Identifying the role of RGMc in an animal model of Multiple Sclerosis

By

Robin J. Vigouroux

A thesis submitted in conformity with the requirements for the degree of Master of Science

Department of Physiology

University of Toronto

© Copyright by Robin J. Vigouroux 2015

ii

The liver protein Hemojuvelin plays a critical role in an animal model of Multiple Sclerosis

Robin J. Vigouroux Master of Science

Department of Physiology University of Toronto

2015

Abstract The Repulsive Guidance Molecule a (RGMa) has recently been implicated in the development of Multiple sclerosis (MS). We report for the first time that the third

member of the RGM family, RGMc, is downregulated in the sera of mice induced with

Experimental Autoimmune Encephalomyelitis (EAE), a well-characterized animal model

of MS. Treatment with soluble RGMc (sRGMc) significantly delayed the onset of EAE

and reduced the clinical severity of disease. Furthermore, RGMc knockout animals

developed a stronger disease progression than wild-type controls. In vitro binding studies

outlined a mechanism by which soluble RGMa and RGMc competed for interaction with

their shared receptor, Neogenin. Finally, we demonstrated that administration of soluble

RGMc halted leukocyte infiltration by interfering with the RGMa-mediated RhoA

permeabilisation of the Blood-Brain Barrier (BBB). Overall, we show that RGMc

treatment alleviated the clinical severity of EAE by enhancing BBB integrity and

preventing leukocyte infiltration.

iii

Acknowledgments First and foremost, I would like to thank my supervisor Dr. Monnier, your knowledge, ambition, and passion for research is truly inspiring. Thank you for giving me the opportunity to carry out this exciting research project in your laboratory and for your advice throughout my graduate studies. Thank you to my

committee: Dr. Jeffrey Henderson, Dr. Lyanne Schlichter, and Dr. Joan Wither for your

time and advice in making this project a smooth as possible. In addition I would like to

thank my examination committee members: Dr. James Eubanks, Dr. Valerie Wallace, Dr.

Joan Wither and Dr. Lu-Yang Wang for their invaluable feedback and time.

I would next like to thank two special individuals: Dr. Nardos Tassew and Yuriy

Baglaenko. Nardos, thank you for your support and guidance since my first day in the

laboratory, which has helped shape not only my approach towards research but also my

approach towards life. Yuriy, thank you for the uncountable hours you have spent with

me on this project and most importantly for being you. I will undoubtedly miss our “early

mornings/late nights” on this project. I admire your perception to science, which has

unquestionably affected how I perceive it.

This manuscript would not have been completed without the help of both Yuriy

and Nardos but also the incredible comments provided by both Eric Gracey and Vasilis

Moisiadis, who took time out their extremely busy schedule to give me feedback and

advice. Thank you to Sherry Yang, you were by far the greatest summer student I have

had the pleasure of working with. Thank you to my laboratory colleagues, my days would

seem much longer and darker without you.

Lastly, I would like to thank my parents, Pascal and Véronique. You have always

given me the opportunity to expand my horizons and provided me with the support I

needed. My brother, Thomas, my role model, thank you for reminding me to follow my

passion. My partner, Marla Charlette, words cannot describe the help you have brought to

me during my graduate studies. Although I am sure many more memories are to come.

This project was supported by the CIHR Biotherapeutic Training Program.

iv

Table of Contents Abstract .................................................................................................................................................. ii Acknowledgments ............................................................................................................................ iii List of Figures ...................................................................................................................................... vi List of Tables .................................................................................................................................... viii List of Abbreviations: ....................................................................................................................... ix

Chapter 1: Introduction .......................................................................................................... 1 1.1 Multiple Sclerosis ........................................................................................................................ 2 1.1.1 Epidemiology and Quality of Life ................................................................................................. 2 1.1.2 Pathogenesis of Multiple Sclerosis ............................................................................................... 4 1.1.3 Multiple Sclerosis and the Iron Hypothesis ............................................................................. 5 1.1.4 Pathophysiology of Multiple Sclerosis ....................................................................................... 7 1.1.5 Treatment of Multiple Slerosis ...................................................................................................... 9 1.2 Experimental Autoimmune Encephalomyelitis (EAE), an Animal Model to Study the Pathophysiology of MS ........................................................................................................... 12 1.2.1 The Experimental Autoimmune Encephalomyelitis Model ............................................ 12 1.2.2 The Established Role of T cells in EAE .................................................................................... 13 1.2.3 An Emerging Role for B cells in EAE ........................................................................................ 14 1.3 The Blood Brain Barrier ........................................................................................................ 15 1.3.1 The Anatomical Composition of the Blood-Brain Barrier ............................................... 15 1.3.2 Immune Extravasation Through The Blood-Brain Barrier ............................................. 15 1.3.3 The Role of Astrocytes In Maintaining The Blood-Brain Barrier Integrity .............. 16 1.4 Repulsive Guidance Molecules ............................................................................................ 18 1.4.1 RGMs and Neogenin ........................................................................................................................ 19 1.4.2 RGMs and Bone Morphogenetic Protein signaling ............................................................. 21 1.4.3 RGMa ..................................................................................................................................................... 22 1.4.4 RGMb ..................................................................................................................................................... 23 1.4.5 RGMc ..................................................................................................................................................... 24 1.4.6 Repulsive Guidance Molecules and Multiple Sclerosis ..................................................... 27 1.5 Hypothesis and aims ............................................................................................................... 29

Chapter 2: Materials and Methods ................................................................................... 30 2.1 Construction of Expression Plasmids ................................................................................ 31 2.1.2 Cloning of sRGMc in the Psectag2B Vector ............................................................................ 31 2.2 Expression and Purification of Recombinant Proteins ............................................... 32 2.2.1 Culturing of Cell-lines ..................................................................................................................... 32 2.2.2 Determining Expression of sRGMc ........................................................................................... 33 2.2.3 Establishment of a Soluble RGMc and Soluble RGMa Stable Cell-line ........................ 33 2.2.4 Protein Purification ......................................................................................................................... 33 2.2.5. Protein Concentration Measurements ................................................................................... 34 2.3 Western Blot Analysis ............................................................................................................. 34 2.4 In Vitro Competition Assay .................................................................................................... 36 2.5 Enzyme-Linked Immunosorbant Assay (ELISA) ............................................................ 37 2.6. Animal Subjects ........................................................................................................................ 38 2.6.1. Statement of Ethics ......................................................................................................................... 38 2.6.2. Experimental Autoimmune Encephalomyelitis Mouse Model ..................................... 38 2.6.3 EAE Body Condition Score ........................................................................................................... 40 2.6.4 sRGMa and sRGMc Treatment Administration .................................................................... 41

v

2.7 Flow Cytometry and Cytokine Staining ............................................................................ 41 2.7.1 Cell Preparation ................................................................................................................................ 41 2.7.2. Flow Cytometry and Intracellular Cytokine Staining ....................................................... 41 2.7.3 MOG-Specific Cytokine Expression and Proliferation ....................................................... 43 2.8 Immuno-Histochemistry ........................................................................................................ 44 2.9 Histological Staining ................................................................................................................ 45 2.10 Blood Brain Barrier Permeability Assays ..................................................................... 46 2.10.1. In Vitro BBB Permeability ......................................................................................................... 46 2.10.2 In Vivo BBB Permeability ........................................................................................................... 46 2.11 Microscopy ............................................................................................................................... 47 2.12 Statistical Analysis ................................................................................................................. 47

Chapter 3: Results ................................................................................................................. 48 Aim I: RGMc expression is modulated in the sera of EAE-induced mice ...................... 49 3.1 RGMc is down regulated in the EAE model. ..................................................................... 49 3.2 RGMc over-expression ameliorates clinical severity of EAE-induced mice ........ 51 3.3 RGMc is crucial both pre- and post-symptomatically. ................................................. 53 Aim II: A relationship exists between RGMa and RGMc ..................................................... 55 3.4 sRGMa is up-regulated in our EAE model and is crucial in the development of the disease .......................................................................................................................................... 55 Aim III: RGMc modulates the molecular activation of the adaptive immune system ................................................................................................................................................................ 58 3.5 RGMc treatment does not affect T-cell priming and activation ............................... 58 sRGMc Has No impact on Naïve Immune Cells ............................................................................... 58 sRGMc Treatment Does Not Modulate Activated Immune Cells ............................................. 62 3.6 RGMc affects the infiltration of leukocytes in the CNS ................................................ 65 3.7 sRGMc decreases BBB EC permeability ............................................................................ 68

Chapter 4: Discussion ........................................................................................................... 73 4.1 Soluble RGMa and RGMc are Differentially Regulated in EAE. ................................. 74 4.2 sRGMc and the immune system ........................................................................................... 75 4.2 sRGMc Increases Blood-Brain EC Barrier Stability ...................................................... 76 Axon Guidance Molecules and the Blood-Brain Barrier ............................................................. 76 The Small GTPase Rho and the Blood-Brain Barrier .................................................................... 76 Cross-talk Between the Sonic Hedgehog and Neogenin pathways in Blood-Brain Barrier Permeability .................................................................................................................................. 77 4.3 Working model .......................................................................................................................... 79 4.4 Future Directions ..................................................................................................................... 81 How does RGMa mediate BBB permeabilization? ......................................................................... 81 What is the role of sRGMc on Iron in EAE? ....................................................................................... 81 Does the interplay between sHh and Neogenin play a crucial role in the development of EAE? .................................................................................................................................................................. 82

Chapter 5: Conclusion .......................................................................................................... 83 Chapter 6: Appendix ............................................................................................................. 84 Chapter 7: Bibliography ...................................................................................................... 90

vi

List of Figures Figure 1-1 Representation of clinical progression of MS……………..………………………………3 Figure 1-2 A schematic representing the organizational layers of the neurovascular unit……………………………………………………………...………………………………………...17 Figure 1-3 The structure of RGM proteins…………………………………………………...……………19 Figure 1-4 Neogenin binds RGMa, RGMb and RGMc at various sites…………..………………20 Figure 1-5 BMP signaling can be mediated through a Smad-dependent and a Smad-independent pathway…………………………………….………………………………….……22 Figure 2-1 A representation of the sRGMc pSecTag2B plasmid………………………………....32 Figure 2-1 Generation of the experimental autoimmune encephalomyelitis (EAE) model……………………………………………………………………………………..……………...39 Figure 2-2 Representation of the body condition score (BCS) index………………..….……..40 Figure 3-1 RGMc levels are decreased during the course of EAE………………….……....……50 Figure 3-2 sRGMc decreases clinical severity of EAE-induced mice…………….……….…….52 Figure 3-3 RGMc plays a role both pre- and post-symptomatically…………….……….……..54 Figure 3-4 sRGMa is up-regulated in EAE and is able to compete with sRGMc for binding to Neogenin……………………….…………………………………………………………….……..57 Figure 3-5 sRGMc has no effect on naïve immune cell populations……………………..……..59 Figure 3-6 sRGMc treatment has no effect on naïve antigen-presenting cells.…………....60 Figure 3-7 sRGMc treatment has no effect on the adhesion protperties of naïve T and B cells……………………………………………………………………………………………………….61 Figure 3-8 sRGMc has no effect on activated immune cells……………………………..…………63 Figure 3-9 sRGMc has no effect on antigen-specific immune cells…………..………………….64 Figure 3-10 sRGMc treatment reduces both the number of cellular Infiltrates and the extent of de-myelination of EAE induced mice...........................................................66 Figure 3-11 sRGMc reduces the amount of immune infiltrates in the spinal cord of EAE-induced mice…………………………………..…………………………………...………….67 Figure 3-12 sRGMa induces blood-brain EC barrier permeability……………………………..…69 Figure 3-13 Neogenin expression in endothelial cells in the mouse spinal cord…………...71 Figure 3-14 sRGMc reduces BBB permeability……………………………………………..…………….72

vii

Figure 4-1 Neogenin and the Blood-Brain Barrier………………….………………………..………..80 Figure 6-1 sRGMc treatment does not modulate the cytokine secretion of MOG pulsed splenocytes……………………..……………………………………………………………..………85 Figure 6-2 sRGMc treatment reduces cellular infiltrates in the retinas of EAE-induced animals………………………………………...………………………………………………………..86 Figure 6-3 sRGMc treatment reduces CD3+ infiltrates in the spinal cord of EAE-induced mice………………………………………………………………………………...………………….....87 Figure 6-4 sRGMc treatment reduces B220+ infiltrates in the spinal cord of EAE-induced mice………………………………………………………………………………...…………………….88 Figure 6-5 sRGMc treatment reduces CD11b+ infiltrates in the spinal cord of EAE-induced mice…………………………………………...……………………….…………………….89

viii

List of Tables

Table 1-1 List of novel agents in clinical trials for the treatment of MS as well as current medications approved for the treatment of CIS, RRMS, PPMS, and SPMS………………………………………………………………………...……………………………11

ix

List of Abbreviations: 4Ig 4 Immunoglobulin-like domain

AP

Alkaline Phosphatase

BCS Body Condition Score

BBB

Blood-Brain Barrier

BM Basement Membrane

BMP Bone Morphogenetic Protein

BSA Bovine Serum Albumin

CCL2

Chemokine Ligand 2

CD Cluster of Differentiation

CIS Clinically Isolated Syndrome

CNS Central Nervous System

CSF Cerebrospinal Fluid

C-terminal Carboxy-terminal

DAPI 4′,6-diamidino-2-phenylindole

DCC Deleted in Colorectal Cancer

DMEM Dulbecco's Modified Eagle Medium

DNA Deoxyribonucleic acid

DRAGON Repulsive Guidance molecule B

EAE

Experimental Autoimmune Encephalomyelitis

EC Endothelial Cell

ELISA Enzyme-linked immunosorbent assay

EBV Epstein-Barr Virus

x

ERK Extracellular-Signal-Regulated Kinase

FBS Fetal Bovine Serum

FNIII Fibronectin type III domain

GA Glatiramer Acetate

GPI Glycosylphosphatidylinisotol

GWAS Genome-Wide Association Study

HEK 293 Human Embryonic Kidney type 293�

ICAM Intracellular Adhesion Molecule

IFN-γ Interferon-Gamma

IgG Immunoglobulin

IL

Inter-Leukin

IP Intra-Peritoneal

IV Intra-Venous

LN Lymph Node

JH

Juvenile Hemochromatosis

MBP

Myelin Basic Protein

MHC Major Histocompatibility Complex

MMP Matrix Metalloproteinase

MOG Myelin Oligodendrocyte Glycoprotein

MRI Magnetic Resonance Imaging

MS Multiple Sclerosis

MT-2 Matriptase-2

N-terminal Amine-terminal

OCC Occludin

xi

P38-MAPK p38-Mitogen Associated Protein Kinase

PBS Phosphate Buffered Saline

PBST Phosphate Buffered Saline with Tween or TritonX-100

PCR Polymerase Chain Reaction

PEI Polyethylenimine

PFA Paraformaldehyde

PFN3 Phosphate Buffered Saline / Fetal Bovine Serum / Azide

PI3K Phosphatidylinositol-4,5-Biphosphate 3-Kinase

PPMS Primary Progressive Multiple Sclerosis

PNPP P-Nitrophenol Phosphate

RGM Repulsive Guidance Molecule

RGMa Repulsive Guidance Molecule A

RGMb Repulsive Guidance Molecule B / DRAGON

RGMc Repulsive Guidance Molecule C / Hemojuvelin / HFE2

RGD Arginine, Glycine, Aspartic acid

ROCK Rho Kinase

RRMS Relapse-Remitting Multiple Sclerosis

SDS Sodium Dodecyl Sulfate

SDS-PAGE Sodium Dodecyl Sulfate – Polyacrylamide Gel Electrophoresis

SEM Standard Error of the Mean

siRNA Short-Interfering RNA

xii

SPMS Secondary Progressive Multiple Sclerosis

sRGMa Soluble Repulsive Guidance Molecule A

sRGMc Soluble Repulsive Guidance Molecule C

Th-1 / -17 T helper cell -1 / -17

TJ Tight Junction

T-reg T regulatory cell

WT Wild-type

μg Microgram

μl Microliter

μm Micrometer�

1

Chapter 1: Introduction

Nearly one hundred and fifty years have passed since the initial description of “La

Sclérose en plaques” (Multiple Sclerosis) by Charcot, Carswell, and Cruveilhier, yet the

nature of this disease continues to puzzle scientists and physicians (1). This is

demonstrated by the large investment in Multiple Sclerosis (MS) research; the MS

society of Canada spent over 10 million dollars in 2013 and the National Institute of

Health is projecting a budget of 115 million dollars in 2014 (2).

The etiology of MS has been heavily debated for years. Whilst there is little

argument about the pathology and clinical presentation of MS, the question of cause

remains unanswered. The following section will provide a brief overview of the proposed

pathogenesis of MS as well as current treatments for this disease. As with most poorly

understood diseases, researchers depend upon appropriate animal models to both

elucidate the pathogenesis and establish therapeutic targets for MS. Several animal

models currently exist to study precise mechanisms of MS. We will discuss the

application of the experimental autoimmune encephalomyelitis (EAE) model of MS (a

well characterized model) for investigating the pathophysiology of this disease and the

downstream implications for developing therapeutic interventions.

Nascent evidence suggests that the Repulsive Guidance Molecule a (RGMa) and

its receptor, Neogenin, are key players in multiple cellular events in MS. Later sections of

this manuscript will focus on the origin and current biological understanding of RGMs.

2

1.1 Multiple Sclerosis 1.1.1 Epidemiology and Quality of Life

MS is a chronic immune-mediated disease of the central nervous system (CNS)

with pathological hallmarks of the disease being inflammation, demyelination, neuronal

loss and gliosis (3). MS is the most common neurological disease amongst young adults,

with over 2.3 million people diagnosed (4). As with several other immune-mediated

diseases, such as type I diabetes, MS follows a sex-bias with a female to male ratio of 3:1

(5). Due to the long duration of disability and diagnosis typically occurring in the third

and fourth decades of life, MS has a profound social and economic impact. According to

the MS Society of Canada, up to 80% of Canadians living with MS will face early

unemployment (6). This places a long-term burden on both health care services and

unemployment insurances.

Clinically, MS can manifest in multiple forms based on the frequency and

duration of neurological deficits, Figure 1-1. The typical phenotype of MS arises with an

isolated neurological deficit which completely subsides, termed Clinically Isolated

Syndrome (CIS) (7). Approximately 85% of patients will go on to develop relapse-

remitting MS (RRMS), typified by neurological deficits for a brief period which subside

completely and spontaneously. Interestingly, ~30% of CIS patients will develop an

atypical form of MS with no relapsing neurological deficits for up to 15 years following

the initial episode. Many of RRMS patients will develop progressive and irreversible

neurological decline, termed Secondary Progressive MS (SPMS) (8). MS may also

present atypically in 5% of patients who have gradual neurological defects that do not

subside with time. This is termed Primary Progressive MS (PPMS). Intriguingly, this

clinical progression of MS does not follow a sex-bias and has a later age of onset, closely

associated with the age of onset of SPMS (9). Lastly, MS can also arise as a pediatric MS,

with 2-5% of patients being diagnosed under the age of eighteen (10).

Physicians assess the development of MS using a variety of tools. This task can

be difficult due to the heterogeneity of symptoms, which range from sensory, cognitive,

3

and motor impairments to psychological deficits (11). In addition, symptoms may arise in

isolation or in combination and vary between individuals. As a result of the diverse

symptoms and the varied onset of MS, the diagnostic criteria for MS have evolved

continuously over the years. Currently, the revised McDonald criteria have come to be

dominant in clinical practice. These build upon a comprehensive view of MS

pathophysiology, and include: the presence of oligoclonal immunoglobulin G (IgG) in the

cerebrospinal fluid (CSF) indicative of CNS inflammation, the occurrence of blood-brain

barrier (BBB) lesions on Magnetic Resonance Imaging (MRI) scans, as well as decreased

visual-evoked potentials (indicative of optic nerve damage) (7, 12-14). Recent findings

have identified possible biomarkers for the diagnosis of MS, namely the presence of

neuro-filament heavy chains in the CSF of MS patients, which correlate with relapse rates

and extent of disability (15).

Figure 1-1 Representation of clinical progression of MS. Adapted from (16).

a

b c

4

1.1.2 Pathogenesis of Multiple Sclerosis The heterogeneity displayed in the pathology and clinical progression of MS

patients has led to numerous hypotheses for the pathogenic roots of this disease.

Traditionally thought of as an autoimmune disease; MS was proposed to follow an

“outside-in” model. Where peripheral immune activation to specific myelin antigens

leads to infiltration of immune cells into the CNS and subsequent myelin damage.

However, more recent studies have proposed an “inside-out model”. This model

postulates that a neurodegenerative disease triggers the activation of immune cells within

the CNS that lead to bystander activation of peripheral immune cells and damage of

myelin (16). No consensus has been drawn as to which model is correct, as such it

remains unknown whether neuro-degeneration precedes the autoimmune attack in MS or

vice versa.

In order to solve this debate, scientists and physicians have focused on

environmental risk factors that might contribute to the pathogenesis of MS (for review)

(17-20). One striking environmental factor was that lower exposure to sunlight increases

the risk of developing MS. Epidemiologically this manifests as an increased incidence in

regions at greater distances from the equator. The dominant theory for this observation is

that Vitamin D3, an immunosuppressive, sunlight-derived vitamin, is inversely correlated

to the incidence of MS (21-23). Another key environmental trigger correlated with MS is

the occurrence of infections, which supports a “molecular mimicry” hypothesis. This

hypothesis proposes that infections by bacterial and viral organisms, which share

molecular similarities to myelin antigens, may cause an adjuvant-like effect and cause

aberrant autoimmune reaction in the host resulting in CNS damage. The Epstein-Barr

virus (EBV) is such a pathogen that has been linked to MS. This link was strengthened

when the discovery was made that a large portion of MS patients possessed antibodies

against EBV (24).

The role of genetics in the development of MS has also been extensively studied

(25). Initial evidence for a genetic inheritance of MS came from studies of twins. These

data indicate that monozygotic twins have a six-fold higher risk of developing MS than

5

do dizygotic twins (26). Moreover, genome-wide association studies (GWAS) have

strengthened the argument that the immune system plays a major role in the development

of MS. These studies have identified DRB1, a gene locus encoding the Major

Histocompatibility Complex (MHC) class II, as having the strongest association with the

risk of MS (27). Minor risk alleles are found in other immune related genes such as those

encoding for interleukins (IL) IL-12A and IL-22RA (28). Recently, it was identified that

epigenetics may also play a role as MS is more frequently inherited from fathers than

mothers (for review) (29).

Despite the role that genetics may play in the development of MS, the majority of

polymorphisms identified in MS do not correlate with disease severity or progression.

Therefore, the complexity of this disease must stem from a conjunction of environmental

triggers in individuals with genetic pre-dispositions.

1.1.3 Multiple Sclerosis and the Iron Hypothesis Iron is crucial for many biological processes in tissues for the proper functioning

of the electron transport chain. In the CNS, iron plays multiple roles ranging from

neurotransmitter release (30) to myelin synthesis (31). Iron homeostasis is essential and

occurs through dietary iron absorption in the duodenum, iron recycling from senescent

erythrocytes in macrophages and storage in the liver (32).

Elevated iron levels have long been recognized in MS patients. Yet, the precise

role of iron in the development of MS remains largely unknown. Studies have observed

abnormal T2-hypointensity in MRI scans of the brains from MS patients which suggests

an increase in iron deposition (33). The localization of iron accumulation may shed light

on its functional role in MS. Although initially characterized by deposition in deep gray

matter regions of MS patients, new technical imaging techniques (Magnetic Field

Correlation, R2 Relaxometry, Susceptibility Weighted Imaging) have also identified iron

deposition in perivascular regions on the periphery of white matter plaques associated

with the site of a lesion (34). The molecular mechanisms by which iron may mediate the

6

development of MS are poorly studied. Whilst most studies hypothesize the role of

reactive oxygen or nitrogen species in iron-mediated degeneration (35), one group has

observed that excess iron resulted in the increased secretion of pro-inflammatory

cytokines, such as Tumor Necrosis Factor α (TNF- α) (36). Furthermore, Gemmati and

colleagues identified polymorphisms in several key iron-regulatory molecules that were

highly correlative of MS incidence. Two genes FPN1: a gene encoding for an iron

exporter protein, HEPC: a gene encoding a 25-amino acid enzyme called hepcidin that is

crucial in iron regulation, were found to increase the incidence of MS by more than 4-

fold and 2.5-fold respectively (37). Furthermore, animal studies have identified that

reducing levels of iron resulted by either dietary restriction (38), iron-chelation therapy

(39, 40), or blocking peptides (41), resulted in reduced disease severity. It is important to

note that MS patients undergoing treatment show decreased levels of iron as compared to

patients receiving placebo, thus implying a possible role for iron in mediating disease

progression (42).

There is still wide speculation surrounding the role of iron in MS. There are gaps

in our understanding of whether iron deposition is the result of neuro-degeneration or

whether it contributes to the development of the disease.

7

1.1.4 Pathophysiology of Multiple Sclerosis The Immune Cascade

The identification of the MHC II risk allele in MS patients alluded to a central

role played by cluster of differentiation (CD4+) T cells in the development of MS.

Analyses of blood and CSF from MS patients further suggested that the disease

implicated the recruitment of auto-reactive CD4+ T lymphocytes from the periphery to

the CNS, where they tethered, rolled, and adhered to endothelial cells lining the blood

vessels (43). The subsequent infiltration of these cells to the parenchyma is associated

with breakdown of the BBB; this has been demonstrated in MS patients using

gadolinium-enhanced MRI scans (44). The initial infiltration of CD4+ effector cells of the

T helper 17 (Th17) or Th1 subtypes lead to the secretion of pro-inflammatory cytokines,

such as IL-17α and IFN-γ respectively (45). These cytokines are cytotoxic and stimulate

the recruitment of other immune cells, such as CD8+ effector T cells, which are able to

further secrete cytotoxic cytokines or antigen-presenting cells, such as CD11c+ cells

which further prime and activate effector T cells within the CNS. This immune cascade

combines with the activation of CNS resident microglia, which can release cytotoxic

cytokines and reactive oxygen or nitrogen species to damage the network of supporting

oligodendrocytes. In addition to this aberrant immune activation, MS patients display a

decreased ability to negatively regulate effector T cells, further impacting this immune

activation (46, 47). Axonal damage occurs early in demyelinating lesions which correlate

highly with infiltration of immune cells (48).

The Neurodegenerative Cascade

Following the initial immune-induced injury, oligodendrocyte progenitors

mediate endogenous re-myelination of injured areas. These progenitors can receive cues

to proliferate from Semaphorin 3A and 3F, leading to re-myelination of injured axons

(shadow plaques) (49). However, subsequent waves of de-myelination as observed

through RRMS, exhaust the oligodendrocyte progenitor pool and eventually lead to the

clinical shift into the secondary progressive phase of the disease, which is associated with

diffuse neuro-degeneration (50). This phase of the disease has been shown to be

correlated with the infiltration of B cells into the CNS parenchyma, followed by the

8

formation of ectopic lymphoid follicles leading to further de-myelination. Axonal

damage may also occur as a result of Wallerian degeneration due to axonal severing (51).

In addition to immune attack, several recent studies have observed a re-distribution of ion

channels along the length of the axonal processes that lead to enhanced intra-axonal

calcium ion accumulation and consequent degeneration (52, 53). Mitochondrial damage

has also been shown to occur at this stage of the disease. Studies have observed that an

impaired NADH dehydrogenase activity and increased complex IV activity occurs in MS

lesions but not in normal-appearing white matter (54).

The Clinical Patterns

The complexity of MS is highlighted by the heterogeneity of pathological patterns

that occur in MS patients. These pathological hallmarks are subdivided in four distinct

patterns. The initial pathological damage is predominantly regulated by the infiltration of

T and B cells at the site of plaque formation (patterns I and II). Typically these

pathological patterns coincide with the novel occurrence of plaques. Subsequently, there

is a shift towards decreased cellular infiltration and increased neuro-degeneration

represented by sites of hypoxic insult leading to neuronal death and apoptosis (patterns

III and IV). MS was originally thought to target white matter tissue, however extensive

gray matter lesions have been identified in the early phases of MS progression. In the

progressive stages of the disease, BBB breakdown does occur, but to a lesser extent in

comparison to RRMS. Furthermore, immune cell infiltrates are present in areas that

maintain BBB permeability (55). This suggests that in progressive stages, immune

activation takes place within the CNS independently of peripheral infiltration. At this

stage of the disease, patients suffer from extensive brain atrophy and dilatation of

ventricles.

9

1.1.5 Treatment of Multiple Sclerosis Early Treatments

Development of therapeutics is often dependent on our understanding of the

underlying pathophysiology of the disease. The development of first-line disease

modifying agents, such as injectable Interferon-β and Glatiramer Acetate (GA), has

provided the first treatments to reduce relapse rates and slow disease progression amongst

RRMS patients (56, 57). Both Interferon-β 1a and 1b subtypes have been shown to have

anti-viral, anti-proliferative and immune-modulatory mechanisms of action (58). The

subsequent discovery of GA, a co-polymer composed of four amino acids, significantly

reduced relapse rates amongst RRMS patients. Mechanistically, GA is proposed to act

through competing with immune cells for binding to myelin basic protein, present on the

myelin sheath of axons. Both Interferon-β and GA were shown to possess similar

efficacies, reducing relapse rate by 30% and reducing the progression of the disease (59).

New Drug Discoveries

In recent years, the targets and mechanisms of MS therapeutics have become

more elaborate; scientists are developing agents that are able to block immune cell

activation, proliferation, adhesion, and cytokine production. The recently FDA-approved

oral agent Fingolimod acts as a Sphingosine-1-Phosphate receptor antagonist. The

presence of this receptor on the surface of immune cells aids in their egress out of

secondary lymphoid organs, such as lymph nodes (60). Another clever treatment under

development inhibits the ability of immune cells to infiltrate into tissue. The development

of monoclonal antibodies that block the function of integrins on the surface of immune

cells, such as the α4β1-blocker Nataluzimab, hinders the ability of these cells to adhere to

endothelial cells lining the choroid plexus of the brain.

Several agents have been tested for their efficacy in treating both SPMS and

PPMS; however, most of these agents have provided disappointing outcomes. There are

currently only 3 agents that are approved by the FDA for the treatment of PPMS and

SPMS, but they are relatively ineffective at interfering with the progression of disability

(see reviews) (59, 61, 62). Recently, the controversial use of hematopoietic stem cell

10

transplantation has been studied in a series of phase II clinical trials that have shown

some benefits in SPMS and PPMS patients (63). Combinational treatments are currently

being tested for possible synergistic effects, such as the use of GA together with

Natalizumab, as well as the development of neuro-protective agents which may prove to

halt the neurodegenerative onset of PPMS and SPMS (60, 61).

The Drawbacks

Whilst these agents provide symptomatic relief in MS patients, there are major

drawbacks to their use. Prolonged use of these treatments can result in a tolerogenic

effect that hinders the efficacy of treatments (64). More troublesome, though, are the

complications associated with the administration of these agents. For example, the

increased incidence of progressive multifocal leuko-encephalopathy (a CNS-specific

infection) in MS patients treated with Natalizumab, or the increased incidence of cardio-

myopathies in MS patients treated with Fingolimod (60).

Overall, the therapeutic landscape for the treatment of MS is developing rapidly,

yet therapeutic interventions still result in mild success amongst patients. Current

therapeutic targets for MS are effective in reducing relapse rates and disability observed

in the early stages of MS. However, most current treatments show significant health costs

on individuals taking these drugs. Furthermore, there are currently very few therapies

offered for MS patients who are in the progressive of the disease.

11

Table 1-1 List of novel agents in clinical trials for the treatment of MS as well as current medications approved for the treatment of CIS, RRMS, PPMS, and SPMS.

Drug name MS type Mode of action Status References

Injectable Drugs

Interferon β (IFN-β1a)

RRMS, SPMS, CIS

Anti-proliferation, immune-modulatory Approved (56, 65)

Interferon β (IFN-β1b)

RRMS, SPMS Anti-proliferation, immune-modulatory Approved (66)

Glatiramer Acetate

RRMS, CIS Antagonist of MPB binding, cytokine modulation, reduced production of ROS and RNS, increased production of BDNF.

Approved (57, 67)

Mitoxantrone RRMS, SPMS, PPMS

Antineoplastic cytotoxic agent, disrupts DNA synthesis, anti-proliferation, and immonu-modulatory

Approved (68)

Oral Drugs

BG-12 RRMS Mode of action not characterized. Approved (69)

Teriflunomide RRMS, CIS Inhibits mitochondrial de novo pyrimidine synthesis Approved (70)

Laquinimod RRMS Acts on VLA-4 responsiveness to chemokine ligand 21. Phase III (71)

Fingolimod RRMS S1PR modulator on lymphocytes and cells Phase III (72, 73)

Monoclonal antibodies

Natalizumab RRMS Inhibits migration of immune cells through BBB endothelial cells. Approved (74, 75)

Alemtuzumab RRMS Targets CD52 on leukocytes. Phase III (76)

Ocreluzimab RRMS Targets CD20 on leukocytes Phase III (77)

Daclizumab RRMS, SPMS Targets CD25 on leukocytes. Phase II (78)

12

1.2 Experimental Autoimmune Encephalomyelitis (EAE), an Animal

Model to Study the Pathophysiology of MS

The development of animal models is an essential tool to better understand the

molecular events occurring in MS. Due to the heterogeneity of this disease in clinical

presentation, disease progression, and pathological features, no single animal model can

fully recapitulate the disease. Thus numerous animal models have been developed for the

investigation of RRMS (SJL/J or C57BL/6 mice), SPMS (Biozzi ABH and NOD mice),

as well as de-myelinating disease (using Cuprizone, Theiler’s murine encephalomyelitis

virus, or dyphteria toxin) (79). However, the most well characterized animal model for

the study of MS is the experimental autoimmune encephalomyelitis (EAE) model.

1.2.1 The Experimental Autoimmune Encephalomyelitis Model

Developed in 1925, the EAE model represents a wide variety of MS animal

models (80). EAE may be induced in mice by active immunization using a myelin

antigen such as myelin oligodendrocyte glycoprotein (MOG) or myelin basic protein

(MBP). The model can also be induced by adoptively transferring immune cells from

MOG-immunized animals to naïve animals. The typical disease onset occurs within 10-

12 days after induction and can follow a variety of progressions depending on the strain

of mouse, dosage of agents, and mode of induction (active or passive) of the disease. No

attempt at summarizing these models will be made as a recently published review

provides an in depth analysis (81). In our model, C57BL/6 mice are induced by active

immunization with MOG(35-55)aa to induce a chronic-progressive form of MS with high

incidence and without the occurrence of remission. The disease progression is

characterized by an ascending paralysis, beginning at the tail and finishing at the

forelimbs. The animal can be scored behaviorally using a well-established body condition

score (BCS), as shown in Figure 2-2.

13

1.2.2 The Established Role of T cells in EAE

In EAE, invading immune cells most prominently target the spinal cord

replicating the pathological patterns I and II of MS (81). The adoptive transfer of CD4+ T

cells from immunized mice into naïve mice confirmed that EAE was also a CD4+ T cell-

mediated disease (82). Initially, IFN-γ producing Th1 effector cells were believed to

mediate the disease, as adoptive transfers of Th1 cells induced EAE in mice. However,

the discovery that the induction of EAE was in fact dependent on a novel cytokine, IL-23,

led to the identification of a novel CD4+ T cell subtype, the IL-17 producing Th17 cells

(83-85). Thus, both Th1 and Th17 CD4+ T cell subsets can mediate EAE. Importantly,

both IFN-γ and IL-17 secreting cells were shown to be enriched in the CSF of MS

patients (45, 86). In EAE, both subtypes of T cells have been shown to promote

differential immune cell recruitments, with Th1 promoting monocytic inflammation and

Th17 promoting neutrophilic infiltrates (87). In addition, novel studies identified that

atypical forms of EAE may arise from a shift in the expression of these pro-inflammatory

cytokines. Higher expression of IL-17 is associated with more prevalent brain lesions

whereas it may be protective in the spinal cord (88). Interestingly, these studies raise the

possibility that T cell subsets may mediate differential functions depending on their tissue

localization.

In a normally functioning immune system, immune cells react and proliferate

upon recognition of a specific antigen. However, this response can be dampened by

another subset of T cells referred to as regulatory T cells (Treg). This T cell pool rapidly

expands and peaks at the recovery phase in the CNS of EAE-induced mice. The role of

these cells was identified using adoptive transfer of Tregs into EAE-induced mice,

resulting in a decreased clinical severity (89, 90). These cells can regulate immune cells

by releasing anti-inflammatory cytokines, such as Transforming Growth Factor-β, and

dampen the immune response. In addition, Tregs can function in an autocrine fashion by

using regulatory receptors to inhibit T cell activation, either by inducing pro-death signals

or by producing immune regulatory cytokines. The most well studied receptor is the

cytotoxic T-lymphocyte antigen-4 which is normally rapidly up-regulated in activated T

cells and regulates T cell function by outcompeting co-stimulatory molecule CD28 (91).

Programmed death-1 is another receptor able to modulate T-cell activation by inhibiting

14

phosphoinositide 3’ kinase (pI3K)-dependent proliferation (92). Importantly, the

appropriate signaling of Tregs was shown to be dysfunctional in the CNS of MS patients

(93).

In addition to the well-established role of CD4+ T-cells in the development of

EAE, studies have also identified other subsets of T cells that play a crucial role in EAE.

Adoptive transfers of CD8+ T cells induce an atypical form of EAE with lesions localized

to white matter of the cerebellum. In addition, this model induces widescale

oligodendrocyte death resembling patterns III and IV of MS patients (94). Recent

findings highlight the occurrence of multiple subsets of CD8+ T cells present in both EAE

and MS. Initial studies using CD8-/- knockout mice have shown increased severity of the

disease and more frequent relapses, indicating a possible regulatory role of CD8+ T cells

in EAE (95, 96). Furthermore, CD8+/CD28-/- T cells have been shown to induce

immunosuppressive phenotypes in EAE by interrupting co-stimulatory molecule

expression on the surface of CD4+ T cells (97).

1.2.3 An Emerging Role for B cells in EAE

Although T cells have been shown to mediate disease, a body of evidence

suggests that B cells are involved in the pathophysiology of EAE. MS patients possess

higher IgG levels in the CSF compared to age-matched controls, suggesting the presence

of antibody-releasing cells within the CSF. Studies have found that B cells enhance EAE

severity by promoting differentiation of Th1 and Th17 cells. Prior to EAE onset, a

regulatory subset of B cells, able to regulate immune response, exist. This may provide a

novel biomarker from which the shift of B cells from regulatory to pathogenic may

correlate with MS onset (98). This finding prompted scientist to develop blocking

antibodies against B cells. Rituximab (for review, see section 1.1.3), acts by binding a B

cell-specific surface receptor (CD20), depleting the B cell pool and ameliorating relapse

rates in MS patients (79).

Overall, EAE models have helped us gain great insight into the pathogenesis and

pathophysiology of MS whilst providing us with numerous therapeutics that have

successfully been translated to the clinic.

15

1.3 The Blood Brain Barrier 1.3.1 The Anatomical Composition of the Blood-Brain Barrier

The circulatory system is vast and complex, providing tissues with nutrients,

hormones and regulating pH. Covering the entire inner surface of blood vessels is the

endothelium, which forms a barrier to regulate vascular permeability. The CNS possesses

a unique endothelial barrier: the BBB. This structure is unique amongst the rest of the

circulatory system, and is made up of multicellular compartments regulating the passage

of contents from the peripheral circulation into the CNS; together these compartments are

referred to as the neurovascular unit. This unit is composed of a primary physical barrier

lining the wall of blood vessels, made of endothelial cells (EC), separated by a basement

membrane (BM) from the second juxtaposed layer of cellular control, the pericytes,

which tightly cover the ECs. Astrocytes regulate a third layer through cellular extensions,

termed astrocytic end-feet. In addition to these cells, the neurovascular unit contains

immune cells unique to the CNS, microglia, as well as the functional units of the CNS,

neurons (Figure 1-2) (99).

The specialized ECs lining the blood vessels of the BBB lack fenestrations, have

low pinocytic activity and possess a continuous expression of tight junction (TJ) proteins

(100). The maintenance of cross talk between the multicellular components of the

neurovascular unit is crucial for CNS homeostasis in response to either toxins or

inappropriate immune infiltration. Under normal conditions, ECs lining the BBB express

very low levels of leukocyte adhesion molecules, thus limiting the influx of peripheral

immune cells (101).

1.3.2 Immune Extravasation Through The Blood-Brain Barrier

In MS, loss of BBB integrity occurs early in the disease progression (102).

Breakdown of the BBB primes tissue for the recruitment of leukocytes and subsequent

neuronal damage. While the BBB normally sequesters immune cells outside of the CNS,

it can also promote the penetration of immune cells to localized regions of inflammation

within the CNS. Early in MS, ECs can enhance leukocyte infiltration by up-regulating

16

both E- and P-selectin proteins on their membranes (103). Furthermore, ECs can secrete

leukocytes attractants such as chemokine ligand 2 (CCL2) (104). Following activation by

inflammatory cytokines, ECs can express adhesion molecules, such as intracellular

adhesion molecule -1 (ICAM-1) and vascular adhesion molecule-1, which enhance the

extravasation of leukocytes through ECs (99). Once they pass through EC junctions,

leukocytes must cross the EC BM. The composition of the EC BM has been shown to

affect leukocyte pooling, for example, a higher expression of laminin 411 and a lower

expression of laminin 511 proteins lead to enhanced leukocyte pooling in EC BM (105).

The final step for infiltration of leukocytes into the parenchyma depends on their

infiltration through astrocytic end-feet. At this stage, leukocytes secrete pro-inflammatory

cytokines, promoting the secretion of matrix metalloprotease – 9 (MMP-9), which

degrades the astrocyte BM and dystroglycan expressed on astrocytic end-feet, resulting in

leukocyte infiltration into the glia limitans (106).

1.3.3 The Role of Astrocytes In Maintaining The Blood-Brain Barrier Integrity

Astrocytes perform a variety of support functions in the CNS, from nutrient distribution

to immune regulation and regulation of BBB integrity. Astrocytic end-feet are highly

polarized structures that express a series of receptors necessary for BBB maintenance.

For example, aquaporin-4, which regulates the influx of water in the CNS, is functionally

lost when astrocyte lose polarity. The result of reduced aquaporin-4 function leads to the

development of edema and increased BBB permeability; both of these phenotypes occur

in EAE-induced mice (107). Studies have recently discovered soluble factors that are

secreted by astrocytes, such as angiotensin-II, which regulate BBB integrity. Using in

vitro co-cultures of ECs and astrocytes, the release of angiotensin-II was shown to

promote an increase in TJ protein formation in ECs, thus strengthening the veracity of the

BBB (108, 109). During the progressive course of MS, astrocytes may, in fact, mediate

anti-inflammatory roles. Recent findings identified that activation of the Hedgehog (Hh)

receptor, Patched-1 (Ptch-1), as well as its downstream transcription factor Gli-1 in

human primary cultures, led to a more robust BBB (i.e. a decrease in CCL2 secretion and

down-regulation of ICAM-1) (110).

17

Figure 1-2 A schematic representing the organizational layers of the neurovascular unit (108).

18

1.4 Repulsive Guidance Molecules A crucial step for the development of the CNS is the appropriate guidance of

axonal tracts towards their target site. These directional cues can be mediated through

either attractive or repulsive molecules. The first discovered guidance cue, Netrin-1, was

shown to attract extending axons towards their correct site of projection (111). Shortly

thereafter, a repulsive molecule was identified in the chick visual system. This molecule

was termed Repulsive Guidance Molecule a (RGMa) as its expression in the chicken

optic tectum led to the repulsion of invading temporal axons from the retina (112).

Since the discovery of these two molecules, three members of the RGM family

have been characterized in mammals: RGMa, RGMb (DRAGON), and RGMc

(Hemojuvelin, HFE2) (113). These proteins share ~40% identity in primary amino acid

sequences and all three express an N-terminal signal peptide sequence followed by an

arginine-aspargine-aspartic acid (RGD) motif. Other key structures include the presence

of a partial von Willebrand type D domain and a carboxy-terminal GPI anchor (113)

(Figu). Both RGMa and RGMc can undergo autocatalytic cleavage generating a

membrane-bound isoform that can further undergo post-translational cleavage to secrete

soluble fragments (114, 115). These proteins demonstrate complex biological activities,

including cell adhesion, axonal outgrowth, axonal guidance, immune regulation, and

systemic iron regulation. All of these functions are mediated through the trans-membrane

receptor Neogenin, which is broadly expressed in the body. RGM’s have also been

shown to enhance Bone Morphogenetic Proteins (BMPs) signaling indirectly by acting as

co-receptors that can activate both the Smad-dependent and -independent pathways.

19

Figure 1-3 The structure of RGM proteins. All RGM proteins share ~40% primary amino acid sequence. All members posses an N-terminal signal sequence targeting the proteins to the membrane where they are anchored using a GPI-anchor sequence on the most C-terminal portion. All RGMs possess a von Willebrand factor domain whereas both RGMa and RGMc possess an auto-catalytic RGD motif able to generate a single-chain and a two-chain membrane-bound protein. RGMb is only expressed as a single-chain membrane-bound protein. Single-chain isoforms can be cleaved from the membrane to generate soluble protein fragments (asterisks).

1.4.1 RGMs and Neogenin

Neogenin is a type-I transmembrane protein that is homologous to the well-

known tumor suppressor receptor, Deleted in Colorectal Cancer (DCC). Both of these

receptors possess an extracellular domain containing four immunoglobulin (4Ig) domains

and six-fibronectin type III (FNIII) domains. The intracellular regions differ between the

two receptors except for 3 conserved regions termed P1, P2, and P3. Unlike DCC,

Neogenin is expressed broadly outside of the CNS in tissues including: lung, heart, gut,

kidney, liver, skeletal muscle, and bone (116). The well-known Netrin-1 ligand, known to

bind DCC at the FNIII(4-5) domains was also shown to bind to Neogenin at the same

location (117), and promote attraction of supraoptic axons in the Xenopus forebrain (118).

Neogenin was also shown to bind RGM proteins, with the RGMa-Neogenin interaction

20

first identified through its chemo-repulsive effect in temporal retinal axons of the chick

anterior optic tectum (119). As portrayed in Figure 1-4, the binding site of RGMa on

Neogenin resides within the FNIII(3-4) domain (114), whereas the binding sites for RGMb

and RGMc are located on the FNIII(5-6) domains (120, 121). Furthermore, functions of

both RGMb and RGMc are mediated through Neogenin signaling (32, 122).

Figure 1-4 Neogenin binds RGMa, RGMb and RGMc at various sites. RGMa was shown to bind the Fibronectin type-III(3-4) domain of Neogenin (114), whereas the binding sites for RGMb and RGMc are located on the Fibronectin type-III(5-6) domains (120, 121).

21

1.4.2 RGMs and Bone Morphogenetic Protein signaling

The BMPs, originally purified in the 1980’s, currently consist of 20 members

belonging to the transforming growth factor -β superfamily of ligands (123). BMPs have

been shown to regulate a number of biological processes, for example, cell fate

specification, cell proliferation, cell migration and cell death (124). There are two types

of BMP receptors, type-I and type-II; BMP ligands bind preferentially to type-I BMP

receptors (125). There are currently four type-I BMP receptors subtypes: ALK3, ALK6,

ALK1, and ALK2 and three type-II BMP receptors subtypes: BMPRII, ACTRIIA, and

ACTRIIB (126, 127). BMP receptors signal through Smad proteins, which upon

activation associate with the receptor and are phosphorylated (receptor-regulated Smads).

Smad proteins form complexes with common-mediator Smads and translocate to the

nucleus to regulate gene transcription, as shown in Figure 1-5. Inhibitory Smads are able

to target the receptor and prevent the phosphorylation of receptor-regulated Smads,

thereby interrupting Smad signaling. Activated BMP receptors can also transduce signals

through a non-canonical pathway utilizing p38 mitogen-acitvated protein kinase (MAPK),

and the extracellular-signal-regulated kinases (ERK1/2). All three RGM proteins bind

BMPs and enhance BMP signaling (128).

22

Figure 1-5 BMP signaling can be mediated through a Smad-dependent and a Smad-independent pathway. A) Upon BMP ligand binding both BMP type-I and BMP type-II receptors dimerize to phosphorylate each other, B) BMP signaling through the canonical pathway is driven by the phosphorylation of Regulatory-Smads which then form a complex with Common-mediator Smads. This complex translocates to the nucleus mediating gene transcription. Alternatively, BMP ligands can activate non-canonical BMP signaling through the activation of downstream p38MAK or ERK1/2. 1.4.3 RGMa

RGMa, the first member of the RGM family, is expressed throughout the body:

CNS, heart, liver, lung, kidney, and gut (113). Surprisingly, silencing the expression of

RGMa is embryonically fatal in only 50% of mice due to failure of neural tube closure

(129). The RGMa protein is post-translationally processed by two pro-protein

convertases, Furin and SKI-1, to generate several soluble and membrane-bound

fragments. The uncleaved full-length protein possesses no biological activity, whereas the

cleaved fragments, both membrane-bound and soluble, inhibit neurite outgrowth through

Neogenin (114). Thus, the processing of RGMa is essential for its biological activity. The

molecular mechanism by which RGMa mediates this repulsive cue has been heavily

studied. To date, RGMa was shown to bind the transmembrane receptor Neogenin, and

activate downstream cytoskeletal remodeling proteins, such as RhoA, Rac1, and CDC42.

Rac1 and CDC42 were shown to act as positive regulators of neurite extension. On the

other hand, RhoA was shown to negatively regulate actin cytoskeleton and mediate

23

growth cone collapse, which is efficiently inhbited using C3-Transferase. RhoA activates

a downstream effector, Rho Kinase which is effectively inhibited using the RhoK

inhibitor Y-27632 (130-132).

The RGMa-Neogenin signaling pathway has been observed to participate in

various biological functions: axon tract formation (133, 134), neural tube closure (135),

neuronal differentiation (136), cell survival (137), cell migration (138), regeneration

(139), and immune activation (140-142). RGMa was also shown to function as a BMP

co-receptor in vitro where it enhanced the BMP canonical signaling pathway (143, 144)

1.4.4 RGMb

The second member of the RGM family, RGMb, is currently the least

characterized; intriguingly RGMb and RGMa share a non-overlapping expression pattern

(145). RGMb is expressed in the CNS, bone, heart, lung, liver, kidney, testis, ovary,

uterus, epididymis and pituitary (146). Whereas knockout of RGMa resulted in high fetal

mortality, RGMb knockout mice die within 2-3 weeks following birth (147). RGMb was

the first member of the RGMs found to act as a co-receptor of BMP ligands (BMP-2/-4)

it activates the downstream Smad-dependent signaling pathway (148).

Early in vitro studies on post-natal rat cerebellar granule neurons showed that

RGMb-treated neurons exhibited shorter neurite length in comparison to non-treated

neurons. Using RhoA pull-down assays, Liu et al. (2009) were able to identify that

RGMb-treated neurons activated the downstream RhoA/Rho-kinase signaling pathway.

Furthermore, RGMb expression was up regulated at the site of injury following spinal

cord injury, indicating a possible inhibitory nature of RGMb in vivo (149). However,

recent observations have identified that RGMb may actually promote neurite outgrowth.

Dorsal root ganglion cells isolated from RGMb knockout mice developed shorter neurites

compared to their wildtype controls. Additionally, RGMb deficient mice showed a

decreased regenerative ability following sciatic nerve injury, which was rescued using the

BMP antagonist Noggin. Thus, RGMb can mediate axonal outgrowth as well as

peripheral nerve regeneration by activating the BMP Smad-dependent pathway (122).

24

Interestingly, RGMb was shown to decrease the expression of IL-6 on

macrophages through the non-canonical BMP pathway by activating the p38 MAPK and

ERK1/2 pathway (147). The recent finding that RGMb could act as a co-receptor to the

programmed-death ligand-2, which able to negatively regulate T cell expansion, further

supported the role of RGMb in immune regulation (150).

1.4.5 RGMc

The discovery of RGMc, also known as Hemojuvelin, was completed by mapping

the gene locus associated with an autosomal recessive disease, juvenile hemochromatosis

(JH) (32). JH presents as an early onset of iron overload typically in the first and second

decade of life, and is caused by the lack of function of a liver-derived enzyme, hepcidin.

Hepcidin regulates iron homeostasis by binding and degrading ferroportin, an iron efflux

exporter (151). Studies identified that RGMc knockout mice develop iron overload and a

decreased hepcidin expression, which is similar to observations in JH (152).

The RGMc protein undergoes complex post-translational processing. The

presence of an autocatalytic sequence results in two cell membrane proteins: i) a single-

chain 50 KDa; and 2) a two-chain 30 KDa protein linked to a 20 KDa protein by di-

sulfide bonds (Figu). The single-chain protein can be further processed by a pro-protein

convertase, Furin, to release a 50 KDa fragment (153). Furthermore, single-chain RGMc

can be cleaved by a serine-protease Matriptase-2 (MT2) to release a 36 KDa fragment

(32).

In hepatocytes, single-chain membrane-bound RGMc acts as a co-receptor for

BMP-6 and induces hepcidin expression (154, 155). Interestingly, only the two-chain

RGMc was shown to bind to Neogenin, whereas the single-chain did not (120, 156).

However, Neogenin knockout animals experience iron overload, low levels of hepcidin,

and reduced BMP signaling (157). These data suggest that Neogenin plays a crucial role

in RGMc-mediated iron regulation.

25

However, the mechanism by which Neogenin regulates iron is poorly understood.

In some studies, Neogenin increased RGMc cleavage at the membrane (32), while in

other studies it reduced the cleavage (157). Moreover, Neogenin was shown to have

variable effects on BMP signaling, in some cases increasing, having no effect or reducing

signaling (152). Soluble fragments of RGMc (sRGMc) play crucial roles in iron

regulation. Whereas membrane-bound RGMc promotes hepcidin expression, sRGMc

inhibits hepcidin expression by competing with BMP receptors for BMP ligands (158).

Although the presence of sRGMc in the sera is well-established, its origin is not

known (152). In the liver, the serine protease MT2 (encoded by the TMPRSS6 gene)

cleaves RGMc upon association of RGMc with Neogenin and MT2. Subsequently, the

complex internalized and trafficked to the Golgi for modification, recycling to the

membrane and a final cleavage by MT2 to sRGMc (32). However, when MT2 is knocked

out sRGMc levels are unchanged, suggesting that the role of MT2 in vivo is not necessary

and that other pathways exist for the creation of sRGMc (159). In fact, the ubiquitously

expressed protein Furin can also cleave RGMc. Cleavage of RGMc by Furin generates a

50 KDa fragment, and is co-ordinated by the hypoxia-inducible factor 1α (160).

Interestingly, the Furin-generated fragment appears to be a more potent inhibitor of BMP

signaling than is the MT2-generated fragment (161). Thus, sRGMc may fill roles other

than iron-regulation. RGMc processing appears to differ between varying tissues.

Skeletal muscle RGMc has been proposed to act as a reservoir for soluble RGMc,

however, skeletal muscle-specific knockout of RGMc does not affect iron regulation as

would be expected (162). Conversely, liver-specific knockout of RGMc does result in

systemic iron overload. Thus, in vivo liver-specific RGMc likely possesses most

importance for iron regulation.

RGMc has been proposed to regulate systemic iron levels through the formation

of a super protein complex. In the circulation, iron-bound transferrin can bind transferrin

receptors (transferrin 2) on the membrane of hepatocytes. This binding dissociates the

iron regulating protein, HFE, which can associate with RGMc to activate the Smad-

dependent signaling pathway inducing the expression of hepcidin (163).

26

Inflammation is associated with iron deregulation. Iron redistribution of reticulo-

endothelial macrophages and reduced intestinal iron absorption are believed to be the

main mechanisms for this iron dysregualtion. During inflammation, IL-6 activates Janus

kinase, to induce hepcidin expression through the phosphorylation of STAT3, which in

turn decreases intestinal iron absorption. Bacterial lipopolysaccharide (LPS; an

inflammatory bacterial agent) induces hepcidin expression and reduces the expression of

RGMc, BMP-2, BMP-4 and BMP-6 in the liver. Furthermore, in vitro studies in a human

hepatoma cell line demonstrated that TNF-α decreased RGMc levels independently of IL-

6 (164-166). Further studies have outlined that induced hepcidin expression following

inflammation is independent of BMP-Smad signaling (167). To date little is known about

the physiological roles of sRGMc. And the source of serum sRGMc remains unknown.

27

1.4.6 Repulsive Guidance Molecules and Multiple Sclerosis

As previously discussed, RGMa serves a pivotal role in the proper development

of the CNS, yet the role of RGMa outside of this complex system has been largely

understudied. Reports of increased RGMa expression on activated macrophages

following spinal cord injury raised a potential route by which RGMa may mediate its

chemo-repulsive signal on regenerating axonal fibers following injury (139, 168). Indeed,

in vitro co-cultures of mouse cortical neurons with macrophages supplemented with LPS,

strongly inhibited neurite outgrowth and led to neurite growth cone collapse (168). This

RGMa effect was shown to be mediated through its interaction with Neogenin since

down-regulation of Neogenin, using short-interfering RNA, decreased the chemo-

repulsive effect of activated macrophages (168). Thus, RGMa is expressed in the surface

of macrophages at the site of injury and is able to repulse regenerating fibers.

Interestingly, a recent discovery linked RGMa to murine EAE, shifting our

understanding of the physiological role of RGMa (169). This study was extended by

genotyping polymorphisms in the RGMa locus of MS patients which revealed to be

highly correlative and followed a female bias, as observed in clinical onsets of the disease.

RGMa polymorphisms correlated with elevated TNF-α and IFN-γ in the CSF and the

peripheral blood mononuclear cells (PBMCs) of MS patients (169). In addition, soluble

fragments of RGMa were found in the cerebrospinal fluid of RRMS patients which

decreased in patients undergoing intrathecal corticosteroid triamcinolone acetonide

(TCA) treatment (170). These exciting studies have shed light on a novel function of

RGMa in immune modulation.

More recently, possible mechanisms by which RGMa may mediate its immune

modulatory effect have been proposed. In vitro studies observed that following LPS

administration, both the full-length and the auto-catalytically cleaved forms of RGMa

were up regulated on the surface of bone marrow-derived dendritic cells, whereas its

receptor, Neogenin, was expressed on the surface of CD4+ T cells (142). Western blot

analysis identified a small GTPase, Rap1, which upon RGMa expression becomes

elevated leading to an increase in T cell adhesion (observed via increased ICAM-1

expression) (142). This finding highlights a possible role for the RGMa-Neogenin

28

signaling pathway in immune cell priming and activation. Muramatsu et al. (2011) were

able to show that using an RGMa-specific antibody decreased the clinical severity in both

active and passive EAE-induced mice. Overall, the RGMa antibody-treated animals

showed a significant reduction in cellular infiltration in spinal cord tissue as well as,

reduced white matter demyelination at day 21 following induction of EAE. These

observations were further confirmed in PBMCs of RRMS patients, where inhibition of

RGMa using an RGMa-specific antibody attenuated T cell proliferation and cytokine

production (142, 171).

RGMa has been further implicated in immune regulation through its ability to

transiently (for 8 hours) hinder leukocyte extravasation in an in vivo model of Zymosan-

A-induced peritonitis (141). RGMa expressed in cytokeratin-positive epithelial cells in

addition to polymorphonuclear leukocytes that expressed both RGMa and Neogenin

(141). In vitro analysis using a parracellular flux assay, indicated that RGMa reduced

formyl-methionyl-leucyl-phenylalanine induced PBMC migration through a lung

epithelial cell monolayer (141). The RGMa/Neogenin signaling pathway was further

implicated in acute inflammation by Konig and colleagues. They reported that Neogenin

knockout animals lost the ability to develop immune response following an acute

peritonitis model (140).

Taken together, the expression of RGMa on peripheral immune cells can

modulate immune activation through dendritic cell-T cell signaling, or by inhibiting the

infiltration of immune cells through epithelial cells. The potential of RGMa signaling in

MS goes far beyond immune modulation, as discussed previously. Inhibition of RGMa

signaling promotes axonal regeneration in several spinal cord injury models as well as

optic nerve injury models (139). Despite the recent focus on RGMa and its role as an

immune modulator, the physiologic mechanism by which RGMa mediates its actions on

the immune system is still poorly understood.

29

1.5 Hypothesis and aims

The recent elucidation that RGMa, and its interaction with Neogenin, plays a

crucial role in immune-activation and priming has uncovered a novel therapeutic target

for the treatment of MS. Yet, these studies fail to identify the role of soluble RGMa in the

development of MS. Likewise, RGMc is also processed and co-exists with soluble RGMa

in the serum. Both soluble proteins were shown to mediate their signal through their

interaction with Neogenin. Thus, we believe that the regulation between levels of soluble

RGMa as well as soluble RGMc is crucial for the development of autoimmune diseases,

such as MS. Together this thesis aims to examine the role of RGMc in the development

of autoimmune diseases in the context of a mouse animal model of MS, EAE.

In this study we hypothesize that:

Soluble RGMc is a key player in the development of experimental autoimmune encephalomyelitis and is crucial in immune-regulation in the CNS.

Our hypothesis will be tested with the following aims:

I: RGMc expression is modulated in the sera of EAE-induced mice

1. Examine the expression of soluble RGMa (sRGMa) and RGMc (sRGMc) in the

sera of mice at days 0, 5, 10, 18, and 30 post-EAE induction.

2. Examine whether supplement of RGMc ameliorates the clinical score in EAE-

induced mice

II: A relationship exists between RGMa and RGMc in the development of EAE

1. Observe the binding properties of sRGMa and sRGMc to Neogenin in vitro

2. Analyze the clinical severity of EAE-induced mice treated with sRGMc in

conjunction with sRGMa

III: RGMc modulates the molecular activation of the adaptive immune system

1. Survey the population distribution of immune cells and the activation of antigen-

specific immune cells in EAE-induced mice treated with sRGMc or vehicle

2. Examine the role of sRGMc on the migration of immune cells into the CNS

30

Chapter 2: Materials and Methods

31

2.1 Construction of Expression Plasmids To examine the role of soluble RGMc in the serum, a construct was engineered and

cloned. Membrane-bound full-length RGMc (mus musculus) was available and used as a

starting material for further cloning.

2.1.2 Cloning of sRGMc in the Psectag2B Vector

To replicate endogenous soluble RGMc, present in serum, the GPI anchor sequence of

RGMc was removed, generating a truncated form of RGMc (sRGMc). The resulting

protein is targeted to the membrane using the Psectag2B signaling sequence and is

released out of the cell, into the medium, as a soluble protein. sRGMC was generated

using the following primers:

Forward primer: 5’ cttggtacccatcatcatcatcatcatcagtgcaagatcctccgctg 3’

Reverse primer: 5’ gcgtctagacactcgagcgtcgagctgcccagctgtctgtc 3’

A Polymerase Chain Reaction (PCR) was performed, using TAQ polymerase, to generate

an RGMc DNA fragment of 1175 base pairs in length containing a KpnI restriction site

(5’ end) and an EcorI site (3’end) (New England Biolabs). The PCR product was then

purified and ligated into a T-vector which was subsequently digested, with the above

mentioned restriction enzymes, and inserted into a pSecTag2B expression vector

(Invitrogen). This construct was subsequently sent for sequencing to ensure the protein

was in the correct frame. The pSecTag 2B vector contains a T7 promoter binding site and

an Igk lead signal peptide for the specific targeting of the inserted sRGMc sequence to

the cellular membrane, see Figure 2-1.

32

Figure 2-1 A representation of the sRGMc pSecTag2B plasmid. The sRGMc construct was generated using the pSecTag2B expression plasmid, containing a T7 promoter and an Igk lead sequence, allowing for the overexpression of sRGMc to the cellular membrane of cells. The construct was generated with an N-terminal and a C-terminal His-tag sequence and a Myc-tag sequence on the C-terminal end. These tags allowed for the specific identification of the secreted protein as well as a method for specific purification of sRGMc.

2.2 Expression and Purification of Recombinant Proteins 2.2.1 Culturing of Cell-lines

Human Embryonic Kidney cells (HEK293) and murine Brain-derived Endothelial cells

(b.end3) were cultured in a humid environment at 37°C and 5% CO2. Cells were

maintained in Dulbecco’s Modified Eagle Medium (Sigma-Aldrich or ATCC) containing

10% fetal bovine serum (FBS) (Gibco) and 1% penicillin/streptomycin (p/s) antibiotics

(Gibco). For cell passaging, a 5-minute trypsinization step (0.25% Trypsin-EDTA,

Gibco) was done in order to disrupt adhesion of cells on the plates.

33

2.2.2 Determining Expression of sRGMc

The sRGMc pSecTag2b plasmid was transiently transfected into the HEK 293 cell line

using the transfection reagent, polyethylenimine (PEI, Polysciences Inc.). Cells were

transfected with 9μg of DNA at 95% cell confluency and were incubated for 6 hrs at

37°C and 5% CO2. The media was removed and cells were washed using Dulbecco-

Phosphate Buffered Saline (D-PBS, Sigma-Aldrich), medium with reduced serum (OPTI-

MEM, Gibco) was then added to the cells and incubated at 37°C and 5% CO2 for 48 hrs.

Empty pSecTag2b-transfected cells served as a control. Following incubation, the

medium was harvested and centrifuged at 300 rcf for 5 minutes to dispense of cellular

debris. Supernatants were then extracted and sRGMc was visualized by SDS-PAGE, see

section 2.3.

2.2.3 Establishment of a Soluble RGMc and Soluble RGMa Stable Cell-line

95% confluent HEK 293 cells were grown in antibiotic-free media for 16 hrs prior to

transfection. HEK 293 cells were transfected with sRGMc and sRGMa (previously

generated from our laboratory) using Lipofectamine 2000 reagent (Invitrogen) according

to manufacturer instructions. Briefly, 24μg of DNA was added to 60μl of Lipofectamine

2000 reagent and seeded to each 10cm tissue culture plate. 24 hrs post-transfection, cells

were passaged in a 1:3 ratio and incubated at 37°C. 48 hrs post-transfection, selection

media (10% FBS, 1% p/s, 250μg/mL Zeocin) was added to the cells and maintained

under selection (every 2-3 days) until all transfected cells were selected. Each specific

colony was then picked and expanded. The expression of both sRGMc and sRGMa were

then assessed using western blot analysis, as described in section 2.3.

2.2.4 Protein Purification

Once the stable cell line expressing both, sRGMc as well as sRGMa, reached 95%

confluence, the media was replaced with OPTI-MEM to aid in the purification process.

After 48 hrs of incubation at 37°C and 5% CO2, the media was spun at 300 rcf, collected

and stored at 4°C. The pH of the media was analyzed (>8.0) and 500μl of nickel agarose

(Ni-A) beads (Qiagen) were then added to the media and shaken for 2 hrs at 4°C. The

beads were then washed using 10mL of Ni-A wash buffer (5mM imidazole, 500mM

NaCl in PBS) for 30 mins at 4°C. The beads were subsequently washed and eluted with

34

500μl of Ni-A Elution buffer (250mM imidazole, 500mM NaCl in PBS) using a gravity

column (BioBasic). Each elution was dialyzed (Spectra/Por cellulose dialysis membrane

Spectrum Laboratories, Inc) with two changes of 1X PBS (137mM NaCl; 10mM

Phosphate buffer; 2.7mM KCl, pH 7.4). The proteins were aliquoted and stored at -20°C.

Protein purity was verified on a SDS-gel developed with a coomassie brilliant blue stain

(Bio-Rad), see section 2.3.

2.2.5. Protein Concentration Measurements

Protein concentrations of individual samples were determined using the protein Bradford

assay (Thermoscientific) as described by the manufacturers. Protein concentrations were

analyzed from absorbance values at 595nm wavelength using a spectrophotometer

(BioTek EL311 AutoReader). The recorded values were normalized to a blank (re-

suspension buffer). Six standard protein concentrations were used to generate a standard

curve; sample concentrations were determined based on their absorbance values.

2.3 Western Blot Analysis Western blot analysis was used to verify the expression of proteins used in this study.

Samples were prepared from: mouse serum, cells, conditioned medium, and reduced-

serum medium. Samples were prepared for gel electrophoresis by adding a 6X loading

buffer (50mM Tris-HCl [pH 6.8], 2% SDS, 10% Glycerol, 1% Beta-mercaptoethanol,

12.5mM EDTA, and 0.02% Bromophenol Blue) and denaturing the proteins by heating

the samples at 95°C for 5 minutes. Equal volume of sample were next loaded and

resolved on a 0.75mm 4% stacking / 10% resolving acrylamide gel in Tris-glycine

running buffer (25mM Tris, 192mM Glycine, and 0.1% SDS) at a constant voltage of 200

V for 1 hr (PowerPacTM Basic Power Supply, Bio-Rad).

To verify protein purity, SDS-gels were washed in Milli-Q H2O and stained with

Coomassie brilliant blue (Sigma-Aldrich) for 30 mins at room temperature.

To verify proteins by Western blot, proteins were then transferred to a nitrocellulose

35

membrane (Bio-Rad) in transfer buffer (30.3g Tris + 144g glycine in water) either

overnight at 4°C using a constant voltage of 11 V, or 1 hr at 4°C using a constant voltage

of 80 V. After the transfer, the membrane was blocked for 1 hr at room temperature with

5% non-fat dry milk solution dissolved in PBS. The nitrocellulose membranes were then

incubated overnight at 4°C with primary antibody in blocking PBST solution (5% non-fat

dry milk, 0.1% Tween-20, PBS). The primary antibodies used are described in Table 2-1.

Antibody Cat. No. company

RGMa AF-2459 R&D

RGMc AF-3636 R&D

Transferrin Sc-30159 Santa Cruz

Neogenin Sc-15337 Santa Cruz

Following primary antibody incubation, the blots were washed three times in PBST (10

mins washes) and then incubated for 2 hrs with InfraRed (IR)-linked secondary

antibodies at room temperature. The secondary antibodies used were: IRDye 800CW,

[Donkey anti-Rabbit]; [Goat anti-Mouse], [Donkey anti-Goat], LI-COR BioSciences).

Lastly, following further washing in PBST, specific immunoreactivity was visualized

using an Odyssey infrared Imaging system (LI-COR BioSciences).

In order to observe the expression of endogenous RGMc in mouse serum – Mice were

induced with EAE, as described in section 2.6.2. Prior to induction and 18 days post-

induction, blood was extracted from the saphenous vein of mice and allowed to coagulate

for 2 hrs at room temperature. The blood samples were then centrifuged at 2000 rcf for

20 mins and subsequently stored at -80°C. A 0.75mm 4% stacking /12% SDS gel was run

as previously described. The transferred nitrocellulose membrane was blocked using 5%

bovine serum albumin (BSA) (BioShop) in PBS. Blots were scanned and visualized using

36

an Odyssey infrared imaging system. Protein levels were determined using densitometric

analysis. RGMc protein levels were then normalized to their corresponding Transferrin

protein levels (loading control).

To verify Neogenin expression in brain-derived endothelial cells – the membrane of

b.End3 cells were isolated as follows: cells were centrifuged at 300 rcf for 5 mins,

supernatants removed and pellets were re-suspended in homogenizing (HB) buffer

(10mM HEPES, 25mM KCl, 5mM MgCl2, pH 7.3). The homogenized solution was

mechanically lysed with 10 passes through a 271/2 / 301/2 - gage needles (BD BioSciences).

The solution was overlaid on a sucrose gradient (5-50%); separated by ultracentrifugation

at 28,000 rcf for 10 mins at 4° C. The membranes were then extracted using a 21G needle

and centrifuged at 17,200 rcf for 10 mins at 4°C. The supernatant was removed and the

membrane pellets were re-suspended to the appropriate concentration in PBS. The

membranes were then prepared for Western Blotting analysis, as previously described.

2.4 In Vitro Competition Assay Using a 96-well microtiter plate (Corning), wells were coated with 100μl (10 μg/mL) of

Poly-L-Lysine (Sigma-Aldrich) at 4°C overnight. Wells were then washed three times

with 100μl of PBST (+0.02% Tween-20). 50μl (2.5 μg/mL) His-tagged proteins (extra-

cellular-Neogenin or sRGMa or sRGMc) were then coated onto each well for 1 hr at

37°C and washed three times with 100μl PBST. Each well was then blocked with 300μl

of 3% BSA in PBST for 1 hr at 37°C. Following the blocking, 50μl (1.0 μg/mL) Alkaline

Phosphatase (AP)-tagged proteins (extracellular-Neogenin or RGMa or RGMc) in 1%

BSA + PBST were added to each well and incubated at 37°C for 1 hr. Each well was

washed thoroughly three times with 100μl PBST and equilibritated using AP developing

buffer (100mM NaHC03, 1mM MgCl2). The reaction was developed away from light

using AP developing buffer supplemented with, p-nitrophenyl phosphate (pNPP, Sigma-

Aldrich). The pNPP reaction results in a fluorometric signal once bound to the AP-tag

fused with the protein of interest. The reaction was stopped, following color development,

37

with the addition of 50μl (0.1M) NaOH. The absorbance of each reaction was measured

using a microplate autoreader (BioTek EL311 AutoReader) at 405nm wavelength.

2.5 Enzyme-Linked Immunosorbant Assay (ELISA) A quantitative sandwich ELISA was used for the detection of sRGMa and sRGMc in the

sera of mice induced with EAE. Mice were induced with EAE, as described in section

2.6.2. Sera from mice at 5, 10, 18 and 30 days post-induction of EAE were isolated by

saphenous vein bleeding. Blood was collected in Microvette® CB300 capillary tubes

(Starstedt), spun down at 2000 rcf for 10 mins and stored at -80°C (n=3 animals). ELISA

on both sRGMa and sRGMc protein levels present in the sera of mice were analyzed

using the ELISA kits for sRGMa (MRGMA0, R&D) and sRGMc (MRGMC0, R&D) as

described by the manufacturer. In brief, a standard was created using recombinant

sRGMa/sRGMc. Sera was diluted four fold using calibrator diluent RD5-18 (R&D). 50μl

of either standard, control or samples were added to capture antibody pre-coated plates

and incubated for 2 hrs at room temperature on a microplate shaker at 500 rpm. The wells

were then washed four times using 400μl of ELISA wash buffer (R&D). 100μl of mouse

RGMa or RGMc biotin-conjugated detection antibody was added to each well and

incubated for 2 hrs at room temperature on a horizontal shaker and subsequently washed

as before. 100μl of substrate solution (blue) was added in each well and incubated at

room temperature for 30 mins away from light prior to stopping color reaction with 100μl

stop solution (R&D), at which point the reaction turned yellow. The signal for each well

was recorded using a microplate reader at 450nm after which the unknowns were

interpolated from the standard curve.

38

2.6. Animal Subjects

2.6.1. Statement of Ethics

All animal experimentation was conducted in accordance with the guidelines of the

Canadian Council of Animal Care, and approved by the Toronto General and Western

Hospital animal care committee (Protocol 2988.1-3).

2.6.2. Experimental Autoimmune Encephalomyelitis Mouse Model

Six to eight week-old female C57BL/6 mice (Harlan laboratories) or 129S-Hfe2tm1Nca/J

(stock. No. 017788, Jackson Laboratories) and their wildtype control 129S1/SvImJ (stock.

No. 002448, Jackson Laboratories) were actively immunized by subcutaneous (s.c.)

injection of 50μg myelin oligodendrocyte glycoprotein (MOG) amino acids 35-55

(Sheldon Biotech, Montreal, QC) in incomplete Freund’s adjuvant (Sigma) supplemented

with 1mg of mycobacterium tuberculosis (CFA) (Difco, Detroit, MI). 400ng of pertussis

toxin (List Biologicals) was administered intraperitoneally (i.p.) on days 0 and 2 post-

immunization (Figure 2-2).

39

Figure 2-2 Generation of the experimental autoimmune encephalomyelitis (EAE) model. As seen on the timeline, an initial injection of MOG (35-55) aa, in an emulsion with CFA, is injected s.c. in the hind flank of mice. Subsequently mice are injected with an i.p. injection of pertussis toxin at day 0 and day 2-post-induction of EAE. The typical initial symptoms arise at days 10-12 following induction. This model leads to an acute ascending paralysis (tail > forelimb), which typically progresses and eventually plateau’s by day 20-22 post induction.

40

2.6.3 EAE Body Condition Score

We assessed clinical signs of EAE on the basis of the following scale: 0, no paralysis; 1,

loss of tail-tone reflex; 2, loss of righting reflex; 3, complete hind limb paralysis; 4,

forelimb weakness; 5, moribund or dead.

Intermediate scores (.5) were given for animals which did not meet the upper scale of

paralysis. A mean cumulative score was obtained from two reading per day at 12-hr

intervals.

Figure 2-3 Representation of the body condition score (BCS) index. Adapted from (172)

41

2.6.4 sRGMa and sRGMc Treatment Administration

To investigate the role of sRGMc mice were induced with EAE as described and were

treated with either: sRGMc, sRGMa, or vehicle (PBS).

In order to evaluate the role of sRGMc as a therapeutic target in EAE-induced mice,

20mM of purified sRGMC was administered either intra-venously (i.v.) at days 3, 6 and 9

or intra-peritoneally every three days for the duration of the disease.

To elucidate the physiological interaction between sRGMc and sRGMa in the EAE

model, a combination of sRGMc (20mM) in conjunction with 2 volumes of sRGMa

(40mM) was administered to mice induced with EAE using intra-peritoneal injections

every three days until time of sacrifice.

2.7 Flow Cytometry and Cytokine Staining

2.7.1 Cell Preparation

Mice were euthanized at day 10 post-induction of EAE. Freshly isolated spleens and

draining caudal lymph nodes (LN) were pressed using a syringe plunger through a 70μm

cell strainers and washed twice using 2mL of 2% FBS in complete RPMI-1640 medium

(Invitrogen) supplemented with 2-β Mercaptoethanol, L-glutamine, p/s, and non-essential

amino acids. Single-cell suspensions were lysed with 7mL of red blood cell (RBC) lysing

buffer (Life Technologies) and centrifuged at 700 rcf for 5 mins. After washing three

times with 2% RPMI-1640 medium, cells were counted and cultured as described below

or proceeding to cell surface staining.

2.7.2. Flow Cytometry and Intracellular Cytokine Staining

The expression of cell-surface markers and cytokine expression on splenocytes and LN

cells were characterized by flow cytometry. For analysis of naïve cells, 5x105 RBC

depleted splenocytes and LN cells were plated in 96-well V-bottom plates (Starstedt) and

blocked with 50μl of 1% mouse IgG in 2%FBS PBS supplemented with azide (PFN3) for

20 mins at 4°C. Cells were then stained with the following primary conjugated antibodies

for 30 mins on ice:

42

Antibody Clone Company

CD5 53-7.3 BioLegend

CD3 145-2C11 BioLegend

CD4 GK1.5 BioLegend

CD8 53-6.7 BioLegend

CD19 6D5 BioLegend

CD11b M1/70 BioLegend

CD11c N418 BioLegend

CD80 16-10A1 BioLegend

CD86 GL-1 BioLegend

CD44 IM7 BioLegend

MHC II M5/114.15.12 BioLegend

CD62L MEL-14 BioLegend

ICAM-1 (CD54) 3E2 BioLegend

IL-17A TC11-18H10.41 BioLegend

IFN-γ XMG1.2 BioLegend

All antibodies were re-suspended in PFN3. When required, cells were washed twice with

100μl of PFN3 and stained with secondary SA-APC, SA-APC-Cy7, SA-PeCy7, or SA-

Percp-Cy5.5 for 30 mins on ice. Cells were then washed twice with PFN3 and

resuspended in a PFN3 solution containing propidium iodide (PI) before proceeding to

FACS acquisitation.

For examination of intracellular cytokine production, 0.5x106 RBC depleted splenocytes

and LN cells were plated in 96-well flat bottom plates (BD Biosciences) in 10% FBS in

complete RPMI-1640 in the presence of 0.5μg/mL phorbol 12-myrisate 13-acetate

(PMA), 0.5μg/mL Ionomycin, and Golgistop (BD Biosciences) for 4 hrs. Cells were

subsequently washed in PBS and stained with Near-Infrared Live Dead (Life

Technologies) as described in the manufacturer’s protocol. Cells were then washed twice

in PFN3 and stained for cell surface markers as described previously. Cells were then

43

fixed with 100μl of Cytofix/Cytoperm solution as described in the manufacturer’s

protocol. For intracellular staning, cells were then stained with anti-IL-17A, and anti-

IFN-γ for 30 mins on ice, washed twice, and resuspended in PFN3 before proceeding to

FACS acquisition.

Nonspecific background staining was determined by using fluorochrome-matched isotype

antibodies and fluorescence minus one controls. Samples were acquired in a BD LSRII or

FACS CantoII cytometer (BD Biosciences). For each experiment, at least 100,000 live

events were acquired and analyzed using Flowjo software (Tree Star Inc.).

2.7.3 MOG-Specific Cytokine Expression and Proliferation

Mice were sacrificed on day 10 post-induction and single cells suspension of splenocytes

were harvested as described in section 2.7.1. 1x106 cells were cultured in 10% FBS

RPMI-1640 in the presence of 0μg/mL, 30μg/mL, or 100μg/mL of MOG peptide for 15

hrs. Cells were then treated with GolgiStop (BD Biosciences) and incubated an additional

3 hrs. Cells were subsequently stained as previously described.

For cytokine analysis by ELISA, 2 x 106 splenocytes were resuspended in 1mL of 10%

FBS RPMI-1640 medium and incubated in 24 well plates (BD Biosciences) in the

absence or presence of MOG (0, 30 μg/mL respectively) for 72 hours at 37°C, 5% CO2.

Plates were centrifuged at 1800rpm for 5minutes and the media was then harvested and

stored at -80C until analysis. Cytokine secretion of IL-17a, IL-6, TNF-α, and IFN-γ were

assessed using the BD cytometric Bead Array (CBA) (BD Biosciences) according to the

manufacturer guidelines.

Measuring the levels of CFSE incorporated into cellular membranes, using flow

cytometry, assessed proliferation of splenocytes. Splenocytes were harvested from mice

as described in 2.7.1 and stained with CFSE (Life Technologies) as described in the

manufacturers protocol. Briefly, 1x106 cells were re-suspended in warm PBS/0.1% BSA

and stained with CFSE solution at a final concentration of 5μM and incubated at 37°C for

10 mins. The staining was quenched using 5 volumes of ice-cold culture media and

incubated for 5 mins on ice. The cell solution was centrifuged at 700 rcf for 5 mins,

44

washed twice using culture medium, and re-suspended in 10% FBS complete RPMI-1640.

Cells were then cultured in presence of 0μg/mL or 30μg/mL of MOG (35-55) peptide for 72

hrs at 37°C, 5% CO2. Following incubation, cells were harvested, washed, and stained

with anti-CD3, -CD4, -CD5, as previously described. Proliferation was analyzed by flow

cytometry following staining in the presence of PI.

2.8 Immuno-Histochemistry Mice were induced with EAE and sacrificed two weeks following induction. Mice were

trans-cardially perfused with 20mL of PBS followed by 20mL of 4% paraformaldehyde

in PBS (PFA) (Electron Microscopy Sciences). Spinal cords were isolated and post-fixed

with 4% PFA overnight at 4◦C, washed three times with PBS and soaked in 30% sucrose

in PBS for 48 hrs. Tissues were then embedded in Optimal Cutting Temperature (OCT)

compound. Frozen sections of spinal cords were cut at 10-30μm with a cryostat, mounted

on gelatinized slides and dried for 2 hrs prior to being stored at -80°C. Sections were then

re-hydrated in PBS for 5 mins and permeabilized with PBST (0.3% Triton X-100 in PBS)

for 5 mins. The tissues were then blocked (PBS, 0.3% Triton X-100, 3% FBS) for 1 hr at

room temperature and then were incubated with primary antibodies overnight at 4°C in a

humidified chamber. The following primary antibodies were used:

45

Antibody Clone/cat no. Company

CD3 145-2C11 BioLegend

CD11b M1/70 BioLegend

B220 RA3-6B2 BioLegend

DAPI MMS-435P Sigma

Fibrinogen D9542 Innovative Research

2.9 Histological Staining A Luxol Fast Blue and Haematoxylin-Eosin (LHE) staining was carried out on EAE-

induced mice. At day 18 post-EAE induction mice were trans-cardially perfused and

30μm spinal cord cryosections were stained. The slides were washed in PBS for 3 mins,

followed by a 30 secs wash in 50% ethanol (EtOH) and an overnight incubation in Luxol

Fast Blue (LFB) at 60ºC. The sections underwent a series of washes in 95% EtOH for 5

mins and distilled water for 5 mins prior to de-staining with LiCO2 for 10 mins.

Following a 30 secs wash in 70% EtOH and a 5 mins wash in MilliQ H2O, sections were

immersed in Harris Hematoxylin (Sigma-Aldrich) for 20 mins. A 10 mins wash in warm

tap H2O was used for differentiation of the hematoxylin stain. Samples were dehydrated

in 95% EtOH and immersed in alcoholic eosin Y (Sigma-Aldrich) for 15 secs. This was

followed by dehydration in two changes of: 95% EtOH for 5 mins, 100% EtOH for 5

mins and xylene for 5 mins. Slides were mounted with Permount (Fisher Scientific) and

air-dried overnight at room temperature.

Cellular infiltration was quantified using an inflammatory index: 0, no inflammation; 1,

cellular infiltration only in the perivascular areas and meninges; 2, mild cellular

infiltration in the parenchyma (<10 cells); 3, moderate cellular infiltration in the

parenchyma (10-49 cells); 4, moderate cellular infiltration in the parenchyma (50-99

46

cells); and 5, severe cellular infiltration in parenchyma (>100 cells).

LFB staining was quantified using relative staining intensity using Image J software. All

intensities were normalized to a sham mouse spinal cord.

2.10 Blood Brain Barrier Permeability Assays

2.10.1. In Vitro BBB Permeability

b.End3-endothelial cells (ECs) were used to generate an in vitro model of the human

endothelial cell barrier lining the choroid plexus. b.end3-ECs were plated on

polyethylene-coated 0.4 µm pore size Boyden chambers (Corning) at a density of 2x105

cells per well in DMEM, and were allowed to grow for 72 hrs to reach confluency at

which point the confluency of the cells were verified using crystal violet staining. After

72hrs, cells were serum starved for 6 hrs and pre-treated for 4hr with RGMa modulators

(sRGMc 10μg/mL; C3 Transferase 10 μg/mL; Y27632 10 μM). RGMa was then added to

the wells for 18hrs. The transwells were then transferred to a new plate containing 500μl

of HBSS and 200μl 4-KDa Dextran-FITC (25mg/mL)(Sigma-Aldrich) was added to the

upper chambers. Tracer diffusion across the EC monolayer was assessed in 30 mins

intervals for a period of 1.5 hrs. The FITC signal, representing the amount of

extravasation through the monolayer, was analyzed with a microplate reader with a

485nm excitation and a 535nm emission.

2.10.2 In Vivo BBB Permeability

To establish the role of RGMc on BBB permeability, 6-8 week old C57Bl/6 female mice

(Harlan Laboratories) were induced with EAE and treated with sRGMc or vehicle, as

described in sections 2.6.2 (n=6 animals per group). Animals were subsequently

anesthetized 18 days post induction and trans-cardially perfused; spinal cords were cryo-

sectioned at 10μm thickness and stored at -80ºC. The sections were stained for:

Fibrinogen (Innovative Research); CD31 (Invitrogen); and DAPI (Sigma-Aldrich). The

area (number of pixels) and fluorescent intensity (mean pixel intensity) of the

extravasation markers were measured using CellSens (Olympus). The relative extent of

fluorescent extravasation and BBB disruption was then calculated by multiplying the area

with the fluorescent intensity.

47

2.11 Microscopy

All images were obtained using a BX61 confocal microscope (Olympus). CellSens

software was used for quantification of cell area and pixel intensity.

2.12 Statistical Analysis

Data were analyzed using GraphPad Prism software. Student’s t-tests and two-way

ANOVA were used for direct comparisons between two groups. For comparisons

between multiple groups, one-way ANOVA with Bonferroni post-hoc correction for

multiple comparisons was utilized. Significance was set at p<0.05 (*); p<0.01 (**);

p<0.001 (***). For every figure, mean and standard error of the mean (SEM) are

presented.

48

Chapter 3: Results

49

Aim I: RGMc expression is modulated in the sera of EAE-induced mice 3.1 RGMc is down regulated in the EAE model.

To determine if levels of RGMc were modulated in EAE-induced animals, 3 mice

were induced (section 2.6.2) and sera was collected from the saphenous vein at days 5, 10,

18, and 30 post induction. The collected sera was compared to the sera of 3 control mice

and analyzed for its RGMc protein content using a commercially available RGMc ELISA

kit. A striking difference was observed in levels of RGMc, which were significantly

reduced by day 5 post-induction and remained decreased for the duration of the disease

course, reaching a 4-fold decrease at 30 days post induction (**p<0.001).

In order to confirm this finding, sera from 3 mice were analyzed by western blot

at day 18 post-induction and compared to control animals. The RGMc proteins levels

were normalized to transferrin signal intensity (loading control) and can be visualized in

Figure 3-1 (*p<0.05). Thus, we demonstrate for the first time a significant relationship

between early development of EAE and reduced levels of RGMc circulating in the serum.

50

Figure 3-1 RGMc levels are decreased in EAE. A) RGMc protein expression was analyzed using an RGMc ELISA kit on sera of EAE-induced mice at days 5, 10, 18, and 30 (n=3) B) 50ug of sera from EAE-induced mice was analyzed by Western blot showing decreased RGMc levels when compared to control animals. Quantification of RGMc levels is normalized to transferrin (n=3).

51

3.2 RGMc over-expression ameliorates clinical severity of EAE-induced mice

The observation that RGMc protein levels were significantly reduced following

induction of EAE led us to further investigate its role in the EAE model. In an effort to do

so, a construct was generated expressing soluble RGMc (sRGMc) in a PsecTag2B

expression plasmid. The plasmid containing a his-tag was used to characterize the

expression of sRGMc in HEK293 stable cell lines. A coomassie stain was also carried out

to identify the purity of the protein. sRGMc has a predicted molecular weight of ~ 50KDa

in non-reducing conditions and is illustrated in Figure 3-2.

Subsequently, mice were induced with EAE and were treated with repeated intra-

venous injections of sRGMc at days 3, 6, and 9 post induction. To ensure that over-

expression of sRGMc was efficient, sera from 3 RGMc-treated mice were collected and

compared to 3 vehicle-treated mice 24 hours post-treatment using an ELISA. Mice

treated with sRGMc i.v. displayed a 3-fold increase in sRGMc levels compared to

vehicle-treated animals. The mice were then observed and scored twice daily at 12 hr

intervals for 18 days. The treatment resulted in a significant decrease in clinical severity

of the disease (Figure 3-2, B) (***p<0.001). However, RGMc-treated animals developed

clinical symptoms by day 14 post induction, suggesting a transient effect of our treatment.

To address this limitation in our treatment, sRGMc was injected intra-peritoneally

every three days for the duration of the disease. The alternate administration route of

sRGMc, as seen in Figure 3-2 B, was shown to significantly abrogate disease severity,

decrease the incidence of EAE onset (Figure 3-2 C), and delay the onset of disease

(Figure 3-2 D).

Overall, over-expression of sRGMc in EAE-induced mice is beneficial in

reducing the incidence and the severity as well as delaying the onset of disease.

52

Figure 3-2 sRGMc decreases clinical severity of EAE-induced mice. A) Expression of sRGMc was analyzed by Western blot under non-reducing conditions. The purified protein was then analyzed by coomassie staining, B) sRGMc treatment both i.v. and i.p. (20mM, injected at days 3, 6, and 9 or every 3 days for the duration of disease course; arrowheads) reduces the clinical severity of EAE-induced mice (i.v. n=10; i.p. n=15), sRGMc reduces: C) the incidence of EAE (n=15), and delays the D) day of onset of EAE (n=15). E) sRGMc treatment is stable for 24 hrs post treatment and restores sRGMC levels to control levels, as observed by ELISA (n=3).

53

3.3 RGMc is crucial both pre- and post-symptomatically.

To specifically assess the role of RGMc in the development of EAE, we obtained

mice with a selective homozygous deletion of RGMc (129S-Hfe2tm1Nca/J). These mice

recapitulate symptoms of JH, with early onset iron overload as well as low hepcidin

levels. Female mice aged between 6-9 weeks were induced as described in section 2.6.2.

Deletion of RGMc was associated with a trend towards an increase in disease severity as

well as percentage of incidence (Figure 3-3). Thus, we provide evidence that genetic

neutralization of RGMc may result in an exacerbated disease phenotype marked by an

increased paralysis and a higher incidence of the disease.

54

Figure 3-3 RGMc KO show a possible susceptibility to EAE. A) Selective deletion of RGMc in EAE-induced mice results in an exacerbated clinical severity when compared to wild-type controls (n=10). No significant difference in B) the day of onset of EAE was observed in RGMc knockout animals when compared to their control (n=10), C) EAE incidence is observed in RGMc knockout animals when compared to their control (n=10).

55

Aim II: A relationship exists between RGMa and RGMc 3.4 sRGMa is up-regulated in our EAE model and is crucial in the development of the disease Nascent studies have demonstrated that ensuing the onset of EAE; membrane-

bound RGMa is up regulated on the surface of immune cells, which increased their

activation and subsequent extravasation to the CNS (140, 142). Recently, RGMa was

shown to undergo complex post-translational processing resulting in many biologically

active soluble fragments (114). Thus, we set out to analyze the levels of RGMa in the

sera of mice induced with EAE at days 5, 10, 18 and 30-post induction. Figure 3-4 A

shows the expression levels of soluble RGMa present in EAE induced-mice. We observe

a dramatic increase (5-fold) in levels of RGMa in the sera which maintains elevated for

the duration of the disease (**p<0.001). Thus, both sRGMa and sRGMc co-exist in the

sera and possess contrasting expression levels in EAE-induced mice.

To further analyze the role of sRGMc and sRGMa physiologically, we tested

whether the interaction of these proteins in the sera were crucial in the development of

EAE. Thus, mice were induced with EAE and treated with either: 1) sRGMc, 2) sRGMc

in conjunction with sRGMa, or 3) vehicle. A striking observation was made, whereby the

reduced clinical severity in sRGMc-treated mice was abolished when supplemented with

sRGMa (**p<0.001).

The observation that both proteins share contrasting expression levels during EAE,

and that they both share the same receptor to mediate their signaling (119, 156), led us to

investigate the possibility for these proteins to interfere with each others’ signaling.

Constructs over-expressing sRGMa, sRGMc and the extracellular domains of Neogenin

(Ec-Neogenin) were generated in a PsecTag2B vector. To evaluate the competition

between sRGMc and sRGMa, an in vitro competition assay was used. Briefly, sRGMc

was coated on a microtiter plate and blocked. Ec-Neogenin-AP tagged was co-incubated

with sRGMa or BSA and added to the RGMc-coated wells. Following several washes,

the wells were developed using AP developing buffer.

56

Figure 3-4 C demonstrates that pre-incubation of sRGMa with Ec-Neogenin-AP

resulted in a 3-fold reduction binding intensity of RGMc to Neogenin when compared to

BSA control. The reversal experiment showed a similar abrogation of binding intensity to

Neogenin. Overall, we show that sRGMa is able to interfere with sRGMc by interacting

on non-overlapping binding sites in Neogenin and vice-versa.

Here, we show for the first time that two molecules from the same protein family

are able to compete and regulate each other’s binding to their receptor. Furthermore, we

show that sRGMa is critical in the development of EAE.

57

Figure 3-4 sRGMa is up regulated in EAE and interferes with sRGMc for binding to Neogenin. A) sRGMa expression is increased in the sera of mice induced with EAE at days 5, 10, 18, and 30, as analyzed using an RGMa ELISA kit (n=3), B) The graph shows EAE scores of 6 week-old EAE-induced mice treated every three days with sRGMc (20mM), vehicle, or sRGMc (20mM) in conjunction with sRGMa (40mM)(n=10), C) Bar graph on the left shows: sRGMa-AP or sRGMc-AP were incubated on plates coated with Neogenin, Neogenin + sRGMa, or Neogenin + sRGMc to assess binding competition between sRGMa and sRGMc proteins to Neogenin (n=3, performed in triplicates). The reversal experiment was carried out and is shown in the bar graph on the right hand side.

58

Aim III: RGMc modulates the molecular activation of the adaptive immune system 3.5 RGMc treatment does not affect T-cell priming and activation i) sRGMc Has No impact on Naïve Immune Cells

Recent reports show that the RGMa-Neogenin signaling pathway is able to

modulate T cell priming and promote their activation by up-regulating small GTPases

such as Rap1. Activation of Rap1 increases the adhesion profile of T cells as well as their

infiltration within the CNS (142). The analysis that sRGMc was able to interefere with

the interaction between sRGMa and Neogenin in vitro prompted us to investigate its role

in modulating the immune system.

In order to assess whether sRGMc could affect the priming of immune cells, both

the distribution and activation of naïve immune cells of EAE-induced mice was analyzed.

Splenocytes from day 10 RGMc-treated mice were analyzed by flow cytometry and

compared to the vehicle-treated group. As portrayed in Figure 3-5 and 3-6, RGMc

treatment does not modulate the distribution of effector cells, as seen by the CD3+, CD8+,

and CD4+ T cells. Moreover, both the distributions and activation of dendritic cells

(CD11c+), and B cells (MHC II, CD80+/CD86+) were unaltered.

59

Figure 3-5 sRGMc has no effect on naïve immune cell populations. Mice induced with EAE were sacrificed 10 days post induction and splenocytes were harvested and stained as described. No difference was observed in the percentage of B cells, T cells, or MHC II on B cells in RGMc-treated versus vehicle-treated animals (n=15).

60

Figure 3-6 sRGMc treatment has no effect on naïve antigen-presenting cells. Mice induced with EAE were sacrificed 10 days post induction and splenocytes were analyzed for the percentage of A) CD11c (dendritic cell), B) CD11b (myeloid cell). sRGMc does not impact the activation of B cells, as seen using co-activation markers C) CD80 on B cells, D) CD86 on B cells. (n=15).

The infiltration of leukocytes into the CNS is a key stage in the acute phase of

EAE. As a result, we wondered whether sRGMc could modulate the ability of T cells to

migrate into the CNS. To migrate into the parenchyma, immune cells must overexpress a

variety of cellular adhesion proteins. Thus, both naive splenocytes and lymph node cells

were analyzed for their expression of adhesion markers, namely ICAM-1 and CD62L. As

depicted in Figure 3-7, sRGMc does not modify the expression of adhesion markers on

the surface of CD4+ and CD8+ T cells as well as B cells.

61

Figure 3-7 sRGMc treatment has no effect on the adhesion protperties of naïve T and B cells. Mice induced with EAE were sacrificed at 10 days post induction and splenocytes were analyzed for their A) levels of ICAM-1 expression on B cell, B) ICAM-1 expression on CD8+ T cells, C) ICAM-1 and CD62L expressino in CD4+T cells. (n=15).

62

ii) sRGMc Treatment Does Not Modulate Activated Immune Cells Muramatsu and colleagues (2011) demonstrated that the expression of RGMa, on

the surface of bone marrow-derived dendritic cells, could prime and activate CD4+ T

cells through its interaction with Neogenin. Treatment with a polyclonal RGMa-antibody

could diminish this activation, as seen by a reduced secretion of IL-17 and IFN-γ (142).

Previously, we showed that sRGMc can also interfere with RGMa for its binding to

Neogenin. Consequently, we explored whether sRGMc treatment was able to modulate

the activation profile of immune cells. Mice were induced with EAE and treated with

sRGMc or vehicle. Splenocytes and draining lymph node cells were harvested and

stimulated with PMA and ionomycin and stained for IL-17 and IFN-γ. However, sRGMc

was unable to modulate the expression profile of IL-17 and IFN-γ secreted by CD4+ T

cells (Figure 3-8). In our EAE model, CD4+ T cells are specifically primed towards MOG (35-55)

peptide. Since the activation profile of immune cells is dependent on their antigen

recognition, we tested whether presenting sRGMc-treated immune cells with MOG (35-55)

peptide would modulate the activation potential splenocytes when compared to controls.

We immunized C57/BL6 mice with MOG(35-55), followed by treatment with either

sRGMc or vehicle and harvested splenocytes 10 days post induction. Splenocytes were

then re-stimulated with MOG(35-55) peptide for 18 hrs and analyzed their cytokine profile.

Again, no apparent effect was seen in RGMc-treated mice when compared to control

mice (Figure 3-9). These findings were confirmed using an ELISA on media collected

from splenocytes pulsed with MOG(35-55) for 3 days (Appendix A).

63

Figure 3-8 sRGMc has no effect on activated immune cells. Mice were induced with EAE and sacrific ed 10 days post induction. A) splenocytes were harvested and stimulated using PMA and Ionomycin and analyzed for the expression of activated CD4+T cells secreting IL-17A or IFN-γ. (n=15). B) Draining lymph nodes (caudal, sciatic, lumbar) cells were also analyzed as described (n=15).

64

Figure 3-9 sRGMc has no effect on antigen-specific immune cells. Mice were induced with EAE and splenocytes were harvested 10 days post induction A) CD4+T cell proliferation was measured using CFSE incorportion in splenocytes treated with 0 or 30ug/mL of MOG(35-55), B) Levels of IL-17 and IFN-γ in splenocytes pulsed with 0, 30, or 100μg/mL MOG(35-55) were analyzed. (n=15).

65

3.6 RGMc affects the infiltration of leukocytes in the CNS

EAE is characterized by broad infiltration of immune cells within the CNS

followed by de-myelination, both of which contribute to the clinical severity of the

disease (80). We therefore explored whether sRGMc treatment was able to modulate the

extent of leukocyte present within the CNS of EAE-induced mice. Cervical spinal cord

sections were stained histologically using hemotoxylin and Eosin in combination with

luxol fast blue. Figure 3-5 depicts the spinal cord histology of both vehicle- or sRGMc-

treated animals. Strikingly, both the extent of cellular infiltrates and de-myelination of

sRGMc-treated animals were significantly reduced when compared to vehicle-treated

animals (**p<0.001). In addition to infiltrating within the spinal cord, immune cells have

been shown to infiltrate extensively in both the brain and the optic nerve of EAE-induced

mice. Moreover, in early phases of MS, patients present with inflammation of the optic

nerve, known as optic neuritis (173). We show preliminary data that treatment with

sRGMc reduced the extent of leukocyte infiltration in the retina of EAE-induced mice

(Appendix B).

To further typify the profile of cellular infiltrates within the spinal cord of EAE-

induced mice, spinal cords were stained for: 1) CD3: a pan T cell marker, B220: a pan B

cell marker, and CD11b: a pan myeloid cell marker. In order to analyze the extravasation

pattern of each cell type within the spinal cord of EAE-induced mice, spinal cords were

divided into 7 patterns of infiltration (Appendices C, D, and E). Figure 3-6 shows

representative images for the infiltration of CD3+, B220+, and Cd11b+ cell. As a whole,

RGMc-treated animals possessed a significantly decreased amount of cellular infiltrates

across all markers.

These data reflect that sRGMc treatment can reduce the extent of leukocyte

infiltration present within CNS of EAE-induced mice, correlated with a reduction of

CD3+, CD11b+, and B220+ cells present in the spinal cords. Furthermore, sRGMc

treatment is associated with a preserved myelination profile in contrast to vehicle-treated

animals.

66

Figure 3-10 sRGMc treatment reduces the number of cellular infiltrates and the extent of de-myelination in EAE-induced mice. Mice induced with EAE were trans-cardially perfused 18 days post induction and stained with H&E in combination with Luxol fast blue. A) sRGMc-treated mice show less de-myelinating foci in cervical spinal cord sections of EAE-induced mice. sRGMc-treated mice possess: B) a greater mean pixel intensity of Luxol fast blue staining compared to vehicle-treated animals (normalized to a sham animal), and a C) decreased inflammatory index (n=6 per group).

67

Figure 3-11 sRGMc reduces the amount of immune infiltrates in the spinal cord of EAE-induced mice. Day 18 EAE-induced mice treated with either sRGMc or vehicle were trans-cardially perfused with 1X PBS and 4% PFA in 1X PBS. A) Representative images of EAE-induced mice cervical spinal cords were cryo-sectioned and subsequently stained using CD3, CD11b, or B220 surface markers. B) A quantitative analysis of CD3+, CD11b+ and B220+ cells in 7 regions of the spinal cord sections (shown in Appendix C-E)(n=6 per group).

68

3.7 sRGMc decreases BBB EC permeability RGMa signaling is dependent on its interaction with Neogenin by activating

downstream cytoskeletal remodeling proteins, such as RhoA (174). Of interest, RhoA

signaling has extensively been shown to modulate the integrity of the blood-brain EC

barrier (175). The BBB synchronizes the homeostasis of the CNS, regulating the passage

of leukocytes into the parenchyma. Moreover, BBB disruption is a key marker of both

EAE and MS, which leads to the subsequent infiltration of immune cells within the CNS

(102). Based on our previous observations, we speculated whether sRGMc could

interfere with sRGMa to restore BBB integrity. To test this exciting theory, a murine

brain-derived cell line (b.end3) was obtained to replicate an in vitro model of the blood-

brain EC barrier. Using both immunohistochemistry and western blot analysis of b.end3

cells, we show that Neogenin is strongly expressed on the surface of these cells, as shown

in Figure 3-12.

We next assessed the role of sRGMa on BBB permeability using a 4-KDa

Dextran conjugated to a FITC fluorochrome (Dextran-FITC). b.end3 cells were allowed

to form a monolayer on Boyden chambers (Figure 3-12 C) and were subsequently treated

with sRGMa , sRGMa blocking peptides for 4 hrs. Extravasation of Dextran-FITC was

assessed every 30 mins for a period of one hour and half. Treatment of sRGMa increased

the extravasation of Dextran-FITC when compared to vehicle-treated wells. Treatment

with either C3 Transferase (Rho inhibitor) or Y27632 (Rho Kinase inhibitor) reduced the

extravasation of Dextran-FITC (Figure 3-12). Because sRGMc reproduced the

RhoA/RhoK inhibitor effect, we conclude that sRGMc diminishes the RGMa-mediated

blood-brain EC barrier permeability, thus preventing infiltration of leukocytes in the CNS.

69

Figure 3-12 sRGMc decreases BBB EC permeability by interfering with RGMa-mediated Rho activation. A) Neogenin expression was analyzed on the membrane of b.end3 cells using immunohistochemistical staining and by Western blot. Shown are changes in b.end3 cell permeability (B) crysal violet staining shows the b.end3 cell monolayer, C) a representative diagram of the boyden chamber set up, D) b.end3 cells were serum-starved for 6 hours followed by a 4hr pre-treatment of sRGMa modulators: C3 Transferase (10μg/mL) or Y27632 (10μM) or sRGMc (10μg/mL). Cells were finally treated with sRGMa (5μg/mL) for 18hours at which point a 4-KDa Dextran-FITC was seeded into the upper chamber and the extravasation was measured over a period of 60 minutes (n=3, performed in triplicates).

70

To further confirm the role of sRGMc in maintaining blood-brain EC barrier

integrity, we tested these findings in vivo. First, we examined whether Neogenin was

expressed in endothelial cells lining the BBB of mice. A sham mouse spinal cord was

stained with: anti-CD31 to localize the presence of endothelial cells, DAPI to localize the

nuclei of cell, as well as Neogenin. As shown in Figure 3-13, Neogenin is widely

expressed in the spinal cord and co-localizes with CD31 staining. Thus, Neogenin is

expressed on the surface of endothelial cells in the mouse spinal cord.

We next went on to ask whether sRGMc treatment had an effect on the integrity

of the BBB following the induction of EAE. To this purpose, mice were induced with

EAE and trans-cardially perfused 18 days post induction. The spinal cords of RGMc-

treated and vehicle-treated mice were stained with three markers: 1) Fibrinogen: a small

plasma protein unable to cross the BBB under normal conditions 2) CD31 and 3) DAPI.

Figure 3-14 demonstrates the extent of extravasation of endogenous fibrinogen observed

in EAE-induced animals treated with vehicle. In sharp contrast, animals treated with

sRGMc showed a significant decrease in fibrinogen extravasation, indicative of a

preserved BBB integrity. The degree of extravasation was quantified by measuring the

relative pixel intensity of fibrinogen in EAE-induced animals normalized to a sham

animal (*p<0.05).

71

Figure 3-13 Neogenin is expressed in endothelial cells in the mouse spinal cord. (A) Immunohistochemical staining for Neogenin expression was carried out in cervical spinal cord sections of naïve mice. Neogenin (red) is shown to strongly co-localize with endothelial cells as seen with CD31 staining (green).

72

Figure 3-14 sRGMc reduces BBB permeability. (A) Immunohistochemical staining of cervical spinal cords of 18 days EAE-induced mice treated every 3 days with sRGMc or vehicle. The extent of Fibrinogen extravasation (red, arrowheads) accumulates around blood vessels (CD31, green, asterisks). Nuclei were stained using DAPI (blue). sRGMc-treated animals show a reduced extravasation of Fibrinogen when compared to vehicle-treated animals. Scale bars, 50μm. B) A quantitative analysis of perivascular extravasation of Fibrinogen by relative pixel intensity in sRGMc-treated and vehicle-treated animals (n=6).

73

Chapter 4: Discussion

Emerging studies have demonstrated the role of RGMa in the development of MS

(169). Furthermore, its interaction with Neogenin was shown to increase the adhesion of

infiltrating leukocytes in the CNS of EAE mice (142). In this study we show for the first

time that sRGMa present in the serum is up regulated following the induction of EAE and

is able to increase the blood-brain EC barrier permeability, thereby increasing the

infiltration of leukocytes within the CNS. The third member of the RGM family, RGMc,

undergoes post-translational processing to generate soluble fragments present in the

serum. Our study identifies a previously uncharacterized function for the iron regulatory

protein RGMc, whereby its expression in the sera of EAE-induced mice is significantly

down regulated. Over-expression of sRGMc reduced the clinical severity in EAE-induced

mice. RGMc knockout animals develop a worse disease progression that their wild-type

control. Moreover, sRGMc treatment both diminished the extent of blood-borne proteins

and the amount of leukocytes extravasating in the CNS. Lastly, we show this effect is

mediated through the competition of these proteins for their receptor Neogenin on the

endothelium of the BBB. Together, our data supports an entirely novel molecular

mechanism between two members of the RGM family and their regulation in the

development of EAE.

74

4.1 Soluble RGMa and RGMc are Differentially Regulated in EAE. Our findings show that following the induction of EAE, both RGMa and RGMc

levels are modulated prior to the onset of symptoms. In particular, sRGMc levels are

significantly reduced in the sera of EAE mice. We believe reduced sRGMc levels are

strongly associated with disease progression, as exogenous expression of sRGMc in these

EAE mice reverts the clinical severity. In agreement with this observation is the finding

that the axon guidance molecule Netrin-1 expression is significantly down regulated

during acute pulmonary inflammation and co-incides with the extensive influx of

leukocytes at the site of injury (176).

A complex physiological interplay exists between sRGMa and sRGMc. In support

of this argument is the finding that alleviation of EAE paralysis observed in sRGMc-

treated mice is completely abolished when co-injected with sRGMa. This interesting

observation pointed us to further analyze the relationship between these two molecules.

Using an in vitro competition assay we identified a novel molecular interplay between

these molecules whereby both proteins compete for the same receptor, Neogenin. From

the literature, we know that the binding site of RGMa (FNIII (3-4)) differs from that of

RGMc on Neogenin (FNIII (5-6)). Thus, we believe these molecules must regulate each

other’s binding through either negative allosteric modulation or by steric hindrance on

Neogenin. Interestingly, another axon guidance molecule was shown to replicate this

same effect. Recently, the axon guidance molecule Netrin-1 was also shown to bind the

RGM receptor Neogenin (117). The precise binding site of Netrin-1 was mapped on the

Neogenin FNIII (4-5) domains. Prior studies had identified that pre-incubation of PC12

neurites with Netrin-1 reduced the repulsive phenotype observed by RGMa (174, 177).

Hence, Netrin-1 is able to functionally inhibit RGMa-mediated axonal inhibition. It

remains unclear whether Netrin-1 mediates its effect by directly interfering with RGMa

binding to Neogenin or whether it can indirectly activate downstream positive signaling

(cdc42) and counteracting negative axonal cue (RhoA). Of importance, the binding

affinity of Netrin-1 toward Neogenin was found to be much lower than that of RGMa to

Neogenin (119). Thus, the binding affinity of both sRGMa and sRGMc on Neogenin

must be studied in order to better understand their binding profiles.

75

4.2 sRGMc and the immune system

Cell migration is crucial for immune cells to attain their desired location. Thus,

the appropriate ligands must be secreted in order for these cells to target to the

appropriate sites. As with every system, the immune system must possess inhibitory cues

to prevent the migration of cells into inappropriate areas. Recently, the role of axon

guidance molecules in immune regulation have been outlined. The guidance cues

function very similarly to chemokine cues by re-modeling the actin cytoskeleton of

extending neurites. Thus it comes as no surprise that axon guidance molecules have

emerged as potential regulators of leukocyte migration. One particular axon guidance

molecule, the Slit family of secreted glycoproteins has been found to modulate the

immune cells. These studies along with a growing body of literature began to link the role

of axon guidance molecules with the immune system (176, 178, 179).

The Slit molecules consist of three isoforms (1-3), which bind to an

immunoglobulin receptor Roundabout (Robo). There are four Robo receptors (1-4) Robo-

1 is highly expressed on the surface of immune cells whereas Robo-4 is expressed on the

surface of endothelial cells (180). Upon binding to Robo-1, Slit-2 is able to activate

secondary messenger small guanosine trinucleotide phosphatase (GTPase), which can

further activate cytoskeletal remodeling proteins such as cdc42, Rac1, and RhoA (181).

Slit2 could inhibit lymphocyte and neutrophil trans-endothelial migration both in vitro

and in vivo (182-184). In contrast to these findings, our study failed to show an immune

regulatory effect of sRGMc treatment in EAE-induced animals.

Although sRGMc showed poor effect on immune cell activation and priming, it

remains to be investigated whether sRGMc can modulate the expression of chemokine

ligands expressed on the surface of endothelial cells and whether sRGMc can modulate

the expression of chemokine receptors expressed by infiltrating leukocytes.

76

4.2 sRGMc Increases Blood-Brain EC Barrier Stability Axon Guidance Molecules and the Blood-Brain Barrier

Our data provide evidence for the first time of sRGMc in reducing BBB

permeability, as shown by a decrease in endogenous fibrinogen extravasation in EAE

mice. Recent studies in agreement with our observations have eluted to the role of the

axonal guidance molecule Netrin-1 in BBB permeability. Wen and colleagues (2014)

showed that over-expression of Netrin-1, using gene transfer in a mouse model of

traumatic brain injury led to a decrease in Evans Blue extravasation within the CNS (185,

186). Moreover, the group identified an increase in TJ levels in Netrin-1 treated animals.

However, the molecular mechanism for this phenotype has not yet been established.

In addition to mediating inhibitory chemotactic stimuli, the Slit-Robo family was

also shown to mediate endothelial cell integrity. For instance, by binding Robo-4 on the

surface of endothelial cells, Slit-2 is able to prevent BBB leakage associated with viral

sepsis (187, 188). It did so by down-regulating the expression of endothelial cell adhesion

molecules following inflammation and reduced the extent of both neutrophilic and

monocytic infiltrates (184, 189).

The Small GTPase Rho and the Blood-Brain Barrier

Here, we propose a model wherein sRGMa can increase BBB permeability by

activating the small GTPase RhoA. This small GTPase family is comprised of RhoA,

Rac1, and CDC42, provide a link between membrane receptors and cytoskeletal

remodeling via actin assembly and disassembly. Indeed, the repulsive function of RGMa

on projecting growth cones is mediated by the downstream activation of RhoA (139). In

addition, numerous axon guidance molecules have been shown to activate the Rho

signaling pathway to mediate their guidance cues (190). The direct downstream effector

of RhoA is Rho kinase (ROCK), which is a serine/threonine protein kinase.

77

An extensive body of research supports the role RhoA in BBB permeability (174,

191, 192). RhoA has been shown to modulate the expression of TJ on the surface of ECs

(175). TJ are localized at cell-cell sites on ECs of the BBB and serve as a para-cellular

barrier for the BBB. The molecular components of the TJ are comprised of two classes of

peripheral membrane proteins: the Claudins, and the Occludins. These proteins are

embedded to the actin cytoskeleton of the ECs by accessory Zonula-Occludens proteins

(Zo-1, and -2) (108). Together these proteins maintain the structural integrity of the BBB.

The expression pattern of both Claudin-5 as well as Occludin was shown to be mainly

restricted to the CNS, making these TJ proteins significantly interesting to study (193,

194).

TJ regulation is dynamically regulated by actin cytoskeletal re-arrangement.

Studies have shown that migration of leukocytes into the CNS is mediated through

monocyte-ECs contact resulted in RhoA activation and the subsequent claudin-

5/Occludin phosphorylation (175). Inhibition of both RhoA as well as ROCK ameliorates

BBB integrity, as shown by up regulation of TJ, decrease in monocytic infiltrates (by

90%), and decreased phosphorylation of claudin-5/Occludin (195). Phosphorylation of

Claudin-5/Occludin leads to the translocation of these proteins from the membrane of

ECs and results in loss of intercellular contacts (196, 197). Furthermore, activation of

RhoA in cells results in morphological retraction of brain-derived endothelial cells (198).

The phosphorylation site on these TJ proteins is crucial for their binding to accessory

proteins, such as the ZO (199).

Cross-talk Between the Sonic Hedgehog and Neogenin pathways in Blood-Brain Barrier Permeability The BBB is a multicellular vascular structure where the astrocyte-endothelial cell

integration is known to regulate the BBB permeability. Astrocytes can produce factors

which can modulate the ECs lining the BBB (99). One of these released factors is the

Sonic Hedgehog (sHh). Alvarez et al. showed that astrocyte can secrete sHh and

modulate BBB integrity through its binding to the Smoothened (Smo) and Patched-1

78

(ptch-1) receptors expressed on the surface of ECs. Moreover, activation of Smo can

increase the activation of downstream transcription factor Gli-1, also expressed in ECs. In

this study, stimulation of the sHh pathway from astrocytes led to an up regulation of TJs

within ECs promoting integrity of the BBB. Furthermore, blocking this pathway

generated a widespread permeability phenotype with extensive blood-borne protein

leakage within the CNS as well as an increased clinical severity of EAE (110).

Recent reports have shown that the morphogen sHh, can regulate the expression

of Neogenin in both mice and humans (200, 201). During limb development, Neogenin

has been shown to act as a negative regulator to the sHh pathway (202). Hong and

colleagues suggest that Neogenin could serve in parallel to ptch-1 by negatively

regulating sHh function. Thus, a possible mechanism in which sHh-mediated BBB

integrity can be inhibited by RGMa signaling through Neogenin would be interesting to

investigate.

79

4.3 Working model The findings portrayed in this document along with the literature extend a

working model through which Neogenin can mediate BBB integrity. We believe

Neogenin is a crucial receptor in the regulation of BBB permeability through various

ways:

1. Muramatsu and colleagues have identified the role of membrane-bound RGMa in

bone marrow-derived dendritic cells in priming CD4+ T cells. This model

describes that interaction between RGMa and Neogenin activates a downstream

GTPase Rap1. Upon activation, Rap1 can mediate the expression of Leukocyte

function-associated antigen-1 (LFA-1) which promotes leukocyte migration

within the CNS (142).

2. Our findings uncover a novel role of Neogenin in BBB integrity, whereby soluble

RGMa can interact with Neogenin to activate downstream secondary messenger

RhoA. This activation leads to the phosphorylation of TJs (Claudin-5 and

Occludin) mediated by Rho Kinase. Upon phosphorylation, TJs are unable to bind

the Zonula-Occludens and translocate away from the paracellular membrane of

endothelial cells. This results in gap formation in the endothelium of the BBB and

the subsequent infiltration of leukocytes.

3. A third mechanism may also be at play. In this mechanism, parallel activation of

Neogenin by sRGMa can inhibit the activation of Gli-1 and reduce the expression

of TJs in ECs. This reduced expression of TJs creates gaps in the endothelium and

leads to the subsequent infiltration of leukocytes within the CNS.

80

Figure 4-1 Neogenin and the Blood-Brain Barrier. Our working model whereby Neogenin modulates the integrity of the BBB in various ways: 1) Interaction between RGMa on dendritic cells and Neogenin on the surface of CD4+ T cells increases Rap1 activation and LFA-1 expression. This increased LFA-1 expression increases the adhesion profile of circulating CD4+ T cells on the endothelium of the BBB, enhancing their ability to transmigrate into the CNS. 2) The interaction between sRGMa and Neogenin expressed on the endothelium of the BBB increases the activation of secondary messenger RhoA. This increased RhoA activation leads to the phosphorylation of TJ by RhoK and the subsequent translocation of TJ away from the paracellular sites creating gaps into which circulating leukocytes can migrate though. 3) Neogenin acts in parallel to Ptch-1 by inhibiting Smo activity. This Smo inhibition reduces the Gli-1 mediated expression of TJ, reducing the integrity of the BBB.

81

4.4 Future Directions

In light of our recent studies, we support a model through which increasing levels of

sRGMa present in the serum in EAE leads to the de-stabilization of the BBB endothelium,

accentuating the infiltration of leukocytes within the CNS. To further strengthen this

theory, the following experiment must be addressed.

How does RGMa mediate BBB permeabilization? Whilst our studies have begun to elucidate the molecular mechanism mediating BBB

permeability, further experiments must be done to identify the direct interplay between

sRGMa and RhoA-mediated TJ phosphorylation. Thus, it would be crucial to carry out an

activation assay of the downstream effector RhoA in b.end3 cells treated with sRGMa, or

sRGMa antagonists (C3-transferase, Y27632, sRGMc). Furthermore, activation of

Neogenin through sRGMa should result in an increased expression of phosphorylated

Claudin-5 and Occludin-1.

What is the role of sRGMc on Iron in EAE? In both EAE and MS, higher levels of iron are observed than in aged-matched controls

(39). Furthermore, polymorphisms associated with iron regulatory pathways such as

HEPC have been associated with an increased risk for MS (37). In addition, the

understanding behind the accumulation of iron in both EAE and MS are poorly

understood. In this study, our focus remained on the competition between sRGMc with

sRGMa. However, RGMc plays a critical role in the regulation of iron upstream of

hepcidin (165). The first crucial experiment will be to identify where is the source of

soluble RGMc affecting the BBB. In an attempt to address this question we have

obtained liver specific RGMc conditional knockout animals (albumin-cre promoter)(162).

Using this exciting approach we will test whether liver-specific RGMc knockout renders

animals more susceptible to EAE. We further propose the following, wherein the tight

regulation observed in our findings between both RGMa and RGMc provide the

physiological model for the interplay between iron regulation and immune quiescence

present in MS. The up regulation of RGMa results in the aberrant immune responses

leading to autoimmunity whereas the reduced RGMc levels may be the cause of the iron

82

overload observed in MS. Additionally, the iron overload observed in MS has been

linked to the generation of reactive oxygen and nitrogen species (43). Therefore, our

treatment may provide a neuro-protective mechanism by regulating iron levels and

diminishing oxidative burst.

Does the interplay between sHh and Neogenin play a crucial role in the development of EAE? The astrocyte-endothelial cell interaction was recently shown to mediate BBB integrity

by secreting sonic Hedghehog and activating downstream Gli-1 transcription factor. The

activation of this transcription factor was shown to increase the expression of tight

junctions towards paracellular endothelial membranes (110). Of particular interest to our

study, recent studies identified Neogenin as a negative regulator of sHh signaling during

limb development (202). In their study, Hong et al showed that Neogenin could act in

parallel to patched-1 and inhibit the activation of Gli-1. In MS, BBB occurs early in the

disease. We propose the following model, in early stages of MS, increase in sRGMa

levels within the CNS can activate Neogenin present on the surface of endothelial cells.

This Neogenin activation could inhibit the sHh-mediated expression of tight junctions

and decrease the expression of TJs on ECs leading to the extensive influx of leukocytes

within the CNS.

83

Chapter 5: Conclusion Our work is the first to identify the role of RGMc in the development of EAE.

Our initial observation that soluble RGM fragments possess contrasting expression

patterns during the course of EAE provided us with enough information to investigate the

role of exogenous sRGMc in the development of EAE. sRGMc-treated animals

developed a delayed onset, a decreased percentage of incidence, and a diminished clinical

severity of the disease course. Moreover, RGMc knockout animals developed a more

severe disease progression than wild-type animals. Our in vitro competition assay

uncovered a molecular mechanism whereby sRGMc was shown to compete with sRGMa

for the binding to Neogenin. We were able to confirm this observation in vivo by treating

RGMC-treated animals in conjunction with sRGMa and observing a worsening disease

phenotype. Our findings, along with previous studies on EAE prompted us to investigate

a role for RGMc in the infiltration of leukocytes within the CNS. We further went to

characterize that RGMc strengthened the integrity of the BBB in EAE.

Prior to our studies the role of RGMc was exclusively believed to regulate iron

expression. Our findings provide evidence for the role of this protein in mediating RGMa

signaling. The finding that sRGMc is able to protect and stabilize the BBB may provide

wider implications than MS as several disorders exhibit a breach of the BBB, such as

stroke (203). We hope that this exciting discovery will propel the RGMc field forward

and place this crucial molecule in the foresight for EAE research and for the development

of MS therapeutics.

84

Chapter 6: Appendix

85

A

Figure 6-1 sRGMc treatment does not modulate the cytokine secretion of MOG pulsed splenocytes. Day 10 EAE-induced mice were sacrificed and their splenocytes were pulsed with MOG for 96 hrs. The cytokine secretion was analyzed using an ELISA.

IL17

RGM

c

Vehicl

e0

500

1000

1500

2000

con

cen

tra

tion

(pg

/mL

)

TNF-α

RGM

c

Vehicl

e0

50

100

150

200

250

con

cen

tra

tion

(pg

/mL

)

IFN-γ

RGM

c

Vehicl

e0

1000

2000

3000

4000

con

cen

tratio

n (p

g/m

L)

IL-6 - Day 17

RGM

c

Vehicl

e0

100

200

300

400

con

cen

tra

tion

(pg

/mL

)

86

B

Figure 6-2 sRGMc treatment reduces cellular infiltrates in the retinas of EAE-induced animals. Representative confocal images of EAE-induced mice retinal whole-mounts stained with cholera toxin

87

subunit-β. RGMc treatment (200mM, injected every 3 days for 18 days) reduces the extent of cellular infiltration (arrowheads) when compared to vehicle-treated animals.

C

Figure 6-3 sRGMc treatment reduces CD3+ infiltrates in the spinal cord of EAE-induced mice. Spinal cords were stained for CD3+ cells and subdivided into 7 patterns of infiltration.

88

D

89

Figure 6-4 sRGMc treatment reduces B220+ infiltrates in the spinal cord of EAE-induced mice. Spinal cords were stained for B220+ cells and subdivided into 7 patterns of infiltration.

E

90

Figure 6-5 sRGMc treatment reduces CD11b+ infiltrates in the spinal cord of EAE-induced mice. Spinal cords were stained for CD11b+ cells and subdivided into 7 patterns of infiltration.

Chapter 7: Bibliography

91

1. Kumar DR, Aslinia F, Yale SH, & Mazza JJ (2011) Jean-Martin Charcot: the father of neurology. Clinical medicine & research 9(1):46-49. 2. (NIH) NIoH (2013) Research Portfolio Online Reporting Tools (RePORT): Categrorical Spending. 3. Noseworthy JH, Lucchinetti C, Rodriguez M, & Weinshenker BG (2000) Multiple sclerosis. The New England journal of medicine 343(13):938-952.

92

4. Anonymous (2012) Setting new standards in multiple sclerosis care and research. Lancet neurology 11(10):835. 5. Bove R & Chitnis T (2014) The role of gender and sex hormones in determining the onset and outcome of multiple sclerosis. Multiple sclerosis 20(5):520-526. 6. Ploughman M, et al. (2014) The Canadian survey of health, lifestyle and ageing with multiple sclerosis: methodology and initial results. BMJ open 4(7):e005718. 7. Miller DH, et al. (2008) Differential diagnosis of suspected multiple sclerosis: a consensus approach. Multiple sclerosis 14(9):1157-1174. 8. Anonymous (2013) Atlas of MS 2013. in Multiple Sclerosis International Federation, p 28. 9. Confavreux C & Vukusic S (2006) Age at disability milestones in multiple sclerosis. Brain : a journal of neurology 129(Pt 3):595-605. 10. Chitnis T, Glanz B, Jaffin S, & Healy B (2009) Demographics of pediatric-onset multiple sclerosis in an MS center population from the Northeastern United States. Multiple sclerosis 15(5):627-631. 11. Carta MG, et al. (2014) Multiple sclerosis and bipolar disorders: The burden of comorbidity and its consequences on quality of life. Journal of affective disorders 167C:192-197. 12. Polman CH, et al. (2005) Diagnostic criteria for multiple sclerosis: 2005 revisions to the "McDonald Criteria". Annals of neurology 58(6):840-846. 13. McDonald WI, et al. (2001) Recommended diagnostic criteria for multiple sclerosis: guidelines from the International Panel on the diagnosis of multiple sclerosis. Annals of neurology 50(1):121-127. 14. Polman CH, et al. (2011) Diagnostic criteria for multiple sclerosis: 2010 revisions to the McDonald criteria. Annals of neurology 69(2):292-302. 15. Kuhle J, et al. (2011) Neurofilament heavy chain in CSF correlates with relapses and disability in multiple sclerosis. Neurology 76(14):1206-1213. 16. Stys PK, Zamponi GW, van Minnen J, & Geurts JJ (2012) Will the real multiple sclerosis please stand up? Nature reviews. Neuroscience 13(7):507-514. 17. Berer K & Krishnamoorthy G (2012) Commensal gut flora and brain autoimmunity: a love or hate affair? Acta neuropathologica 123(5):639-651. 18. Ebers GC (2008) Environmental factors and multiple sclerosis. Lancet neurology 7(3):268-277. 19. Krementsov DN & Teuscher C (2013) Environmental factors acting during development to influence MS risk: insights from animal studies. Multiple sclerosis 19(13):1684-1689. 20. Mandia D, et al. (2014) Environmental factors and multiple sclerosis severity: a descriptive study. International journal of environmental research and public health 11(6):6417-6432. 21. Evans C, et al. (2013) Incidence and prevalence of multiple sclerosis in the Americas: a systematic review. Neuroepidemiology 40(3):195-210. 22. Martinelli V, et al. (2014) Vitamin D levels and risk of multiple sclerosis in patients with clinically isolated syndromes. Multiple sclerosis 20(2):147-155.

93

23. Farias AS, et al. (2013) Vitamin D3 induces IDO+ tolerogenic DCs and enhances Treg, reducing the severity of EAE. CNS neuroscience & therapeutics 19(4):269-277. 24. Lang HL, et al. (2002) A functional and structural basis for TCR cross-reactivity in multiple sclerosis. Nature immunology 3(10):940-943. 25. Sadovnick AD (2012) Genetic background of multiple sclerosis. Autoimmunity reviews 11(3):163-166. 26. Gourraud PA, Harbo HF, Hauser SL, & Baranzini SE (2012) The genetics of multiple sclerosis: an up-to-date review. Immunological reviews 248(1):87-103. 27. International Multiple Sclerosis Genetics C, et al. (2007) Risk alleles for multiple sclerosis identified by a genomewide study. The New England journal of medicine 357(9):851-862. 28. Baranzini SE & Nickles D (2012) Genetics of multiple sclerosis: swimming in an ocean of data. Current opinion in neurology 25(3):239-245. 29. Kucukali CI, Kurtuncu M, Coban A, Cebi M, & Tuzun E (2014) Epigenetics of Multiple Sclerosis: An Updated Review. Neuromolecular medicine. 30. Crichton RR, Dexter DT, & Ward RJ (2011) Brain iron metabolism and its perturbation in neurological diseases. Journal of neural transmission 118(3):301-314. 31. Todorich B, Pasquini JM, Garcia CI, Paez PM, & Connor JR (2009) Oligodendrocytes and myelination: the role of iron. Glia 57(5):467-478. 32. Enns CA, Ahmed R, & Zhang AS (2012) Neogenin interacts with matriptase-2 to facilitate hemojuvelin cleavage. The Journal of biological chemistry 287(42):35104-35117. 33. Stankiewicz JM & Brass SD (2009) Role of iron in neurotoxicity: a cause for concern in the elderly? Current opinion in clinical nutrition and metabolic care 12(1):22-29. 34. LeVine SM, Bilgen M, & Lynch SG (2013) Iron accumulation in multiple sclerosis: an early pathogenic event. Expert review of neurotherapeutics 13(3):247-250. 35. Rathore KI, et al. (2008) Ceruloplasmin protects injured spinal cord from iron-mediated oxidative damage. The Journal of neuroscience : the official journal of the Society for Neuroscience 28(48):12736-12747. 36. Williams R, Buchheit CL, Berman NE, & LeVine SM (2012) Pathogenic implications of iron accumulation in multiple sclerosis. Journal of neurochemistry 120(1):7-25. 37. Gemmati D, et al. (2012) Polymorphisms in the genes coding for iron binding and transporting proteins are associated with disability, severity, and early progression in multiple sclerosis. BMC medical genetics 13:70. 38. Grant SM, Wiesinger JA, Beard JL, & Cantorna MT (2003) Iron-deficient mice fail to develop autoimmune encephalomyelitis. The Journal of nutrition 133(8):2635-2638. 39. Stankiewicz JM, Neema M, & Ceccarelli A (2014) Iron and multiple sclerosis. Neurobiology of aging 35S2:S51-S58.

94

40. Weigel KJ, Lynch SG, & Levine SM (2014) Iron chelation and multiple sclerosis. ASN neuro 6(1):e00136. 41. LeVine SM & Chakrabarty A (2004) The role of iron in the pathogenesis of experimental allergic encephalomyelitis and multiple sclerosis. Annals of the New York Academy of Sciences 1012:252-266. 42. Pawate S, Wang L, Song Y, & Sriram S (2012) Analysis of T2 intensity by magnetic resonance imaging of deep gray matter nuclei in multiple sclerosis patients: effect of immunomodulatory therapies. Journal of neuroimaging : official journal of the American Society of Neuroimaging 22(2):137-144. 43. Friese MA, Schattling B, & Fugger L (2014) Mechanisms of neurodegeneration and axonal dysfunction in multiple sclerosis. Nature reviews. Neurology 10(4):225-238. 44. Gaitan MI, et al. (2011) Evolution of the blood-brain barrier in newly forming multiple sclerosis lesions. Annals of neurology 70(1):22-29. 45. Kebir H, et al. (2007) Human TH17 lymphocytes promote blood-brain barrier disruption and central nervous system inflammation. Nature medicine 13(10):1173-1175. 46. Bettelli E, Korn T, & Kuchroo VK (2007) Th17: the third member of the effector T cell trilogy. Current opinion in immunology 19(6):652-657. 47. Viglietta V, Baecher-Allan C, Weiner HL, & Hafler DA (2004) Loss of functional suppression by CD4+CD25+ regulatory T cells in patients with multiple sclerosis. The Journal of experimental medicine 199(7):971-979. 48. Ferguson B, Matyszak MK, Esiri MM, & Perry VH (1997) Axonal damage in acute multiple sclerosis lesions. Brain : a journal of neurology 120 ( Pt 3):393-399. 49. Compston A & Coles A (2008) Multiple sclerosis. Lancet 372(9648):1502-1517. 50. Anderson JM, et al. (2008) Abnormally phosphorylated tau is associated with neuronal and axonal loss in experimental autoimmune encephalomyelitis and multiple sclerosis. Brain : a journal of neurology 131(Pt 7):1736-1748. 51. Dziedzic T, et al. (2010) Wallerian degeneration: a major component of early axonal pathology in multiple sclerosis. Brain pathology 20(5):976-985. 52. Friese MA, et al. (2007) Acid-sensing ion channel-1 contributes to axonal degeneration in autoimmune inflammation of the central nervous system. Nature medicine 13(12):1483-1489. 53. Kornek B, et al. (2001) Distribution of a calcium channel subunit in dystrophic axons in multiple sclerosis and experimental autoimmune encephalomyelitis. Brain : a journal of neurology 124(Pt 6):1114-1124. 54. Lu F, et al. (2000) Oxidative damage to mitochondrial DNA and activity of mitochondrial enzymes in chronic active lesions of multiple sclerosis. Journal of the neurological sciences 177(2):95-103. 55. Lassmann H, van Horssen J, & Mahad D (2012) Progressive multiple sclerosis: pathology and pathogenesis. Nature reviews. Neurology 8(11):647-656.

95

56. Jacobs LD, et al. (1996) Intramuscular interferon beta-1a for disease progression in relapsing multiple sclerosis. The Multiple Sclerosis Collaborative Research Group (MSCRG). Annals of neurology 39(3):285-294. 57. Comi G, Filippi M, & Wolinsky JS (2001) European/Canadian multicenter, double-blind, randomized, placebo-controlled study of the effects of glatiramer acetate on magnetic resonance imaging--measured disease activity and burden in patients with relapsing multiple sclerosis. European/Canadian Glatiramer Acetate Study Group. Annals of neurology 49(3):290-297. 58. Hilas O, Patel PN, & Lam S (2010) Disease modifying agents for multiple sclerosis. The open neurology journal 4:15-24. 59. Tanasescu R, Ionete C, Chou IJ, & Constantinescu CS (2014) Advances in the treatment of relapsing-remitting multiple sclerosis. Biomedical journal 37(2):41-49. 60. Barten LJ, Allington DR, Procacci KA, & Rivey MP (2010) New approaches in the management of multiple sclerosis. Drug design, development and therapy 4:343-366. 61. Stroet A, Linker RA, & Gold R (2013) Advancing therapeutic options in multiple sclerosis with neuroprotective properties. Journal of neural transmission 120 Suppl 1:S49-53. 62. O'Connor PW & Oh J (2014) Disease-modifying agents in multiple sclerosis. Handbook of clinical neurology 122:465-501. 63. Muraro PA, et al. (2005) Thymic output generates a new and diverse TCR repertoire after autologous stem cell transplantation in multiple sclerosis patients. The Journal of experimental medicine 201(5):805-816. 64. Coyle PK (2009) Disease-modifying agents in multiple sclerosis. Annals of Indian Academy of Neurology 12(4):273-282. 65. Jacobs LD, et al. (2000) Intramuscular interferon beta-1a therapy initiated during a first demyelinating event in multiple sclerosis. CHAMPS Study Group. The New England journal of medicine 343(13):898-904. 66. Kappos L, et al. (2006) Treatment with interferon beta-1b delays conversion to clinically definite and McDonald MS in patients with clinically isolated syndromes. Neurology 67(7):1242-1249. 67. Johnson KP, et al. (2001) Copolymer 1 reduces relapse rate and improves disability in relapsing-remitting multiple sclerosis: results of a phase III multicenter, double-blind, placebo-controlled trial. 1995. Neurology 57(12 Suppl 5):S16-24. 68. Marriott JJ, et al. (2010) Evidence Report: The efficacy and safety of mitoxantrone (Novantrone) in the treatment of multiple sclerosis: Report of the Therapeutics and Technology Assessment Subcommittee of the American Academy of Neurology. Neurology 74(18):1463-1470. 69. Gold R, et al. (2012) Placebo-controlled phase 3 study of oral BG-12 for relapsing multiple sclerosis. The New England journal of medicine 367(12):1098-1107. 70. O'Connor P, et al. (2011) Randomized trial of oral teriflunomide for relapsing multiple sclerosis. The New England journal of medicine 365(14):1293-1303.

96

71. Comi G, et al. (2012) Placebo-controlled trial of oral laquinimod for multiple sclerosis. The New England journal of medicine 366(11):1000-1009. 72. Cohen JA, et al. (2010) Oral fingolimod or intramuscular interferon for relapsing multiple sclerosis. The New England journal of medicine 362(5):402-415. 73. Kappos L, et al. (2010) A placebo-controlled trial of oral fingolimod in relapsing multiple sclerosis. The New England journal of medicine 362(5):387-401. 74. Polman CH, et al. (2006) A randomized, placebo-controlled trial of natalizumab for relapsing multiple sclerosis. The New England journal of medicine 354(9):899-910. 75. Miller DH, et al. (2007) MRI outcomes in a placebo-controlled trial of natalizumab in relapsing MS. Neurology 68(17):1390-1401. 76. Coles AJ, et al. (2012) Alemtuzumab for patients with relapsing multiple sclerosis after disease-modifying therapy: a randomised controlled phase 3 trial. Lancet 380(9856):1829-1839. 77. Kappos L, et al. (2011) Ocrelizumab in relapsing-remitting multiple sclerosis: a phase 2, randomised, placebo-controlled, multicentre trial. Lancet 378(9805):1779-1787. 78. Gold R, et al. (2013) Daclizumab high-yield process in relapsing-remitting multiple sclerosis (SELECT): a randomised, double-blind, placebo-controlled trial. Lancet 381(9884):2167-2175. 79. Simmons SB, Pierson ER, Lee SY, & Goverman JM (2013) Modeling the heterogeneity of multiple sclerosis in animals. Trends in immunology 34(8):410-422. 80. Gold R, Linington C, & Lassmann H (2006) Understanding pathogenesis and therapy of multiple sclerosis via animal models: 70 years of merits and culprits in experimental autoimmune encephalomyelitis research. Brain : a journal of neurology 129(Pt 8):1953-1971. 81. Rangachari M & Kuchroo VK (2013) Using EAE to better understand principles of immune function and autoimmune pathology. Journal of autoimmunity 45:31-39. 82. Paterson PY (1960) Transfer of allergic encephalomyelitis in rats by means of lymph node cells. The Journal of experimental medicine 111:119-136. 83. Cua DJ, et al. (2003) Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421(6924):744-748. 84. Becher B, Durell BG, & Noelle RJ (2002) Experimental autoimmune encephalitis and inflammation in the absence of interleukin-12. The Journal of clinical investigation 110(4):493-497. 85. Park H, et al. (2005) A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nature immunology 6(11):1133-1141. 86. Traugott U & Lebon P (1988) Multiple sclerosis: involvement of interferons in lesion pathogenesis. Annals of neurology 24(2):243-251.

97

87. Kroenke MA, Carlson TJ, Andjelkovic AV, & Segal BM (2008) IL-12- and IL-23-modulated T cells induce distinct types of EAE based on histology, CNS chemokine profile, and response to cytokine inhibition. The Journal of experimental medicine 205(7):1535-1541. 88. Stromnes IM, Cerretti LM, Liggitt D, Harris RA, & Goverman JM (2008) Differential regulation of central nervous system autoimmunity by T(H)1 and T(H)17 cells. Nature medicine 14(3):337-342. 89. Kohm AP, Carpentier PA, Anger HA, & Miller SD (2002) Cutting edge: CD4+CD25+ regulatory T cells suppress antigen-specific autoreactive immune responses and central nervous system inflammation during active experimental autoimmune encephalomyelitis. Journal of immunology 169(9):4712-4716. 90. Langrish CL, et al. (2005) IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. The Journal of experimental medicine 201(2):233-240. 91. McCoy KD & Le Gros G (1999) The role of CTLA-4 in the regulation of T cell immune responses. Immunology and cell biology 77(1):1-10. 92. Francisco LM, Sage PT, & Sharpe AH (2010) The PD-1 pathway in tolerance and autoimmunity. Immunological reviews 236:219-242. 93. Frisullo G, et al. (2009) Regulatory T cells fail to suppress CD4T+-bet+ T cells in relapsing multiple sclerosis patients. Immunology 127(3):418-428. 94. Bitsch A, Schuchardt J, Bunkowski S, Kuhlmann T, & Bruck W (2000) Acute axonal injury in multiple sclerosis. Correlation with demyelination and inflammation. Brain : a journal of neurology 123 ( Pt 6):1174-1183. 95. Jiang H, Zhang SI, & Pernis B (1992) Role of CD8+ T cells in murine experimental allergic encephalomyelitis. Science 256(5060):1213-1215. 96. Koh DR, et al. (1992) Less mortality but more relapses in experimental allergic encephalomyelitis in CD8-/- mice. Science 256(5060):1210-1213. 97. Montero E, et al. (2004) Regulation of experimental autoimmune encephalomyelitis by CD4+, CD25+ and CD8+ T cells: analysis using depleting antibodies. Journal of autoimmunity 23(1):1-7. 98. Fillatreau S, Sweenie CH, McGeachy MJ, Gray D, & Anderton SM (2002) B cells regulate autoimmunity by provision of IL-10. Nature immunology 3(10):944-950. 99. Alvarez JI, Katayama T, & Prat A (2013) Glial influence on the blood brain barrier. Glia 61(12):1939-1958. 100. Abbott NJ, Ronnback L, & Hansson E (2006) Astrocyte-endothelial interactions at the blood-brain barrier. Nature reviews. Neuroscience 7(1):41-53. 101. Ransohoff RM & Engelhardt B (2012) The anatomical and cellular basis of immune surveillance in the central nervous system. Nature reviews. Immunology 12(9):623-635. 102. Alvarez JI, Cayrol R, & Prat A (2011) Disruption of central nervous system barriers in multiple sclerosis. Biochimica et biophysica acta 1812(2):252-264.

98

103. Engelhardt B & Ransohoff RM (2005) The ins and outs of T-lymphocyte trafficking to the CNS: anatomical sites and molecular mechanisms. Trends in immunology 26(9):485-495. 104. Biernacki K, Prat A, Blain M, & Antel JP (2001) Regulation of Th1 and Th2 lymphocyte migration by human adult brain endothelial cells. Journal of neuropathology and experimental neurology 60(12):1127-1136. 105. Wu C, et al. (2009) Endothelial basement membrane laminin alpha5 selectively inhibits T lymphocyte extravasation into the brain. Nature medicine 15(5):519-527. 106. Agrawal S, et al. (2006) Dystroglycan is selectively cleaved at the parenchymal basement membrane at sites of leukocyte extravasation in experimental autoimmune encephalomyelitis. The Journal of experimental medicine 203(4):1007-1019. 107. Wolburg-Buchholz K, et al. (2009) Loss of astrocyte polarity marks blood-brain barrier impairment during experimental autoimmune encephalomyelitis. Acta neuropathologica 118(2):219-233. 108. Obermeier B, Daneman R, & Ransohoff RM (2013) Development, maintenance and disruption of the blood-brain barrier. Nature medicine 19(12):1584-1596. 109. Wosik K, et al. (2007) Angiotensin II controls occludin function and is required for blood brain barrier maintenance: relevance to multiple sclerosis. The Journal of neuroscience : the official journal of the Society for Neuroscience 27(34):9032-9042. 110. Alvarez JI, et al. (2011) The Hedgehog pathway promotes blood-brain barrier integrity and CNS immune quiescence. Science 334(6063):1727-1731. 111. Tessier-Lavigne M & Goodman CS (1996) The molecular biology of axon guidance. Science 274(5290):1123-1133. 112. Monnier PP, et al. (2002) RGM is a repulsive guidance molecule for retinal axons. Nature 419(6905):392-395. 113. Severyn CJ, Shinde U, & Rotwein P (2009) Molecular biology, genetics and biochemistry of the repulsive guidance molecule family. The Biochemical journal 422(3):393-403. 114. Tassew NG, Charish J, Seidah NG, & Monnier PP (2012) SKI-1 and Furin generate multiple RGMa fragments that regulate axonal growth. Developmental cell 22(2):391-402. 115. Nili M, David L, Elferich J, Shinde U, & Rotwein P (2013) Proteomic analysis and molecular modelling characterize the iron-regulatory protein haemojuvelin/repulsive guidance molecule c. The Biochemical journal 452(1):87-95. 116. Cole SJ, Bradford D, & Cooper HM (2007) Neogenin: A multi-functional receptor regulating diverse developmental processes. The international journal of biochemistry & cell biology 39(9):1569-1575. 117. Xu K, et al. (2014) Neural migration. Structures of netrin-1 bound to two receptors provide insight into its axon guidance mechanism. Science 344(6189):1275-1279.

99

118. Wilson NH & Key B (2006) Neogenin interacts with RGMa and netrin-1 to guide axons within the embryonic vertebrate forebrain. Developmental biology 296(2):485-498. 119. Rajagopalan S, et al. (2004) Neogenin mediates the action of repulsive guidance molecule. Nature cell biology 6(8):756-762. 120. Yang F, West AP, Jr., Allendorph GP, Choe S, & Bjorkman PJ (2008) Neogenin interacts with hemojuvelin through its two membrane-proximal fibronectin type III domains. Biochemistry 47(14):4237-4245. 121. Bell CH, et al. (2013) Structure of the repulsive guidance molecule (RGM)-neogenin signaling hub. Science 341(6141):77-80. 122. Ma CH, et al. (2011) The BMP coreceptor RGMb promotes while the endogenous BMP antagonist noggin reduces neurite outgrowth and peripheral nerve regeneration by modulating BMP signaling. The Journal of neuroscience : the official journal of the Society for Neuroscience 31(50):18391-18400. 123. Tian C & Liu J (2013) Repulsive guidance molecules (RGMs) and neogenin in bone morphogenetic protein (BMP) signaling. Molecular reproduction and development 80(9):700-717. 124. Wu MY & Hill CS (2009) Tgf-beta superfamily signaling in embryonic development and homeostasis. Developmental cell 16(3):329-343. 125. Groppe J, et al. (2002) Structural basis of BMP signalling inhibition by the cystine knot protein Noggin. Nature 420(6916):636-642. 126. Shi Y & Massague J (2003) Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113(6):685-700. 127. Wu Q, Sun CC, Lin HY, & Babitt JL (2012) Repulsive guidance molecule (RGM) family proteins exhibit differential binding kinetics for bone morphogenetic proteins (BMPs). PloS one 7(9):e46307. 128. Massague J (2012) TGFbeta signalling in context. Nature reviews. Molecular cell biology 13(10):616-630. 129. Niederkofler V, Salie R, Sigrist M, & Arber S (2004) Repulsive guidance molecule (RGM) gene function is required for neural tube closure but not retinal topography in the mouse visual system. The Journal of neuroscience : the official journal of the Society for Neuroscience 24(4):808-818. 130. Redowicz MJ (1999) Rho-associated kinase: involvement in the cytoskeleton regulation. Archives of biochemistry and biophysics 364(1):122-124. 131. Uehata M, et al. (1997) Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 389(6654):990-994. 132. Aktories K & Just I (2005) Clostridial Rho-inhibiting protein toxins. Current topics in microbiology and immunology 291:113-145. 133. Matsunaga E, et al. (2004) RGM and its receptor neogenin regulate neuronal survival. Nature cell biology 6(8):749-755. 134. Tassew NG, et al. (2008) Intraretinal RGMa is involved in retino-tectal mapping. Molecular and cellular neurosciences 37(4):761-769. 135. Kee N, et al. (2008) Neogenin and RGMa control neural tube closure and neuroepithelial morphology by regulating cell polarity. The Journal of

100

neuroscience : the official journal of the Society for Neuroscience 28(48):12643-12653. 136. Matsunaga E, Nakamura H, & Chedotal A (2006) Repulsive guidance molecule plays multiple roles in neuronal differentiation and axon guidance. The Journal of neuroscience : the official journal of the Society for Neuroscience 26(22):6082-6088. 137. Koeberle PD, Tura A, Tassew NG, Schlichter LC, & Monnier PP (2010) The repulsive guidance molecule, RGMa, promotes retinal ganglion cell survival in vitro and in vivo. Neuroscience 169(1):495-504. 138. Lah GJ & Key B (2012) Novel roles of the chemorepellent axon guidance molecule RGMa in cell migration and adhesion. Molecular and cellular biology 32(5):968-980. 139. Hata K, et al. (2006) RGMa inhibition promotes axonal growth and recovery after spinal cord injury. The Journal of cell biology 173(1):47-58. 140. Konig K, et al. (2012) The axonal guidance receptor neogenin promotes acute inflammation. PloS one 7(3):e32145. 141. Mirakaj V, et al. (2011) Repulsive guidance molecule-A (RGM-A) inhibits leukocyte migration and mitigates inflammation. Proceedings of the National Academy of Sciences of the United States of America 108(16):6555-6560. 142. Muramatsu R, et al. (2011) RGMa modulates T cell responses and is involved in autoimmune encephalomyelitis. Nature medicine 17(4):488-494. 143. Babitt JL, et al. (2005) Repulsive guidance molecule (RGMa), a DRAGON homologue, is a bone morphogenetic protein co-receptor. The Journal of biological chemistry 280(33):29820-29827. 144. Xia Y, et al. (2007) Repulsive guidance molecule RGMa alters utilization of bone morphogenetic protein (BMP) type II receptors by BMP2 and BMP4. The Journal of biological chemistry 282(25):18129-18140. 145. Oldekamp J, Kramer N, Alvarez-Bolado G, & Skutella T (2004) Expression pattern of the repulsive guidance molecules RGM A, B and C during mouse development. Gene expression patterns : GEP 4(3):283-288. 146. Corradini E, Babitt JL, & Lin HY (2009) The RGM/DRAGON family of BMP co-receptors. Cytokine & growth factor reviews 20(5-6):389-398. 147. Xia Y, et al. (2011) Dragon (repulsive guidance molecule b) inhibits IL-6 expression in macrophages. Journal of immunology 186(3):1369-1376. 148. Samad TA, et al. (2004) DRAGON: a member of the repulsive guidance molecule-related family of neuronal- and muscle-expressed membrane proteins is regulated by DRG11 and has neuronal adhesive properties. The Journal of neuroscience : the official journal of the Society for Neuroscience 24(8):2027-2036. 149. Liu X, et al. (2009) Repulsive guidance molecule b inhibits neurite growth and is increased after spinal cord injury. Biochemical and biophysical research communications 382(4):795-800. 150. Xiao Y, et al. (2014) RGMb is a novel binding partner for PD-L2 and its engagement with PD-L2 promotes respiratory tolerance. The Journal of experimental medicine 211(5):943-959.

101

151. Ganz T (2007) Molecular control of iron transport. Journal of the American Society of Nephrology : JASN 18(2):394-400. 152. Core AB, Canali S, & Babitt JL (2014) Hemojuvelin and bone morphogenetic protein (BMP) signaling in iron homeostasis. Frontiers in pharmacology 5:104. 153. Kuninger D, Kuns-Hashimoto R, Nili M, & Rotwein P (2008) Pro-protein convertases control the maturation and processing of the iron-regulatory protein, RGMc/hemojuvelin. BMC biochemistry 9:9. 154. Andriopoulos B, Jr., et al. (2009) BMP6 is a key endogenous regulator of hepcidin expression and iron metabolism. Nature genetics 41(4):482-487. 155. Meynard D, et al. (2009) Lack of the bone morphogenetic protein BMP6 induces massive iron overload. Nature genetics 41(4):478-481. 156. Kuns-Hashimoto R, Kuninger D, Nili M, & Rotwein P (2008) Selective binding of RGMc/hemojuvelin, a key protein in systemic iron metabolism, to BMP-2 and neogenin. American journal of physiology. Cell physiology 294(4):C994-C1003. 157. Lee DH, et al. (2010) Neogenin inhibits HJV secretion and regulates BMP-induced hepcidin expression and iron homeostasis. Blood 115(15):3136-3145. 158. Babitt JL, et al. (2007) Modulation of bone morphogenetic protein signaling in vivo regulates systemic iron balance. The Journal of clinical investigation 117(7):1933-1939. 159. Chen W, et al. (2013) A novel validated enzyme-linked immunosorbent assay to quantify soluble hemojuvelin in mouse serum. Haematologica 98(2):296-304. 160. Shalev H, et al. (2013) High levels of soluble serum hemojuvelin in patients with congenital dyserythropoietic anemia type I. European journal of haematology 90(1):31-36. 161. Maxson JE, Chen J, Enns CA, & Zhang AS (2010) Matriptase-2- and proprotein convertase-cleaved forms of hemojuvelin have different roles in the down-regulation of hepcidin expression. The Journal of biological chemistry 285(50):39021-39028. 162. Chen W, Huang FW, de Renshaw TB, & Andrews NC (2011) Skeletal muscle hemojuvelin is dispensable for systemic iron homeostasis. Blood 117(23):6319-6325. 163. D'Alessio F, Hentze MW, & Muckenthaler MU (2012) The hemochromatosis proteins HFE, TfR2, and HJV form a membrane-associated protein complex for hepcidin regulation. Journal of hepatology 57(5):1052-1060. 164. Krijt J, Vokurka M, Chang KT, & Necas E (2004) Expression of Rgmc, the murine ortholog of hemojuvelin gene, is modulated by development and inflammation, but not by iron status or erythropoietin. Blood 104(13):4308-4310. 165. Niederkofler V, Salie R, & Arber S (2005) Hemojuvelin is essential for dietary iron sensing, and its mutation leads to severe iron overload. The Journal of clinical investigation 115(8):2180-2186.

102

166. Constante M, Wang D, Raymond VA, Bilodeau M, & Santos MM (2007) Repression of repulsive guidance molecule C during inflammation is independent of Hfe and involves tumor necrosis factor-alpha. The American journal of pathology 170(2):497-504. 167. Salama MF, Bayele HK, & Srai SS (2012) Tumour necrosis factor alpha downregulates human hemojuvelin expression via a novel response element within its promoter. Journal of biomedical science 19:83. 168. Kitayama M, Ueno M, Itakura T, & Yamashita T (2011) Activated microglia inhibit axonal growth through RGMa. PloS one 6(9):e25234. 169. Nohra R, et al. (2010) RGMA and IL21R show association with experimental inflammation and multiple sclerosis. Genes and immunity 11(4):279-293. 170. Demicheva E, et al. (2015) Targeting Repulsive Guidance Molecule A to Promote Regeneration and Neuroprotection in Multiple Sclerosis. Cell reports. 171. Kubo T, Tokita S, & Yamashita T (2012) Repulsive guidance molecule-a and demyelination: implications for multiple sclerosis. Journal of neuroimmune pharmacology : the official journal of the Society on NeuroImmune Pharmacology 7(3):524-528. 172. Doctor M (2013) Education: Quality Control of EAE. in Multiple Sclerosis Research. 173. Balk L, et al. (2014) Disease course heterogeneity and OCT in multiple sclerosis. Multiple sclerosis 20(9):1198-1206. 174. Conrad S, Genth H, Hofmann F, Just I, & Skutella T (2007) Neogenin-RGMa signaling at the growth cone is bone morphogenetic protein-independent and involves RhoA, ROCK, and PKC. The Journal of biological chemistry 282(22):16423-16433. 175. Persidsky Y, et al. (2006) Rho-mediated regulation of tight junctions during monocyte migration across the blood-brain barrier in HIV-1 encephalitis (HIVE). Blood 107(12):4770-4780. 176. Ly NP, et al. (2005) Netrin-1 inhibits leukocyte migration in vitro and in vivo. Proceedings of the National Academy of Sciences of the United States of America 102(41):14729-14734. 177. O'Leary C, et al. (2013) RGMa regulates cortical interneuron migration and differentiation. PloS one 8(11):e81711. 178. Suzuki K, et al. (2007) Semaphorin 7A initiates T-cell-mediated inflammatory responses through alpha1beta1 integrin. Nature 446(7136):680-684. 179. Wu JY, et al. (2001) The neuronal repellent Slit inhibits leukocyte chemotaxis induced by chemotactic factors. Nature 410(6831):948-952. 180. Chaturvedi S & Robinson LA (2014) Slit2-Robo signaling in inflammation and kidney injury. Pediatric nephrology. 181. Wong K, et al. (2001) Signal transduction in neuronal migration: roles of GTPase activating proteins and the small GTPase Cdc42 in the Slit-Robo pathway. Cell 107(2):209-221. 182. Guan H, et al. (2003) Neuronal repellent Slit2 inhibits dendritic cell migration and the development of immune responses. Journal of immunology 171(12):6519-6526.

103

183. Tole S, et al. (2009) The axonal repellent, Slit2, inhibits directional migration of circulating neutrophils. Journal of leukocyte biology 86(6):1403-1415. 184. Chaturvedi S, et al. (2013) Slit2 prevents neutrophil recruitment and renal ischemia-reperfusion injury. Journal of the American Society of Nephrology : JASN 24(8):1274-1287. 185. Wen J, Qian, S., Yang, Q., Deng, L., Mo, Y., and Yu, Y. (2014) Overexpression of netrin-1 increases the expression of tight junction-associated proteins, claudin-5, occludin, and ZO-1, following traumatic brain injury in rats. Experimental and therapeutic medicine 8:881-886. 186. Liu N, et al. (2011) Effects of treadmill exercise on the expression of netrin-1 and its receptors in rat brain after cerebral ischemia. Neuroscience 194:349-358. 187. Jones CA, et al. (2008) Robo4 stabilizes the vascular network by inhibiting pathologic angiogenesis and endothelial hyperpermeability. Nature medicine 14(4):448-453. 188. Jones CA, et al. (2009) Slit2-Robo4 signalling promotes vascular stability by blocking Arf6 activity. Nature cell biology 11(11):1325-1331. 189. Zhao H, Anand AR, & Ganju RK (2014) Slit2-Robo4 pathway modulates lipopolysaccharide-induced endothelial inflammation and its expression is dysregulated during endotoxemia. Journal of immunology 192(1):385-393. 190. Mueller BK, Mack H, & Teusch N (2005) Rho kinase, a promising drug target for neurological disorders. Nature reviews. Drug discovery 4(5):387-398. 191. Zhao Y, et al. (2013) Rho-associated protein kinase isoforms stimulate proliferation of vascular smooth muscle cells through ERK and induction of cyclin D1 and PCNA. Biochemical and biophysical research communications 432(3):488-493. 192. Baumer Y, Spindler V, Werthmann RC, Bunemann M, & Waschke J (2009) Role of Rac 1 and cAMP in endothelial barrier stabilization and thrombin-induced barrier breakdown. Journal of cellular physiology 220(3):716-726. 193. Nitta T, et al. (2003) Size-selective loosening of the blood-brain barrier in claudin-5-deficient mice. The Journal of cell biology 161(3):653-660. 194. Morita K, et al. (2003) Expression of claudin-5 in dermal vascular endothelia. Experimental dermatology 12(3):289-295. 195. Saito H, Minamiya Y, Saito S, & Ogawa J (2002) Endothelial Rho and Rho kinase regulate neutrophil migration via endothelial myosin light chain phosphorylation. Journal of leukocyte biology 72(4):829-836. 196. Stamatovic SM, Keep RF, Kunkel SL, & Andjelkovic AV (2003) Potential role of MCP-1 in endothelial cell tight junction 'opening': signaling via Rho and Rho kinase. Journal of cell science 116(Pt 22):4615-4628. 197. Stamatovic SM, et al. (2005) Monocyte chemoattractant protein-1 regulation of blood-brain barrier permeability. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism 25(5):593-606. 198. Wojciak-Stothard B, Entwistle A, Garg R, & Ridley AJ (1998) Regulation of TNF-alpha-induced reorganization of the actin cytoskeleton and cell-cell

104

junctions by Rho, Rac, and Cdc42 in human endothelial cells. Journal of cellular physiology 176(1):150-165. 199. Kale G, Naren AP, Sheth P, & Rao RK (2003) Tyrosine phosphorylation of occludin attenuates its interactions with ZO-1, ZO-2, and ZO-3. Biochemical and biophysical research communications 302(2):324-329. 200. Milla LA, et al. (2012) Yeast-based assay identifies novel Shh/Gli target genes in vertebrate development. BMC genomics 13:2. 201. Milla LA, et al. (2014) Neogenin1 is a Sonic Hedgehog target in medulloblastoma and is necessary for cell cycle progression. International journal of cancer. Journal international du cancer 134(1):21-31. 202. Hong M, Schachter KA, Jiang G, & Krauss RS (2012) Neogenin regulates Sonic Hedgehog pathway activity during digit patterning. Developmental dynamics : an official publication of the American Association of Anatomists 241(3):627-637. 203. Liu K, Li Z, Wu T, & Ding S (2011) Role of rho kinase in microvascular damage following cerebral ischemia reperfusion in rats. International journal of molecular sciences 12(2):1222-1231.

105