copies ofhawi were raised at 25° C and heat shocked at different timesof development. The resulting adults were frequently mosaicin eye pigmentation, indicating that HSH2 is able to producenovel hobo activity in developing eye tissue (Figure 2 andTable II). Later heat shocks resulted in higher frequenciesof mosaicism, ostensibly because there are more cells thatcould have a mobilization event. Heat shock of a 4-6 dayold population of larvae at 37° C for 1 h resulted in 100%of the adult flies containing numerous small clones (typically

Fig. 2. hobo expression in somatic tissue. Mosaic white expressionresulting from mobilization of the mini-white marked hobo element,hawl, by the hsp7O-hobo fusion, HSH2. The mosaic fly on the leftcontains both hawI and HSH2 and resulted from a 1 h, 37° C heatshock of a population distributed over 0-2 days of development (at25° C, after egg deposition). On the right is a nonmosaic sibling toindicate the pigment levels imparted by the two donor hawl insertionson the X chromosome in this line. The observation that mosaic flieshave some sectors which are lighter than that due to the donor sitessuggests hawl is undergoing excision as well as transposition.

one to a few ommatidia). Heat shock of a 0-2 daypopulation of animals resulted in mosaicism in 44-50% ofadult flies (Table II). Results based upon 0-2 day heatshocks were chosen for comparison of the three independentpositions of HSH2 because they resulted in larger clones thatare more easily detected, and yielded a frequency of clones

hobo germline specificity

A,rl:.o-.e

= 7-." -.o

probe

7.46

4.40)

I15112 -_. 2.37

OP 1.35

9

* (1.24

ilt)1 41

Fig. 3. Northern analysis of HSH2 RNA. RNA prepared from larvaecontaining HSH2 that had been heat shocked for 1 h at 37° C wasprobed with the XhoI fragment of hobo (essentially all of hobo exceptfor 286 bp 5' and 106 bp 3'). A single, full-length HSH2 transcriptthat copurifies with poly(A)+ RNA migrates at -2.5 kb. Analysis ofRNA from animals given a mild pre-heat shock first to abrogate theeffect of heat shock on splicing also reveals one full-length transcript(unpublished data). Hybridization to ribosomal protein 49 transcript(RP49) is shown as a loading standard (Al-Atia et al., 1985). 'A+',1 Ag poly(A)+ RNA; 'Total', 3 Ag total RNA; 'A-', 0.5 /tgpoly(A)- RNA; 'M', RNA mol. wt markers (BRL). The size in kb ofthe mol. wt markers is indicated in the margin.

possibly regulation. RNase protection using a probecorresponding to the region 90-609 of hobo on HSH2 RNAdetected only one full-length species of transcript (Figure 4).

Southern analysis of RT-PCR products from an 1.2 kbregion spanning the ORFO/ORF 1 stop codon, however, didreveal shorter bands that hybridize to hobo probes in somecases (Figure 5). Although we did not observe the samebands using plasmid or in vitro transcribed RNA controltemplates, there are reasons for believing these shorter bandsare not relevant to hobo splicing and regulation. First, eventhough shorter species should have amplified moreefficiently, re-amplification of the primary PCRs using thesame or nested primers yielded only the full-length product.Second, the intensity of the shorter products did not correlatewith genetic function. In some PCR amplifications,HSH2-containing animals that had not been heat shockedyielded more of the shorter products than heat shockedsiblings (unpublished data); nonetheless, the frequency ofsomatic transposition with heat shock was much greater thanwithout heat shock (as great as three orders of magnitudefor heat shock during 4-6 days of development). Althoughanimals were frozen immediately after heat shock for RNApreparation, the RNA profile at later times was probably

Fig. 4. RNase protection analysis of the region spanning theORFO/ORFI junction in HSH2 RNA. (A) Representation of the probeused in this analysis. A 531 bp 32P-labeled antisense RNA probe wastranscribed in vitro from an HFL1 subclone. The 531 bp probecorresponds to the region between positions 609 and 90 of HFL1 andalso contains 11 bp of 5' polylinker sequence. Full-length protection ofHSH2 RNA would give a 463 bp fragment because of digestion ofpolylinker sequences and the region of the probe from position 90 to147, the point of fusion of hobo to the hsp7O 5' untranslated leader.Probe sequence corresponding to HSH2 is represented as a horizontalline, and other sequences of the probe as diagonal lines. (B) RNaseprotection reveals one unspliced transcript species in the ORFO/ORFIregion. The size of the protected fragment is that predicted by thereasoning in (A). Total RNA was prepared from larvae which hadbeen heat shocked with a mild pre-heat shock. Faint lower mol. wtbands are not an indication of splicing because they are also present insamples derived from the transformation host lacking HSH2(unpublished data). 'RNase-': undigested full-length probe;'RNase+', RNase-digested probe incubated with 1 itg HSH2 RNA;'M', mol. wt standards. Sizes of standards in base pairs are indicatedin the margin.

similar because other transcripts unspliced during heat shockare not spliced upon recovery (Yost and Lindquist, 1988).Thus, there is no compelling evidence for splicing of ORFOto ORF1 as the mechanism of hobo regulation.

1639

147

HSH227791

hsp7O

147 630

90

B +

710

489

404

_ 367

242

B.R.Calvi and W.M.Gelbart

A14-

II 142-N,

419S1Il-.4t 111 241) -

-1,i. 1111-,

.4'

.114-;

Fig. 5. RT-PCR analysis of HSH2 RN}'ORFO/ORFI junction. (A) Schematic relanalyzed in the RT-PCRs. Below HSH2approximate positions of primers used iImargins the sizes of the full-length prodbeen treated with DNase was incubatedH1428- with or without reverse transcrtranscript in a region that is highly constransposase and therefore is likely part cPrimary amplifications rely on a sense phsp7O-7+, and a hobo antisense primer1.19 kb product if full-length. The samehsp7O-3+ and H1249-, which would y1.15 kb, were used for reamplification cprimers are named for the nucleotide pothe most 5' base of the primer is identicRT-PCR products. Blots of PCRs wererepresenting virtually the entirety of hobprimary amplifications using the primers'Control': pHSH2 plasmid control templRNA derived from HSH2 lines given asevere heat shock either with (RT+) ortranscriptase added before PCR. 'cn;ry':from a line lacking HSH2 with (RT+);transcriptase. This is the line used as a IHSH2 and is devoid of other hobo elemwere reamplified using either the same IH1271- (lanes 6-8), or the nested prir(lanes 9-11). Secondary amplificationswith reverse transcriptase did not yield 1data). Although some reactions give smaproducts, they are not likely to be derivspecies. For example, although primaryspecies for HSH2 RNA (lane 2), only tiusing the same primers and conditions o10). The position and size in kb of mol.blots are shown in the margins.

Use of a novel reporter to detect low level hobopromoter activity

Ilxpcctid 1.11li-lll II ikb) To test further the hypothesis that hobo germline specificityis due to a transcriptional mechanism, it would be desirableto control the expression of a reporter gene with the hobopromoter. Presumably because of the low level activity of

1 l lp the hobo promoter, traditional reporter gene constructs havefailed to yield detectable activity (unpublished data). We thus

I.lI-10explored the use of a potentially more sensitive reporter, Ptransposase.The activity of the natural P element in the germline is

easily detected even though the transcript encoding functional1 ii :,< }, transposase is exceedingly rare (Laski et al., 1986; Rio

et al., 1986). Additionally, although the P promoter isweakly active in the soma and germline, removal of theregulated intron of P in the construct A2-3 results in a highlevel of P transposase activity in both tissues. Thus, becauseof the ease of detection at low transposase concentrations,and the potential to monitor activity in the soma and germlineby assaying P mobilization, we chose A2-3 P transposaseas a reporter for the hobo promoter.We replaced the P promoter in A2-3 with the putative hobo

promoter. Specifically the 1-147 fragment of hobo, frombp 1 of hobo to 40 bp downstream of the hobo TATAconsensus, was fused to bp 69 of P, 4 bp downstream ofthe P TATA consensus (Kaufman and Rio, 1991). Becauseof the potential of this fusion to produce P transposase,introduction into the genome via P element-mediatedtransformation may have resulted in unstable transformants.

i. We thus chose hobo-based transformation for introductionof the A2-3 reporter into the genome. It was not known,however, whether the 1-147 fragment contained sufficient

in the region spanning the 5' sequences required in cis for hobo transformation. Wepresentation of the region therefore inserted the hobo-P fusion into a complete hoboare shown the names and transformation vector that contains a larger 5' end, and that

n this analysis and in the is marked with the rosy+ gene. This construction, H[ry+,lucts expected. RNA that had HA2-3] (HA2-3), contains all sequences of the hobo element.with the antisense primer 'riptase. H1428- primes hobo HA2-3 has two hobo 5' ends i the same orientation, an outer;erved with Ac and Tam3 end representing the first 995 bp of hobo sequence and an)f the functional message. inner, 1-147 putative promoter fragment of hobo which is?rimer in the hsp7O 5' leader, fused to A2-3 (Figure 6). Thus, through one transformationH1271 - which would yield a experiment we could obtain transformants that contain a 5'primers or the nested primers

'ield a full-length product of end representing only the 1-147 fragment, or, if 1-147)f primary PCR products. hobo is not used for integration, insertions that contain the 1-995sition within HFL1 to which end as well. Of three independent transformants, all-al. (B) Southern analysis of contained both the inner 1-147 and the outer 1-995 5' endprobed with an XhoI fragment of hobo within HA2-3.'o. '1° PCR' (lanes 1-5):s hsp7O-7+ and H1271 -. We measured P transposase activity in the germline andlate; 'HSH2': RT-PCR of total soma for lines containing HA2-3 driven by the hobomild heat treatment plus a promoter and for a line containing a highly active insert ofwithout (RT-) reverse A2-3 with the P promoter resident at cytological positionRnd without (RT-) reverse 99B (Robertson et al., 1988) (Table Ill). In the germline,transformation recipient for the frequency of X to autosome transposition of a mini-whiteents. '2° PCR': primary PCRs marked P element was reduced several-fold for two linesprimers, hsp7O-7+ and and 20-fold for one line of HA2-3 relative to A2-3(99B).Of samples not pre-incubated In eye tissue, however, the activity of HA2-3 was reducedhybridizing bands (unpublished at least 1000-fold relative to A2-3(99B). This is aaller as well as full-length conservative estimate of the difference because most of theed from spliced mRNA G1 flies in the A2-3(99B) cross contained multiple mosaicamplification gives shorter patches. Comparison of the ratio of P transposase activityr nested primers (lanes 7 and in the soma versus the germline for A2-3 with that of HA2-3.wt markers for the separate allowed estimation of the relative contribution of the hobo

promoter to germline specificity (Table E). This comparison

1640

I!Iisi)7(),-9)I

-m-

hobo germline specificity

indicates replacement of the P promoter with hobo sequence A test for Ha2-3 activity in tissues of the adultis sufficient to confer a strong germline bias to A2-3 P cuticletransposase activity. These results argue strongly that hobo We wished to ask if the low expression observed for HA2-3activity is restricted to the germline by a transcriptional in the eye would extend to other somatically derived tissues.mechanism. Thus, HA2-3 activity in tissues leading to adult cuticle was

tested by assaying P-mediated instability at the singed (sn)5\c : locus. The mutant phenotype of snW is a slightly bent adult

9t\-]|{1{1 i;ll'i bristle. In the presence of P transposase, which mobilizesP elements resident at the locus, the snw allele is highlyunstable and can become more extreme (sne) resulting in an

II+01x' 0 ~-'-'' E]+ extremely shortened bristle, or revert to wild-type (sn+)(Engels, 1979, 1984; Robertson et al., 1988). We chose toscore only sne bristles because the sn+ phenotype

lI1,i+. I1A 51l'. ' ' *1""! EN _ + overlapped that of snw in our genetic background. When-:~v.rv_e>1: ^ snW' flies were crossed to A2-3(99B), 60% of the bristlesscored were sne in the first generation, indicative of P

Fig. 6. Schematic representation of hobo sequences fused to A2-3 P transposase activity in the soma (Table IV). In contrasttransposase and their activity in the germline and soma. Here all . . .

I

sequences of the vector integrated into the genome are shown because HA2-3 is much less active than A2-3(99B) in its somaticof their potential to affect expression. The putative hobo promoter destabilization of snW. Among the three separate genomic(positions 1-147 of HFL1, 40 bp 3' of the TATA consensus) is fused positions of HA2-3, only one bristle of 450 scored wasto position 69 of A2-3, a P element derivative which lacks the possibly sne. In the germline, however, the ability ofregulated intron, and therefore is potentially active in germline and HA2-3 to induce sne flies was only reduced to 40-73%soma. This fusion removes the TATA consensus in the A2-3 element. hat fo (Table Ia) wecocldH[ry+, HA2-3l contains this fusion in a rosy+ (y+) marked hobo that for A2-3(99B) (Table IV). Thus, we conclude thatthetransformation vector. The 1-147 fragment of hobo is in the same somatic quiescence conferred by hobo cis sequences is notorientation as the hobo vector. H[ry+, HA2-3Inv] is identical to peculiar to eye tissue, but probably represents a true somaH[ry+, HA2-3] except that the hobo promoter-52-3 fusion is in germline dichotomy in hobo expression.opposite orientation relative to the remainder of the hobo vector. Because HA2-3 contained sequences representin both theAlthough the relative activity in the soma is designated as a '-', there Bis a low level of somatic activity detected (Tables III and IV). ry+ 1- 147 and 1-995 ends of hobo, it was not known ifsequences are shown foreshortened. hobo sequences are represented as transcription began within the distal or proximal 5' end ofshaded boxes. Above and below are the nucleotide coordinates for the this construct. If transcription began in the distal 1 -995extent of hobo sequences in the elements. Arrowheads within theboxes represent the terminal inverted repeats. The arrow below the

sequence indicates the proposed transcriptional initiation site within 5' leader which could potentially mediate a post-hobo. transcriptional regulation. The low level of activity of the

Table Ill. P[w+] mobilization assay of HA2-3 in the soma and germline

Transposase source Somatic activity (S) Germline activity (G) G/S ratio

Adults Mosaic Gennlines Germlines withscored adults scored transpositionb

P[ry+, A2-3](99B) 275 275 (100%) 20 15 (75%) 0.75H[ry+, HA2-3](2-I)a 1975 1 70 8 (11%) 2.2 x 102H[ry+, HA2-3](2-2) 1696 2 70 10 (14%) 1.2 x 102H[iy+, HA2-3](3-1) 1390 0 70 3 (4%)

aThe first number in parentheses designates the chromosomal linkage of the insertion and the second the line number for that chromosome.bGermrlines with transposition were those that gave rise to one or more exceptional G2 w+ males.

Table IV. snw assay of HA2-3 and HA2-3Inv in the soma and germline

Transposase source Soma Germline

Bristles sne bristles Germlines Germlines withscored tested sne progeny

P[ry+, A2-3](99B) 150 90 (60%) 16 16 (100%)H[ry+, HA2-3](2-I)a 150 1 13 7 (54%)H[ry+, HA2-3](2-2) 150 0 11 8 (73%)H[ry+, HA2-3](3-1) 150 0 10 4 (40%)H[ry+, HA2-3Invl(3-1) 262 0 20 18 (90%)H[ry+, HA2-3Inv](2-1) 274 0 20 7 (35%)H[ry+, HA2-3Inv](2-2) 176 0 20 9 (45%)

aThe first number in parentheses designates the chromosomal linkage of the insertion and the second the line number for that chromosome.

1641

B.R.Calvi and W.M.Gelbart

hobo promoter did not allow us to locate the start oftranscription by standard primer extension experiments. Wethus constructed a second version of HA2-3, H[ry+,HA2-3Inv] (HA2-3Inverted or HA2-3Inv) in which the1-147 fragment of hobo and A2-3 P sequences wereinserted in the opposite orientation relative to other hobosequences within the transformation vector (Figure 6). Linescontaining HA2-3Inv displayed germline specific activity atfrequencies comparable to HA2-3 (Table IV). Thus, theseresults suggest that transcription is initiated within the 1-147fragment of hobo containing the TATA and CAATconsensus, and that the HA2-3 transcript probably containsat most only a few bases of hobo sequence.

DiscussionThe results presented here suggest that the primary basis forthe germline restriction of hobo activity is the limitation oftransposase to this tissue through transcriptional control. Thisis evidenced by the ability of the hsp70 promoter to directhobo activity in the soma and hobo sequences to confergermline bias to the reporter A2-3. Although formallypossible, we think it unlikely that the germline specificityof HA2-3 is due to a post-transcriptional regulation becauseits transcript probably contains only a few base pairs of hobosequence. In addition, the absence of evidence for splicingof the hobo transcript suggests that hobo germline specificityis not due to a tissue specific mRNA species. Although wecannot eliminate the possibility that there may be additionalpost-transcriptional controls on hobo activity, the results withHA2-3 and HA2-3Inv suggest that transcription is theprimary limitation to expression in the soma. If there areadditional controls, they must be different in some respectfrom those for the P element because hsp70-hobo fusionsdisplay activity in the soma but hsp70-P fusions do not.The I element, a retrotransposable element in the fly, is

also known to have germline restricted activity (Buchetonet al., 1984; Bucheton, 1990). The full-length, transposition-intermediate RNA of this element is restricted to the femalegermline (Chaboissier et al., 1990). This is probably dueto the restriction of I element promoter activity to this tissue(Lachaume et al., 1992; McLean et al., 1993). Thus thetranscriptional mechanism of hobo may be similar to thatused by the I element. We find no sequences that are similarbetween the promoters of the two elements, however(unpublished data).

Sequences responsible for hobo expressionThe results with the A2-3 reporter suggest that transcriptionbegins within the 1-147 fragment of hobo which containsthe TATA and CAAT consensus. Other sequences of hobocontained within the transformation vector, however, maycontribute to hobo transcriptional control. Given that the1-147 fragment within HA2-3Inv is in opposite orientationrelative to the transformation vector, if there are othersequences within hobo that contribute, they must be able toact somewhat independently of distance and orientation.Although larger numbers are needed, the observation of

rare somatic events for HA2-3, but not P-HBL1, suggeststhat the altered organization of hobo sequences within HA2-3may lead to a detectable but low level of transcription inthe soma. Alternatively, given steps subsequent totranscription are different for the P-HBLl and HA2-3 activity

1642

assays, there may be additional, minor, post-transcriptionalcontrols that act to reduce further the activity of the intacthobo element.

The nature of hobo transcriptional controlIt has been shown that transposition of P elements in thesoma is deleterious (Engels et al., 1987; Woodruff, 1992).If there are selective pressures against hobo somaticmobilization, the efficacy of transcriptional control as ameans to restrict expression to the germline depends on theefficiency of protection from activation by host enhancersand promoters that act in somatic tissues. Protection againstfortuitous activation due to genomic position is a recurringtheme in mobile element regulation (Kleckner, 1990). Wethink it likely, therefore, that hobo transcription is inhibitedby a negatively acting mechanism in the soma. In fact,although we observe variable levels of germline activity fordifferent insertions of both P-HBL1 and HA2-3, we havenever observed a stimulation of activity in the soma due togenomic position. Tests of other P-HBLl lines, and surveysof wild-type strains containing multiple hobo elements fortheir ability to mobilize hawi, have failed to reveal any withhobo activity in the soma (unpublished data).Because the mini-white gene within hawl is sensitive to

genomic position effects, the absence of hobo activity in thesoma cannot be due to sequences analogous to those foundat the hsp70 locus and in the gypsy mobile element that areable to act as buffers to genomic position effects (Kellumand Schedl, 1992; Roseman et al., 1993). Whatever themechanism of transcriptional regulation, the observation thathobo activity in the male and female germline can result inclusters of exceptional progeny suggests that the hobopromoter is active early during premeiotic germ cell divisions(Blackman et al., 1987; Ho et al., 1993).

Are natural hobo elements occasionally active in thesoma?There have been several observations which suggest that insome strains hobo elements may infrequently transpose inthe soma. In our early work characterizing genetic instabilityat the dpp locus due to hobo activity, in one line individualsmosaic for appendage defects characteristic of dpp mutantswere observed at very low frequency (Blackman and Gelbart,1989). This strain no longer displays this property. We couldnot determine whether these were transposase-dependentevents because the presence of numerous, unmarkedelements in these strains did not allow for controls in theabsence of transposase. Similarly, reports that in some strainsdifferent nuclei in the same salivary gland contain different,potentially hobo-mediated, chromosomal rearrangementscannot be unambiguously ascribed to hobo transposaseactivity (Lim, 1981; Yannopoulos et al., 1983).An additional suggestion that hobo may be occasionally

active in somatic tissue comes from the observation ofpolymorphic hobo positions in different salivary gland nucleiof the same animal visualized by in situ hybridization topolytene chromosomes (Kim and Belyaeva, 1991). This wasobserved in a mutagenized strain (MS) which was isolatedon the basis of its high spontaneous mutation rate [for reviewsee Ilyin et al. (1991)]. It may be that this strain is mutantfor factor(s) that directly or indirectly mediate hobotranscription in the soma. When the MS strain is crossedto strains containing hawl, however, we do not observe

hobo germline specificity

mosaic eye pigmentation. We find no evidence for adominant or recessive mutation that permits hobo somaticmobilization (unpublished data). It is possible that salivarygland cells are permissive for hobo mobilization in thesestrains whereas eye tissue is not. Alternatively, the differentstrains used to test hobo activity in the in situ hybridizationand haw 1 assays may differ with regard to additional factorsthat affect hobo somatic activity.

While we have never observed high levels of expressionin the soma due to genomic position, infrequently somepositions of hobo that place it near particularly strongenhancers may result in somatic transposase production. Dueto high instability in these lines, mobilization of thetransposase-producing element would then result in loss ofsomatic activity and selective advantage over siblings thatretain mobilization in the soma. This would explain the rare,transient observations of somatic hobo activity. Additionally,some strains may contain mutations within host genes orhobo elements that result in somatic activity. These mutationsmay be similarly transient due to instability or selectivepressures against high levels of somatic hobo activity.

The experiments described here provide a beginning tounderstanding the mechanism by which hobo mobilizationis restricted to the germline. Regulatory pathways leadingto hobo germline specificity probably also control theexpression of host genes. Continued investigation of thismechanism may aid in elucidating the molecular distinctionsbetween soma and germline.

Materials and methodsTransformation and genetic testsAll basic strains are described in Lindsley and Zimm (1992). Two strainsdevoid of hobo elements (E strains), cn; ry42 or y w67c23, were used astransformation recipients for ry+ marked or w+ marked elementsrespectively. P element based transformations were essentially as describedby Spradling and Rubin (1982) except that puchs7rA2-3 was co-injected asthe source of transposase (provided by D.Rio). hobo element basedtransformations were as described by Blackman et al. (1989), except thatthe source of hobo transposase, HBLl, was used.hobo transposase tests involving mobilization of hawl from the X

chromosome were essentially as described by Calvi et al. (1991). For mostheat shocked versions of this cross, GI progeny distributed over 2 daywindows of development were heat shocked in shell vials at 37° C for 1h in a water bath (10 min to achieve temperature + 60 min heat shock),after which the vials were cooled to 25° C in a water bath. All otherdevelopment was at 25° C. Both eyes of the ensuing adult flies that containedtransposase and hawl were scored for mosaic eye pigmentation at 16 xmagnification. The potential for mosaicism segregated with the chromosomecontaining the hsp7O-hobo fusions.Sources of P transposase were tested in two ways. The first was based

on the mobilization of P[w+, newt] (kindly provided by J.Sekelsky,unpublished data), a highly mobile P element marked with the mini-whitegene that is resident on an X chromosome containing the mutations y andw. In the Go, P transposase was introduced via the male and P[w+. newt]via the female. Both eyes of the GI were inspected for mosaic eyepigmentation. Single male flies containing the source of transposase andP[w+, newt] element were crossed to two w sn3 tester females in vials for6 days at 25° C. The vials were then scored on days 16-17 for theappearance of transpositions (sn w+ sons) among the G2.The second test was based on singed-weak (snW) mutability (Engels,

1984; Robertson et al., 1988). P transposase-containing males were crossedto y snw; bw; st females and the male GI progeny hemizygous for the snlocus were scored for bristle defects. The left and right posterior scutellarbristles were scored for each fly examined. Only sne defects were recordedbecause sn+ and snw phenotypes closely resembled each other in ourgenetic background. For sn genmline tests, males containing the source ofP transposase and y sn* chromosome were crossed singly in vials to twoattached-X females [C(J)DX, y wfl. GI adults were cleared from the vials

on day 6 and patroclinous male G2 progeny were scored for nonmosaicsne bristle phenotype on days 16-17. All crosses were reared at 25° C.

RNA analysisRNA was extracted from various stages using a hot phenol method asdescribed by Brown and Kafatos (1988). Poly(A)+ RNA was purified byone passage over a poly(T) - Sepharose column according to the conditionsof the supplier (BMB). For HSH2 heat-shocked RNA, animals were heatshocked for 1 h at 37° C and then immediately frozen in liquid N2. Whereindicated animals were given a mild heat shock of 35° C for 30 min, followedby 3 h recovery at 25° C, and then severe heat shock of 37° C for 1 h. Thispre-heat shock has been shown to reduce the inhibition to splicing observedfor severe heat shocks alone [for review see Yost et al. (1990)].For Northerns, gel electrophoresis in formaldehyde-containing gels and

transfer to nylon membranes were as described by Lehrach et al. (1977)and Rabinow and Birchler (1989). pRG2.6X, an XhoI subclone whichrepresents virtually the entirety of hobo (Blackman et al., 1987), was usedfor the generation of 32P-labeled hobo probes by random oligopolymerization using random hexamers (Feinberg and Vogelstein, 1983,1984). Hybridization and washes were performed at 65° C in Church Bufferas described (Church and Gilbert, 1984). Northern blots were reprobed withrandom oligo generated probes prepared from the plasmid rp49 to detectribosomal protein 49 (RP49) message to control for loading (Al-Atia, 1985).RNA markers (BRL) were used as size standards.RNase protection and probe preparation were essentially as described

(Krieg and Melton, 1987) except for the following modifications. The plasmidHA609 was used as template for in vitro transcription of 32P-labeledantisense probe. HA609 was created from HFL1 by digestion with PstIand SacI, making the ends blunt with T4 polymerase, and gel purificationand self-ligation of the vector/5' hobo fragment. Thus HA609 is deletedfor all sequences 3' of position 609 of HFLI until the Sacl site within thepolylinker. HA609 template was linearized by digestion with RsaI at position90 of HFL1 sequence. Probe was synthesized by T7 RNA polymeraseresulting in a 531 bp antisense transcript which is identical to HFL1 fromposition 90 to 609 and includes 11 bp of polylinker sequence. Full-lengthin vitro transcribed RNA probe was purified on 4% acrylamide-6 M ureagels and eluted directly into formamide hybridization buffer. Markers wereprepared by digestion of pBS-KS (Stratagene) with Hpall and labeled byfilling the ends using the Klenow fragment of DNA polymerase I and allfour [32P]NTPs at 800 Ci/mmol.RT-PCR of HSH2 RNA was essentially as described by Fuqua et al.

(1990), with the following modifications. 20 ytg total RNA was DNase-treated at 37° C for 30 min in a 100 1l reaction containing 30 U of RNase-free DNase I (BMB), 80 U of RNAsin (Promega), 10 mM DTT, 0.1 Msodium acetate pH 5, 5 mmol MgSO4, after which RNA was phenolextracted twice and ethanol precipitated. 1 Ag of DNase-treated RNA wasdenatured for 3 min at 100° C and incubated with or without 60 U of MMLVreverse transcriptase in a 10 A1 reaction containing 50 mM KCI, 3 mMMgCl, 10mM Tris-HCI pH 9,0.1% Triton X-100, 0.75 mM each dNTP,I U/1l RNAsin, 10 mM DTT, 1.25 pmol/Al primer, for 1 h at 370Cfollowed by 30 min at 45° C. The 10 1l reverse transcription was heatedto 100° C for 3 min and added direcdy into 40 $1 of prewarmed PCR solution.The final concentrations were 50 mM KCI, 2 mM MgCl2, 10 mMTris-HCI pH 9, 0.1% Triton X-100, 150 mM each NTP, sense andantisense primer at 0.25 -0.5 pmol/4l each, and 2.5 U Taq polymerase.PCR typically involved 25-30 cycles each consisting of 1 min at 940C,

min at 50° C, and 2 min at 72° C. The hobo primer, H1271-, andhsp7O-7 +, a primer corresponding to sequence within the hsp 70 untranslatedleader present in HSH2, were used for primary amplifications. For secondaryamplifications 1 1d of the primary PCR products were reamplified in 501I reactions using either the same primers, H1271 - and hsp7o-7 +, or thenested primers, H1249- and hsp7o-3 +, corresponding to hobo and hsp 70sequence respectively. hobo primers were named for the position withinHFL1 for which the most 5' nucleotide of the primer corresponds, with+ and - symbols to designate sense and antisense primers respectively.The sequences of the primers are as follows: hsp7o-3 +, GGCGGTACC-GAATACAAGAAGAGAAACTCTG; hsp7o-7+, GCCAAGAAGTAA-TTATTGAATAC; H 1428-, GTAGTTGGAGTTCCATCTAGTCGG;H1271-, GGTTGGATCCTGACAACAGGTGACTGCTAC; H1249-,TAAACGGGTATTGCCCTCTAAAGCC.PCR products derived from hobo were identified by probing Southern

blots of the PCRs with 32P-labeled pRG2.6X. Hybridization of bands tohobo probes in lanes representing reactions with reverse transcriptase, butnot in those without reverse transcriptase, confirms they are derived fromhobo RNA. Full-length PCR products were subcloned and restrictionmapped, confrming they do not contain deletions. Multiple attempts to clone

1643

B.R.Calvi and W.M.Gelbart

the shorter primary PCR products that do not reamplify have beenunsuccessful.

DNA cloningProcedures for plasmid constructions were essentially as described (Sambrooket al., 1989). HSH2 was constructed by inserting the FspI fragment of HFLI(from 147 to 2791) into a ry+ P element vector containing the hsp7Opromoter which was prepared by digestion with Notl and made blunt-endedby the Klenow fragment of DNA polymerase I. This ry+ P element vectorcontaining the hsp7O promoter, P[ry+, hs], had been created by insertingthe Sail-NotI fragment containing the hsp7O promoter from pCasper-hs(provided by C.Thummel) into the NotI and Sail sites of pDM30 (Mismerand Rubin, 1987).HA2-3 was constructed by first ligating the Kpnl-FspI fragment of HFL1

and a BanHI-ApaLI filled in fragment from puchsirA2-3 (provided byD.Rio) into the KpnI- and BamHI-cut vector pmartini. pmartini was createdby inserting the polylinker from pPoly IE-I (Lathe et al., 1987) into thevector pBS-KSII+ (Stratagene). A NotI fragment containing the hobo-Pelement fusion was excised from this vector and ligated into the NotI siteof the ry+ marked hobo vector H[ry+, HFLN]. H[ry+, HFLN] is aderivative of HFL1 in which the Sall site has been changed into a NotIsite by the addition of a linker, and which has the 7.2 kb HindIIl ry+fragment from Car20 (Rubin and Spradling, 1983) ligated into the uniqueHindIII site of hobo. In HA2-3Inv the NotI fragment containing positions1 -147 of hobo fused to A2-3 is in inverted orientation relative to the hobotransformation vector.

AcknowledgementsThe authors wish to thank the following individuals. D.Rio for helpful adviceand puchs7rA2-3; C.Thummel for pCasper-hs; S.Bray, T.Hsu andG.Tzertzinis for advice on PCR; K.Mowry and M.Mortin for advice onRNase protection; J.Sekelsky for the gift of P[w+, newt], discussions andcomputer maintenance; D.Smith for early attempts with reporters;M.Sanicola and S.Findley for vector construction; D.Coen for helpful advice;F.Kafatos, W.Bender, C.Swimmer and R.Padgett for a critical reading ofthe manuscript; E.Chartoff and Y.Kraytsberg for technical assistance;L.Lukas, D.Lukas and J.Gargano for fly support. B.R.C. was supportedby a NSF predoctoral fellowship and a PHS predoctoral traineeship ingenetics. This research was supported by a PHS grant to W.M.G.

ReferencesAl-Atia,G.R., Fruscoloni,P. and Jacobs-Lorena,M. (1985) Biochemistry,

24, 5798-5803.Blackman,R.K. and Gelbart,W.M. (1989) In Berg,D.E. and Howe,M.M.

(eds), Mobile DNA. American Society for Microbiology, Washington,DC, pp. 523-529.

Blackman,R.K., Grimaila,R., Koehler,M.M.D. and Gelbart,W.M. (1987)Cell, 49, 497-505.

Blackman,R.K., Koehler,M.M.D., Grimaila,R. and Gelbart,W.M. (1989)EMBO J., 8, 211-217.

Brown,N.H. and Kafatos,F.C. (1988) J. Mol. Biol., 203, 425-437.Bucheton,A. (1990) Trends Genet., 6, 16-21.Bucheton,A., Paro,R., Sang,H.M., Pelisson,A. and Finnegan,D.J. (1984)

Cell, 38, 153-163.Calvi,B.R., Hong,T.J., Findley,S.D. and Gelbart,W.M. (1991) Cell, 66,465-471.

Chaboissier,M.-C., Busseau,I., Prosser,J., Finnegan,D.J. and Bucheton,A.(1990) EMBO J., 9, 3557-3563.

Church,G.M. and Gilbert,W. (1984) Proc. Natl Acad. Sci. USA, 81,1991-1995.

Engels,W.R. (1979) Proc. Natl Acad. Sci. USA, 76, 4011-4015.Engels,W.R. (1984) Science, 226, 1194-1196.Engels,W.R. (1989) In Berg,D.E. and Howe,M.M. (eds), Mobile DNA.

American Society for Microbiology, Washington, DC, pp. 437-484.Engels,W.R., Benz,W.K., Preston,C.R., Graham,P.L., Phillis,R.W. and

Robertson,H.M. (1987) Genetics, 117, 745-757.Feinberg,A.P. and Vogelstein,B. (1983) Anal. Biochem., 132, 6.Feinberg,A.P. and Vogelstein,B. (1984) Anal. Biochem., 137, 266.Fuqua,S.A.W., Fitzgerald,S.D. and McGuire,W.L. (1990) BioTechniques,

9, 206-211.Ho,Y.T., Weber,S.M. and Lim,J.K. (1993) Genetics, 134, 895-908.Ilyin,Y.V., Lyubomirskaya,N.V. and Kim,A.I. (1991) Genetica, 85,13-22.

Kaufmnan,P.D. and Rio,D.C. (1991) Proc. Natl Acad. Sci. USA, 88,2613-2617.

Kaufnan,P.D. and Rio,D.C. (1992) Cell, 69, 27-39.Kellum,R. and Schedl,P. (1992) Mol. Cell. Biol., 12, 2424-2431.Kim,A.I. and Belyaeva,E.S. (1991) Mol. Gen. Genet., 229, 437-444.Kleckner,N. (1990) Rev. Cell Biol., 6, 297-327.Krieg,P.A. and Melton,D.A. (1987) Methods Enzymol., 155, 397-415.Lachaume,P., Bouhidel,K., Mesure,M. and Pinon,H. (1992) Development,

115, 729-735.Laski,F.A. and Rubin,G.M. (1989) Genes Dev., 3, 720-728.Laski,F.A., Rio,D.C. and Rubin,G.M. (1986) Cell, 44, 7-19.Lathe,R., Vilotte,J.L. and Clark,A.J. (1987) Gene, 57, 193-201.Lehrach,H., Diamond,D., Wozney,J.M. and Boedtker,H. (1977)

Biochemistry, 16, 4743.Lim,J.K. (1981) Cold Spring Harbor Symp. Quant. Biol., 45, 553-560.Lim,J.K. (1988) Genetics, 85, 9153-9157.Lindsley,D.L. and Zimm,G.G. (1992) The Genome of Drosophila

melanogaster. Academic Press, San Diego, CA.McClintock,B. (1948) Carnegie Inst. Wash. Year Book, 47, 155-169.McClintock,B. (1952) Carnegie Inst. Wash. Year Book, 51, 212-219.McLean,C., Bucheton,A. and Finnegan,D.J. (1993) Mol. Cell. Biol., 13,

1042-1050.Mismer,D. and Rubin,G.M. (1987) Genetics, 116, 565-578.O'Hare,K. and Rubin,G.M. (1983) Cell, 34, 25-35.Pirrotta,V., Steller,H. and Bozzetti,M.P. (1985) EMBO J., 4, 3501-3508.Rabinow,L and Birchler,J.A. (1989) EMBO J., 8, 879-889.Rio,D.C. (1991) Trends Genet., 7, 282-287.Rio,D.C., Laski,F.A. and Rubin,G.M. (1986) Cell, 44, 21-32.Robertson,H.M., Preston,C.R., Phillis,R.W., Johnson-Schlitz,D.M.,

Benz,W.K. and Engels,W.R. (1988) Genetics, 118, 461-470.Roseman,R.R., Pirrotta,V. and Geyer,P.K. (1993) EMBO J., 12, 435-442.Rubin,G.M. and Spradling,A C. (1983) NucleicAcids Res., 11, 6341 -6351.Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning. A

Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

Siebel,C.W. and Rio,D.C. (1990) Science, 248, 1200-1208.Siebel,C.W., Fresco,L.D. and Rio,D.C. (1992) Genes Dev., 6, 1386-1401.Smith,P.A. and Corces,V.G. (1991) Adv. Genet., 29, 229-300.Spradling,A.C. and Rubin,G.M. (1982) Science, 218, 341-347.Streck,R.D., MacGaffey,J.E. and Beckendorf,S.K. (1986) EMBO J., 5,

3615-3623.Woodruff,R.C. (1992) Genetica, 86, 143-154.Yannopoulos,G., Stamatis,N., Zacharopoulou,A. and Pelecanos,M. (1983)

Mutat. Res., 108, 185-202.Yannopoulos,G., Stamatis,N., Monastirioti,M., Hatzopoulos,P. and

Louis,C. (1987) Cell, 49, 487-495.Yost,H.J. and Lindquist,S. (1986) Cell, 45, 185-193.Yost,H.J. and Lindquist,S. (1988) Science, 242, 1544-1548.Yost,H.J., Petersen,R.B. and Lindquist,S. (1990) Trends Genet., 6, 223.

Received on November 23, 1993; revised on January 10, 1994

1644