THE ISLAMIC UNIVERSITY - GAZA

Biological Sciences Master Program

Improving the Diagnosis of Dermatophytes in Gaza

Strip by using Nested PCR

Submitted in Partial Fulfillment for the Degree of Master of Science in

Biological Sciences / Microbiology

By

Eyad Khalil Ayesh

Supervisor

Dr. Tarek Elbashiti

Assoc. Prof. of Biotechnology

Jun, 2013

II

Declaration

I hereby declare that this submission is my own work and that, to the best of my

knowledge and belief, it contains no material previously published or written by another

person nor material which to a substantial extent has been accepted for the award of any

other degree of the university of other institute, except where due acknowledgment has

been made in the text .

Signature Name Date Eyad Eyad Khalil Ayesh

Copy right.

All Right Reserved : No part of this work can be copied , translated or stored in a

retrieval system , without prior permission of the author.

III

Dedication

To my beloved parents and family

to my wife,

to my sons and daughters

IV

Acknowledgements

This work has been carried out at Remal Clinic laboratories in the Ministry of

Health of Gaza, Palestine and Gene Medical Laboratories.

I would like to express my sincere thanks to all the people who directly or indirectly

have contributed to this work. In particular, I would like to thank Dr. Tarek Elbashiti

my great supervisor.

I would like to extend my thanks to all the staff at the Department of Microbiology, in

Remal clinic and staff at Gene Medical Laboratories.

I would also like to thank my friends and colleagues, for all of their support and

guidance and encouraging; good luck to all.

Finally, I want to say that my beloved family especially my brothers and sisters, my

wife, they always stand beside me and give me encouragement all time and for their

never-ending love and support. I am so proud of my family.

Thank you all.

V

Improving the Diagnosis of Dermatophytes in Gaza Strip by using Nested PCR

Abstract

Dermatophytes are a very related to keratinophilic fungi that can invade

keratinized humans and animal tissues such as skin, hair and nails causing

dermatophytosis. They are the important cause of superficial fungal infection.

Conventional methods like potassium hydroxide (KOH) microscopy and fungal culture

lacks the ability to make an early and specific diagnosis. In this study it is taken into

consideration to evaluate nested polymerase chain reaction (NPCR) using primers

targeting dermatophyte specific sequence of chitin synthase 1 (CHS1) gene and

compared with conventional method potassium hydroxide (KOH) microscopy test in

Remal Clinic in Gaza city.

A total of ninety nine patients were clinically suspected with dermatophytosis including

16 skin specimens 16 nail specimens and 67 hair specimens. For each specimens KOH,

PCR and NPCR tests were carried out.

Having compared the output results of NPCR sequencing with the wild-type gene which

is obtained from the National Center for Biotechnology Information (NCBI) gene bank.

The comparison indicates that the product of NPCR is CHS1 gene according to (NCBI)

gene bank. Additionally, it is considered to compare the results of NPCR with KOH for

dermatophytes which gives that 41.4% are positive indication based on KOH and

18.18% is positive indication according to NPCR.

After carrying out the statistical analysis using SPSS for both tests results obtained from

NPCR and KOH, it is found that 30% of the total sample has to be included for

treatment based on KOH test, although this percent of the sample doesn‟t need to

undergo treatment according to NPCR test. It is also shown that 6% of the sample are

excluded for treatment in KOH test, in spite the NPCR indicated that this percent must

be included in the treatment.

The prominent controversy between the test results (KOH and NPCR) was found

particularly in the nails diagnosis.

Key words: Dermatophytes, KOH method, PCR, Nested PCR

VI

Arabic Abstract

في قطاع غزج NPCR انرضاػف انركزر ذحسي ػهيح فحص انفطزياخ انجهذيح تاسرخذاو ذقيح

انهخص

انكيشاحييت في اإلسا انحيا انفطشياث اندهذيت ي فطشياث يشحبطت بادة انكيشاحي حيث إا حاخى األسدت

انفحصاث انخقهيذيت انخاصت بانفطشياث اندهذيت . حيث أ األظافش حسبب انعذ انفطشيت –انشعش –يثم اندهذ

ت بعضا يفخقش إن انذقت األخش يحخاج إن فخشة طيهت نهخشخيص .( انزاسع انفطشيKOHيثم فحص )

حج يقاست CHS1باسخخذاو حسهسم يعي ندي NPCR انخضاعف انخكشس ز انذساست حى حقييى فحص ففي

عيت نا احخانيت عذ فطشيت 99انسخخذيت في عيادة انشيال )غزة ( حيث حى فحص KOHخائح فحص

.عيت ي انشعش 67-عيت ي انبششة 66-عيت أظافش 66يقست كانخاني

انقاست NCBIانشكز انطي نعهياث انخقيت انحييت يع NPCRقذ حج يقاست خائح انخسهسم نفحص

كاج سبت KOHيع خائح NPCRباإلضافت إن رنك حى يقاست خائح ، CHS1 اندي أكذث أ اناحح

.% 68.68ي NPCR% في فحص 46.4ي KOHفي فحص تانعياث انخب

% ي يدع انعياث دخهج في دائشة انعالج باء عه فحص 03ز انخائح بعذ انخحهيم اإلحصائي حشيش إن أ

KOHعه فحص باء نهعالجى ي أ ز انسبت نيسج في حاخت عه انشغNPCR ، حى 6خذ أ يا سبخ %

ظش NPCRعه فحص باءعه انشغى ي حاخخا ان انعالج KOHإخشاخا ي دائشة انعالج في فحص

. أكثش االخخالف في انخائح في عهيت حشخيص األظافش

VII

Table of contents

Item Page

Biological Sciences Master Program.............................................................................. I

Declaration ..................................................................................................................... II

Dedication ...................................................................................................................... III

Acknowledgements ....................................................................................................... IV

Abstract ........................................................................................................................... V

Arabic Abstract ............................................................................................................ VI

Table of contents ......................................................................................................... VII

List of Figures ................................................................................................................. X

List of Tables ................................................................................................................. XI

Abbreviations .............................................................................................................. XII

Chapter One .................................................................................................................... 1

Introduction .................................................................................................................... 1

1.1 Preface .................................................................................................................... 2

1.2 Dermatophytes Species........................................................................................... 2

1.2.1 Epidermophyton Spp. ...................................................................................... 2

1.2.2 Microsporum Spp. ........................................................................................... 3

1.2. 3 Trichophyton Spp. .......................................................................................... 3

1.3 Keratin and keratinolytic ........................................................................................ 3

1.4 The Role of the Immune System ............................................................................ 4

1.5 Pathogenicity .......................................................................................................... 4

1.6 Epidemiology ......................................................................................................... 4

1.7 Dermatophytes in the Worldwide ........................................................................... 5

1.7.1 Mediterranean Countries ................................................................................. 5

1.7.2 West Bank ....................................................................................................... 5

1.7.3 Arab Land Occupied in 1948.......................................................................... 5

1.7.4 Egypt ................................................................................................................ 5

1.7.5 Gaza Strip ........................................................................................................ 6

1.8Aim of the Study . ................................................................................................... 6

1.8.1 General Objective ............................................................................................ 6

1.8.2 Specific Objectives .......................................................................................... 6

1.8.3 Significance: ................................................................................................... 6

Chapter Two ................................................................................................................... 7

VIII

Literature Review ........................................................................................................... 7

2.1 Dermatophytoses .................................................................................................... 8

2.2 Etiology .................................................................................................................. 9

2.3 Transmission ........................................................................................................... 9

2.4 Disinfection ............................................................................................................ 9

2.5 Infections in Humans ............................................................................................ 10

2.6 Prevalence ............................................................................................................. 10

2.7 Diagnostic Tests ................................................................................................... 11

2.8 Identification of Dermatophyte. ........................................................................ 11

2.8.1 Conventional Method .................................................................................... 11

2.8.2 Conventional PCR ........................................................................................ 11

2.8.3 Nested PCR ................................................................................................... 12

2.9 The Role of the Immune System .......................................................................... 12

2.11 Teleomorphs ....................................................................................................... 14

2.12 Preview of previous studies : ............................................................................. 15

Chapter Three ............................................................................................................... 27

Materials and Methods ................................................................................................ 27

3.1 Materials ............................................................................................................... 28

3.1.1 Instrument ...................................................................................................... 28

3.1.2 PCR primers .................................................................................................. 28

3.1.3 Chemical ........................................................................................................ 28

3.2 Methods ................................................................................................................ 29

3.2.1 Study Area ..................................................................................................... 29

3.2.2 Samples .......................................................................................................... 29

3.2.3 Specimens Collection .................................................................................... 29

3.2.4 Specimens Division. ...................................................................................... 29

3.2.5 Specimens Identification ............................................................................... 29

3.2.6 Questionnaire ................................................................................................. 36

3.2.7 Data Analysis ................................................................................................. 36

Chapter Four ................................................................................................................ 37

Results ............................................................................................................................ 37

4.1 Potassium hydroxide (KOH) microscopy. ........................................................... 38

4.2 Molecular Diagnosis ............................................................................................. 39

4.3 Gene Sequencing .................................................................................................. 39

4.4 Statistical analysis ................................................................................................ 41

4.4.1 Study population ............................................................................................ 41

IX

4.4.2 Relative absolute error .................................................................................. 45

4.4.3 Lab diagnosis exclusion and inclusion errors ................................................ 46

Chapter Five .................................................................................................................. 47

Discussion ...................................................................................................................... 47

Chapter six .................................................................................................................... 52

Conclusions & Recommendations ............................................................................... 52

Conclusions ................................................................................................................ 53

Recommendations ...................................................................................................... 53

References .................................................................................................................. 54

Appendix .................................................................................................................... 62

X

List of Figures

Figure Page

Figure 4.1 Microscopic appearance of positive sample (spores) from hair in KOH. ... 40

Figure 4. 2 Results of First and Nested PCR .................................................................. 41

Figure 4.3 The wild-type gene obtained from the NCBI gene bank accession number

GI: AB 003558) .............................................................................................................. 42

Figure 4.4 The DNA sequencing result of CHS1 out put .............................................. 43

Figure 4.5 Sample classification of gender .................................................................... 44

Figure 4.6 classification of sample type ......................................................................... 44

Figure 4.7 The domestic animal kinds in houses ........................................................... 45

Figure 4.8 Age group distribution. ................................................................................. 45

Figure 4.9 The results of KOH classification ................................................................. 44

Figure 4. 63 result of FPCR classification ...................................................................... 46

Figure 4. 66 The result of NPCR classification .............................................................. 44

Figure 4.62 The results of KOH,FPCR,NPCR classification ........................................ 47

XI

List of Tables

Table Page

Table 2.1: Anamorph genera and species of dermatophytes...........................................15

Table 2.2: Teleomorph-Anamorph State of Dermatophytes ........................................... 16

Table ‎3.1: list of equipment used in this study. .............................................................. 28

Table 3.2: list of PCR primers used in this study. ......................................................... 28

Table 3.3: list of chemical used in this study. ............................................................... 28

Table 3.4: for first PCR reaction mixture ...................................................................... 32

Table 3.5: Temperature cycling program for FPCR ....................................................... 33

Table 3.6: Nested PCR Master Mix For 25 μ l reactions, the amounts given are per

reaction ........................................................................................................................... 33

Table 3.7: Temperature cycling program for NPCR ...................................................... 33

Table 4.1: sample type and lab methods KOH & NPCR . ............................................. 45

Table 4.2: holding animals in the house relative KOH & NPCR. .................................. 45

Table 4.3: lab diagnosis exclusion and inclusion errors. ................................................ 46

XII

Abbreviations

KOH Potassium hydroxide microscopy

PCR polymerase chain reaction NPCR Nestedpolymerase chain reaction

CHS1 Chitin Synthase 1 gene

ITS polymorphisms within the fungal internal transcribed spacer

µl Micro liter

DNA Deoxyribonucleic acid

nt Nucleotides

dNTPs Deoxynucleotide triphosphates

bp Base pair

g Gram

GEL Gelatin liquifaction

FPCR First polymerase chain reaction

NCBI National Center for Biotechnology Information

EDTA Ethylene diamine tetra acetic acid

6

Chapter One

Introduction

2

Chapter 1

INTRODUCTION

1.1 Preface

The dermatophytes are a group of closely related fungi that have the capacity

to invade keratinized tissue (skin, hair, and nails) of humans and other animals to

produce an infection, dermatophytosis, commonly referred to as ringworm. Infection

is generally cutaneous and restricted to the nonliving cornified layers because of the

inability of the fungi to penetrate the deeper tissues or organs of immunocompetent

hosts. Reactions to a dermatophyte infection may range from mild to severe as a

consequence of the host‟s reactions to the metabolic products of the fungus, the

virulence of the infecting strain or species, the anatomic location of the infection, and

local environmental factors (Shinkafi and Manga,2011; Barry and Hainer, 2003; and

Weitzman and Summerbell, 1995).

1.2 Dermatophytes Species

The etiologic agents of the dermatophytoses are classified in three anamorphic

(asexual or imperfect) genera, Epidermophyton, Microsporum and Trichophyton, of

anamorphic class Hyphomycetes of the Deuteromycota (Fungi Imperfecti) (Weitzman

and Summerbell, 1995).

The most common system to classify dermatophytes as follows (Achterman and

White, 2011).

•Geophilic dermatophytes are found mainly in soil, where they are associated with

decomposing hair, feathers, hooves and other keratin sources. They infect both

humans and animals ( Epidermophyton).

•Zoophilic dermatophytes are mainly found in animals but can be transmitted to

humans ( Microsporum) .

•Anthropophilic dermatophytes are mainly found in humans and are very seldom

transmitted to animals ( Trichophyton)

1.2.1 Epidermophyton Spp. The type species is Epidermophyton floccosum. The macroconidia are broadly

clavate with typically smooth, thin to moderately thick walls and one to nine septa,

range in size 20 to 60 by 4 to 13 mm in size. They are usually abundant and borne

0

singly or in clusters. Microconidia are absent. This genus has only two known species

to date, and only E. floccosum is pathogenic (Taleb, 2010 and Borelli, 1965).

1.2.2 Microsporum Spp. The type species is Microsporum audouinii. Macroconidia are characterized

by the presence of rough walls which may be asperulate, echinulate, or verrucose.

Originally, the macroconidia were described by Emmons as spindle shaped or

fusiform, but the discovery of new species extended the range from obovate (egg

shaped) as in Microsporum nanum to cylindrofusiform as in Microsporum

vanbreuseghemii.

The macroconidia may have thin, moderately thin to thick walls and 1 to 15 septa and

range in size from 6 to 160 by 6 to 25 mm. Microconidia are sessile or stalked and

clavate and usually arranged singly along the hyphae or in racemes as in

Microsporum racemosum, a rare pathogen (Taleb, 2010 and Borelli, 1965) .

1.2. 3 Trichophyton Spp. The type species is Trichophyton tonsurans. Macroconidia, when present,

have smooth, usually thin walls and one to 12 septa, are borne singly or in clusters,

and may be elongate and pencil shaped, clavate, fusiform, or cylindrical. They range

in size from 8 to 86 by 4 to 14 mm. Microconidia, usually more abundant than

macroconidia, may be globose, pyriform or clavate, or sessile or stalked, and are

borne singly along the sides of the hyphae or in grape-like clusters (Taleb, 2010 and

Borelli, 1965).

1.3 Keratin and keratinolytic

Keratin is a major component of hair, feathers and wool and is the most

complex of the cytoskeletal intermediate filament proteins of epithelial. The

durability of keratins is a direct consequence of their complex architecture. In

addition to keratin, keratinaceous materials such as skin, hair, nails, hoofs and horns

contain a large proportion of non-keratin proteins. A large number of fungi,

including yeasts, dermatophytes and other moulds, grow on human skin, hair and

nails. The term „keratinolytic‟ is used for fungi exhibiting the enzymatic ability

to attack and utilize keratin. Degradation of keratin by microorganisms is

performed by specific proteases that is, keratinases (Sharma et al., 2011).

4

1.4 The Role of the Immune System

Fungal virulence is the result of interplay between the infecting organism and

the host. During dermatophyte infection, cell-mediated immunity is widely

considered to be responsible for modulating dermatophyte disease and fungal antigens

activate T-suppressor and T-helper cells. Diverences specific to the host are thought to

be important in determining the relative susceptibility of individuals, with factors such

as age, gender, and genetics all like lytoplayarole )Achterman and White, 2012(.

1.5 Pathogenicity

The dermatophyte species within the three genera Epidermophyton,

Microsporum and Trichophyton differ in their pathogenicity in vivo. While all species

invade the stratum corneum of the epidermis and the follicular ostium of hairs,

different species vary widely in their capacity to invade hair and nail. The reasons for

this observed tissue specificity are unknown, but are thought to be related to specific

nutritional requirements or the enzyme production of individual organisms. Role of

proteolytic enzymes in pathogenicity Self synthesised enzymes serve fungi in a

number of ways. They enhance survival in tissues by chemically or physically altering

the immediate environment and they act directly by digesting host proteins, thus

providing a source of nutrition. Therefore the pathogenic potential of a fungal agent

depends on its ability to produce enzymes. In turn variations in enzymatic potential of

a fungus may be responsible for differences in the pathogenic effects of various

strains (Simpanya, 2000).

1.6 Epidemiology

Dermatophytes are among the few fungi causing communicable disease, that

is, diseases acquired from infected animals or birds or from the fomites they have

engendered. All but one of the species known to cause disease primarily affect

mammals, the exception is Microsporum gallinae, is primarily established in

gallinaceous fowl. Apart from those species usually associated with disease,

transitional species exist which appear to be primarily saprobic organisms

occasionally or rarely causing infection. Finally, some Trichophyton,

Epidermophyton, and Microsporum species closely related to the dermatophytes

appear to be exclusively saprobic or nearly so. The members of these three genera

5

have no collective designation. The term dermatophytes should be restricted to

designate infectious organisms and will be referred to below as dermatophytes and

their congeners. Closely biologically related organisms not included in this group

include Chrysosporium species with teleomorphs in the genus Arthroderma (Ajello,

1974).

1.7 Dermatophytes in the Worldwide

Although dermatophytes can be isolated worldwide, many species are only

encountered in geographically restricted areas of the more than 40 species of

dermatophytes previously identified only about 12 are common causes of human

infection (Elewski, 2000).

1.7.1 Mediterranean Countries T. violaceum and M. canis were also reported to be the predominant scalp ringworm

pathogens in many countries of the Mediterranean, including Suadia Arabia

(Venugopal and Venugopal, 1993), Kuwait (Al-Fouzan et al., 1992) and Iran

(Knosravi et al ., 1994).

1.7.2 West Bank The test seventy-five children cases of tinea capitis (1%) were mycologically proven.

The incidence was higher in young children. T. violaceum was the most common

causative agent 82.7% followed by M . canis (16%) and T. schoenleinii (1.3%)

(Ali-Shtayeh et al., 1997).

1.7.3 Arab Land Occupied in 1948 M. canis was first reported in 1975, since then this dermatophyte has spread

throughout the country becoming an important cause of scalp ringworm (Alteras et

al., 1986).

1.7.4 Egypt The most frequently isolated dermatophyte species was T. violaceum which accounted

for most (71.1%) of all the recovered dermatophyte, followed by M. canis (21.09%)

T. rubrum (6.2%) and M. boullardii (0.49) both E. floccosum and T. tonsurans were

only rarely isolated (0.24%) (Zaki et al., 2008).

6

1.7.5 Gaza Strip As mentioned in the only related study, the most common dermatophyte caused tinea

capitis in north Gaza area was M. canis (92.5%) and (7.5%) was T. mentagrophytes

(Taleb, 2010).

1.8Aim of the Study .

1.8.1 General Objective

The aim of this study is to improving the diagnosis of dermatophytes in Gaza Strip by

using Nested PCR.

1.8.2 Specific Objectives The specific objectives of this research could be summarized in the following points,

includes:

1. To carrying out the traditional diagnosis by direct microscopy by using KOH.

2. To evaluating a nested PCR targeting specific gene for dermatophytes.

3. To comparing between the results of the traditional diagnosis and the new method

by nested PCR.

4. Faster following of residual disease during drug treatment.

1.8.3 Significance: In Gaza Strip labs, the laboratory diagnosis of dermatophytosis routinely involves

direct microscopic examination of clinical specimen and some times followed by in

vitro culture techniques. Microscopic identification of fungal elements directly from

clinical specimen is a rapid diagnostic method but it lacks specificity and sensitivity,

with false negative results. In vitro culture is a specific diagnostic test but it is slow

technique, and may take up to 8 weeks to give the results. The advent of molecular

technology has enabled the development of techniques like polymerase chain

reaction, which is a highly sensitive and specific test and can be used for diagnosis of

various microorganisms including fungal pathogens. In this study, it is considered to

improve and evaluated a nested PCR to obtain rapid and good identification of the

dermophytes fungi to help the doctors to post theraputic strategies. The treatment of

dermatophytoses would be most appropriate when the selection of antimicrobial agent

is based on the identity of the causative agent. The results of this study may shed light

on this tragic condition that will be of interest to improve the health conditions of

people living in the Gaza Strip.

7

Chapter Two

Literature Review

8

Chapter 2

Literature Review

2.1 Dermatophytoses

Because dermatophytes require keratin for growth, they are restricted to hair, nails,

and superficial skin. Thus, these fungi do not infect mucosal surfaces.

Dermatophytoses are referred to as “tinea” infections. They are also named for the

body site involved. Some dermatophytes are spread directly from one person to

another (anthropophilic organisms). Others live in and are transmitted to humans from

soil (geophilic organisms), and still others spread to humans from animal hosts

(zoophilic organisms). Transmission of dermatophytes also can occur indirectly from

fomites (e.g., upholstery, hairbrushes, hats). Anthropophilic organisms are responsible

for most fungal skin infections. Transmission can occur by direct contact or from

exposure to desquamated cells. Direct inoculation through breaks in the skin occurs

more often in persons with depressed cell-mediated immunity. Once fungi enter the

skin, they germinate and invade the superficial skin layers. In patients with

dermatophytoses, physical examination may reveal a characteristic pattern of

inflammation, termed an “active” border. The inflammatory response is usually

characterized by a greater degree of redness and scaling at the edge of the lesion or,

occasionally, blister formation. Central clearing of the lesion may be present and dis-

tinguishes dermatophytoses from other papulosquamous eruptions such as psoriasis or

lichen planus, in which the inflammatory response tends to be uniform over the

lesion. The location of the lesions also can help identify the pathogen. A

dermatophytosis can most likely be ruled out if a patient has mucosal involvement

with an adjacent red, scaly skin rash. In this situation, the more probable diagnosis is a

candidal infection such as perlèche (if single or multiple fissures are present in the

corners of the mouth) or vulvovaginitis or balanitis (if lesions are present in the geni-

tal mucosa). Potassium hydroxide (KOH) microscopy aids in visualizing hyphae and

confirming the diagnosis of dermatophyte infection. Other diagnostic modalities

include Wood‟s lamp examination, fungal culture, and skin or nail biopsy (Barry and

Hainer, 2003).

9

2.2 Etiology

Dermatophytosis is caused by fungi in the genera Microsporum, Trichophyton and

Epidermophyton. These organisms, called dermatophytes, are the pathogenic

members of the keratinophilic (keratin digesting) soil fungi. Microsporum and

Trichophyton are human and animal pathogens. Epidermophyton is a human

pathogen. The dermatophytes were all formerly classifed as members of the phylum

Deuteromycota (Fungi imperfecti). Some are now known to reproduce sexually and

have been reclassifed in the phylum Ascomycota, family Arthrodermataceae. Each of

these fungi now has two species names, one for the stage found in vertebrate hosts,

and one for the form that grows in the environment (the perfect state). Formerly, the

perfect states of Microsporum species were placed in the genus Nannizia and the

perfect states of Trichophyton in the genus Arthroderma. Currently, the perfect states

of both Microsporum and Trichophyton belong to the genus Arthroderma. (Weitzman

and Summerbell, 1995 and ALY,1994).

2.3 Transmission

Infection occurs by contact with arthrospores (asexual spores formed in the hyphae

of the parasitic stage) or conidia (sexual or asexual spores formed in the “free living”

environmental stage). Infection usually begins in a growing hair or the stratum

corneum of the skin. Dermatophytes do not generally invade resting hairs, since the

essential nutrients they need for growth are absent or limited. Hyphae spread in the

hairs and keratinized skin, eventually developing infectious arthrospores.

Transmission between hosts usually occurs by direct contact with a symptomatic or

asymptomatic host, or direct or airborne contact with its hairs or skin scales. Infective

spores in hair and dermal scales can remain viable for several months to years in the

environment. Fomites such as brushes and clippers can be important in transmission.

Geophilic dermatophytes, such as M. nanum and M. gypseum, are usually acquired

directly from the soil rather than from another host (Georg, 1960).

2.4 Disinfection

Dermatophyte spores are susceptible to common disinfectants such as benzalkonium

chloride, dilute (1:10) chlorine bleach, or strong detergents. Chlorhexidine is no

longer considered to be a good environmental decontaminant for these fungi. The

mechanical removal of any material containing keratin, such as shed skin and hairs,

63

facilitates disinfection. Vacuuming is considered to be the best method in many cases

(cfsph.web)

2.5 Infections in Humans

The incubation period in humans is 1 to 2 weeks.

Clinical Signs

Dermatophytes generally grow only in keratinized tissues such as hair, nails and the

outer layer of skin; the fungus usually stops spreading where it contacts living cells

or areas of inflammation. Mucus membranes are not affected. The clinical signs may

vary, depending on the region affected. In humans, pruritus is the most common

symptom. The skin lesions are usually characterized by infammation that is most

severe at the edges, with erythema, scaling and occasionally blister formation.

Central clearing is sometimes seen, particularly in tinea corporis; this results in the

formation of a classic “ringworm” lesion. On the scalp and facial hair, there may be

hair loss. Dermatophytes acquired from animals or the soil generally produce more

inflammatory lesions in humans than anthropophilic dermatophytes. In humans,

dermatophytoses are referred to as “tinea” infections, and are named with reference

to the area of the body involved. Infections can spread to other areas; tinea corporis

in children, for example, is often the result of a tinea capitis infection that has spread

to the face (cfsph.web).

2.6 Prevalence

Although dermatophyte infections are known to be common, their prevalence is

unknown as this disease is not not fable and many infections are treated with over-the-

counter drugs. In the United Kingdom, a survey found dermatophytosis to be the

most common zoonosis; its prevalence was 24%. Infections are more common in

children than adults. The geographic distribution of the various dermatophyte

species, as well as their animal hosts, influences the zoonosis found in humans. M.

canis, usually transmitted by cats and dogs, is more common in people living in

urban areas. T. verrucosum is more often found in rural environments. In

Switzerland, one study reported that 14% of those working with cattle had been

infected. Most dermatophyte infections are not serious in healthy persons; however,

opportunistic bacteria can cause cellulitis in skin damaged by inter digital fungal

infections. These infections are a particular concern in diabetics. Dermatophytosis is

more serious in those who are immunosuppressed. These individuals may have

66

atypical and locally aggressive dermatophyte infections, including extensive skin

disease, sub cutaneous abscesses, and disseminated disease (cfsph.web).

2.7 Diagnostic Tests

Some (but not all) strains of M. canis and M. equinum exhibit green fluorescence

when stimulated by certain wave- lengths of UV light. A Wood‟s lamp can be used to

examine the fur for these fungi. Certain topical preparations may mask the

fluorescence, and alcohol can either suppress the fluorescence or cause non-specific

fluorescence. Microscopic examination of skin scrapings or hairs in potassium

hydroxide (KOH) may reveal hyphae or conidia. A potassium hydroxide-calcofuor

white (CFW) mixture can also be used to visualize dermatophyte structures, using a

fluorescence microscope. Definitive diagnosis usually relies on culture. Skin

scrapings or plucked hair samples may be cultured, or the fur may also be brushed

with a disinfected toothbrush to collect hairs. Species found in dogs and cats will

grow in about 4 to 7 days at 25-28؛C, on a variety of commercial media.

Dermatophyte Test Medium (DTM) contains a pH indicator (phenol red) that will

turn the medium red when a dermatophyte is growing; however, bacteria and fungi

other than dermatophytes can also produce a pH change. Therefore, the growth must

be examined further to differentiate the organism. Dermatophytes are traditionally

identified using a “slide culture” to observe the reproductive structures (conidia) and

hyphae. Species can be identified by the colony structure and color, micro conidia,

macro conidia and other microscopic structures (Moriello k. 2004).

2.8 Identification of Dermatophyte.

2.8.1 Conventional Method The dermatophytosis caused by various dermatophyte species cannot be easily

differentiated on the basis of clinical manifestations methods.

For many years, conventional laboratory methods based on the detection of

phenotypic characteristics, such as microscopy and in-vitro culture, have played an

essential role in dermatophyte identification. However, these procedures generally

suffer from the drawbacks of being either slow or non-specific (Liu et al., 2000).

2.8.2 Conventional PCR Recent developments and applications of nucleic acid amplification technology have

provided the opportunity to enhance the quality and speed of dermatophyte diagnosis.

62

This method by use polymerase chain reaction (PCR) for diagnosis after use nested

PCR (Liu et al., 2002).

2.8.3 Nested PCR Nested PCR is a variation of the polymerase chain reaction (PCR), in that two pairs

(instead of one pair) of PCR primers are used to amplify a fragment.

The first pair of PCR primers amplify a fragment similar to a standard PCR. However,

a second pair of primers called nested primers (as they lie / are nested within the first

fragment) bind inside the first PCR product fragment to allow amplification of a

second PCR product which is shorter than the first one.

The advantage of nested PCR is that if the wrong PCR fragment was amplified, the

probability is quite low that the region would be amplified a second time by the

second set of primers. Thus, Nested PCR is a very specific PCR amplification (PCR

Station. web).

2.9 The Role of the Immune System

Fungal virulence is the result of interplay between the infecting organism and the

host. During dermatophyte infection, cell-mediated immunity is widely considered to

be responsible for modulating dermatophyte disease and fungal antigens activate T-

suppressor and T-helper cells. Differences specific to the host are thought to be

important in determining the relative susceptibility of individuals, with factors such

As age, gender ,and genetic. The most numerous cells in the epidermis are

keratinocytes, indicating that dermatophytes must primarily interact with these cells.

Interestingly, keratinocytes seem to exhibit a differential response following exposure

to different dermatophyte species (Achterman and White, 2011).

60

2.10 Anamorphic

The anamorphic species of the dermatophytes are listed in Table 1 (Weitzman

and Summerbell, 1995).

Table.2.1 Anamorph genera and species of dermatophytes (Weitzman and Summerbell 1995).

Species Date of exploring Epidermophyton 1907

E. floccosum 1930

Microsporum 1843

M. audouinii 1843

M. canis 1902

M. equinum 1904

M. ferrugineum 1921

M. fulvum 1909

M. gallinae 1929

M. gypseum 1928

M. nanum 1956

M. persicolor 1928

M. praecox 1987

M. racemosum 1965

M. vanbreuseghemii, 1962

Trichophyton 1845

T. concentricum 1895

T. equinum 1902

T. gourvilii 1933

T. kanei 1989

T. megninii 1896

T. mentagrophytes 1896

T. raubitschekii, 1981

T. rubrum 1911

T. schoenleinii 1930

T. simii 1965

T. soudanense 1912

T. tonsurans 1845

T. verrucosum 1902

T. violaceum 1902

T. yaoundei 1957

64

2.11 Teleomorphs

Some dermatophytes, mostly the zoophilic and geophilic species of

Microsporum and Trichophyton, are also capable of reproducing sexually and

producing ascomata with asci and ascospores. These species are classified in the

teleomorphic genus Arthroderma (Weitzman et al., 1986), family Arthrodermataceae

of the Onygenales (Currah, 1985), phylum Ascomycota. Previously, the teleomorphs

of the sexually reproducing Microsporum and Trichophyton species and related

keratinophilic fungi had been classified in the genera Nannizzia and Arthroderma,

respectively (Ajello, 1977). However, on the basis of a careful evaluation of the

morphological characteristics used to define these two genera (Weitzman et al., 1986),

concluded that the species making up these genera represented a continuum and that

their minor differences did not merit maintaining them in two separate genera.

Nannizzia and Arthroderma are considered to be congeneric, with Arthroderma

having taxonomic priority (Weitzman and Summerbell, 1995).

Table 2.2 Teleomorph-Anamorph State of Dermatophytes (Weitzman and Summerbell, 1995)

Teleomorph (reference) Anamorph

Arthroderma Microsporum, Trichophyton

A. benhamiae T. mentagrophytesa

A. fulvum M. fulvumb

A. grubyi M. vanbreuseghemii

A. gypseum M. gypseumb

A. incurvatum M. gypseumb

A. obtusum M. nanum

A. otae. M. canis var. canis, M. canis var distortum

A. persicolor M. persicolor

A. simii T. simii

A. racemosum M. racemosum

A. vanbreuseghemii T. mentagrophytesa

65

2.12 Preview of previous studies :

Chandran et al. Study (2013)They aimed to evaluate a commercially available PCR

kit for the in vitro detection of dermatophytes and specifically Trichophyton rubrum

in nail specimens with suspected onychomycosis, and to compare the detection rates

of PCR with conventional diagnostic methods.Nail specimens were prospectively

collected from patients with clinically suspected onychomycosis. All nail specimens

were positive on direct microscopic examination. PCR and fungal cultures were

administered, and the detection rates of dermatophytes were compared. In all, 107

nail specimens were analysed. The fungal culture was positive in 57 (53%) specimens

(38 dermatophytes and 19 non-dermatophytes). PCR was positive in 77 (72%)

specimens (63 T. rubrum and 14 pan-dermatophyte). A total of 37 specimens (35%)

were positive for both fungal culture and PCR. PCR detected dermatophytes in 39

specimens that were missed by the fungal culture, increasing the diagnosis of

dermatophyte-positive specimens by 37%. Five dermatophyte-culture-positive

specimens were negative for PCR.The study demonstrates that PCR increases the

sensitivity of detection of dermatophytes in nail specimens. Despite its limitations, the

use of PCR can complement direct microscopic examination and fungal cultures to

aid clinicians in the diagnosis of suspected dermatophytic onychomycosis (Chandran

et al,. 2013)

A total of 218 patients presenting in a surgical practice over 3 months with clinical

signs of tinea pedis and/or onychomycosis were involved in the prospective study. All

patients had predisposing factors for tinea pedis and tinea unguium, such as vascular

insufficiency, diabetes mellitus, and leg ulcers. Nail specimens and skin scrapings

were investigated for fungi using Blancophor preparation, and cultured. In addition

to conventional diagnostics, PCR (polymerase chain reaction) for detection of

dermatophyte DNA was employed. This PCR-Elisa assay is based on the use of

specific primers which target the topoisomerase II gene. This allows the highly

specific molecular identification of Trichophyton (T.) rubrum, T. interdigitale, and

Epidermophyton floccosum directly in clinical samples.

23.9 % of patients were culture-positive for dermatophytes (either T. rubrum, or T.

interdigitale). With PCR, dermatophyte DNA either of T. rubrum or T. interdigitale

66

could be detected in nail samples and skin scrapings from at least 29.9 % of all

patients. Epidermophyton floccosum was not found in this study, neither by

cultivation nor by PCR. The diagnostic sensitivity of the PCR-Elisa assay was

calculated as 79.0% %; the diagnostic specificity as 85.5 %.

PCR-Elisa evaluation makes possible a rapid, specific and sensitive diagnosis of

dermatophytosis of the nails and skin within 24 (maximal 48) hours with

identification of the involved species(Winter et al.,2013)

PCR method based on the amplification of the chitin synthase 1 gene was developed.

The study included 119 strains of dermatophytes and non dermatophytic fungi, eight

dermatophytic reference strains and 201 nail specimens from patients with

dermatophytic onyxis.

PCR positivity was based on the production of a specific 432bp fragment. None of the

investigated non dermatophytic strains was positive. Sensitivity of PCR was higher as

compared to mycological examination (90.5% vs. 81.1%). PCR was positive in 31

onyxis cases with positive direct examination but negative or contaminated culture. In

contrast, PCR was negative in 10 cases where both direct examination and culture

were found positive.

PCR is an adequate tool for the diagnosis of dermatophytic onychomycosis. It is much

adapted to cases where culture is negative or contaminated by overgrowing molds,

which makes the identification of the causal agent problematic (Dhib et al., 2012)

Verrier et al .Study (2012)In this study, they describe a PCR-terminal restriction

fragment length polymorphism (TRFLP) assay to directly and routinely identify the

infecting fungi in nails. Fungal DNA was easily extracted using a commercial kit after

dissolving nail fragments in an Na 2 S solution. Trichophyton spp., as well as 12 non

dermatophytes could be unambiguously identified by the specific restriction fragment

size of 5-end-labeled amplified 28 S DNA. This assay enables the distinction of

different fungal infectious agents and their identification in mixed infections.

Infectious agents could be identified in 74% (162/219) of cases in which the culture

results were negative. The PCR-TRFLP assay described here is simple and reliable.

67

Furthermore, it has the possibility to be automated and thus routinely applied to the

rapid diagnosis of a large number of clinical specimens in dermatology laboratories.

Kim et al. study (2011) In this study, the possibility of using multiplex PCR was

investigated to speed up and specify the detection of aflatoxigenic Aspergillus species

in meju, a traditional Korean fermented soybean food starter. Two different sets of

three primers were designed specifically for the omtB, ver-1, aflR, and omtA genes

present in the aflatoxin biosynthesis cluster. The optimized multiplex PCR showed

that only aflatoxigenic Aspergillus species gave three band patterns in both primer

sets. The detection limits were determined as 125 pg/ml for genomic DNA from

aflatoxigenic A. parasiticus KCCM 35078, and 105 spores/g of meju sample for DNA

extracted directly from meju. A total of 65 Aspergillus isolates from meju were tested

for the presence of aflatoxigenic fungi by the application of multiplex PCR, and were

analyzed by TLC and HPLC for the aflatoxin production in the culture filtrates.

Results showed a good correlation between the presence of the aflatoxin biosynthesis

genes analyzed by multiplex PCR and aflatoxin production by TLC and HPLC. This

suggests that this multiplex PCR method may provide an accurate and specific

detection of aflatoxigenic Aspergillus species in fermented soybean foods

Sharma et al.study (2011) In this study,the present investigation was aimed to

evaluate the in vitro biodegradation of keratin by clinical isolates of

dermatophytes and soil fungi. Ten fungal species, out of which, six

(Chrysosporium indicum, Trichophyton mentagrophytes, Scopulariopsis sp.,

Aspergillus terreus, Microsporum gypseum and Fusarium oxysporum) were

isolated from soil and four clinical (Trichophyton rubrum, Trichophyton

verrucosum, Trichophyton tonsurans and Microsporum fulvum) were obtained

from human skin. The isolates were tested for their keratin degradation ability on

human and animal (cow and buffalo) hair baits. The rate of keratin degradation was

expressed as weight loss over three weeks of incubation. Human hair had the highest

rate of keratin degradation (56.66%) by colonization of C. indicum. Whereas M.

gypseum and T. verrucosum were highly degraded (49.34%) to animal hairs. There

was a significant difference (p < 0.05) in keratin substrate degradation rates by the

examined fungi. Human hair served as an excellent source for the biodegradation of

keratin by the isolated test fungi as compared to animal hair. Releasing protein

showed maceration of the keratin substrates by the test fungi. The present study

68

reveals that, the isolated test fungi play a significant impact on biodegradation of

keratin substrates for betterment of environmental hazards.

De Baere et al. study (2010) In this study,a total of 95 isolates, belonging to 33

species of five dermatophyte genera, i.e. Arthroderma (15 species), Chrysosporium

(two), Epidermophyton (one), Microsporum (three) and Trichophyton (12), were

studied using internal transcribed spacer 2 (ITS2)-PCR-RFLP analysis (ITS2-RFLP),

consisting of amplification of the ITS2 region, restriction digestion with BstUI

(CG/CG) and restriction fragment length determination by capillary electrophoresis.

ITS2-RFLP analysis proved to be most useful for identification of species of the

genera Arthroderma, Chrysosporium and Epidermophyton, but could not distinguish

between several Trichophyton species. The identification results are in agreement

with established and recent taxonomical insights into the dermatophytes; for example,

highly related species also had closely related and sometimes difficult-to-discriminate

ITS2-RFLP patterns. In some cases, several ITS2-RFLP groups could be

distinguished within species, again mostly in agreement with the taxonomic

delineations of subspecies and/or genomovars, confirming the relevance of ITS2-

RFLP analysis as an identification technique and as a useful taxonomic approach.

A new concept for multiplex detection and quantification of microbes is here

demonstrated on a range of infectious fungal species. Padlock probe methodology in

conjunction with qPCR and Luminex™ technology was used for simultaneous

detection of ten fungal species in one single experiment. By combining the

multiplexing properties of padlock probes and Luminex™ detection with the well

established quantitative characteristics of qPCR, quantitative microbe detection was

done in 10-plex mode. A padlock probe is an oligonucleotide that via a ligation

reaction forms circular DNA when hybridizing to specific target DNA. The region of

the padlock probe that does not participate in target DNA hybridization contains

generic primer sequences for amplification and a tag sequence for Luminex™

detection. This was the fundamental for well performing multiplexing. Circularized

padlock probes were initially amplified by rolling circle amplification (RCA),

followed by a SybrGreen™ real time PCR which allowed an additive quantitative

assessment of target DNA in the sample. Detection and quantification of amplified

padlock probes were then done on color coded Luminex™ microspheres carrying

69

anti-tag sequences. A novel technique, using labeled oligonucleotides to prevent

reannealing of amplimers by covering the flanks of the address sequence, improved

the signal to noise ratio in the detection step considerably. The method correctly

detected fungi in a variety of clinical samples and offered quantitative information on

fungal nucleic acid (Eriksson et al.,2009)

Uchida et al. Study (2009)The present study was performed to assess the utility of

specific polymerase chain reaction (PCR)-based methods for Trichophyton rubrum

and Trichophyton mentagrophytes as diagnostic tools for dermatophytoses. Both

conventional morphological identification and specific PCR methods based on the

nuclear ribosomal internal transcribed spacer (ITS)1 DNA sequence were performed

to identify dermatophyte species from clinical specimens of patients who visited

Kawasaki Social Insurance Hospital between 16 May and 17 August 2005. Specific

PCR methods were also directly applied to clinical specimens, and the results of the

two methods were compared. The clinical samples examined consisted of 126 skin

scale specimens and 80 nail specimens. The positive rates of culture isolation from

clinical specimens were 67% and 33% for skin scale and nail specimens, respectively.

In contrast, PCR analysis yielded a positive rate of 100% for clinical isolates from

both skin scales and nails, and rates of 95% and 99% were obtained by direct

application to clinical specimens. The results of the present study indicated that

specific PCR is highly advantageous as a diagnostic tool for detection and

identification of dermatophytes on direct application to skin scale or nail specimens.

Garg et al. Study (2009)In their study they have evaluated nested PCR targeting the

Chitin Synthase 1 (CHS1) gene (DDBJ accession no.-AB003558) shared by three

genera, i.e., Trichophyton, Epidermophyton, and Microsporum,Of the 105 clinically

suspected cases of skin dermatophytosis, 63.8% (67/105) were positive for fungal

elements by KOH microscopy. Dermatophytes were detected in 82.8% (87/105) of

the specimens by nested PCR, 49.5% (52/105) by first round PCR and isolated by

culture in 23.8%(25/105) cases. Among the dermatophytes isolated on culture

Trichophyton rubrum was the commonest isolate (48%, 12/25), followed by T.

mentagrophyte (40%, 10/ 25), Trichophyton tonsurans (8%, 2/25), and Trichophyton

violaceum (4%, 1/25). Of 80 specimens negative for dermatophyte isolation by

fungal culture, 4 specimens were positive for nondermatophytic molds and 12

23

specimens for Candida albicans. 37 (46.2%) specimens were positive by first round

PCR and 59 (73.7%) by nested PCR. Of the 87 nested PCR positive specimens

candida albicans was cultured from 5 specimens, thus nested PCR detecting cases

with hidden mixed infections. Nested PCR was positive in 73.7% (28/38) of the KOH

microscopy-negative specimens. In addition, all 59 patients on antifungal therapy

were positive by nested PCR. Among 50 clinically suspected cases of hair

dermatophytosis, positivity by nested PCR was highest 86% (n = 43/ 50) followed by

KOH microscopy 58% (n = 29/50), first round PCR 52% (n = 26/50) and fungal

culture 30% (n = 15/50). Nested PCR was positive for 66.6% (n = 14/ 21) and 80% (n

= 28/35) of the KOH microscopy-negative and culture-negative specimens

respectively. Of twenty specimens negative both by KOH microscopy and fungal

culture, nested PCR was positive in 13 (65%) specimens. In addition, all 28 patients

on antifungal therapy were positive by nested PCR .

The DNA sequencing analyses have demonstrated relatively limited polymorphisms

within the fungal internal transcribed spacer (ITS) regions among Trichophyton spp.

they sequenced the ITS region (ITS1, 5.8S, and ITS2) for 42 dermatophytes

belonging to seven species (Trichophyton rubrum, T. mentagrophytes, T. soudanense,

T. tonsurans, Epidermophyton floccosum, Microsporum canis, and M. gypseum) and

developed a novel padlock probe and rollingcircle amplification (RCA)-based method

for identification of single nucleotide polymorphisms (SNPs) that could be exploited

to differentiate between Trichophyton spp. Sequencing results demonstrated

intraspecies genetic variation for T. tonsurans, T. mentagrophytes, and T. soudanense

but not T. rubrum. Signature sets of SNPs between T. rubrum and T. soudanense (4-

bp difference) and T. violaceum and T. soudanense (3-bp difference) were identified.

The RCA assay correctly identified five Trichophyton species. Although the use of

two “group-specific” probes targeting both the ITS1 and the ITS2 regions were

required to identify T. soudanense, the other species were identified by single ITS1-

or ITS2-targeted species-specific probes. There was good agreement between ITS

sequencing and the RCA assay. Despite limited genetic variation between

Trichophyton spp., the sensitive, specific RCA-based SNP detection assay showed

potential as a simple, reproducible method for the rapid (2-h) identification of

Trichophyton spp(Kong et al.,2008)

26

Garg et al. Study (2007)In this study, nested PCR using novel primers targeting the

pan-dermatophyte-specific sequence of the chitin synthase 1 gene (CHS1) was

compared with KOH microscopy, culture isolation, and single-round PCR for

diagnosis of 152 patients with clinically suspected onychomycosis. Results indicate

that nested PCR may be considered the gold standard for the diagnosis of cases of

onychomycosis for which the etiological agents are dermatophytes.

A rapid two-step DNA extraction method and a multiplex PCR for the detection of

dermatophytes in general and Trichophyton rubrum specifically were developed and

evaluated with DNA extracted from pure cultures and from clinically diseased nails.

A total of 118 nail samples received for routine microscopy and culture for

dermatophytes were subsequently tested by the two PCRs separately and in a

multiplex format. Using DNA extracted from pure cultures and the pan-dermatophyte

PCR, the T. rubrum-specific PCR sequentially and in a multiplex format correctly

detected all dermatophytes and additionally correctly identified T. rubrum.

Comparison of the traditional diagnostic evaluation (microscopy and culture) of nail

samples with PCR on DNA directly extracted from the nails showed excellent

agreement between PCR and microscopy, but the number of samples with

dermatophyte species identification was increased considerably from 22.9% to 41.5%,

mainly due to the identification of T. rubrum by PCR in microscopy-positive but

culture-negative samples. In conclusion, this 5-hour diagnostic test was shown to

increase not only the speed but also the sensitivity of investigation for nail

dermatophytosis(Dabrowska et al.,2007)

Newer methods such as PCR are being investigated in order to improve the diagnosis

of invasive aspergillosis. One of the major obstacles to using PCR to diagnose

aspergillosis is a reliable, simple method for extraction of the fungal DNA. The

presence of a complex, sturdy cell wall that is resistant to lysis impairs extraction of

the DNA by conventional methods employed for bacteria. Numerous fungal DNA

extraction protocols have been described in the literature. However,these methods are

time-consuming, require a high level of skill and may not be suitable for use as a

routine diagnostic technique. Here, a number of extraction methods were compared: a

22

freeze–thaw method, a freeze–boil method, enzyme extraction and a bead-beating

method using Mini-BeadBeater-8. The quality and quantity of the DNA extracted was

compared using real-time PCR. It was found that the use of a bead-beating method

followed by extraction with AL buffer (Qiagen) was the most successful extraction

technique, giving the greatest yield of DNA, and was also the least time-consuming

method assessed(Lisa et al.,2006)

Roque et al. Study (2006)This report describes application of PCR fingerprinting to

identify common species of dermatophytes using the microsatellite primers M13,

(GACA) 4 , and (GTG) 5. The initial PCR analysis rendered a specific DNA fragment

for Microsporum audouinii, which was cloned and sequenced. Based on the

sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers

were designed and verified by PCR to establish their reliability in the diagnosis of M.

audouinii. These primers produced a singular PCR band of 431 bp specific only to

strains and isolates of M. audouinii, based on a global test of 182 strains/isolates

belonging to 11 species of dermatophytes. These findings indicate these primers are

reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

Fusarium spp. and other non-dermatophyte fungi are repeatedly isolated from

abnormal nails. To investigate whether these fungi are the aetiological agents of

infection or simply transient contaminants, a PCR/sequencing/RFLP assay was

developed for direct and routine identification of the infecting fungi in

onychomycosis. Fungal DNA was readily extracted using a commercial kit after

dissolving nail fragments in a Na 2 S solution. Amplification of part of the 28S rDNA

by PCR was performed with universal primers and the fungal species were identified

by sequencing. The PCR/sequencing results were comparable with microbiological

identification from the same nail sample. In addition to dermatophytes, Fusarium spp.

and other less frequently isolated non-dermatophyte fungi were identified as single

fungal agents in onychomycosis. Moreover, mixed infections were clearly

demonstrated in 10% of cases by RFLP analysis of PCR products. Identification of

infectious agents could be obtained in 2 days, whilst results from fungal cultures take

1–3 weeks. Rapid and reliable molecular identification of the infectious fungus

expedites the choice of appropriate antifungal therapy, thereby improving the cure

rate of onychomycosis (Monod et al., 2006)

20

Multiple codominant genetic markers from single spores of the arbuscular

mycorrhizal (AM) fungi Glomus mosseae, Glomus caledonium, and Glomus

geosporum were amplified by nested multiplex PCR using a combination of primers

for simultaneous amplifi cation of five loci in one PCR. Subsequently, each marker

was amplified separately in nested PCR using specific primers. Polymorphic loci

within the three putative single copy genes GmFOX2, GmTOR2, and GmGIN1 were

characterized by sequencing and single strand conformation polymorphisms (SSCP).

Primers specific for the LSU rDNA D2 region were included in the multiplex PCR to

ensure correct identification of the Glomus spp . spores. Single AM fungal spores

were characterized as multilocus genotypes by combining alleles of each amplified

locus. Only one copy of each putative single copy gene could be amplified from each

spore, indicating that spores are homokaryotic. All isolates of G. mosseae had unique

genotypes. The amplification of multiple codominant genetic markers from single

spores by the nested multiplex PCR approach provides an important tool for future

studies of AM fungi population genetics and evolution (Stukenbrock and

Rosendahl .,2004)

They analyzed the population structure of the anthropophilic dermatophyte species

Trichophyton violaceum, which mainly causes tinea capitis, and T. rubrum, the most

frequently isolated agent of dermatophytosis worldwide. A microsatellite marker (T1)

was developed by using the enrichment technique for microsatellites. The T1 marker

containing a (GT) 8-10 repeat was proven to specifically amplify both species,

underlining their close kinship. Four polymorphic alleles were detected within asset of

about 130 strains by using polyacrylamide gel electrophoresis with this marker. An

association with geographic origin of the isolates was apparent. Given the close

relatedness of both species, these data suggest an African origin of the entire

T. rubrum complex, followed by the emergence of a new genotype (B) in Asia with

subsequent spread of this genotype over Europe and the United States (Ohst et al.,

2004)

24

Dermatophytoses such as tinea pedis and tinea unguium are very common diseases in

the field of dermatology. The diagnosis of dermatophytoses is usually performed by

direct microscopy and culture. The identification of species is based on morphological

features of giant culture and slide culture. However, in some cases, it is difficult to

identify the species clearly because the culture shows an atypical appearance or is

false negative. Therefore, several molecular biological methods have been developed

for precise identification of a species. The analysis of patterns of random

amplification of polymorphic DNA (RAPD) and restriction fragment length

polymorphisms (RFLP) of mitochondrial DNA is useful for identifying isolates which

are not clearly identifiable by conventional biological techniques. The phylogenetic

analysis of dermatophytes was made by using DNA direct sequencing of nuclear

ribosomal internal transcribed spacer 1 (ITS1). Sequence analysis of chitin synthase 1

(CHS 1) is a rapid tool for species level identification. They attempted the

identification and viability assessment of dermatophytes based on the quantitative

measurement of dermatophyte actin (ACT) mRNA. An internal fragment of the ACT,

725 to 762 bp, was isolated by PCR from the genomic DNA of dermatophytes and

sequenced. ACT intron based primers were dermatophyte species-specific and primer

pairs crossing the intron were dermatophyte genus-specific. The results indicated that

quantification of dermatophyte ACT mRNA correlated with the results of culture and

KOH examination. It is important that the identification of dermatophyte be done by

combining conventional methods with molecular biological methods. In some cases

results of the two methods do not correspond, and is those the fungal species needs to

be re-examined (Kawai et al., 2003).

For PCR-based identification of Aspergillus species, a common primer of the DNA

topoisomerase II genes of Candida, Aspergillus and Penicillium, and species-specific

primers of the genomic sequences of DNA topoisomerase II of A. fumigatus, A. niger,

A. flavus (A. oryzae), A. nidulans and A. terreus were tested for their specificities in

PCR amplifications. The method consisted of amplification of the genomic DNA topo

isomerase II gene by a common primer set, followed by a second PCR with a primer

mix consisting of 5 species-specific primer pairs for each Aspergillus species. By

using the common primer pair, a DNA fragment of approximately 1,200 bp was

amplified from the Aspergillus and Penicillium genomic DNAs. Using each species-

25

specific primer pair, unique sizes of PCR products were amplified, all of which

corresponded to a species of Aspergillus even in the presence of DNAs of several

fungal species. The sensitivity of A. fumigatus to the nested PCR was found to be 100

fg of DNA in the reaction mixture. In the nested PCR obtained by using the primer

mix (PsIV), the specific DNA fragment of A. fumigatus was amplified from clinical

specimens. These results suggested that this nested PCR method is rapid, simple and

available as a tool for identification of pathogenic Aspergillus to a species level

(Kanbe et al.,2002).

Diagnosis of dermatophytosis employing conventional laboratory procedures has been

complicated by the slow growth and varied morphological features shown by

dermatophytes. After analysis of the nucleotide base sequences of a 1.2-kb fragment

amplified from a dermatophyte fungus Trichophyton rubrum by arbitrarily primed

PCR with random primer OPD18, a pair of primers (TR1F and TR1R) was designed

and evaluated for specific identification of T. rubrum. The sensitivity of the primers

TR1F and TR1R was high, as a specific PCR band of 600 bp was detected from as

little as 7pg of T. rubrum DNA (Liu et al.,2002)

Dermatomycoses are very common infections caused mainly by dermatophytes.

Scytalidiosis is a differential mycological diagnosis, especially in tropical and

subtropical areas. Since a culture-based diagnosis takes 2 to 3 weeks, they set up a

PCR-restriction fragment length polymorphism (RFLP) method for rapid

discrimination of these fungi in clinical samples. The hypervariableV4 domain of the

small ribosomal subunit 18S gene was chosen as the target for PCR. The

corresponding sequences from 19 fungal species (9 dermatophytes, 2 Scytalidium

species, 6 other filamentous fungi, and 2yeasts) were obtained from databases or

were determined in the laboratory. Sequences were aligned to design primers for

dermatophyte specific PCR and to identify digestion sites for RFLP analysis. The

reliability of PCR-RFLP for the diagnosis of dermatomycosis was assessed on fungal

cultures and on specimens from patients with suspected dermatomycosis. Two sets of

primers preferentiallyamplified fungal DNA from dermatophytes (DH1L and

DH1R)or from Scytalidium spp. (DH2L and DH1R) relative to DNA from bacteria,

26

yeasts, some other filamentous fungi, and humans. Digestion of PCR products

withEaeIorBamHI discriminated between dermatophytes and Scytalidiumspecies, as

shownwithcultures of 31 different fungal species.Whenclinical samples weretested

byPCR-RFLP, blindly to mycological findings, the results of the two methods agreed

for 74 of 75 samples. Dermatophytes and Scytalidium spp. can thus be readily

discriminated by PCR-RFLP within 24 h. This method can beapplied to clinical

samples and is suited to rapid etiologic diagnosis and treatment selectionfor patients

with dermatomycosis (Dubach et al.,2001)

27

Chapter Three

Materials and Methods

28

Chapter 3

Materials and Methods

3.1 Materials

3.1.1 Instrument

Table 3.1 list of equipment used in this study.

Equipment Manufacture/country light microscope Zeiss/Germany

electrophoresis apparatus Thermo-electron corporation Ec 105

Vacuum (suction unit) Su-770(association with cannic.lnc) Taiwan

Vortex microspin BioSan/England

micro centrifuge (rpm 14000) Sigma/USA

Digital camera Sony (4*200m)cyber-shot/Japan

A thermal cycler HYBAID, Omnigene/ England b a l a n c e 4 d i g i t F e w – m o d e l : f e j - 2 0 0

UV Transilluminator (Dinco & Reunium Industries Ltd.) /USA

electrophoresis chamber (Owl Scientific Plastics, Inc.)/. USA

Dna/rna – uv – cleaner Uvc/t - BioSan/England

3.1.2 PCR primers

Table 3.2 list of PCR primers used in this study.

Primer name Sequence nucleotides [nt]

CHS1 1S F 5'-CAT CGA GTA CAT GTG CTC GC-3' 70 to 89

CHS1 1R R 5'-CTC GAG GTC AAA AGC ACG CC-3' 485 to 504

CHS1JF2 F 5'-GCA AAG AAG CCT GGA AGA AG-3' 111 to 130

CHS1JR2 R 5'-GGA GAC CAT CTG TGA GAG TTG-3' 378 to 398

3.1.3 Chemical Table 3.3 list of chemical used in this study.

Chemicals potassium hydroxide (KOH ). 0.1% Triton X-100

proteinase K solution

GoTaq Green Master Mix, 2X ( Promega,

USA). phenol-chloroform

Tris-EDTA buffer dimethyl sulfoxide. Ca HCo3 HCL

precipitation solution Isopropanol 75% ethanol TE-buffer

agarose ethiudium bromide

29

3.2 Methods

3.2.1 Study Area

The study was performed at Al-Remal Clinics at Ministry of Health (MOH) and

Gene Medical Labs in Gaza Strip.

3.2.2 Samples

A total of 99 sample from patients clinically suspected with dermatophytosis were

included in the study irrespective of their age or gender.

3.2.3 Specimens Collection

For skin dermatophytoses the clinical specimens collected were epidermal scales. The

scales were scrapped from near the advancing edges of the lesions after disinfecting

the lesions with 70% alcohol. When the advancing edges were not evident, scrapings

were collected from areas representing the whole infected area.

For hair sample dermatophytoses basal root portion of hair were collected by

plucking the hair with sterile forceps. In cases with black dot, scalpel was used to

scrape the scales and excavate small portions of the hair roots.

For nail the first step of the sample collection process is thorough cleansing of the nail

area with alcohol to remove contaminants such as bacteria. Because the sites of

invasion and localization of the infection differ in the different types of nychomycosis

. Nail clippings and nail scrapings of the affected part of the nail .

3.2.4 Specimens Division. According to the modified procedures of (Garg et al., 2009) the collected specimens

were divided into two portions. The first portion of the specimens was examined

microscopically using 20% potassium hydroxide (KOH).The second portion was used

for DNA extraction we put in eppendorf tube

3.2.5 Specimens Identification

3.2.5.1 Direct microscopy by KOH

This method aids visualizing hyphae and confirmation of the diagnosis of

dermatophyte infection. The scale from the active border of a lesion was obtained,

03

and several loose hairs from the affected area were pulled out, in the case of nails, sub

ungual debris was obtained. A moist cotton swab was rubbed vigorously over the

active border of a lesion works as well as a scalpel blade and is safer. The scale, hair,

or debris were transferred to a glass slide, and a few drops of 20% KOH were added.

For nail material or hair the slide was gently warmed. The wetmount preparation was

then examined under a microscope (X400) with back and forth rotation of the focus

knobs. This technique aided the visualization of hyphae (branching, rod-shaped

filaments of uniform width with lines of separation [septa]). In tinea capitis, the

hairshaft may be uniformly coated with minute dermatophyte spores (Barry and

Hainer study, 2003).

3.2.5.2 Molecular Techniques

3.2.5.2.1 DNA Extraction

The crushed specimen were cut and put in eppendorf tube and 200 μl buffer (0.02g

Ca HCo3-30 μl HCL - add water to 10 ml) were Added.The following steps were

followed.

1. Add 5 μl of (proteinase K)

2. Incubation for 2-3 hours at 65C

3. Then using MasterPure TM

Genomic DNA Purification Kit for Blood

(Epicentre Technologies Co., USA) according to the following procedure:

a. Add 250 μl precipitation solution (5M Sodium perchlorate (dissolve

70 g of sodium perchlorate in 80 ml d.w make up 100 ml)

b. Mix by vortex for at least 30 sec, then centrifugation at 14,000 Xg

for 7 min.

c. The supernatant was poured into a new eppendorf tube, and 700 μl of

isopropanol were added. The tube was inverted gently 30-40 times to

visualize the DNA strings.

d. The DNA was precipitated by centrifugation at 14,000 Xg for 10 min.

4. DNA was washed twice with 75% ethanol, by adding 200 μl of 70%

ethanol followed by centrifugation at 14,000 Xg for 3 min.

06

5. DNA pellet was air dried, resuspended in 100 μl of TE (10 mM Tris-

HCl [pH 8.0], 1 mM EDTA) buffer, and then incubated overnight at

room temperature (or incubation for 10 min at 37°C).

6. Finally, the DNA was mixed, quantified using agarose gell

electrophoresis for semi quality and DNA quality evaluation .

3.2.5.2.2. Polymerase Chain Reaction (PCR)

The polymerase chain reaction(PCR) is an in vitro technique which allows the

amplification of a specific DNA fragment that lies between two regions of known

DNA sequence (Newton and Graham, 1997). The amplification of DNA is achieved

by using a short single stranded DNA molecules which are complementary to the ends

of a defined sequence of the DNA template (known as primers), that hybridize to

opposite strands and flank the target DNA sequence that is to be amplified. Under

suitable reaction conditions and in the presence of deoxynucleoside triphosphate

(dNTPs), a DNA polymerase extends the primers annealed to a single stranded DNA

template. As a result, a new DNA strands complementary to the template strands are

synthesized (Newton and Graham, 1997; Bartlett and Stirling, 2003). Repetitive

cycles involving template denaturation, primer annealing, and extension of the

annealed primers by Taq DNA polymerase results in exponential accumulation of a

specific DNA fragments. In other words, the number of target DNA copies

approximately doubles every cycle, since the primer extension products synthesized

in a given cycle can serve as a template in the next cycle (Watson et al., 1992).

3.2.5.2.3 First PCR

The sequence of primers used for specific amplification .

PCR was performed using primer pairs CHS1 1S (5'-CAT CGA GTA CAT GTG

CTC GC-3'; nucleotides [nt] 70 to 89) and CHS1 1R (5'-CTC GAG GTC AAA AGC

ACG CC-3'; nt 485 to 504). These primers amplify a 435-bp DNA fragment of the

dermatophyte-specific CHS1 gene sequence of Arthroderma benhaemiae, a

teleomorph of Trichophyton mentagrophytes (DDBJ accession no. AB003558) (Garg

et al., 2009).

02

3.2.5.2.4 Nested PCR

Nested PCR was performed by designing a novel set of primers, JF2 (5'-GCA AAG

AAG CCT GGA AGA AG-3'; nt 111 to 130) and JR2 (5'-GGA GAC CAT CTG TGA

GAG TTG-3'; nt 378 to 398), amplifying a DNA fragment of 288 bp from the internal

sequence of the amplicon obtained from first-round PCR ( Garg et al., 2009).

PCR Mixture First

The PCR mixture (25 μl) for first-round PCR contained 12.5 μ l of green mix 1 μl

each of primers 0.1MG/ML CHS1 1S and CHS1 1R (Operon, Cologne, Germany),

and 3 μ l of DNA template. Deionised water was added subsequently to achieve the

final volume(Table 3.4). The reaction mixture was initially denatured at 94°C for 30

s, followed by 31 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s,

and extension at 72°C for 60 s. This was followed by a final extension step for 5 min

at 72°C in a thermal cycler(Table 3.5 ) (HYBAID, Omnigene). The PCR mixture for

nested PCR consisted of 1 μl primers JF2 and JR2 and 2 μ l diluted product of the

primary cycle as the DNA template; the rest of the constituents were the same as

those described in (Table 3.6). The running conditions of nested PCR were similar to

the first-round PCR except that 35 cycles were used(Table 3.7). double-distilled

water and DNA of positive controls were used as the negative and positive controls,

respectively.

Table 3.4 For first PCR reaction mixture for 25 μ l, the amounts given are per reaction

Reagents Volume ( μl) Go tag polymerase (ready mix) 12.5 μ l Primer forward 1 μl Primer Reverse 1 μl DNA 3 μ l Water 7.5 μ l Total mix 25 μ l We take DNA Template 2 μ l

00

Table 3.5 Temperature cycling program for FPCR

PCR Machine Cycling Parameters

For first PCR Rounds

initially

denatured 94ºC/30 sec.

31 cycles:

94ºC/30sec.

60ºC/30 sec.

72ºC/ 60 sec.

extension step 72ºC/ 5 min

Hold: 4ºC

Table 3.6 Nested PCR Master Mix for 25 μ l reactions, the amounts given are per reaction

Reagents Volume ( μl)

Go tag polymerase (ready mix) 12.5 μ l

Primer forward 1 μl

Primer Reverse 1 μl

DNA Template 2 μ l

water 6.5 μ l

Total mix 25 μ l

Table 3.7 Temperature cycling program for NPCR

PCR Machine Cycling Parameters

For nested PCR Rounds

initially

denatured 94ºC/30 sec.

35 cycles:

94ºC/30sec.

60ºC/30 sec.

72ºC/ 60 sec.

extension step 72ºC/ 5 min

Hold: 4ºC

04

3.2.5.2.5 Agarose Gel Electrophoresis

The amplified PCR product were resolved by electrophoresis on a 2% agarose gel and

stained with ethidium bromide for analysis. The agarose gel (Life Technologies,

Scotland) was prepared in 1X Tris-Acetate EDTA (TAE) buffer (40 mM Tris base, 40

mM acetic acid, 1mM EDTA), then stained with ethidium bromide (final

concentration is 0.5 μg/μl). The gel casting tray containing the gel is placed into the

electrophoresis chamber (Owl Scientific Plastics, Inc.). Stained PCR products and

DNA molecular weight marker were loaded into the agarose gel. Then the gel was run

at 80 volt (constant voltage) for 45-75 min, according to the gel size used. After that,

the ethiudium bromide-stained DNA was detected by ultraviolet radiation using UV

Transilluminator (Dinco & Rheunium Industries Ltd.) amplicon of 288 bp was taken

as positive for dermatophytes. (Fig. 2) and photographed by digital Camera for

documentation.

3.2.5.2.6 DNA Sequencing To be more confirmed, we conducted DNA sequencing in Makassed Islamic

Charitable Hospital.

Direct DNA sequencing for PCR products that contain the known mutations and

polymorphisms in –( AB003558) JF2 (5'-GCA AAG AAG CCT GGA AGA AG-3'; nt

111 to 130) and JR2 (5'-GGA GAC CAT CTG TGA GAG TTG-3'; nt 378 to 398),

amplifying a DNA fragment of 288 bp from the internal sequence of the amplicon

obtained from first-round PCR

The amplification was performed in 100 µl reaction containing 400 ng of genomic

DNA, 0.4 µg of each primer, and 50 µl of GoTaq Green Master Mix, 2X ( Promega,

USA).

Cycling parameters included an initial denaturation step of 4 min at 94C, followed

by 35 cycles of 94C for 30 sec, 61C for 30 sec, 72C for 30 sec, with a final

extension step of 10 min at 72C.

The amplified products were separated on 2% agarose gel and purified using GFX™

PCR DNA and Gel Band Purification Kit (Amersham Pharmacia Biotech) according

to the following procedure:

Purification of DNA from gel band:

05

An empty 1.5 ml eppendorf tube was weighed to the nearest

10mg.

The slice of agarose containing the DNA band was excised

using a sterile razor blade and transferred to the last preweighed tube.

The weight of the slice was determined by weighing the tube

containing the agarose slice and subtracting the weight of the empty

tube.

Proteins were denatured and agarose was dissolved by adding

10 µl of capture buffer for each 10 mg of gel slice, mixing vigorously,

and incubating the tubes at 60 ºC for 15 min.

During the incubation, one GFX column is placed in a

collection tube for each sample to be purified.

After the agarose was completely dissolved, the sample was

centrifuged briefly (to collect at the bottom of the tube), transferred to

the GFX column and incubated at room temperature for 1 min (so as to

capture the DNA to the glass fiber matrix).

The column with its collection tube was then centrifuged at

15,000 Xg for 30 sec and the flow-through was discarded.

Matrix-bound DNA was washed by adding 500 µl of wash

buffer to the column followed by centrifugation at 15,000Xg for 30

sec.

The collection tube was discarded, and the GFX column was

transferred to a new 1.5 ml eppendorf tube.

The purified DNA is eluted from the GFX column by applying

35 µl of autoclaved double-distilled water to the top of the glass fiber

matrix in the GFX column, incubating at room temperature for 1 min,

and centrifugation at 15,000 Xg for 1 min.

Following the purification, DNA segments were separated

using 3130 Genetic Analyzer. Then the sequence of each sample was

compared to the wild-type gene obtained from the NCBI gene bank

accession number GI: AB 003558).

06

3.2.6 Questionnaire

For each sample, the questionnaire was filled by technician . The questionnaire

sample is given in the appendix. The questionnaire was prepared to find out any

relation between the dermatophytes and age, sex,work, domestic animals in the

house.

3.2.7 Data Analysis

The data were analyzed statistically by SPSS analysis (version 13). The results

presented through histograms, tables,. Relative absolute error and exclusion and

inclusion errors.

07

Chapter Four

Results

08

Chapter 4

Results

4.1 Potassium hydroxide (KOH) microscopy.

This method aids visualizing hyphae or spores and confirmation of the diagnosis

of dermatophyte infection. In tinea capitis, the hair shaft may be uniformly coated

with minute dermatophyte spores (Figure 4.1).

Figure 4. 1: Microscopic appearance of positive sample (spores) from hair in KOH.

As shown in Figure 4.9 and table 4.1 the positive result in KOH method were 41 out

of 99 sample which considered as 41.4% . These results distributed as 3 from skin out

of 16 , 9 from nails out of 16 and 29 from scalp out of 67 (Table 4.1)

The result also show that the higest percentage of positive result was from the nails

samples .

09

4.2 Molecular Diagnosis

The amplified PCR product were resolved by electrophoresis on a 2% agarose gels

and stained by ethidium bromide for analysis (Figure 4.2).

4.2.1 First PCR

As shown in Figure 4.10 the positive result in FPCR were 2 out of 99 sample

which considered as 2.02%only .

4.2.2 Nested PCR

As shown in Figure 4.11 and Table 4.1 the positive results in NPCR were 18 out

of 99 sample which considered as 18.18% . These results distributed as 1 from skin

out of 16 , 3 from nails out of 16 and 14 from scalp out of 67 (Table 4.1).

The results also show that the highest percentage of positive results was from the

scalp,which constitute 20% of all suspected scalp samples.

Figure 4. 2 : Results of First and Nested PCR

Figure (4.2) Results of first and nested PCR of clinical specimens of

dermatomycosis. Lane 1, 100 bp DNA ladder (Molecular Marker); Lane 2, 4, 6 First

PCR negative cases; lane 3, 7 nested PCR positive cases; Lane 5, nested PCR

negative case; lane 8, 9 first and nested PCR positive control respectively (288 bp);

Lane 10, 11 first and nested PCR. Negative control; lane12 blank .

4.3 Gene Sequencing

Figure (4.4) show the gene sequencing of our PCR gene product.By

comparing our result with the wild-type gene obtained from the NCBI gene bank

accession number GI: AB 003558). we found that 95% homology with the reference

43

> dbj|AB003558.1| Arthroderma benhamiae gene for chitin synthase 1,

partial cds

Length=615

Score = 339 bits (183), Expect = 1e-97

Identities = 206/217 (95%), Gaps = 1/217 (0%)

Strand=Plus/Minus

Query 4

CGCGGCTTGAGGATAACCTGGGTGCCCTTGACCTCCATGCCTATCTGGGTGGTATATTCG 63

||||||||||||||||||||||| |||||||||||||||||||||||||

||||||||||

Sbjct 326 CGCGGCTTGAGGATAACCTGGGT-

CCCTTGACCTCCATGCCTATCTGGGCGGTATATTCG 268

Query 64

TAGATGTGAGCAGTGACGTCTTTACCGTTAACCTGCTGCTTAGCAATGCCATCTTGGTAA 123

|||||||||||||||| ||||| ||||||||||||||| || |||||||| ||

||||||

Sbjct 267

TAGATGTGAGCAGTGATGTCTTGACCGTTAACCTGCTGTTTGGCAATGCCGTCCTGGTAA 208

Query 124

ACACCTAGACCGGCAAGGACAGCTCTTGTACGTGGGTTTATCTTTGCACGACCGTCTGAG 183

||||| |||||||||||||||||||| ||||||||

||||||||||||||||||||||||

Sbjct 207

ACACCAAGACCGGCAAGGACAGCTCTCGTACGTGGATTTATCTTTGCACGACCGTCTGAG 148

Query 184 ACGATACAAACGACAATCTTCTTCCAGGCTTCTTTGC 220

|||||||||||||||||||||||||||||||||||||

Sbjct 147 ACGATACAAACGACAATCTTCTTCCAGGCTTCTTTGC 111

sequencer GI: AB 003558 .This finding confirms PCR product to be indeed the

product of CHS1 gene and confirms the PCR product specificity of the CHS1 gene

Figure (4.3) .

Figure 4. 3: The wild-type gene obtained from the NCBI gene bank accession number

GI: AB 003558)

46

Figure 4.4: The DNA sequencing result of CHS1 out put

4.4 Statistical analysis

Of the 99 clinically suspected cases of dermatophytosis, 41.4% were diagnosed as

positive for fungal elements by KOH microscopy. Dermatophytes were detected in

18.18% of the specimens by nested PCR.

4.4.1 Study population

As shown in Figure (4.5 ) 46.32% of our clinical samples were from males. The

sources of the clinical sample was distributed as 16.16% from each skin and nails and

67.68% from scalp Figure (4.6).

42

- Figure 4. 5: Sample classification of gender

Figure 4. 6: classification of sample type

As inferred from the Questionnaire (Appendix) about the presence of domestic

animals in the houses of the suspected patient ,cats were the highest percentage which

was 70.4%.

The percentage of positive results among the suspected patients holding domestic

animals at their houses was 33.3%while it was 22% for the suspected patients not

holding domestic animals Table( 4.2).

40

Figure 4. 7: The domestic animal kinds in houses

The age distribution of the cases is ranged from 1 year to higher than 35 years.The

highest age distribution was ranged between 1-10 years which constitute 64.52%

(Figure 4.8)

Figure 4. 8: Age group distribution.

__

44

0

10

20

30

40

50

60

positive KOHnegative KOH

41

58

Figure 4. 9: The results of KOH classification

Figure 4. 10 result of FPCR classification

0

20

40

60

80

100

positive NPCRnegative NPCR

18

81

Figure 4. 11: The result of NPCR classification

0

20

40

60

80

100

positive FPCRnegative FPCR

2

97

Figure 4. 10 result of FPCR classification

45

0102030405060708090

100

positive KOH

negative KOH

positive FPCR

negative FPCR

positive NPCR

negative NPCR

Figure 4. 12: The results of KOH,FPCR,NPCR classification

4.4.2 Relative absolute error

The following table shows a tabulating of the sample according to the sample type

and the Lab methods with the (relative absolute error).

Table 4.1 Sample type and lab methods KOH & NPCR .

%

Error

Total Nested pcr Result Koh Result Sample Type

Negative Positive Negative Positive

12.50 16 15 1 13 3 Skin

37.50 16 13 3 7 9 Nail

22.39 67 53 14 38 29 Scalp

23.23 99 81 18 58 41 Total

The following table shows a tabulating of the sample according to holding animals in

the house and the Lab methods with the (relative absolute error).

Table 4.2 Holding animals in the house relative to KOH & NPCR.

Total Nested PCR Result KOH Result holding animals

Negative Positive Negative Positive

27 22 5 13 14 Yes

63 53 10 39 24 NO

90 75 15 52 38 Total

46

4.4.3 Lab diagnosis exclusion and inclusion errors

Inclusion and Exclusion errors refer to discrepancies between the diagnosis by NPCR

method and the diagnosis by KOH method. Exclusion error represents the percentage

of negative samples by KOH method that is positive according to NPCR method.

Inclusion error represent the percentage of negative samples by NPCR method which

is positive in KOH method.

Table 4.3 Lab diagnosis exclusion and inclusion errors.

Nested PCR Result vs. KOH Result

KOH Result Total

positive negative

Nested

pcr

Result

positive 12 6 18

negative 29 52 81

Total 41 58 99

Exclusion error = 6/99 = 6.06%

Inclusion error = 29/99 =29.29%

47

Chapter Five

Discussion

48

Chapter 5

Discussion

Dermatophytes are among the few fungi causing communicable diseases; previously

most dermatophyte strains had relatively restricted geographical distribution.

However recently, dermatophytosis has become one of the most common human

infectious diseases in the world and is cosmopolitan in distribution. Dermatophytosis

cannot be easily diagnosed on the basis of clinical manifestations as a number of other

conditions mimic the clinical presentation.The differential diagnosis of

dermatophytoses includes seborrhoeic dermatitis, atopic dermatitis, contact dermatitis,

psoriasis, candidal intertrigo, erythrasma, eczema etc (Barry and Hainer, 2003).

Further it is more difficult to diagnose dermatophytosis in immunocompromised

patients, as clinical presentation is often atypical (Odom,1994).

It is essential that good laboratory methods are available for rapid and precise

identification of the dermatophytes involved, in order to apply appropriate treatment

and prevention measures. The conventional methods of fungal detection have their

own drawbacks; for e.g. KOH microscopy has low specificity and fungal culture is

associated with low sensitivity and takes long time. Further dermatophyte isolates

from patients on antifungal treatment generally do not show characteristic

morphology on culture, thus further compromising the results of culture isolation (liu

et al., 1997). The changing profiles of human dermatophytoses among countries have

further necessitated the development of improved diagnostic methods for

identification of dermatophytes (liu et al., 1997). Thus newer fungal diagnostic meth-

ods are need of the hour as identification of the etiological agent is required not only

for accurate diagnosis, but also for post-therapeutic strategies (Shiraki et al., 2004).

The treatment of dermatophytoses would be most appropriate when the selection of

antimicrobial agent is based on the identity of the causative agent. For e.g.

griseofulvin is effective only for dermatophytic infections, with no activity against

Candida spp. and nondermophytic molds. Terbinafine shows fungicidal activity

against dermatophytes with a cure rate of 80 to 95% but shows only fungistatic

activity against Candida albicans. For nondermatophytic molds infections, the role of

49

terbinafine is not well defined and topical amorolfine lacquer may be effective for

select patients (DW et al., 1995).

Recently, molecular biology-based techniques, such as PCR followed by restriction

fragment length polymorphism (RFLP) (Yang et al, 2008), Real time PCR (Arabatzis

et al, 2007) and multiplex PCR assay (Brillowska et al., 2007) have been adapted for

detection of dermatophytes from clinical specimen. These molecular methods have a

good potential to directly detect dermatophytes in clinical specimens; however these

methods are yet to be standardised for routine clinical laboratories. PCR – RFLP is a

complex technique with poor discriminative power to make an easy and specific

diagnosis. Real time PCR – appears to be promising but is not practical enough for a

large number of laboratories that are either small scale or very tightly budgeted.

Very few studies like our study have compared KOH microscopy and culture with

direct PCR of clinical specimens In a case study, Nagao et al.(2012) detected

Trichophyton rubrum by nested PCR targeting internal transcribed spacer gene 1

(ITS1) in a patient with trichophytia profunda acuta, which was negative by both

KOH microscopy and culture (Nagao et al, 2005). This finding is agree with our

results. Yan et al (2007) evaluated arbitrary primed PCR with conventional methods

in 50 tinea corporis and 58 tinea cruris patients and showed that arbitrary primed PCR

is a rapid sensitive and specific detection method for dermatophytes from skin

scrapings. (Yan et al, 2007). Recently Bergman et al,(2008) performed a PCR-reverse

line blot assay on 819 clinical samples (596 nail, 203 skin and 20 hair) and

demonstrated a positive PCR-RLB result in 93.6% of 172 culture-positive and

microscopy-positive samples. (Bergmans et al, 2008). Garg et.al 2007 study strongly

supports our result they involving 152 clinically suspected patients with

onychomycosis it was established that nested PCR might be considered as gold

standard for the diagnosis of onychomycosis, where the etiological agents are

dermatophytes. In Garg et.al 2009 study results also indicate that nested PCR may be

considered as gold standard for the diagnosis of dermatophytosis and can aid the

clinician in initiating prompt and appropriate antifungal therapy. Which also supports

our finding .

In this study, a total of ninety nine patients were clinically suspected with

dermatophytosis including 16 skin specimens 16 nail specimens and 67 hair

53

specimens Table (4.1). For each specimens both of KOH and NPCR test were carried

out.

Having compared the output results of NPCR sequencing with the wild-type gene

which is obtained from the NCBI gene bank Fig. (4.4). The comparison indicates that

the product of NPCR is CHS1 gene according to (NCBI) gene bank Fig.(4.3).

Additionally, it is considered to compare the results of NPCR with KOH for

dermatophytes which gives that 41.4% are positive indication based on KOH and

18.18% is positive indication according to NPCR Fig.(4.12)and Table(4.3). Our

results reflect the accuracy of NPCR method and eliminate the false – positive and

reconsider few of the false-negative as positive samples.

After carrying out the statistical analysis using SPSS for both test results obtained

from NPCR and KOH, it is found that 30% of the total sample have to be included

for treatment based on KOH test, although this percent of the sample doesn‟t need to

undergo treatment according to NPCR test. It is also shown that 6% of the sample are

excluded for treatment in KOH test, in spite the NPCR indicated that this percent shall

be included in the treatment Table(4.3).

Correct diagnosis of dermatophytic onychomycosis and identification of the causal

agent is a major importance as it allows appropriate antifungal treatment to be

promptly instituted. Diagnosis of onychomycosis is currently performed by direct

mycological examination and culture on Sabouraud dextrose agar medium. The

precise identification of the dermatophyte in cause is based on the macroscopic and

microscopic characters of the grown colonies. However, false negative results of

direct examination occur in 5 to 15% of cases, depending on the skill of the observer

and the quality of sampling (Liu et al, 2000, and Robert and Pihet, 2008).

Furthermore, dermatophyte hyphae are very difficult to distinguish from those of non

dermatophytic fungi like molds which often only occur as transient contaminants and

not as the actual etiological agent of the disease (Brillowska et al, 2007, Ebihara et al,

2009, and Robert and Pihet, 2008).

The present study aimed at evaluating a PCR technique based on the amplification of

the CHS1 gene which is one of the most widely used target in the molecular diagnosis

of dermatophytic onyxis in humans (Garg et al, 2007, Hirai et al, 2003, Kano et al,

1998, Neji et al, 2010, and Spiliopoulou et al, 2011).

The prominent controversy between the test results (KOH and NPCR) was found in

the nails diagnosis Table(4.1). This complies with previous studies but differs in the

56

nature of results as the positive results higher in KOH test and it may be related to

one or more of the following reasons :

- Labs equipment shortage .

- No advanced training for workers in the labs .

- Unqualified technicians to carry out perfect tests to discriminate between

pathogenic fungus and normal flora,contament ,bubbles or oil.

- Nails thickness without being treated enough in KOH. .

On the other hand, our results showed that people who get contact with animals(pets)

are most likely to have dermatophytosis more than other people . This finding is in

accordance with most previously reported studies (Emeka, 2011 and Beraldo et al.,

2011).

52

Chapter six

Conclusions & Recommendations

50

Chapter 6

Conclusions & Recommendations

Conclusions

A total of ninety nine patients were clinically suspected with dermatophytosis

including 16 skin specimens 16 nail specimens and 67 hair specimens. For each

specimens both of KOH and NPCR test were carried out.

Having compared the output results of NPCR sequencing with the wild-type gene

which is obtained from the NCBI gene bank. The comparison indicates that the

product of NPCR is CHS1 gene according to (NCBI) gene bank. Additionally, it is

considered to compare the results of NPCR with KOH for dermatophytes which gives

that 41.4% are positive indication based on KOH and 18.18% is positive indication

according to NPCR.

After carrying out the statistical analysis using SPSS for both test results obtained

from NPCR and KOH, it is found that 30% of the total sample has to be included for

treatment based on KOH test, although this percent of the sample doesn‟t need to

undergo treatment according to NPCR test. It is also shown that 6% of the sample are

excluded for treatment in KOH test, in spite the NPCR indicated that this percent shall

be included in the treatment.

The prominent controversy between the test results (KOH and NPCR) was found

particularly in the nails diagnosis.

The study results approved that the NPCR test has to be considered in dermatophytes

test in Gaza medical Laboratories in addition to the KOH test specially in nail test.

Recommendations

1- Sending directives to the Ministry of Health in the Gaza Strip by introducing

screening NPCR part of routine testing for dermatophytes .

2- Conduct training session for lab technicians to develop their skills in the

diagnosis of dermatophytes by KOH test.

3- Community a wareness in taking necessary measures when dealing with

domestic animals.

4- Inviting researchers to take into account the studies on dermatophytes in the

Gaza Strip

54

References

- Achterman RR.,and White TC., (2011) Dermatophyte virulence factors:

identifying and analyzing genes that may contribute to chronic or acute skin

infections. International Research Journal of Microbiology.vol.(2012),pp:1-8.

- Ajello L. (1977) Taxonomy of the dermatophytes: a review of their imperfect

and perfect states, In K. Iwata (ed.), Recent advances in medicaland veterinary

mycology. University of Tokyo Press, Tokyo, pp. 289–297.

- Ajello L. (1974) Natural history of the dermatophytes and related

fungi.Mycopathol. Mycol. Appl. Vol. 53, pp. 93–110.

- Al-Fouzan A., Wanda A. and Kubec K. (1992) Dermatophytosis of children in

Kuwait ;Aprospective survey . Intl.J.Dermatol., vol. 32, pp.798-801.

- Ali-Shtayeh M., Arda H., and Abu-Ghdeib, S., (1997) Epidemiological study of

tinea capitis in school children in the Nablus area (West Bank). Myco., Vol. 41,

pp. 243-248.

- Alteras I., Feuerman, E., David, M., and segal, R., (1986) The increasing role of

Microsporum.canis and the variety of dermatophytic manifestations in Israel.

Mycopath.,vol. 15, pp.105-107.

- Aly R. (1994) Ecology and epidemiology of dermatophyte infections. J. Am.

Acad. Dermatol.,Vol. 31pp. 21–25.

- Anna Brillowska-Dąbrowska, Ditte Marie Saunte, and Maiken Cavling

Arendrup. (2007) Five-Hour Diagnosis of Dermatophyte Nail Infections with

Specific Detection of Trichophyton rubrum. J Clin Microbiol. Vol. 45(4),pp:

1200–1204.

- Arabatzis M., Bruijnesteijn van Coppenraet LE., Kuijper EJ., de Hoog GS.,

Lavrijsen AP., Templeton K., Raaij-Helmer EM van der., Velegraki A., Gräser

Y., Summerbell RC. (2007) Diagnosis of common dermatophyte infections by a

novel multiplex real-time polymerase chain reaction detection/identification

scheme. Br J Dermatol,Vol 157,pp.681-689.

55

- Barry I.and Hainer M. (2003) Dermatophyte Infections. American family

physician, Vol. 67,pp.101-108.

- Beraldo R., Gasparoto A., Martins A., Siqueira D., Dias A. (2011)

Dermatophytes in household cats and dogs Dermatófitos em gatos e cães

domésticos..

- Bergmans AM., Schouls LM., Ent M van der, Klaassen A, Böhm N

Wintermans RG. (2008) Validation of PCR-reverse line blot, a method for rapid

detection and identification of nine dermatophyte species in nail, skin and hair

samples. Clin Microbiol Infect, Vol.14(8),pp.778-88.

- Borelli D. (1965) Microsporum racemosum nova species. Acta. Med. Venez.

Vol.12,pp.148-151.

- Brillowska DA., Saunte DM., Arendrup MC. (2007) Five-Hour Diagnosis of

Dermatophyte Nail Infections with Specific Detection of Trichophyton rubrum.

Journal of Clinical Microbiologyl, Vol 45,pp.1200-1204.

- Chandran NS., Pan JY., Pramono ZA., Tan HH., Seow CS. (2013)

Complementary role of a polymerase chain reaction test in the diagnosis of

onychomycosis. Australas J Dermatol.Vol.54(2),pp:105-108.

- Chandran NS., Pan JY., Pramono ZA., Tan HH.,Seow CS.

(2013)Complementary role of a polymerase chain reaction test in the diagnosis

of onychomycosis. Australas J Dermatol. Vol.54(2),pp.105-108.

- Currah R., (1985) Taxonomy of the Onygenales: Arthrodermataceae,

Gymnoascaceae, Myxotrichaceae, and Onygenaceae. Mycotaxon.,Vol. 24,pp.1-

216.

- De Baere T, Summerbell R, Theelen B, Boekhout T, Vaneechoutte M. (2010)

Evaluation of internal transcribed spacer 2-RFLP analysis for the identification

of dermatophytes. J Med Microbiol,Vol. 59,pp:48-54.

- Dhib I., Fathallah A., Charfeddine IB., Meksi SG., Said MB., Slama F., Zemni

R. (2012) Evaluation of Chitine synthase (CHS1) polymerase chain reaction

assay in diagnosis of dermatophyte onychomycosis. J. Mycol Med

,Vol.22(3),pp.249-255.

56

- DW , Evans EGV., Kibbler CC., Richardson MD., Roberts MM., Rogers ,

Warnock DW., Warren RE. (1995) Fungal nail disease: a guide to good practice

(report of a Working Group of the British Society for Medical Mycology). Br

Med J,Vol. 311,pp.1277-1281.

- Ebihara M., Makimura K., Sato K., Abe S., Tsuboi R. (2009) Molecular

detection of dermatophytes and non dermatophytes in onychomycosis by nested

polymerase chain reaction based on 28s ribosomal RNA gene sequences. Br J

Dermatol, Vol.161,pp. 1038-1044.

- Elewsk B. (2000) tinea capitis :a current perspective. J. Am. Acad. Dermatol.,

Vol.42,pp.1-20.

- Emeka I. Nweze (2011) Dermatophytoses in Domesticated Animals. Rev. Inst.

Med. Trop. Sao Paulo, vol53(2),pp:95-99.

- Eriksson R, Jobs M, Ekstrand C, Ullberg M, Herrmann B, Landegren U, Nilsson

M, Blomberg J. (2009) Multiplex and quantifiable detection of nucleic acid from

pathogenic fungi using padlock probes, generic real time PCR and specific

suspension array readout. J Microbiol Methods,Vol.78(2),pp:195-202.

- Garg J., Tilak R., Singh S., Gulati AK., Garg A., Prakash P. (2007) Evaluation of

Pan Dermatophyte Nested PCR in Diagnosis of Onychomycosis. J Clin

Microbiol ,Vol.45(10)pp.3443-3445.

- GargJ., TilakR., GargA., PrakashP.,Gulati A., and NathG., (2009) - Rapid

detection of dermatophytes from skin and hair. BMC Res. 2,p.60.

- Georg K. (1960) Epidemiology of the dermatophytoses sources of infection,

modes of transmission and epidemicity. Annals of the New York Academy of

Sciences, Vol.89,pp.69-77.

- Griffiths LJ, Anyim M, Doffman SR, Wilks M, Millar MR, Agrawal SG. (2006)

Comparison of DNA extraction methods for Aspergillus fumigatus using real-

time PCR. J Med Microbiol,Vol. 55( 9,),pp:1187-1191.

- Gupta A. and Cooper E. (2008) Update in Antifungal Therapy of

Dermatophytosis. Mycopathologia,Vol. 166, pp. 353–367.

57

- Hirai A., Kano R., Nakamura Y., Watanabe S., Hasgawa A. (2003) Molecular

taxonomy of dermatophytes and related fungi by chitin synthase 1 (CHS1) gene

sequences. Antonie van Leeuwenhoek ,Vol.83,pp.11-20.

- Kanbe T, Yamaki K, Kikuchi A. (2002) Identification of the pathogenic

Aspergillus species by nested PCR using a mixture of specific primers to DNA

topoisomerase II gene. Microbiol Immunol. Vol.46(12),pp:841-848.

- Kano R., Nakamura Y., Watanabe S., Takahashi H., Tsujimto H., Hasegawa

A.(1998) Molecular analysis of chitin synthase 1 (CHS1) gene sequences of

Trichophyton mentagrophytes complex and T. rubrum. Curr Microbiol

,Vol.37,pp.236-239.

- Kawai M. (2003) Diagnosis of dermatophytoses: conventional methods and

recent molecular biological methods. Nihon Ishinkin Gakkai Zasshi.,Vol.

44(4),pp:261-264.

- Kim DM., Chung SH., Chun HS. (2011) Multiplex PCR assay for the detection

of aflatoxigenic and non-aflatoxigenic fungi in meju, a Korean fermented

soybean food starter. Food Microbiol,Vol.28(7),pp:1402-1408.

- Knosravi R., Aghamirian R., and Mahmoudi M. (1994) Dermatophytoses in

Iran. Mycoses,Vol.37,pp: 43-48.

- Kong F, Tong Z, Chen X, Sorrell T, Wang B, Wu Q, Ellis D, Chen S. (2008)

Rapid identification and differentiation of Trichophyton species, based on

sequence polymorphisms of the ribosomal internal transcribed spacer regions, by

rolling-circle amplification. J Clin Microbiol.,Vol.46(4),pp:1192-1199

- Liu D., Pearce L., L i l l e y g ., Coloe S., B a i r d R ., and Pedersen J. (2002)

PCR identifcation of dermatophyte fungi Trichophyton rubrum, T. soudanense

and T. gourvilii. J. Med. Microbiol, Vol. 51,pp. 117-122.

- Liu D, Coloe S, Baird R, Pederson J. (1997) Molecular determination of

dermatophyte fungi using the arbitrarily primed polymerase chain reaction. Br

Dermatol ,Vol.137,pp:351-355.

- Liu D., Coloe S., Baird R., Pederson J. (2000) Application of PCR to the

identification of dermatophyte fungi. J Med Microbiol ,Vol.49,pp. 493-497.

58

- Machouart-Dubach M, Lacroix C, de Chauvin MF, Le Gall I, Giudicelli C,

Lorenzo F, Derouin F. (2001) Rapid discrimination among dermatophytes,

Scytalidium spp., and other fungi with a PCR-restriction fragment length

polymorphism ribotyping method . J Clin Microbiol,Vol.39(2),pp:685-690.

- Monod M., Bontems O., Zaugg C., Léchenne B., Fratti M. and Panizzon R.

(2006) Fast and reliable PCR/sequencing/RFLP assay for identification of fungi

in onychomycoses. J Med Microbiol , vol. 55 ( 9),pp: 1211-1216.

- Moriello k. (2004) Treatment of dermatophytosis in dogs and cats. Veterinary

Dermatology,Vol.15,pp.99-107.

- Mukesh Sharma, Meenakshi Sharma and Vijay Mohan Rao. (2011) In vitro

biodegradation of keratin by dermatophytes and some soil keratinophiles.

African Journal of Biochemistry Research Vol. 5(1), pp: 1-6.

- Nagao K., Takashi S., Takashi O. (2012) Identification of Trichophyton rubrum

by nested PCR analysis from paraffin embedded. (Microbilogy, 2012)N.

- Nagao, K., S. Takashi, O. Takashi, and N. Takeji. (2005) Identification of

Trichophyton rubrum by nested PCR analysis from paraffin embedded specimen

in trichophyton profunda acuta of the glabrous skin. Jpn. J. Med.Mycol,Vol.

46,pp:129–132.

- Neji S., Makni F., Sellami H., Cheihrouhou F., Sellami A., Ayadi A. (2010)

Molecular identification of dermatophytes isolated in Sfax- Tunisia. J Mycol

Med ,Vol.20,pp.85-90.

- Odom RB. (1994) Common superficial fungal infections in immunosuppressed

patients. J Am Acad Dermatol,Vol. 31,pp.56-59.

- Ohst T, de Hoog S, Presber W, Stavrakieva V, Gräser Y. (2004) Origins of

microsatellite diversity in the Trichophyton rubrum-T. violaceum clade

(Dermatophytes). J Clin Microbiol.,Vol.42(10),pp:4444-4448.

- PCR station http://www.pcrstation.com/nested-pcr/accessed at 9/6/2011

- Robert R., Pihet M. (2008) Conventional methods for the diagnosis of

dermatophytosis. Mycopathologia ,Vol.166,pp.295-306.

59

- Roque D., Vieira R., Rato S., and Luz-Martins M. (2006) Specific Primers for

Rapid Detection of Microsporum audouinii by PCR in Clinical Samples. J. Clin.

Microbiolvol.44 ( 12),pp: 4336-4341.

- Sharma A., Chandra S., Sharma M. (2010) Prevalence of keratinophilic

fungi in semi−arid region with particular reference to soil pH. Asian J Exp

Sci, Vol. 24, pp: 59−63.

- Shin JH., Sung JH., Park SJ., Kim JA., Phd MD., Lee JH. (2003) Species

identification and strain differentiation of dermatophyte fungi using polymerase

chain reaction amplification and restriction enzyme analysis. J Am Acad

Dermatol ,Vol48,pp.553–561.

- Shinkafi A., and Manga B., (2011) Isolation of Dermatophytes and Screening of

selected Medicinal Plants used in the treatment of Dermatophytoses.

International Research Journal of Microbiology, Vol. 2(1) pp:. 040-048.

- Shiraki Y., Soda N., Hirose N., Hiruma M. (2004) Screening Examination and

Management of Dermatophytosis by Trichophyton tonsurans in the Judo Club of

a University. Nippon Ishinkin Gakkai Zasshi,Vol 45(1),pp.7-12

- Simpanya M. (2000) Dermayophytes: Their taxonomy, ecology and

pathogenicity. Revista Iberoamericana de Micologya, pp: 1-12.

- Spiliopoulou A., Bartzavali C., Anastassiou ED., Christofidou M.(2011)

Detection of Trichophyton rubrum by multiplex PCR and all other

dermatophytes from nails. Eur Soc Clin Microbiol Infect Dis. Italy . Vol.

46(2),pp.129-132.

- Stukenbrock EH, Rosendahl S. (2005) Development and amplification of

multiple co-dominant genetic markers from single spores of arbuscular

mycorrhizal fungi by nested multiplex PCR. Fungal Genet

Biol.,Vol.42(1),pp:73-80.

- Taleb M. (2010) Microbiological studies in tintea capitis, and its treatment by

species oils in Gaza strip. Unpublished.

- The center for food security and public health

:http://www.cfsph.iastate.eduaccessed at 25/4/2011.

63

- Turin L., Riva F., Galbiati G., Cainelli T. (2000) simple and highly sensitive

double-rounded polymerase chain reaction assay to detect medically relevant

fungi in dermatological specimens. Eur J Clin Invest ,Vol.30,pp.511-518.

- Uchida T, Makimura K, Ishihara K, Goto H, Tajiri Y, Okuma M, Fujisaki R,

Uchida K, Abe S, Iijima M. (2009) Comparative study of direct polymerase

chain reaction, microscopic examination and culture-based morphological

methods for detection and identification of dermatophytes in nail and skin

samples. J Dermatol,Vol.36(4),pp:202-208.

- Urano S., Shirai S., Suzuki Y., Sugaya K., Takigawa M., Mochizuki T.(2003)

A case of Tinea capitis caused by Trichophyton tonsurans. Jpn J Med Mycol

,Vol. 44,pp.25-29.

- Venugopal P., and venugopal T., (1993) Tinea capitis in Saudi Arabia. Int.J.

Dermatol.,Vol.32,pp. 39-40.

- Verrier J, Pronina M, et al. (2012). Identification of infectious agents in

onychomycoses by PCR-terminal restriction fragment length polymorphism. J.

Clin. Microbiol.,Vol.50(3),pp:553-561.

- Weitzman I., McGinnis A., PadhyeA., and AjelloL., (1986) The genus

Arthroderma and its later synonym Nannizzia. Mycotaxon.,Vol. 25,pp.505-518.

- Weitzman I., and Summerbell R., (1995) The dermatophytes.Clin. Microbiol.

Rev,Vol. 8,pp.240–259.

- Winter I, Uhrlaß S, Krüger C, Herrmann J, Bezold G, Winter A, Barth S, Simon

JC, Gräser Y, Nenoff P. (2013) Molecular biological detection of dermatophytes

in clinical samples when onychomycosis or tinea pedis is suspected. A

prospective study comparing conventional dermatomycological diagnostics and

polymerase chain reaction. Hautarzt, Vol. 64(4),pp:283-289.

- Winter I., Uhrla S., Krüger C., Herrmann J., Bezold G., Winter A., Barth S.,

Simon JC., Gräser Y., Nenoff P. (2013) Molecular biological detection of

dermatophytes in clinical samples when onychomycosis or tinea pedis is

suspected: A prospective study comparing conventional dermatomycological

diagnostics and polymerase chain reaction . Hautarzt.,Vol.64(4),pp.283-289.

66

- Yan D., Li L., Chen DY., Zhang YH., Hu CH., Deng ZH. (2007) Detection of

fungi in liquor workers with tinea corporis and tinea cruris using arbitrarily

primed polymerase chain reaction. Zhonghua Lao Dong Wei Sheng Zhi Ye Bing

Za Zhi,Vol 25(3),pp.133-135.

- Yang G., Zhang M., Li W., An L. (2008) Direct Species Identification of

Common Pathogenic Dermatophyte Fungi in Clinical Specimens by Semi-nested

PCR and Restriction Fragment Length Polymorphism.Mycopathologia,Vol

166(4),pp.203-208.

- Zaki S., Ibrahim N., Aoyama K., Shetaia y., Abdel-Ghany, A. and Mikami Y.

(2008) Dermatophyte infections in Cairo, Egypt, Science and Business Media B.

Mycopath.,Vol.167,pp.133-139.

62

Appendix

استبيان خاص بالبحث

رقـى انؼيــح: انراريـخ:

انؼـــــز: انجس: االســى:

رقى انجىال/ انهاذف: انؼـىا:

أخزي ػم يشرزك روضح يذرسح يكا انؼم أو انذراسح:

ال ؼى هم يىجذ حيىااخ في يكا انسك؟

أخزي أغاو حيز كالب تقز دواج قطط أىاػها:

ال عى هم يىجذ أيزاض يزيح؟

ال عى هم يزضد خالل األشهز األخيزج؟

ال عى هم ذأخذ كىرذيزول؟

ال عى هم ذأخذ يضاداخ حيىيح؟

انؼانج:ذشخيص انطثية

انريجح:

KOH:

First PCR:

Nested PCR:

يالحظاخ:

انرىقيغ: