Identification of Candida albicans ALS2 and ALS4 and Localization ...

JOURNAL OF BACTERIOLOGY,0021-9193/98/$04.0010

Oct. 1998, p. 5334–5343 Vol. 180, No. 20

Copyright © 1998, American Society for Microbiology. All Rights Reserved.

Identification of Candida albicans ALS2 and ALS4 and Localizationof Als Proteins to the Fungal Cell Surface

L. L. HOYER,* T. L. PAYNE, AND J. E. HECHT

Department of Veterinary Pathobiology, University of Illinois, Urbana, Illinois

Received 26 June 1998/Accepted 18 August 1998

Additional genes in the growing ALS family of Candida albicans were isolated by PCR screening of a genomicfosmid library with primers designed from the consensus tandem-repeat sequence of ALS1. This procedureyielded fosmids encoding ALS2 and ALS4. ALS2 and ALS4 conformed to the three-domain structure of ALSgenes, which consists of a central domain of tandemly repeated copies of a 108-bp motif, an upstream domainof highly conserved sequences, and a domain of divergent sequences 3* of the tandem repeats. Alignment of fivepredicted Als protein sequences indicated conservation of N- and C-terminal hydrophobic regions which havethe hallmarks of secretory signal sequences and glycosylphosphatidylinositol addition sites, respectively.Heterologous expression of an N-terminal fragment of Als1p in Saccharomyces cerevisiae demonstrated functionof the putative signal sequence with cleavage following Ala17. This signal sequence cleavage site was conservedin the four other Als proteins analyzed, suggesting identical processing of each protein. Primary-structurefeatures of the five Als proteins suggested a cell-surface localization, which was confirmed by indirect immu-nofluorescence with an anti-Als antiserum. Staining was observed on mother yeasts and germ tubes, althoughthe intensity of staining on the mother yeast decreased with elongation of the germ tube. Similar to other ALSgenes, ALS2 and ALS4 were differentially regulated. ALS4 expression was correlated with the growth phase ofthe culture; ALS2 expression was not observed under many different in vitro growth conditions. The datapresented here demonstrate that ALS genes encode cell-surface proteins and support the conclusion that thesize and number of Als proteins on the C. albicans cell surface vary with strain and growth conditions.

The opportunistic pathogen Candida albicans is a fungusthat exists in a diverse range of associations with its human oranimal host. C. albicans can survive in the host without overtdisease symptoms and, under the appropriate circumstances,can cause disease that varies in site and severity. C. albicansinfection can be localized and superficial or systemic and dis-seminated to a wide range of organs (reviewed in reference43). This complexity of interactions of C. albicans with its hostsuggests that the fungus possesses numerous mechanisms toadapt to this diversity of host sites, a versatility undoubtedlycontrolled by differential gene expression. Much investigativeeffort has focused on defining molecular mechanisms C. albi-cans uses for growth and pathogenesis. One attribute of thefungus that is positively correlated with pathogenicity is adher-ence (reviewed in reference 7). Adherent strains of C. albicansare more virulent than those with a less-adhesive nature. Ad-ditionally, a hierarchy exists among Candida species, with themore frequently isolated pathogenic species exhibiting greateradhesive capacity (reviewed in reference 7). Adherence ofC. albicans to host surfaces is also involved in the process ofcolonization, which may occur without accompanying patho-genesis. Investigations to understand C. albicans adhesion haveinvolved characterization of the cell surface, since this is theinitial point of contact between fungus and host (reviewed inreferences 7, 9, 17, 23, and 29). Adherence of C. albicans tonumerous cell types, cellular components, and nonliving sub-stances has been examined to further define adhesive relation-ships. Numerous obstacles exist to hamper the study of C. al-bicans adhesion, including widely noted growth-medium-dependent effects and differences between C. albicans strains

tested in the same assay (reviewed in references 15, 30, and45). Despite these obstacles, several C. albicans molecules in-volved in adhesive interactions have been identified (reviewedin references 7, 9, 17 and 23).

Characterization of the C. albicans ALS gene family hasyielded data that address the major themes discussed above.The first gene in the ALS family, ALS1, was isolated in a dif-ferential screen to identify hypha-specific genes (26). Althoughsubsequent studies demonstrated that ALS1 is not strictly hy-pha-specific, its sequence has significant identity with the se-quence of AGa1 from Saccharomyces cerevisiae, which encodesa-agglutinin, a cell-surface adhesion glycoprotein that facili-tates contact between haploid cells during mating (19, 37).Because C. albicans has not been observed to undergo meiosisor mating, it may be less likely that the function of Als1p isdirectly analogous to that of Aga1p (26). However, conserva-tion between sequences required for the adhesive function ofa-agglutinin and those at the N terminus of Als1p raised theintriguing possibility that Als1p is an adhesion glycoprotein(26). Data supporting this conclusion have been publishedrecently (16, 18).

In addition to its potential to encode an adhesion glycopro-tein, other features of ALS1 prompted further study. ALS1encodes a central domain of tandemly repeated copies of ahighly conserved 108-bp sequence that, when translated, pre-dicts a highly conserved 36-amino-acid motif (26). The tan-dem-repeat sequence hybridizes to several genomic fragmentsfrom C. albicans, suggesting that ALS1 belongs to a gene fam-ily (26). The existence of a gene family defined by the tandem-repeat-hybridizing fragments was demonstrated by the charac-terization of ALS3 (25). The size of the ALS family is difficultto estimate because of the presence of additional tandem-repeat-hybridizing fragments and of other genomic sequencesthat hybridize to a probe derived from the 59 end of ALS1 (25,26).

* Corresponding author. Mailing address: Department of Veteri-nary Pathobiology, University of Illinois at Urbana-Champaign, 2522VMBSB, 2001 S. Lincoln Ave., Urbana, IL 61802. Phone: (217) 333-5043. Fax: (217) 244-7421. E-mail: [email protected].

5334

on February 3, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Experiments to characterize the ALS genes and to under-stand their regulation were initially undertaken to lay the ground-work for studying Als protein function in C. albicans. StudyingAls protein function in C. albicans is challenging because, as-suming redundancy of function among proteins in the family,creation of a truly null mutant requires characterization of theentire family and disruption of many genes. We reasoned thatthe number of gene disruption steps could be reduced byknowing which genes were expressed under a particular growthcondition. Combining a particular growth condition with spe-cific disruptions could effectively create a null mutant. Studiesof ALS gene regulation demonstrated that ALS1 and ALS3 aredifferentially expressed (25, 26). ALS1 expression in vitro isregulated by components of growth media, and ALS3 is hypha-specific (25, 26). In addition, expression of ALS1 was shown tovary among strains of C. albicans (25).

In this study, we present data to further characterize theALS genes and their encoded proteins. Two new genes, ALS2and ALS4, are described. Similar to previously characterizedALS genes, ALS2 and ALS4 are shown to be differentiallyregulated. Comparison of ALS gene sequences yielded a gen-eralized ALS gene structure that fits another C. albicans gene,ALA1 (18). Here, we recognize the place of ALA1 in the ALSfamily. Analysis of sequence features of the five predicted Alsproteins suggests that they are localized on the C. albicans cellsurface, a property demonstrated by indirect immunofluores-cence with an anti-Als antiserum. Taken together, the datapresented here demonstrate that the cell-surface-localized Alsproteins could account for a significant portion of the strain-and growth-medium-dependent differences in adhesion com-monly noted in the C. albicans literature.

MATERIALS AND METHODS

Media and strains. All standard growth media and strains were describedpreviously (25, 26). C. albicans B311 used in this study was purchased from theAmerican Type Culture Collection; other isolates of B311 used in previousstudies were not used here.

Library screening and DNA sequencing of ALS genes. Construction of thefosmid library and PCR screening with primers specific for the consensus tan-dem-repeat sequence were described previously (25). Fosmids that were positivein the PCR screen were grouped on the basis of PCR products (25); a repre-sentative fosmid was chosen from each group for subcloning and DNA sequenc-ing of each ALS allele. Fosmids chosen were 19F-1 (ALS2-1), 20F-3 (ALS2-2),20E-6 (ALS4-1), and 29F-9 (ALS4-2). These fosmids were purified and digestedwith a variety of restriction enzymes. Southern blots of these digests were probedwith an 870-bp KpnI fragment from ALS1 that encodes only tandem-repeatsequences (26) to identify fragments likely to encode related ALS genes. Thesefragments were subcloned into pUC vectors (57) and transformed into Esche-richia coli DH5aMCR (Gibco BRL). Plasmid purification and DNA sequencingwere conducted as described previously (26). DNA sequencing of the tandem-repeat regions of ALS genes was limited to that required to determine that thetandem repeats conformed to the consensus pattern derived from ALS1 and thatthe tandem-repeat domain did not encode anything besides head-to-tail copies ofthe 108-bp sequence. This was accomplished with a combination of repeat-regionsubclones and production of nested deletions with a double-stranded nesteddeletion kit (Amersham Pharmacia Biotech). Sequences were reported as do-mains 59 and 39 of the tandem-repeat domain. Both alleles of ALS2 and ALS4from C. albicans 1161 were sequenced and deposited separately. Accessionnumbers for other sequences discussed here include L25902 (ALS1 [26]),U87856 (ALS3 [25]), and AF025429 (ALA1/ALS5 [18]).

ALS2- and ALS4-specific probes. A 164-bp fragment located immediately 39 ofthe tandem-repeat domain was amplified by PCR and found to detect both ALS2and ALS4. This PCR fragment was amplified with the forward primer 59 TCCGAGTCCATTCCAGTACTAA 39 and the reverse primer 59 GTTACAGCATCACTAGAAGGAATATC 39. The standard PCR for these primers and othersdescribed below included 1 mM (each) primer, 0.2 mM (each) deoxynucleosidetriphosphate, 1.5 mM MgCl2, 13 Promega PCR buffer, 2.5 U of Promega TaqDNA polymerase, and 10 to 100 ng of template DNA.

Since there was a high degree of identity between ALS2 and ALS4 in thedomain 39 of the tandem repeats, this region could not be exploited to definegene-specific probes as it had been for ALS1 (26) and ALS3 (25). Because of thehigh degree of nucleotide sequence conservation between all ALS genes withinthe domain 59 of the tandem repeats, ALS2 and ALS4 could be specifically

detected only with oligonucleotide probes. The resulting ALS2-specific probe, 59TAGTTCCTTACAAAGTAAGCCGTTCAATTT 39 (located at nucleotide 897in the ALS2-coding region), and the ALS4-specific probe 59 CGCGGCTTCTGTTGATGACTCATTTACTCATACT 39 (located at nucleotide 900 of the ALS4-coding region) were used in Southern blotting. The reverse complement of eachprobe was synthesized for use in Northern blotting as described below.

ALS5 probe. A probe encoding only tandem-repeat sequences from ALA1/ALS5 (18) was synthesized by PCR with the forward primer 59 GGTACAAGTTCCACTGCCAAA 39 and the reverse primer 59 AAGACAGTTCTTCCAATGGATCA 39. These primers amplified two products from genomic DNA ofC. albicans 1177, one at approximately 200 bp and the other at approximately 680bp. These two products were presumably due to amplification of tandem-repeatregions from each allele of ALS5 in this strain. The 680-bp fragment was clonedinto pCR2.1 (Invitrogen) and transformed into E. coli TOP10F9 cells (Invitro-gen). The DNA sequence of the cloned PCR fragment conformed to the con-sensus tandem-repeat sequence of ALS5 (18).

Nucleic acid blots. Southern blotting was performed as described previously(26) with the digoxigenin nonradioactive nucleic acid labeling and detectionsystem (Boehringer Mannheim). Blots probed with the ALS1 or ALS5 tandem-repeat sequence were hybridized at 65°C overnight. Blots were washed in 23SSC (13 SSC is 0.15 M NaCl plus 0.015 M sodium citrate)–0.1% sodium dodecylsulfate (SDS) at room temperature for 30 min and then with 0.53 SSC–0.1%SDS at 65°C for 1 h.

Cultures of strains SC5314 and 3153A were used to demonstrate the growth-stage-associated expression of ALS4 on Northern blots. Cells from an overnightYPD (yeast extract, peptone, dextrose) culture were washed twice in sterile waterand inoculated into 500 ml of fresh YPD at 5 3 106 cells/ml. An aliquot of thisculture was removed to extract total RNA for the 0 h time point. Cells for RNApreparation were washed twice with diethylpyrocarbonate-water, flash frozen inan ethanol dry-ice bath, and stored at 280°C until RNA was extracted. Thefreshly inoculated YPD culture was incubated at 30°C, with shaking at 200 rpm.Samples were removed every hour for 8 h and processed for RNA extraction asdescribed above. Three or four independent cell counts were performed at eachtime point to construct a growth curve.

Total RNA extraction, formaldehyde gel electrophoresis, and Northern blot-ting were performed as described previously (25). Fifty micrograms of total RNAwas loaded into each gel lane. ALS4-specific message was detected with theend-labelled ALS4-specific oligonucleotide. Hybridization with oligonucleotideprobes followed the method of Sundstrom et al. (52). Equal loading of total RNAon Northern blots was evaluated with a fragment from the C. albicans TEF1 gene(52) as previously described (26).

Production of anti-Als antiserum. Hyperimmune anti-Als serum raised in aNew Zealand White rabbit was a gift from George Livi (SmithKline BeechamPharmaceuticals). The anti-Als serum was raised against four 10-mer peptidesderived from the N-terminal domain of Als1p (26). These peptides were chosenbecause they were likely to be in a hydrophilic, surface-exposed region of themature, folded protein as predicted by secondary-structure algorithms (14).Peptides from the N-terminal region of Als1p were selected because this portionof the protein was predicted to be relatively free of glycosylation compared toother regions of the protein (26). The peptides selected were GWSLDGTSAN(amino acids 53 to 62), FYSGEEFTTF (amino acids 98 to 107), TGSSTDLEDS(amino acids 139 to 148), and NTVTFNDGDK (amino acids 156 to 165). Thesepeptides were linked to keyhole limpet hemocyanin (KLH) and combined inequal quantities prior to emulsification in Freund’s complete adjuvant (Sigma).The emulsion was injected into the rabbit at multiple subcutaneous sites. A bloodsample was collected from the marginal ear vein 14 days later. A booster immu-nization was administered 4 weeks after the initial immunization. The boosterimmunization was performed with the mixture of four KLH-linked peptidesemulsified in incomplete Freund’s adjuvant (Sigma). A blood sample was col-lected 14 days after the booster immunization, and the anti-Als titer was assayedon a Western blot of a heterologously produced soluble N-terminal fragment ofAls1p (see below). Four total-booster injections were performed, with the anti-Als titer increasing following each round. Increasing titer was judged by increas-ing dilutions of serum required to obtain an equivalent Western blot signal.Serum collected from the rabbit was stored in small aliquots at 280°C. Preim-mune serum collected from the same rabbit in which the anti-Als serum wasraised and a commercially purchased anti-KLH serum (ICN) were both utilizedas negative controls.

Indirect immunofluorescence of C. albicans cells. Cells of strain SC5314 weregrown in YPD until they reached late stationary phase; at this stage of growth,cultures typically have a density of approximately 5 3 108 cells/ml. Cells from thisculture were washed twice in phosphate-buffered saline (PBS) (per liter: 10 g ofNaCl, 0.25 g of KCl, and 1.43 g of Na2HPO4 [pH 7.2 to 7.3]) and counted. A freshculture of RPMI 1640 (catalog no. 11875-085; Gibco BRL) was inoculated at adensity of 5 3 106 cells/ml. This culture was incubated at 37°C and 120 rpm for1 h 45 min. One hundred microliters of this culture was spread into an area of acleaned glass slide that had been delineated by etching with a diamond pen.Slides were washed thoroughly in PBS before we proceeded. Slides were blockedwith 200 ml of 1.5% normal goat serum (Jackson Research Laboratories) dilutedin PBS and incubated for 10 min at room temperature in a humid chamber.Excess normal serum was drained from slides, and 200 ml of a primary antibodysolution was added. Two different primary antisera were used, a 1:100 dilution of

VOL. 180, 1998 C. ALBICANS ALS2 AND ALS4 5335


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

the anti-Als serum purified on a protein G column according to the manufac-turer’s instructions (MAbTrap G II column; Amersham Pharmacia Biotech) anda 1:500 dilution of the preimmune serum from the rabbit in which anti-Als serumwas raised. Immunoglobulin G (IgG) concentrations of these preparations wereroughly equivalent; a lower dilution of the protein-G-purified serum was used toaccount for the dilution that occurs during the purification procedure. Primaryantiserum was incubated on slides for 1 h at 4°C in a humid chamber. Slides werewashed thoroughly in ice-cold PBS. The secondary antibody, fluorescein-isothio-cyanate (FITC)-conjugated goat anti-rabbit IgG (heavy plus light chains) (cata-log no. 111-095-003; Jackson Research Laboratories) was diluted 1:2,500 from a0.75 mg/ml stock and incubated on slides for 1 h at 4°C in a humid chamber.Slides were washed thoroughly in ice-cold PBS and stored in darkness at 4°Cuntil they were viewed later the same day.

Immunofluorescence images were obtained with an Olympus BX60 fluores-cence microscope with an oil immersion lens at approximately 4003 magnifica-tion. Images were captured with a Photometrics Ltd. system consisting of acharge-coupled device camera (model CH250), an electronic unit (model CE200A, equipped with a 50-Hz 16-bit A/D converter), and a controller board(model NU 200). Images were acquired and evaluated with Adobe Photoshopsoftware and a Macintosh Quadra 840 AV computer (Apple Computer, Inc.).

Heterologous expression of an N-terminal fragment of Als1p in S. cerevisiae. APCR product encoding the N-terminal 433 amino acids of Als1p was producedwith the forward primer 59 CCCCCCCATGGTTCAACAATTTACATTGTTATTCCTATA 39 and the reverse primer 59 CCCCCGTCGACCAGTGGAACTTGTACCACCACTGTGTCA 39. The PCR product derived from C. albicansB311 genomic DNA was digested with NcoI and SalI and cloned into theNcoI-SalI-digested S. cerevisiae expression vector p138NB. Features of this vec-tor have been described previously (38, 42). Briefly, the expression vector con-tains the TRP1 selectable marker and partial 2mm sequences for maintenance athigh copy number. Expression is driven by the copper-inducible CUP1 genepromoter. A multiple cloning site is present in the vector downstream of theCUP1 promoter and upstream of the CYC1 transcription terminator. Shuttlevector functions allowed a correct construct, pLH109, to be selected in E. coliDH5aMCR (Gibco BRL). Plasmid pLH109 was transformed into the S. cerevi-siae strain YPH 274 (a/a ura3-52/ura3-52 lys2-801amber/lys2-801amber ade2-101ochre/ade2-101ochre trp1-D1/trp1-D1 his3-D200/his3-D200 leu2-D1/leu2-D1 [50]). The re-sulting S. cerevisiae strain was grown in synthetic complete medium without tryp-tophan (22). A 500-ml culture was grown to late stationary phase at 30°C. Cellswere harvested from this culture, washed twice in fresh synthetic completemedium without tryptophan, and resuspended in 30 ml of fresh medium. Ex-pression from the CUP1 promoter was induced by the addition of 150 mMCuSO4. Induced cells were grown for 4 h at 30°C with 200 rpm shaking. Cellswere collected by centrifugation, and the resulting culture supernatant wasbrought to 70% saturation with ammonium sulfate to precipitate proteins, in-cluding the secreted N-terminal portion of Als1p. The ammonium sulfate pre-cipitation was incubated overnight at 4°C on a rocker platform and then har-vested by centrifugation at 15,000 rpm (31,000 3 g) for 30 min in a BeckmanJA-17 rotor. Supernatant was decanted, and the precipitate was dissolved in PBS.The dissolved precipitate was thoroughly dialyzed against PBS in 12,000- to14,000- molecular-weight-cutoff dialysis tubing (Spectrum Laboratories, Inc.).The dialysate was concentrated in a Centricon-10 unit (Amicon, Inc.) and run ona 12.5% Tris-glycine polyacrylamide gel (31). S. cerevisiae YPH274 transformedwith blank p138NB plasmid was processed concurrently as a negative control.Coomassie blue R-250 (Sigma) and silver staining (Bio-Rad) indicated the pres-ence of a single protein band at approximately 65 kDa in samples fromYPH274(pLH109) that was not present in YPH274(p138NB). This band waspresumed to be the N-terminal portion of Als1p. Its identity was confirmed byWestern blotting with the anti-Als antiserum described above.

N-terminal amino acid sequencing of the Als1p-derived fragment. The 65-kDaband in the supernatant of the YPH274(pLH109) culture was well separatedfrom the sparse number of protein bands present on the acrylamide gel. Todetermine the N-terminal amino acid sequence of the 65-kDa Als1p fragment, a12.5% polyacrylamide gel of supernatant sample was run. Proteins from the gelwere electroblotted to a polyvinylidene difluoride membrane (Gelman Sciences,Inc.) with a 10 mM CAPS [3-(cyclohexylamino)-1-propanesulfonic acid] (Sigma)(pH 11.0)–10% methanol buffer in a Bio-Rad TransBlot apparatus. The polyvi-nylidene difluoride membrane was rinsed thoroughly with deionized water andstained with 0.2% Coomassie blue R-250 in 45% methanol–10% acetic acid. Themembrane was destained with 50% methanol–1% acetic acid and air dried, andthe Als1p-derived fragment was excised with a new razor blade. N-terminalamino acid sequencing was performed by the Iowa State University ProteinFacility with a model 492 Procise protein sequencer and a model 140C analyzer(Applied Biosystems, Inc.).

Nucleotide sequence accession numbers. Both alleles of ALS2 and ALS4 fromC. albicans 1161 were sequenced and deposited separately. GenBank accessionnumbers are AF024580 (59 domain) and AF024581 (39 domain) (ALS2-1),AF024582 and AF024583 (ALS2-2), AF024584 and AF024585 (ALS4-1), andAF024586 and AF024587 (ALS4-2).

RESULTS

ALS2 and ALS4 complete the set of genes that hybridize withthe ALS1 tandem-repeat probe. An 870-bp KpnI fragment de-rived from within the tandem-repeat domain of ALS1 hybrid-izes with several genomic fragments from C. albicans andC. stellatoidea; the number of hybridizing fragments dependsupon the strain examined (26). The 10 copies of the 108-bptandem-repeat element from ALS1 in strain B792 were alignedto derive a consensus sequence (26). PCR primers based onthe most-conserved regions of the tandem-repeat sequencewere used to screen a fosmid library from C. albicans 1161 (25).By this technique, fosmids were noted to yield different PCRproduct patterns and were grouped accordingly (25). Charac-terization of a representative fosmid from one of the groupsyielded ALS3 (25); fosmids from the other groups encodedalleles of two other ALS genes, designated ALS2 and ALS4.Restriction enzyme analysis and hybridization with ALS-gene-specific probes indicated that ALS2 and ALS4 accounted forthe remaining fragments that hybridize with the ALS1 tandem-repeat probe in genomic DNA from C. albicans 1161 (Fig. 1).A similar analysis with 12 C. albicans and two C. stellatoideastrains indicated that, in each strain, all four ALS genes arepresent and account for all of the restriction fragments thathybridize with the ALS1 tandem-repeat probe (data not shown).Varying numbers of tandem-repeat-hybridizing fragmentsoriginally noted in each strain (26) were due to differencesbetween allelic fragments encoding the same gene and to comi-gration of larger restriction fragments (data not shown).

The DNA sequence was derived for both alleles of ALS2and ALS4. ALS2 and ALS4 conformed to the basic three-domain structure of ALS genes, which includes a central do-main of varying numbers of copies of a tandemly repeated108-bp sequence, a 59 domain that is approximately 1.3 kb inlength and conserved between ALS genes, and a 39 domainthat is variable in length and sequence (25). Characterizationof fosmids encoding ALS2 and ALS4, as well as physical map-

FIG. 1. Designation of genomic DNA fragments that encode ALS genes.Southern blots of BglII- or HindIII-digested genomic DNA from C. albicans 1161were hybridized with an 870-bp KpnI fragment from ALS1 that contained onlytandem-repeat sequences (26). ALS alleles corresponding to each of these re-striction fragments were identified on separate blots with gene-specific probesdeveloped previously (25, 26) or in this study. Allelic fragments were deduced bydata from several experiments and sources, including physical mapping of C. al-bicans chromosomes (11, 48), restriction mapping of specific fosmid clones, DNAsequence analysis, and gene regulation studies (25, 26). Molecular size markers(in kilobases) are included between the blots.

5336 HOYER ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ping efforts in this lab and others, suggested that ALS2 andALS4 were located approximately 70 kb from each other onchromosome 6, SfiI fragment C (data not shown; 48).

Allelic differences have been noted previously for other ALSgenes, although this has been mainly in the tandem-repeatregion, where alleles have been demonstrated to encode dif-ferent numbers of head-to-tail copies of the 108-bp motif (26)(Table 1). In the current study, alleles of ALS2 and ALS4 weresequenced to study conservation of nucleotides in the non-tandem-repeat domains. In these other two domains, alleles ofALS2 and alleles of ALS4 were more than 97% identical innucleotide sequence (see below). Although the complete tan-dem-repeat region in both ALS2 and ALS4 was not sequenced,sufficient sequencing was completed in each allele to deter-mine that the tandem-repeat region conformed to the consen-sus tandem-repeat sequences derived for ALS1 and ALS3 andto confirm that only tandem-repeat sequences were present(data not shown). Sequencing of large regions of tandemlyrepeated DNA has been omitted in other studies such as theS. cerevisiae genome project (28).

Designation of C. albicans ALS5 and its place in the ALSfamily. Characterization of ALS1, ALS2, ALS3, and ALS4yielded a generalized three-domain structure for ALS genes.Another recently characterized C. albicans gene, called ALA1(18), also fits this basic motif and belongs to the ALS family.Because the name ALA1 has been previously used to denote analanyl tRNA synthetase in S. cerevisiae (44), and because C. al-bicans nomenclature follows the S. cerevisiae precedent (48),we propose that the gene described by Gaur and Klotz (18) becalled ALS5.

ALS5 was not identified in the original screening of genomicDNA by hybridization with the ALS1 tandem-repeat probe.Therefore, although both genes encode a domain of tandemrepeats, the exact tandem-repeat sequences were sufficientlydissimilar to escape detection by cross-hybridization under theexperimental conditions employed. Comparison of the consen-sus tandem-repeat sequences of ALS1 (26) and ALS5 (18)indicated matches between only 39% of the nucleotides (datanot shown). Because hybridization between two sequences de-

pends on matches between individual tandem-repeat copiesrather than an idealized consensus, Southern blotting was doneto see if any genomic fragments hybridized with both probes.An ALS5 tandem-repeat probe was amplified by PCR withprimers that flank the tandem-repeat region in this gene (18).The DNA sequence of this probe fragment indicated that itclosely matches the consensus sequence of the tandem repeatsof ALS5 in the clinical isolate used by Gaur and Klotz (data notshown; 18). Southern blots of BglII-digested genomic DNAfrom C. albicans and C. stellatoidea strains indicated that theALS1 tandem repeats hybridized to a different set of genomicfragments than did the ALS5 tandem repeats in most strains(Fig. 2). Based on this result, the small number of fragments ofsimilar size that were detected with both probes most likelyencode different genes. Additional ALS genes have been iso-lated which possess the general ALS three-domain structurebut which have more sequence similarities to ALS5 than toALS1. Analysis of these gene sequences suggested that vari-ability in the tandem-repeat sequences was a potential crite-rion for the division of the ALS family into subfamilies (24).

Sequences in the N-terminal domain of Als proteins are high-ly conserved and encode a secretory signal peptide. SequencesN-terminal of the tandem-repeat domain were highly con-served in each predicted Als protein, with amino acid identitybetween different proteins ranging from 68 to 86% (Fig. 3).Identity of the nucleotide sequences encoding the N-terminaldomain was 73 to 90%. At the start of each coding region wasa hydrophobic sequence with hallmarks of a secretory signalpeptide (54). To test whether the hydrophobic N terminusfunctioned as a signal sequence, a construct expressing theN-terminal 433 amino acids of Als1p under control of theCUP1 promoter was transformed into S. cerevisiae (see Mate-rials and Methods). Supernatants from cultures of the CuSO4-induced construct and a control strain harboring the blankexpression plasmid were run on SDS-polyacrylamide gels (31).Coomassie blue and silver staining of these gels indicated thata major protein species was present at approximately 65 kDa insupernatant from cells with the Als1p construct and absentfrom cells transformed with blank vector (data not shown). N-

TABLE 1. Comparison of Als protein features from predicted amino acid sequences

Als protein featurePredicted amino acid sequence

Als1pa Als2-1p Als2-2p Als3p Als4-1p Als4-2p Als5pa

No. of amino acidsN-terminal domain 433 432 432 433 433 433 433C-terminal domain 470 372 373 293 372 373 770

No. of consensus N glycosylation sitesb

N-terminal domain 0 2 2 0 0 0 0C-terminal domain 6 4 4 4 4 4 4

% Serine and threonineN-terminal domain 28 27 27 27 31 31 27C-terminal domain 45 36 37 41 37 36 45

No. of repeat copiesc 10 35 26 10 33 23 6

Size of nonglycosylated protein (kDa)d 133 218 183 120 209 171 150

a The Als1p sequence is from C. albicans B792 (26); the Als5p sequence (18) is from a clinical isolate. All other sequences are from C. albicans 1161. In strain 1161,ALS3 alleles are similar in size, but ALS1 alleles are detectably different lengths (Fig. 1).

b Asn-X-Ser/Thr, where X is any amino acid except proline (2). Consensus N glycosylation sites are abundant in the tandem-repeat domain; the consensustandem-repeat sequence contains one consensus N glycosylation site per copy (26), suggesting that the tandem repeats are highly N and O glycosylated.

c Values for the sequences of Als1p, Als3p, and Als5p are exact. Values for Als2p and Als4p were estimated from DNA sequence and detailed restriction mappinginformation.

d Values for Als1p, Als3p, and Als5p are exact. Values for Als2p and Als4p were estimated as follows: (predicted molecular weight of N-terminal domain) 1(predicted molecular weight of C-terminal domain) 1 (number of tandem-repeat copies) (molecular weight of consensus Als1p tandem-repeat sequence).



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

terminal amino acid sequencing of the 65-kDa protein yieldedthe sequence Lys-Thr-Ile-Thr and indicated true secretion ofthe N-terminal Als1p fragment with resultant loss of the first17 amino acids (Fig. 3). Cleavage following Ala17 was correctlypredicted by the Signalase program (21), which is based on thepredictive algorithms of von Heijne (54) and identifies sites forsignal peptide cleavage. Analysis of the other Als protein se-quences with the Signalase program predicted signal peptidecleavage at the same site, which was conserved in each of theAls amino acid sequences characterized to date (Fig. 3). Be-cause signal sequences have been shown to be processed sim-ilarly in S. cerevisiae and C. albicans (39), it is likely that thesame processing site is utilized by C. albicans.

The N-terminal domain of the Als protein molecule, partic-ularly within the first 330 amino acids, was predicted to berelatively free of glycosylation. In this region, all predicted Alsprotein sequences, with the exception of Als2p, lacked consen-sus sequences for N glycosylation (Fig. 3). After the first 330amino acids, each predicted Als protein had a threonine-richregion, raising the possibility that O glycosylation may be add-ed; the increased frequency of serine and proline residues alsosupported this possibility (Fig. 3).

Sequences C-terminal of the tandem-repeat domain are di-vergent but have a serine-threonine-rich composition. Of thethree domains present in Als proteins, the domain C-terminalof the tandem repeats was the least conserved across the fam-ily. This domain varied in sequence and length in the predictedAls proteins but exhibited similar amino acid sequence com-positions (Table 1). The serine-threonine richness of this do-main was consistent with the possibility of abundant O glyco-sylation (27). This feature, along with the presence ofconsensus sites for N glycosylation, predicted that the C-ter-minal domain was heavily glycosylated (Table 1). Both of thesefeatures were also observed in the tandem-repeat domain,which was similarly predicted to be heavily glycosylated.

Although sequences of the C-terminal domain were diver-gent, those residues within 50 amino acids of the stop codonwere highly conserved (Fig. 4). Within these conserved resi-dues was a hydrophobic region with hallmarks of the consensussite for glycosylphosphatidylinositol (GPI) addition. The fea-tures of a GPI addition site have been well characterized (re-viewed in references 8 and 12); following these rules, cleavage

at the conserved Gly or Ser was predicted (Fig. 4). Yeastproteins to which GPI is added can be localized to either thecell membrane or, after truncation of the GPI, cross-linked inthe cell wall (reviewed in reference 8). Analysis of amino acidsequences predicted from the S. cerevisiae genome sequencingproject identified a dibasic motif immediately preceding theGPI attachment site that is present in proteins localized to thecell membrane (8). The lack of this dibasic motif in the Alsprotein sequences (Fig. 4) suggested that if C. albicans fol-lowed the same rules as S. cerevisiae, Als proteins were likely tobe localized in the cell wall.

Although the C-terminal domain was the most highly diver-gent of the three ALS domains, the C-terminal domains ofAls2p and Als4p and the nucleotide sequences which encodethem were more than 95% identical. Multiple alignment of thenucleotide sequences of the ALS2 and ALS4 alleles indicatedthat only 3.9% of the sequence positions were mismatched.ALS2-1 and ALS4-1 each had a small gap; in each case, thisgap was apparently due to duplication of a trinucleotide se-quence in the other allele. Allelic sequences were also exam-ined; ALS2 alleles had 2.8% of sequences mismatched,whereas ALS4 sequences varied in only 0.5% of nucleotides.The mismatch between allelic sequences in the 59 domain wasslightly less, with 0.3% variation between the ALS2 alleles and0.4% between alleles of ALS4. The nucleotide sequence iden-tity between the 39 domains of ALS2 and ALS4 extendedbeyond the coding region; a region approximately 500 bp 39 ofeach coding region was sequenced and found to be over 95%identical for each gene (data not shown).

Cell-surface localization of Als proteins by indirect immu-nofluorescence. The predicted amino acid sequences of the Alsproteins suggested that they were localized on the cell surface.Features such as an N-terminal signal peptide, a C-terminalGPI addition site, repeated sequences, and C-terminal regionsrich in serine and threonine have all been noted in other yeastcell-surface proteins (reviewed in reference 8). Cell-surface lo-calization of Als proteins was demonstrated by indirect im-munofluorescence with a rabbit polyclonal antiserum raisedagainst four KLH-linked 10-mer peptides from Als1p. Subse-quent characterization of additional ALS genes indicated thatthe 10-mer peptide sequences were highly conserved in thepredicted amino acid sequences for other proteins of the Als

FIG. 2. Southern blots of BglII genomic DNA fragments hybridized with ALS1 and ALS5 tandem-repeat probes. Genomic DNA from a variety of C. albicans andC. stellatoidea strains was digested with BglII, blotted and probed with an 870-bp KpnI ALS1-tandem-repeat-specific probe (left panel). The blot was stripped andreprobed with a PCR-amplified ALS5 tandem-repeat fragment PCR amplified from C. albicans 1177 (right panel). Molecular size markers (in kilobases) are indicatedat the left for each blot.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

family (Fig. 3). Recognition of Als1p and Als3p by the anti-Alsantiserum was demonstrated by Western blotting of heterolo-gously produced protein fragments (data not shown); other Alsproteins remain to be tested.

For immunofluorescence studies, yeast-form cells were grownin YPD medium and transferred to RPMI 1640 to induce germtube formation. Both the mother yeast and germ tube stainedwith the anti-Als antiserum (Fig. 5). The specificity of this staining

was demonstrated in competition experiments in which stain-ing of both the mother yeast and the germ tube was blocked bythe addition of soluble N-terminal Als1p fragment (data notshown). C. albicans cells treated either with preimmune serumfrom the rabbit in which the polyclonal serum was raised (Fig.5F) or with commercially purchased anti-KLH antiserum inplace of the anti-Als serum did not stain (data not shown).

Although YPD-grown yeast forms stained with anti-Als se-

FIG. 3. Alignment of N-terminal amino acid sequences predicted from genes in the ALS family. Amino acid sequences were predicted by the translation of ALSgene sequences 59 of the start of the tandem-repeat domain. Sequences included are Als1p (26), Als2p and Als4p (this study), Als3p (25), and Als5p/Ala1p (18).Sequences were aligned with default parameters of the PILEUP program of Genetics Computer Group software (14). A consensus sequence (Cons), indicating aminoacids conserved in all sequences, is provided below the alignment. The vertical line (designated SSC) between residues 17 and 18 denotes the site of signal sequencecleavage demonstrated biochemically for Als1p and predicted by computer algorithm to be conserved for the remaining proteins. Boxed regions labelled 1, 2, 3, and4 correspond to the four 10-mer peptides from Als1p used to raise the rabbit polyclonal anti-Als antiserum used in indirect immunofluorescence studies. The boxedAls2p and Als4p sequences (labelled Probe) correspond to the region in the nucleotide sequence from which ALS2- and ALS4-specific oligonucleotides were derived.Boxed sequences between alleles of Als2p or Als4p indicate nonconserved amino acid sequences predicted from allelic nucleotide sequences. Consensus N glycosylationsites (2) are underlined in the Als2p sequences at positions 253 and 315. All CUG codons have been changed from Leu to Ser (46, 55).

FIG. 4. Alignment of the C-terminal amino acid sequences of Als proteins. Approximately the last 50 amino acids of each predicted Als protein sequence werealigned, to demonstrate sequence conservation in this region. A consensus sequence indicating amino acids conserved in every protein is indicated below the multiplealignment. The putative GPI addition sites are indicated by arrows. The larger arrow over the Gly residue suggests that this is the more likely GPI attachment site.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

rum (data not shown), this staining intensity diminished withelongation of the germ tube (Fig. 5B and D). The germ tubelength which corresponded to the loss of mother yeast fluores-cence differed with the size of the mother yeast cell (Fig. 5Aand B [arrow] versus Fig. 5C and D [arrows]). An additionalexperiment was performed in which cells were collected forstaining at 30-min intervals following the induction of germtube formation. Decreasing fluorescence was observed withgerm tube elongation for both small and large yeasts, with thesame final result of nonfluorescent mother yeast. However, alonger time was required to effect equivalent results from smallmother yeasts than from larger yeast cells (data not shown).Results from the indirect immunofluorescence experiments in-dicated that Als proteins were localized on the C. albicans cellsurface and raised interest in the distribution of Als proteinsduring the yeast-to-hypha conversion.

Variability in ALS gene size and expression pattern. It iswell documented that the sizes of ALS genes in any C. albicansstrain are highly variable (25, 26). In certain strains, alleles ofa given ALS gene produce different-sized proteins due to vari-ation in the numbers of tandem-repeat copies present in eachallele (Table 1). Also, certain Als proteins are likely to belarger than others, with Als1p in one strain, for example, beingtwice the size of Als1p in another strain (26).

Variability also exists within the ALS family with respect topatterns of gene expression. Previous work demonstrated thedifferential expression of ALS1 (26) and the hypha-specificexpression of ALS3 (25). Northern analysis established thatALS4 expression was correlated with the growth phase of aC. albicans culture. This effect was first noted in a pilot exper-iment in which C. albicans cells from an overnight YPD culturewere subcultured into fresh media and incubated at 30°C withshaking at 200 rpm. RNA was analyzed at 3-h time points by

Northern blotting with an ALS4-specific probe. ALS4-specificmessage was present except when cells were in early- to mid-log phase (data not shown). Cultures were followed for 33 h, atwhich time ALS4 message was abundant (data not shown). Tomore carefully analyze the time period in which ALS4-specificmessage was absent, the experiment was repeated with 1-htime intervals (Fig. 6). A Northern blot hybridized to detectALS4-specific messages was deliberately overexposed to iden-tify lanes in which ALS4-specific message was absent and topinpoint the time when the synthesis of ALS4-specific messagebegan (Fig. 6). Because the half-life of the ALS4-specific RNAwas not known, it was unclear whether signals present at the 0-,1- and 2-h time points were due to new synthesis or to dilutionand decay of message present in the stationary-phase cells usedto inoculate the culture. Synthesis of ALS4-specific messagebegan during the fifth hour, when cells reached mid-log phase,and increased as the culture reached stationary phase. In pre-vious experiments, the increase in ALS4-specific signal contin-ued as the culture reached stationary phase (data not shown).These experiments were also done with C. albicans 3153A, andthe same pattern of expression was noted (data not shown).

In contrast to the definable pattern of ALS4 expression,ALS2-specific message was not detected in cultures grown un-der a wide variety of in vitro conditions, including all growthstages in YPD and YND (neopeptone substituted for pep-tone); RPMI 1640-induced germ tubes and hyphae; Lee (33)and Soll medium (supplemented Lee medium [3]) at pHs 4.5,5.5, 6.5, and 7.5; Emmons-modified Sabouraud medium (32)with various carbon sources, including dextrose, galactose,maltose, and sucrose; and hyphal cells induced by adding 10%serum to YPD, 10 mM imidazole buffer (49), and PBS. Cells inthese media were grown at various temperatures, including 25,30, and 37°C. C. albicans strains in these studies included B311,

FIG. 5. Indirect immunofluorescence of C. albicans SC5314 germ tubes. YPD-grown C. albicans cells of strain SC5314 were induced to form germ tubes byinoculation into RPMI 1640 medium. Panels A, C, and E are light micrographs corresponding to the fluorescent micrographs in panels B, D, and F, respectively. Cellsin panels B and D were treated with anti-Als antiserum followed by FITC-labelled goat-anti-rabbit IgG. Cells in panel F were stained with preimmune serum from thesame rabbit in which the anti-Als serum was raised, followed by staining with the FITC-labelled secondary antiserum. The arrow in panel B indicates a large motheryeast cell that has lost its fluorescence. Arrows in panel D indicate small mother yeast cells for which fluorescence is still visible.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

B792, SC5314, 1177, 3153A, and WO-1. The lack of detectionof an ALS2-specific message under so many in vitro conditionssuggested a number of possibilities, including the possibilitythat ALS2 was a pseudogene and the possibility that ALS2required in vivo signals for expression.

DISCUSSION

PCR screening of a C. albicans fosmid library with primersbased on the consensus tandem-repeat sequence of ALS1yielded fosmids encoding ALS3 (25), ALS2, and ALS4. Thesegenes account for the ALS1-tandem-repeat-hybridizing frag-ments detected in high-stringency Southern blots of C. albicansgenomic DNA (26). An additional gene described in the liter-ature, ALA1 (18), also belongs in the ALS family and is des-ignated ALS5. Although ALS5 encodes tandem repeats similarto those in ALS1, there is sufficient nucleotide sequence diver-gence between the two consensus repeat sequences that theydetect different genomic fragments on high-stringency South-ern blots.

Sequences N-terminal of the tandem repeats are highly con-served in the five aligned Als proteins; however, sequencesC-terminal of the tandem repeats are divergent. N-terminalhydrophobic sequences function as a signal peptide which iscleaved following Ala17, a site conserved in each Als protein.C-terminal conserved hydrophobic sequences within the last 50amino acids of each predicted Als protein have characteristicsof the site for GPI addition. These observations are consistentwith cell-surface localization of Als proteins, a feature demon-strated by indirect immunofluorescence with an anti-Als se-

rum. The anti-Als serum stains both mother yeasts and germtubes, with the intensity of staining of the mother yeast dimin-ishing as the germ tube elongates.

Analysis of expression patterns of the two newly character-ized ALS genes indicates that the expression of ALS4 is cor-related with the growth phase of the culture. ALS2 messagewas not detected in vitro despite the fact that a wide variety ofgrowth conditions were tested. These data support previous ev-idence that genes in the ALS family are differentially regulated.

Als protein profile on the C. albicans cell surface. The profileof Als proteins on the C. albicans cell surface is highly variableand depends upon several factors, including growth conditionsand strain (Table 1) (25, 26). Indirect immunofluorescenceexperiments demonstrated that the Als protein profile on theC. albicans surface is dynamic. Both mother yeasts and germtubes stain with an anti-Als serum, and staining of the motheryeast diminishes with germ tube elongation. Possible explana-tions for the diminishing fluorescence of the mother yeastinclude migration of the Als proteins from the mother yeast tothe growing germ tube, masking of the Als protein antigens onthe mother yeast by synthesis of new cell wall material, andshedding of the Als protein antigens into the culture medium.Migration of cell wall material from mother yeast to germ tubeis unlikely in light of data published by Staebell and Soll (51),which demonstrated growth of a germ tube predominantly byapical expansion. Masking of cell-surface proteins by carbohy-drate or by glycosylation of other proteins has been discussedin the context of C. albicans cell-surface hydrophobicity (20,41). Because the N-terminal epitope recognized by the anti-Als

FIG. 6. ALS4 expression in YPD-grown C. albicans cells. Strain SC5314 was grown overnight in YPD; cells from this culture were used to inoculate fresh YPDmedium. Immediately after inoculation (0 h) and at each hour for the next 8 h, an aliquot of cells was removed. Cells were counted to generate a growth curve (rightpanel) and harvested for RNA extraction and Northern blotting with an ALS4-specific probe (left panel). A fragment of the C. albicans TEF1 gene was used as a controlfor equal loading of RNA.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

antiserum is predicted to be glycosylation free, it is unlikelythat the epitope is masked by the direct addition of carbohy-drate. However, modification of preexisting glycosylated cell-surface proteins or the production of new ones might explainthe diminished fluorescence of the mother yeast. Another pos-sible reason for the diminishing fluorescence of the motheryeast is the shedding of antigens into the culture medium, aphenomenon that is well documented (reviewed in reference40). High-molecular-weight mannoproteins within the range ofsizes predicted for Als proteins are among those shed (1, 40).Previous work by Brawner and Cutler described a C. albicanscell-surface antigen with the same pattern of expression weobserved with our anti-Als serum (4–6). Immunogold electronmicroscopy with a monoclonal IgM indicated that the antigenstudied by Brawner and Cutler was associated with the outerflocculent layer of the cell surface (4–6); they discussed shed-ding of the antigen into the growth medium as an explanationfor its diminished intensity on the mother yeast during germtube elongation.

Nature of the putative binding domain. Als proteins werenamed because of the similarities between predicted Als se-quences and the sequence of a-agglutinin of S. cerevisiae. In-formation about the well-characterized a-agglutinin has pro-vided numerous clues about the localization and function ofAls proteins (36). The most-significant sequence identity be-tween Als proteins and a-agglutinin exists between the first 300amino acids of each protein (26). Within this region, a-agglu-tinin has an immunoglobulin fold structure that is characteris-tic of many different cell adhesion molecules (10, 13, 35, 56).Because the Als proteins have significant sequence similarity toAga1p across domain-sized blocks, they are likely to have a three-dimensional structure similar to that of a-agglutinin (34). Thisobservation implicates the first 300 amino acids of the Alsprotein N terminus as a putative binding domain. Examinationof Cys residues in the two sequences indicates that the six Cysresidues in the first 300 amino acids of a-agglutinin are con-served in the first 300 amino acids of all Als proteins; however,in this region, each Als protein contains two additional Cysresidues that are not found in a-agglutinin. Conservation of theeight Cys residues in the first 300 amino acids of each matureAls protein strongly suggests structural similarity in this por-tion of each molecule. Additional studies are planned to pre-dict the structure of the putative binding domain of Als pro-teins and to evaluate its relatedness to the immunoglobulin fold.

The tandem-repeat region and C-terminal domain are pre-dicted to be highly N and O glycosylated. Because O glycosy-lation can confer a rigid structure on a given protein (27), thetandem repeats and C-terminal sequences are likely the meansby which the putative binding domain is displayed on the cellsurface. Estimates of protein length demonstrate that most Alsproteins could be localized in the cell membrane or cell walland still display this binding domain on the cell surface; shorterproteins, such as Als3p (25), may require cell wall localizationto expose the putative binding domain on the cell surface.While lack of the dibasic motif suggests that Als proteins arelocalized in the cell wall, membrane localization cannot becompletely ruled out, because the GPI addition site of C. al-bicans Phr1p, which is localized in the cell membrane, alsolacks the dibasic motif (47, 53). It is also possible that not allAls proteins have the same subcellular localization.

Als protein function. The growing size of the ALS familyprompts questions about the function of the encoded proteinsand conservation of function between proteins in the family.Als protein function was addressed by two recent studies inwhich S. cerevisiae was transformed with a C. albicans libraryseeking C. albicans genes that could confer an adhesive phe-

notype on the nonadherent S. cerevisiae. In the first study,expression of ALA1/ALS5 in S. cerevisiae conferred adherenceto fibronectin, laminin, type IV collagen, and buccal epithelialcells (18). In the second study, the expression of ALS1 in S.cerevisiae conferred adherence to endothelial cells and to cellsfrom an esophageal epithelial line (16). Conclusions drawn inboth these studies are consistent with our ideas about the func-tion of Als proteins. The nature of the adhesive interactionobserved in these studies, however, needs further clarificationto determine whether adhesion is due to the putative N-termi-nal binding domain or to another portion of the molecule. Oneportion of the molecule with the potential to mediate an adhe-sive effect is the region predicted to be highly glycosylated. Theeffect of protein must be separated from that of the likely carbo-hydrate in order to define the nature of the adhesive interaction.

The availability of amino acid sequences for several Alsproteins allows initial speculation about the conservation offunction among proteins in the family. Presumed adhesivefunction due to extensive glycosylation suggests that Als pro-teins require only a sequence that serves as the scaffold for theaddition of carbohydrate; this is provided by the tandem-re-peat and C-terminal domains which are rich in consensus Nglycosylation sites and in serine and threonine, which are po-tential sites for the addition of O-linked carbohydrate (2, 27).The amino acid sequence of the C-terminal domain is highlyvariable between Als proteins, but each protein has featuresconducive to abundant carbohydrate addition. Adhesive func-tion due to an N-terminal binding domain requires conserva-tion of sequence determining similar structural features. Thisis observed for each mature Als protein, which has eight con-served Cys residues, a similar N-terminal domain length, and ahigh degree of sequence identity. Of the five Als protein se-quences, Als4p is least like the others in regard to its N-ter-minal domain sequence, suggesting that it is the least likelyto exhibit conserved function. More-meaningful informationabout conservation of function will be gained from structuralpredictions with even-less-similar sequences, such as that ofAls7p, which is only about 50% identical to Als1p in the N-terminal domain (24). Differential glycosylation at the N ter-minus, which is possible for Als2p (Table 1), could also lead toalterations in the three-dimensional structure of the regionand to corresponding variations in function. Whether adhesivefunction is due to protein, carbohydrate, or both, proteins en-coded by the differentially regulated, multigene ALS familyhave the potential to explain much of the strain- and growth-medium-dependent differences in adhesion commonly ob-served for C. albicans.

ACKNOWLEDGMENTS

We thank George Livi and Megan McLaughlin of SmithKlineBeecham Pharmaceuticals for their gift of the anti-Als antiserum,Steven Klotz for making the sequence of ALA1 available to us prior topublication, and Roberto Docampo and Hong-Gang Lu for the use ofand assistance with the fluorescence microscope and digital imagingequipment. We also thank the Iowa State University DNA Sequencingand Synthesis Facility for sequencing the ALS2 and ALS4 genes.L.L.H. is grateful to Allan Shatzman, George Livi, Stewart Scherer,and Alan Myers for their support of studies of the ALS gene family;without their support, this work would not have been possible.

This work was supported by Public Health Service Grant AI39441(to L.L.H.); by Cooperative State Research, Education and Extension,U.S. Department of Agriculture, under project no. ILLU-70-0305 (toL.L.H.); and by the University of Illinois Campus Research Board (toL.L.H.).

REFERENCES1. Aguiar, J. M., F. Baquero, and J. M. Jones. 1993. Candida albicans exocel-

lular antigens released into a synthetic culture medium: characterization and



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

serological response in rabbits. J. Gen. Microbiol. 139:3005–3010.2. Bause, E. 1983. Structural requirements of N-glycosylation of proteins. Bio-

chem. J. 209:331–336.3. Bedell, G. W., and D. R. Soll. 1979. Effects of low concentrations of zinc on

the growth and dimorphism of Candida albicans: evidence for zinc-resistantand -sensitive pathways for mycelium formation. Infect. Immun. 26:348–354.

4. Brawner, D. L., and J. E. Cutler. 1986. Ultrastructural and biochemicalstudies of two dynamically expressed cell surface determinants on Candidaalbicans. Infect. Immun. 51:327–336.

5. Brawner, D. L., and J. E. Cutler. 1984. Variability in expression of a cellsurface determinant on Candida albicans as evidenced by an agglutinatingmonoclonal antibody. Infect. Immun. 43:966–972.

6. Brawner, D. L., and J. E. Cutler. 1986. Variability in expression of cellsurface antigens of Candida albicans during morphogenesis. Infect. Immun.51:337–343.

7. Calderone, R. A., and P. C. Braun. 1991. Adherence and receptor relation-ships of Candida albicans. Microbiol. Rev. 55:1–20.

8. Caro, L. H. P., H. Tettelin, J. H. Vossen, A. F. J. Ram, H. van den Ende, andF. M. Klis. 1997. In silicio identification of glycosyl-phosphatidylinositol-anchored plasma-membrane and cell wall proteins of Saccharomyces cerevi-siae. Yeast 13:1477–1489.

9. Chaffin, W. L., J. L. Lopez-Ribot, M. Casanova, D. Gozalbo, and J. P.Martinez. 1998. Cell wall and secreted proteins of Candida albicans: identi-fication, function, and expression. Microbiol. Mol. Biol. Rev. 62:130–180.

10. Chen, M.-H., Z.-M. Shen, S. Bobin, P. C. Kahn, and P. N. Lipke. 1995. Structureof Saccharomyces cerevisiae a-agglutinin. J. Biol. Chem. 270:26168–26177.

11. Chu, W.-S., B. B. Magee, and P. T. Magee. 1993. Construction of an SfiImacrorestriction map of the Candida albicans genome. J. Bacteriol. 175:6637–6651.

12. Coyne, K. E., A. Crisci, and D. M. Lublin. 1993. Construction of syntheticsignals for glycosyl-phosphatidylinositol anchor attachment. J. Biol. Chem.268:6689–6693.

13. de Nobel, H., P. N. Lipke, and J. Kurjan. 1996. Identification of a ligand-binding site in an immunoglobulin fold domain of the Saccharomyces cerevi-siae adhesion protein a-agglutinin. Mol. Biol. Cell 7:143–153.

14. Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set ofsequence analysis programs for the VAX. Nucleic Acids Res. 12:387–395.

15. Douglas, L. J. 1987. Adhesion of Candida species to epithelial surfaces. Crit.Rev. Microbiol. 15:27–43.

16. Fu, Y., G. Rieg, W. A. Fonzi, P. H. Belanger, J. E. Edwards, and S. G. Filler.1998. Expression of the Candida albicans gene ALS1 in Saccharomyces cer-evisiae induces adherence to endothelial and epithelial cells. Infect. Immun.66:1783–1786.

17. Fukazawa, Y., and K. Kagaya. 1997. Molecular bases of adhesion of Candidaalbicans. J. Med. Vet. Mycol. 35:87–99.

18. Gaur, N. K., and S. A. Klotz. 1997. Expression, cloning, and characterizationof a Candida albicans gene, ALA1, that confers adherence properties uponSaccharomyces cerevisiae for extracellular matrix proteins. Infect. Immun. 65:5289–5294.

19. Hauser, K., and W. Tanner. 1989. Purification of the inducible a-agglutininof S. cerevisiae and molecular cloning of the gene. FEBS Lett. 225:290–294.

20. Hazen, K. C., and B. W. Hazen. 1992. Hydrophobic surface protein maskingby the opportunistic fungal pathogen Candida albicans. Infect. Immun. 60:1499–1508.

21. Hegner, M., A. von Kieckebusch-Guck, R. Falchetto, P. James, G. Semenza,and N. Mantei. 1992. Single amino acid substitutions can convert the un-cleaved signal-anchor of sucrase-isomaltase to a cleaved signal sequence.J. Biol. Chem. 267:16928–16933.

22. Hicks, J. B., and I. Herskowitz. 1976. Interconversion of yeast mating types.I. Direct observations of the action of the homothallism (HO) gene. Genetics83:245–258.

23. Hostetter, M. K. 1994. Adhesins and ligands involved in the interaction ofCandida spp. with epithelial and endothelial surfaces. Clin. Microbiol. Rev.7:29–42.

24. Hoyer, L. L., J. E. Hecht, and M. Z. Ho. 1998. Unpublished data.25. Hoyer, L. L., T. L. Payne, M. Bell, A. M. Myers, and S. Scherer. 1998.

Candida albicans ALS3 and insights into the nature of the ALS gene family.Curr. Genet. 33:451–459.

26. Hoyer, L. L., S. Scherer, A. R. Shatzman, and G. P. Livi. 1995. Candidaalbicans ALS1: domains related to a Saccharomyces cerevisiae sexual agglu-tinin separated by a repeating motif. Mol. Microbiol. 15:39–54.

27. Jentoft, N. 1990. Why are proteins O-glycosylated? Trends Biochem. Sci. 15:291–294.

28. Johnston, M., S. Andres, R. Brinkman, J. Cooper, H. Ding, J. Dover, Z. Du,A. Favello, L. Fulton, S. Gattung, C. Geisel, J. Kiresten, T. Kucaba, L. Hiller,M. Jier, L. Johnston, Y. Langston, P. Latreille, E. J. Louis, C. Macri, E.Mardis, S. Menezes, L. Mouser, M. Nhan, L. Rifkin, L. Riles, H. S. Peter, E.Trevaskis, K. Vaughan, D. Vignati, L. Wilcox, P. Wohldman, R. Waterston,R. Wilson, and M. Vaudin. 1994. Complete nucleotide sequence of Saccha-romyces cerevisiae chromosome VIII. Science 265:2077–2082.

29. Kennedy, M. J. 1988. Adhesion and association mechanisms of Candida

albicans. In M. R. McGinnis (ed.), Current topics in medical mycology, vol.2. Springer-Verlag, New York, N.Y.

30. Kennedy, M. J. 1990. Models for studying the role of fungal attachment incolonization and pathogenesis. Mycopathologia 109:123–137.

31. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680–685.

32. Larone, D. H. 1995. Medically important fungi, 3rd ed. American Society forMicrobiology, Washington, D.C.

33. Lee, K. L., H. R. Buckley, and C. C. Campbell. 1975. An amino acid liquidsynthetic medium for the development of mycelial and yeast forms of Can-dida albicans. Sabouraudia 13:148–153.

34. Lipke, P. N. 1998. Personal communication.35. Lipke, P. N., M.-H. Chen, H. de Nobel, J. Kurjan, and P. C. Kahn. 1995.

Homology modeling of an immunoglobulin-like domain in the Saccharomy-ces cerevisiae adhesion protein a-agglutinin. Protein Sci. 4:2168–2178.

36. Lipke, P. N., and J. Kurjan. 1992. Sexual agglutination in budding yeasts:structure, function, and regulation of adhesion glycoproteins. Microbiol.Rev. 56:180–194.

37. Lipke, P. N., D. Wojciechowicz, and J. Kurjan. 1989. AGa1 is the structuralgene for the Saccharomyces cerevisiae a-agglutinin, a cell surface glycoproteininvolved in cell-cell interactions during mating. Mol. Cell. Biol. 9:3155–3165.

38. Livi, G. P., P. Kmetz, M. M. McHale, L. B. Cieslinski, G. M. Sathe, D. P.Taylor, R. L. Davis, T. J. Torphy, and J. M. Balcarek. 1990. Cloning andexpression of cDNA for a human low-Km, rolipram-sensitive cyclic AMPphosphodiesterase. Mol. Cell. Biol. 10:2678–2686.

39. Livi, G. P., J. S. Lillquist, L. M. Miles, A. Ferrara, G. M. Sathe, P. L. Simon,C. A. Meyers, J. A. Gorman, and P. R. Young. 1991. Secretion of N-glyco-sylated interleukin-1b in Saccharomyces cerevisiae using a leader peptidefrom Candida albicans. J. Biol. Chem. 266:15348–15355.

40. Lopez-Ribot, J. L., D. Gozalbo, P. Sepulveda, M. Casanova, and J. P. Mar-tinez. 1995. Preliminary characterization of the material released to theculture medium by Candida albicans yeast and mycelial cells. Antonie Leeu-wenhoek 68:195–201.

41. Masuoka, J., and K. C. Hazen. 1997. Cell wall protein mannosylation deter-mines Candida albicans cell surface hydrophobicity. Microbiology 143:3015–3021.

42. McHale, M. M., L. B. Cieslinski, W.-K. Eng, R. K. Johnson, T. J. Torphy,and G. P. Livi. 1991. Expression of human recombinant cAMP phosphodi-esterase isozyme IV reverses growth arrest phenotypes in phosphodiester-ase-deficient yeast. Mol. Pharmacol. 39:109–113.

43. Odds, F. C. 1988. Candida and candidosis, 2nd ed. Balliere Tindall, London,England.

44. Ripmaster, T. L., K. Shiba, and P. Schimmel. 1995. Wide cross-speciesaminoacyl-tRNA synthetase replacement in vivo: yeast cytoplasmic alanineenzyme replaced by human polymyositis serum antigen. Proc. Natl. Acad.Sci. USA 92:4932–4936.

45. Rotrosen, D., R. A. Calderone, and J. E. Edwards. 1986. Adherence ofCandida species to host tissues and plastic surfaces. Rev. Infect. Dis. 8:73–85.

46. Santos, M. A. S., and M. F. Tuite. 1995. The CUG codon is decoded in vivo asserine and not leucine in Candida albicans. Nucleic Acids Res. 23:1481–1486.

47. Saporito-Irwin, S. M., C. E. Birse, P. S. Sypherd, and W. A. Fonzi. 1995.PHR1, a pH-regulated gene of Candida albicans, is required for morpho-genesis. Mol. Cell. Biol. 15:601–613.

48. Scherer, S. 1998. http://alces.med.umn.edu/candida.49. Shepherd, M. G., C. Y. Yin, S. P. Ram, and P. A. Sullivan. 1980. Germ tube

induction in Candida albicans. Can. J. Microbiol. 26:21–26.50. Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors and yeast

host strains designed for efficient manipulation of DNA in Saccharomycescerevisiae. Genetics 122:19–27.

51. Staebell, M., and D. R. Soll. 1985. Temporal and spatial differences in cellwall expansion during bud and mycelium formation in Candida albicans.J. Gen. Microbiol. 131:1467–1480.

52. Sundstrom, P., M. Irwin, D. Smith, and P. S. Sypherd. 1991. Both genes forEF-1a in Candida albicans are translated. Mol. Microbiol. 5:1703–1706.

53. Vai, M., I. Orlandi, P. Cavadini, L. Alberghina, and L. Popolo. 1996. Can-dida albicans homologue of GGP1/GAS1 gene is functional in Saccharomy-ces cerevisiae and contains the determinants for glycosylphosphatidylinositolattachment. Yeast 12:361–368.

54. von Heijne, G. 1986. A new method for predicting signal sequence cleavagesites. Nucleic Acids Res. 14:4683–4690.

55. White, T. C., L. E. Andrews, D. Maltby, and N. Agabian. 1995. The “univer-sal” leucine codon CTG in the secreted aspartyl proteinase 1 (SAP1) gene ofCandida albicans encodes a serine in vivo. J. Bacteriol. 177:2953–2955.

56. Wojciechowicz, D., C.-F. Lu, J. Kurjan, and P. N. Lipke. 1993. Cell surfaceanchorage and ligand-binding domains of the Saccharomyces cerevisiae celladhesion protein a-agglutinin, a member of the immunoglobulin superfam-ily. Mol. Cell. Biol. 13:2554–2563.

57. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phagecloning vectors and host strains: nucleotide sequences of the M13mp18 andpUC19 vectors. Gene 33:103–119.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Identification of Candida albicans ALS2 and ALS4 and Localization ...

Documents

Transcript of Identification of Candida albicans ALS2 and ALS4 and Localization ...