IDENTIFICATION OF ATAXIA-ASSOCIATED mtDNA MUTATIONS … Nerve 09.pdf · 2009-09-14 · mitted...

ABSTRACT: The potential pathogenicity of two homoplasmic mtDNA point mu-tations, 9035T�C and 4452T�C, found in a family afflicted with maternally trans-mitted cognitive developmental delay, learning disability, and progressive ataxiawas evaluated using transmitochondrial cybrids. We confirmed that the 4452T�Ctransition in tRNAMet represented a polymorphism; however, 9035T�C conversionin the ATP6 gene was responsible for a defective F0-ATPase. Accordingly, mutantcybrids had a reduced oligomycin-sensitive ATP hydrolyzing activity. They had lessthan half of the steady-state content of ATP and nearly an 8-fold higher basal levelof reactive oxygen species (ROS). Mutant cybrids were unable to cope with addi-tional insults, i.e., glucose deprivation or tertiary-butyl hydroperoxide, and theysuccumbed to either apoptotic or necrotic cell death. Both of these outcomes wereprevented by the antioxidants CoQ10 and vitamin E, suggesting that the abnormallyhigh levels of ROS were the triggers of cell death. In conclusion, the principalmetabolic defects, i.e., energy deficiency and ROS burden, resulted from the9035T�C mutation and could be responsible for the development of clinical symp-toms in this family. Furthermore, antioxidant therapy might prove helpful in themanagement of this disease.

Muscle Nerve 39: 000–000, 2009

IDENTIFICATION OF ATAXIA-ASSOCIATEDmtDNA MUTATIONS (m.4052T>C and m.9035T>C)AND EVALUATION OF THEIR PATHOGENICITY INTRANSMITOCHONDRIAL CYBRIDSMARIANNA SIKORSKA, PhD,1 JAGDEEP K. SANDHU, PhD,1 DAVID K. SIMON, MD, PhD,2

VIMUKTHI PATHIRAJA, MD,2 CAROLINE SODJA, MSc,1 YAN LI, MD,1

MARIA RIBECCO-LUTKIEWICZ, PhD,1 PATRICIA LANTHIER, BSc,1 HENRYK BOROWY-BOROWSKI, PhD,1

ADRIAN UPTON, MD, PhD,3 SANDEEP RAHA, PhD,4 STEFAN M. PULST, MD, PhD,5 and

MARK A. TARNOPOLSKY, MD, PhD3,4

1 Neurogenesis and Brain Repair Group M54, Institute for Biological Sciences, National Research Council Canada,1200 Montreal Road, Ottawa, Ontario, K1A 0R6, Canada

2 Department of Neurology, Beth Israel Deaconess Medical Center and Harvard Medical School,Boston, Massachusetts, USA

3 Department of Medicine (Neurology), McMaster University, Hamilton, Ontario, Canada4 Department of Pediatrics (Neuromuscular and Neurometabolic Disorders), 1200 Main Street West,

Room 2U26, McMaster University, Hamilton, Ontario, L8N 3Z5, Canada5 Cedars-Sinai Medical Center, Los Angeles, California, USA

Accepted 17 February 2009

Maternally inherited mitochondrial diseases arelinked directly to mutations in the mitochondrialgenome, namely, base substitutions and/or inser-

tion/deletions. To date, more than 130 pathogenicmtDNA mutations have been described. Many ofthem are located in the polypeptide encoding re-gions and impair the functions of respiratory chaincomplexes, the final common pathway of aerobicmetabolism. A variety of clinical features have beenassociated with mitochondrial cytopathies, includingptosis, ataxia, external ophthalmoplegia, optic atrophy,pigmentary retinopathy, sensorineural deafness, neu-ropathy, cardiomyopathy, proximal myopathy, and ex-ercise intolerance.10,11,28,34,49 Mitochondrial cytopa-thies often share small clusters of clinical features thatallow them to be grouped into clinical syndromes, i.e.,the Kearns–Sayre syndrome (KSS), chronic progressiveexternal ophthalmoplegia (CPEO),25 mitochondrialencephalomyopathy with lactic acidosis and stroke-like

Abbreviations: ATP, adenosine triphosphate; CFDA, 5-carboxyfluoresceindiacetate; CoQ10, coenzyme Q10; CuZnSOD, copper-zinc superoxide dis-mutase; �GCS, �-glutamyl cysteine ligase; GCLC, �-glutamyl cysteine ligasecatalytic subunit; GCLM, �-glutamyl cysteine ligase modulatory subunit; GD,glucose deprivation; GSH, reduced glutathione; MnSOD, manganese super-oxide dismutase; mtDNA, mitochondrial DNA; OXPHOS, oxidative phosphor-ylation; PTS, polyoxyethanyl-alpha-tocopheryl sebacate; ROS, reactive oxy-gen species; tBHP, tertiary butyl hydroperoxideKey words: antioxidant; homoplasmic mutations; mitochondrial; oxidativestress; therapyCorrespondence to: M. Sikorska; e-mail: [email protected] orM.A. Tarnopolsky; e-mail: [email protected]

© 2009 Wiley Periodicals, Inc.Published online in Wiley InterScience (www.interscience.wiley.com). DOI 10.1002/mus.21355

Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 1

tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 S�7 7/20/09 11:41 Art: 08-0574

episodes (MELAS),7 myoclonic epilepsy with ragged-red fibers (MERRF),15 Leigh syndrome (LS),8 or neu-rogenic weakness with ataxia and retinitis pigmentosa(NARP).18

The majority of pathogenic mtDNA mutationsare heteroplasmic, and the manifestation of clinicalsymptoms occurs only after a critical proportion ofmutant mtDNA in a tissue exceeds the threshold forgenotype expression.45 This threshold varies for dif-ferent types of mtDNA mutations. For example, forthe 8344A�G mutation, which causes MERRF syn-drome, the threshold level is about 85% of mutantmtDNA,6 whereas for the 8993T�G mutation, re-sponsible for the NARP phenotype, the threshold isbetween 70% and 90%.9,47 Homoplasmic mutations,on the other hand, are mostly regarded as polymor-phisms, and their pathogenic significance is oftendifficult to demonstrate. However, several homoplas-mic point mutations have been linked to clinicaldisorders such as deafness, i.e., the 1555A�G tran-sition in SNHL (nonsyndromic and aminoglycoside-induced sensorineural hearing loss) or blindness,i.e., 11778G�A, 3460A�G, or 14484T�C, which arecommonly found in LHON (Leber’s hereditary op-tic neuropathy) patients.4 We and others22,42 havealso described a variety of clinical features associatedwith homoplasmic mutations.

Recently, we identified a family in which severalmembers, maternally linked across four generations,were afflicted with developmental delays, learningdisabilities, and ataxia. Genetic testing for spinocer-ebellar ataxias 1, 2, 3, 6, 7, 8, 17, Friedreich’s ataxia(FRDA), and the 8993T�G/C NARP/MILS muta-tions were all negative. Sequencing of the mtDNArevealed that all affected individuals carried two ho-moplasmic basepair (bp) substitutions, 4452T�C intRNAMet and 9035T�C in the ATP6 gene (A6 sub-unit), which might have been an underlying cause ofthe clinical symptoms. The mitochondrial tRNAMet isone of 22 tRNAs encoded by mtDNA and is utilizedin translation of 13 essential subunits of respiratorychain complexes (i.e., I, III, IV, and V). This is acritical gene for mitochondrial protein synthesis, es-pecially in the mammalian system, which utilizes asingle tRNAMet species not only for two alternative Mcodons (AUG and AUA), but also for both initiationand elongation of translation.12 The A6 is one of thetwo mitochondrially encoded subunits of the F0 por-tion of ATP synthase (complex V). Structurally, ATPsynthase is comprised of a rotary catalytic F1 portion,a transmembrane F0 portion, and two stalks that linkF1 and F0.3,19 The F1F0-ATP synthase complex islocated in the inner mitochondrial membrane and

utilizes the proton motive force generated by therespiratory chain complexes I–IV.30

In this study we generated transmitochondrialcybrids to discern the metabolic defects attributableto the homoplasmic base substitutions, 4452T�Cand 9035T�C, which was identified in the affectedfamily. The results revealed a significant decrease inoligomycin-sensitive ATP hydrolysis, reduction ofATP, and high reactive oxygen species (ROS) levelsin the mutant cybrids. All these changes are consis-tent with alterations in F0-ATPase, which most likelyresulted from the presence of the 9035T�C transi-tion converting Leu-170 to proline in the A6 subunit.The data also confirmed the polymorphic nature ofthe 4452T�C transition.

MATERIALS AND METHODS

Subjects/Case Report. The subjects were membersof a four-generation pedigree, in which 16 out of 17members were clinically affected by developmentaldelay, learning disability, and progressive ataxiastarting in early to late childhood. The family historywas suggestive of a maternally transmitted mitochon-drial cytopathy (Fig. 1). Blood samples for DNAanalysis were taken from eight members of the ped-

FIGURE 1. A pedigree diagram. Sixteen of 17 family members,maternally linked across four generations (marked in black), havebeen clinically affected with cognitive developmental delay, learn-ing disability, and progressive ataxia starting in childhood. Theonly person not affected was a 5-year-old boy (III6), born to amale, who showed no evidence of ataxia or developmental is-sues. Arrows point to probands II1 and III1, mother and daughter,respectively, who donated blood for the generation of transmito-chondrial cybrids. Two cybrid clones from each of these twomtDNA donors were selected for further studies: CF2B1 andCF2D2 generated from proband II1 and JE1B2 and JE2G1 gen-erated from proband III1. *Patient a neurological examinationcompleted by one of the authors (M.T.). Patients IV2 and IV3 wereexamined by a pediatric neurologist in their home town and wereconfirmed to have developmental delay and ataxia.

2 Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009

F1


igree across four generations, and muscle biopsiesand nerve conduction tests were obtained in twoindividuals (II1, III1).

DNA Extraction and PCR Amplification. Total cellularDNA was extracted from the blood of proband III1.U87MG glioblastoma cells, control cybrids harbor-ing wildtype (wt) mtDNA, and cybrids harboringmutated mtDNA from proband II1 and proband III1

were amplified using polymerase chain reaction(PCR), as described previously.38 PCR amplificationof the tRNAMet region was performed with the fol-lowing primers: forward 5�CTC CAT ACC CAT TACAAT CTC3� (nt 4221–4238; GenBank Access. No.D38112.1) and reverse 5�CGG GTT GGG CCA GGGGAT TAA TTA GTA CGG GAA GGG CAT3� (nt4491–4453). The mutation was detected after restric-tion digestion of the PCR products with Nla III. PCRamplification of the ATP6 region was performedwith the following primers: forward 5�GCG GGCACA GTG ATT ATA GG3� (nt 8845–8871) and re-verse 5�GTT GAT ATT GCT AGG GTG GCG CTTCCA ATT AGG TTC ATG 3� (nt 9075–9038). Restric-tion digestion to detect the mutation was done withBspHI. PCR was run at 94°C for 1 min, 55°C for 45 s,72°C for 30 s for 30 cycles.

Generation of Cybrids. Cybrids were generated on abackground of U87MG human glioblastoma (Amer-ican Tissue Culture Collection [ATCC], Rockville,Maryland, No. HTB-14) by platelet transformation aspreviously described.42 Briefly, U87MG�o cells werefused in the presence of PEG1500 with mitochon-dria-containing platelets isolated from fresh blood ofsubjects II1 and III1 (mother and daughter, Fig. 1)and from a 45-year-old healthy volunteer. The plate-let isolation and subsequent cell transformationwere performed exactly as previously described.42

The transformed cells were allowed to recover for 1week in �° medium, and the cybrids were selectedand maintained in MEM with 10% fetal bovine se-rum (FBS), 100 �g/ml pyruvate, 2 mM glutamine,and 1� antibiotic-antimycotic solution (completemedium) at 37°C in 5% CO2. Cybrid clones wereexpanded and analyzed for the presence of mtDNAmutations by PCR amplification and restriction di-gestion with Nla III and BspHI.

Experimental Treatments and Cell Viability Assay. Cy-brids (70% confluent) were placed in glucose-free(GD) medium for up to 48 h, or in complete me-dium with 1.5 mM tertiary butyl hydroperoxide(tBHP) and 2% FBS for 45 min, followed by recoveryin complete medium without tBHP for up to 16 h. In

some experiments, cells were pretreated 3� a weekfor 1 week with a water-soluble formulation of Coen-zyme Q10 (CoQ10) formulated with polyoxyethanylalpha-tocopheryl sebacate (PTS; 10 �g CoQ10 and 30�g PTS/ml) or with PTS alone (30 �g/ml) addeddirectly to the media and prepared as describedbelow. The 5-carboxyfluorescein diacetate (CFDA)assay was used to quantify cell viability.31

Preparation of Water-Soluble Formulation of CoQ10 and

PTS. PTS was synthesized by conjugating polyethyl-ene glycol 600 to alpha-tocopherol via bi-functionalsebacic acid (Sigma-Aldrich, St. Louis, Missouri) aspreviously described.2,37 A water-soluble formulationwas prepared by combining PTS and CoQ10 (KyowaHakko, New York, New York) in a molar ratio of 2:1mol/mol (3:1 w/w) and heating them to a temper-ature higher than their respective melting points toform a clear melt that was water-soluble and could bediluted with aqueous solutions (e.g., water, saline,phosphate buffer) to a desired concentration. Typi-cally, stock solutions of 50 mg/ml in phosphate-buffered saline (PBS) were prepared.

Analysis of CoQ10, PTS, and Vitamin E Contents. Mea-surements were performed on a high-performanceliquid chromatography (HPLC) apparatus (Beck-man Gold System, Palo Alto, California) consistingof a 126 Solvent Module equipped with a Rheodyne7725i loop injector and a UV 168 Detector as previ-ously described.14,37 Briefly, harvested cells (1–2 �107) were pelleted, lysed in 100 �l of water, andsubsequently frozen at �70°C. Prior to further ex-traction with 1-propanol and n-hexane, samples weresubjected to repeated freeze/thaw cycles. The sol-vents were evaporated, and the dry residues weredissolved in ethanol. For CoQ10 measurements, sam-ples were treated with H2O2 and analyzed by a re-verse-phase chromatography on a Supelcosil LC-18-DB column (5 �m particle size, 30 cm � 4.0 mmI.D., Supelco, Bellefonte, Pennsylvania) with a mo-bile phase of dichloromethane:methanol (40:60 v/v)pumped isocratically at a flow rate of 1 ml/min.Absorbance at 275 and 290 nm was monitored, andthe detector output was recorded using BeckmanSystem Gold software. The retention time was 8.2min for CoQ10, 4.7 min for PTS and 4.1 min forvitamin E. Their concentrations were calculatedfrom the appropriate peak areas using standardcurves.2,37

RNA Extraction and Real-Time PCR Analysis. TotalRNA from control and mutant cybrids was extractedusing a TriReagent method according to the manu-



facturer’s instructions (Molecular Research Center,Cincinnati, Ohio). RNA was reverse-transcribed(RT) using Superscript II reverse transcriptase (In-vitrogen, Burlington, Ontario) and AncT primers(5�T20VN3�). Following cDNA synthesis, RNA tem-plates in the RT reaction were degraded. cDNA waspurified using QIAquick PCR purification columns(Qiagen, Mississauga, Ontario), and it was quantifiedusing a Quant-iT OliGreen ssDNA quantitation kit(Molecular Probes, Invitrogen).

Five nanograms of cDNA per sample, in tripli-cate, were used for real-time PCR, performed usingprimer sets specific for the genes of interest andSYBR Green PCR Master Mix (Applied Biosystems,Foster City, California) in the ABI PRISM 7000 Se-quence Detection System (Applied Biosystems) (Ta-ble 1). Changes in gene expression were measuredusing a comparative Ct (2-��Ct) method that calcu-lates relative fold differences between the cybridscontaining the wt mtDNA and the mutant mtDNA.

Cytochemistry of Cytochrome c Oxidase Activity. Cy-brids grown in 12-well plates were incubated with 0.5mg/ml of 3�3-diaminobenzidine and 1 mg/ml ofoxidized cytochrome c at 37°C for 30 min as previ-ously described.31 Images were captured on a CarlZeiss Axiovert 200M microscope.

Measurement of ATP Content. Cybrids grown in T-25flasks were harvested in Tris-acetate buffer (pH7.75), and ATP content was analyzed using lucif-erase-luciferin solution (Thermo Labsystems Oy,Helsinki, Finland) as described.31

Mitochondrial ATPase Activity Assay. Cybrids grownin 6-well plates (70% confluent) were incubated inEarle’s Balanced Salt Solution with or without 15 �Moligomycin (O4876, Sigma) for 20 min at 37°C. Theactivity of ATPase was measured as described.13

Briefly, cells were pelleted, washed with 25 mMHEPES, 110 mM NaCl, 2.6 mM KH2PO4, 1.2 mMMgSO4, and 1 mM CaCl2, pH 7.4, and resuspendedin 800 �l of 20 mM HEPES, 1 mM MgCl2, and 2 mMEGTA, pH 7.0. The samples were kept on ice andsonicated for 5 s at 60 �m amplitude. To each sam-ple 200 �l of buffer containing 60 mM sucrose, 50mM triethanolamine, 50 mM KCl, 4 M MgCl2, 2 mMEGTA, 1 mM KCN, 200 �M NADH, 2 mM ATP, and1.5 mM phosphoenolpyruvate, pH 8.0 (with KOH)was added. The conversion of NADH to NAD� wasfollowed for 2 min at 340 nm after the addition of 5U pyruvate kinase (P1506, Sigma) and 5 U lactatedehydrogenase (L3888, Sigma). Total protein con-

centration was determined by the bicinchoninic acidassay.

Caspase-3 Activity Assay. Cells were lysed on ice for30 min in 25 mM HEPES, 5 mM MgCl2, 2 mM DTT,1.3 mM EDTA, 1 mM EGTA, 0.1% Triton X-100, andprotease inhibitor cocktail. Caspase-3 (CPP32) activ-ity was measured using the ApoAlert caspase assay aspreviously described.31

Measurement of ROS. ROS levels were assessed byflow cytometry of cells stained with CMH2DFDA (5-6-chloromethyl-2�, 7�-dichlorodihydrofluorescein) aspreviously described.31

Measurement of Mitochondrial Membrane Potential.

Cybrids grown in T-75 flasks (70% confluent) wereincubated in Earle’s Balanced Salt Solution contain-ing 500 nM MitoTracker Red CM-H2XRos (Molecu-lar Probes) for 30 min at 37°C. Cells were collectedby centrifugation and resuspended in PBS contain-ing 1% BSA. Samples were kept on ice in the dark,and a minimum of 20000 events were analyzed usinga Coulter ELITE ESP flow cytometer.20

Measurement of Glutathione (GSH) Content. Cellswere harvested, washed twice with ice-cold PBS, andpelleted. Cell pellets (1 � 106 cells/sample) wereresuspended in 500 �l of cold deoxygenated PBSand briefly sonicated. Proteins were precipitatedwith 5% perchloric acid (final concentration), andsamples were centrifuged at 14,000g at 4°C for 10min. Protein concentration was determined usingBioRad (Hercules, California) reagent. Supernatantswere injected directly into the HPLC (Beckman Sys-tem Gold) equipped with a Synergi 4 �l Hydro-RP,150 � 4.6 mm column (Phenomenex, Torrance,California). The mobile phase was 20 mM potassiumphosphate, pH 2.7/acetonitrile (99:1) at room tem-perature; flow rate 1.0 ml/min, and UV detection at210 nm. GSH (Sigma) was used as a standard (0.2 �gwas injected onto the column and eluted as abovewith retention times of 3.217 min for GSH). Dataanalysis was performed using 32 Karat software(Beckman Coulter).

Western Blotting. Cybrids were lysed in RIPA buffer(50 mM Tris, pH 7.4, 150 mM NaCl, 2 mM EDTA,0.1% SDS, 1% deoxycholate, 1% Triton X-100), andproteins were separated by 10% sodium dodecyl sul-fate-polyacrylamide gel electrophoresis (SDS-PAGE).Samples were transferred to nitrocellulose and probedwith rabbit polyclonal anti-GCS light chain antibody(generated in-house), anti-GCS heavy chain antibody



at 3 �g/ml (Neomarkers), anti-MnSOD (Santa CruzBiotechnology, Santa Cruz, California) or mousemonoclonal anti-� actin (Sigma) followed by horserad-ish peroxidase (HRP)-conjugated antirabbit secondaryantibody. ECL plus (Amersham, Arlington Heights,Illinois) was used for detection.

Microscopy. Cells grown on glass coverslips weretreated with either GD or tBHP, fixed with 3% para-formaldehyde, and stained with Hoechst 33258. Im-ages were captured by fluorescence and phase contrastoptics on a Carl Zeiss Axiovert 200M microscope.

Ethics Approval. All patients gave informed writtenconsent for all aspects of the clinical testing. All ofthe testing was completed as part of the clinicalwork-up of the pedigree with an unknown ataxia.Blood for the generation of the cybrids was obtainedat the time of blood drawing from three of thesubjects during their participation in a randomizeddouble-blind clinical trial that was part of a largerstudy approved by the McMaster University EthicsBoard.

Statistical Analysis. Data are expressed as mean �SEM, unless otherwise stated. Comparisons betweengroups were performed using analysis of variance(ANOVA) followed by a post-hoc Dunnett’s, Bonfer-roni’s, or Tukey’s multiple comparisons test. P 0.05 was taken as statistically significant. Statisticalanalysis was carried out using GraphPad Prism 4.0software (San Diego, California).

RESULTS

Report of Pedigree. Proband II1 had a spinocerebel-lar degeneration phenotype, elevated lactate with1H-MRS, and a family history suggesting mitochon-drial inheritance (Fig. 1). Proband II1 was first re-ferred in 1999 as a 38-year-old left-handed womanwith a 30-year history of dysarthria and ataxia. Shehad difficulty keeping up with the other children inschool and could not finish a grade nine curriculum.Her symptoms were slowly progressive. Physical ex-amination revealed mild cognitive impairment,slurred and scanning speech, mild distal intrinsicfoot atrophy, ankle dorsiflexion and eversion weak-ness, brisk upper extremity and knee reflexes withabsent ankle reflexes, extensor plantar responses,decreased vibration sensation at the metatarsopha-langeal joint, a positive Trendelenburg test, upperand lower extremity dysmetria, and a broad-based,profoundly ataxic gait.

Electrophysiological testing revealed normal motorand sensory nerve conduction velocities in the armswith decreased compound muscle actual potential am-plitudes and absent sensory nerve action potentials inthe legs. Electromyography of the right tibialis anteriorand medial gastrocnemius muscles showed normal in-sertional activity and 1� long duration and polyphasicmotor unit potentials. A computed tomography (CT)scan of the head showed mild cerebellar atrophy. Fur-ther laboratory testing showed normal profiles of verylong chain fatty acids, urinary amino acids and organicacids, serum lactate, ammonia, pyruvate, urinary sul-fite, and vitamin E. Genetic testing for SCA 1, 2, 3, 6, 7,8, 17, and FRDA were also normal. A muscle biopsyof the right vastus lateralis was normal at the lightand electron microscopic level. Mutational analysisfor mitochondrial DNA deletions (Southern blot)and 3243A�G, 3260A�G, 3303C�T, 8344A�G,8993T�G/C, 3271T�C point mutations by PCR-RFLP were all negative.

The family history, however, was suggestive of amaternally transmitted mitochondrial cytopathy,since 16 of 17 family members in a four-generationpedigree were clinically affected with cognitive de-velopmental delay/learning disability and progres-sive ataxia starting in childhood (Fig. 1). Twelve ofthe family members were evaluated by one of theauthors (M.T.) and were confirmed to have varyinglevels of ataxia, developmental delay, and sensoryneuropathy. Three of the men have had anger man-agement issues resulting in legal charges and incar-ceration. The only person apparently not affectedwas a 5-year-old born to a man whose parents andteachers reported no clinical evidence of ataxia ordevelopmental issues at school (III6). Blood samplesfor DNA analysis were taken from 11 members of thepedigree across four generations, and muscle biop-sies and nerve conduction tests were obtained fromtwo individuals (II1, III1).

Muscle biopsies were normal at the light micro-scopic level. Early paracrystalline inclusions wereseen in patient III1 using electron microscopy. Nerveconduction tests demonstrated reductions in com-pound muscle action potential amplitudes of theperoneal and tibial nerves. Electron transport chainenzyme activity of skeletal muscle in patient III1

showed borderline complex I � III activity (0.52,range � 0.5–1.9) with a low ratio relative to citratesynthase (9.7%, normal �10%), with normal com-plex II � III and IV activities. MRI scanning with1H-MR spectroscopy in patients III1 and II2 showedmild cerebellar atrophy in the superior and poste-rior vermal regions with an elevated lactate signal inthe brainstem, basal ganglia, and temporal/occipital



white matter regions. All members of the pedigreehad normal resting plasma lactate concentrations(2.2 mmol/L).

Patients II1 and III1 participated in a randomizeddouble blind crossover study of creatine monohy-drate 5 g daily, alpha lipoic acid 150 mg twice daily,Coenzyme Q10 100 mg twice daily, and vitamin E 100IU twice daily. They reported subjective improve-ment in energy and balance during the treatmenttrial.

We sequenced the entire coding region of themtDNA isolated from muscle of patient II1, and alsoscreened DNA from blood of patients II2, II5, III1,III2, III4, III5, III7, III8, and IV1. All patients testedpositive for homoplasmic variants, 4452T�C intRNAMet and 9035T�C transition in the ATP6 gene.Neither of these two variants was found in 140 un-related ataxia patients. This posed a questionwhether these transitions represented polymor-phisms or were pathogenic and responsible for theabove-described clinical manifestations. To addressthis question, mitochondria from two females in twogenerations (i.e., probands II1 and III1, mother anddaughter, respectively) and from a healthy volunteerwere used to generate transmitochondrial cybridsand used for further biochemical studies.

Generation and Characterization of Cybrids. Multiplecybrid clones were selected for each of the threemtDNA donors based on the restriction digestionpatterns of PCR-amplified DNA fragments with NlaIII and BspHI (Fig. 2A). The 4452T�C transitionintroduced a restriction site for Nla III (i.e., Nla IIIcuts at CATG) in the region of tRNAMet gene. There-fore, the restriction enzyme cuts the 271 bp PCRfragment from mutant mtDNA into 235 bp and 36bp (Fig. 2A). Indeed, the cutting was observed in themutant mtDNA donor (lane 2) and all cybrids trans-formed by platelets of both donors carrying the mu-tant mtDNA (lanes 5, 6). The restriction digestionwas always complete, indicating the homoplasmicnature of this mutation. Since there was no nativerestriction site for Nla III in the wt mtDNA, the PCRfragments of the wt mtDNA donor (lane 1) or con-trol wt cybrids (lanes 3, 4) remained intact. On theother hand, the 9035T�C mutation in the ATP6gene eliminated the restriction site for BspHI (i.e.,BspHI cuts at TCATGA). Whereas the 222 bp PCRfragment of wt mtDNA was cleaved into two frag-ments (184 bp and 38 bp) by BspHI (Fig. 2A, lanes7 and 9, 10), the 9035T�C transition eliminated thissite, and the mutant PCR products were not cleaved(lanes 6 and 11, 12). Again, the digestion pattern wasconsistent with the homoplasmic mutation.

Two cybrid clones from each mtDNA donor wereselected for further studies. These were control cy-brids, MK1 and MK4 with wt mtDNA, mutant cy-brids, CF2B1 and CF2D2 from proband II1, andJE1B2 and JE2G1 from proband III1. Subsequently,growth kinetics of the selected cybrids was exam-ined. Cybrids carrying mutant mtDNA grew muchslower, with doubling times from 48–94 h (i.e.,JE2G1 and CF2B1); this contrasted with control cy-brids, which doubled every 30–36 h (MK1 andMK4). The mutant cybrids were stable and main-

FIGURE 2. Characterization of transmitochondrial cybrids. (A)Restriction digestion patterns of mtDNA. DNA was isolated, PCR-amplified and digested with Nla III (lanes 1–6) or BspH I (lanes7–12). Lanes 1 and 7: restriction pattern of mtDNA from parentU87MG cells; lanes 2 and 8: mutant mtDNA from platelets ofproband III1; lanes 3 and 9: wt mtDNA from MK1 cybrid; lanes 4and 10: wt mtDNA from MK4 cybrid; lanes 5 and 11: mutantmtDNA from CF2D2 cybrid (proband II1 mtDNA donor); lanes 6and 12: mutant mtDNA from JE2G1 cybrid (proband III1 mtDNAdonor). (B) Cytochrome c oxidase activity. a: U87MG rho0 cells;b: control wt MK1 cybrid; c,d: mutants CF2D2 and JE2G1 clones,respectively. Magnification: 200�. (C) Cellular ATP content. ATPlevels in control (MK1 and MK4) and mutant (CF2B1, CF2D2,JE1B2, JE2G1) cybrids. Data are the mean � SEM from eightseparate experiments performed in duplicate. **Significant (P 0.01) differences between wt and mutant cybrids.


F2


tained homoplasmy for 2–3 months in culture. Thetransferred mitochondria were functional, and thecybrids possessed comparable levels of mitochon-drial cytochrome c oxidase activity as visualized byhistochemistry (Fig. 2B), although some variationsbetween cybrid clones were observed (Fig. 2B panelsb, c, for example). Since the COX complex wasunaffected, the 4452T�C transition did not seem tohave a prominent impact on overall mitochondrialprotein synthesis. This confirmed that the 4452T�Ctransition represented a polymorphism (reported inthe MITOMAP database, www.mitomap.org), ratherthan a pathogenic mutation. It is thus possible thatthe homoplasmic 9035T�C transition, which con-verts Leu-170 to proline in the transmembrane do-main of A6, might be responsible for the above-described clinical features.

Consistent with this possibility, there was a cleardifference in the steady-state levels of intracellularATP between wt and mutant cybrids (Fig. 2C). Sig-nificantly, the basal ATP content in all mutant cy-brids was 40%–50% lower than in wt controls. Thevalues measured in control cybrids were 6.2 � 0.4and 5.2 � 0.6 pmoles/�g protein in MK1 and MK4and between 3.1 � 0.4 to 3.5 � 0.4 in mutant CF2B1and JE2G1 (P 0.01 for all mutants as compared towt controls, Dunnett’s multiple comparisons test).

The measured ATP values, however, only re-flected the cybrids’ net balance between energy con-sumption and production. They were not direct in-dicators of the mitochondrial ATP synthase activity,which would be expected to be altered if the9035T�C transition in the ATP6 gene contributedto the lowering of cellular energy balance. To ad-dress this, we evaluated the catalytic activity of mito-chondrial F1F0-ATP synthase using oligomycin-sensi-tive ATP hydrolysis coupled to the oxidation ofNADH. The mitochondrial ATP synthase also cata-lyzes a reversible reaction of ATP hydrolysis (ATPaseactivity) that is coupled to proton pumping acrossthe mitochondrial inner membrane.30 As shown inTable 2, nearly 50% of cellular ATP hydrolyzingactivity in wt cybrids was oligomycin-sensitive, henceit was contributed by the mitochondrial F1F0-AT-Pase. In the mutants this activity dropped to 15%–17% of the total, indicating clearly the defectivecatalytic properties of ATP synthase. Furthermore,the total cellular ATPase activity was also much lowerin the mutant cybrids, pointing again to their meta-bolic impairments.

The mitochondrial membrane potential wasmeasured by flow cytometry after staining the cellswith MitoTracker Red. The mean fluorescence in-tensity was very similar in the wt and mutant cybrids,i.e., 8.1 � 1.1, 7.5 � 0.5, and 8.6 � 1.4 for MK1,CF2D2, and JE2G1, respectively (P�0.05, Newman–Keuls multiple comparisons test), indicating no sig-nificant differences in the membrane potential.

Table 1. Gene-specific primer sets for qPCR.

Gene Primer sequence

Productsize(bp)

MnSODF: 5� GCTTGTCCAAATCAGGATCCA 3�R: 5� GCGTGCTCCCACACATCA 3� 77

CuZnSODF: 5� TGGTCCATGAAAAAGCAGATGA 3�R: 5� CACAAGCCAAACGACTTCCA 3� 87

GSRF: 5� GCCCTCCACCCCTCATG 3�R: 5� CTGAAAAAATCCATCGCTGGTT 3� 70

GCLCGCLMCATGSHPX

F: 5� AGAGAAGGGGGAAAGGACAA 3�R: 5� GTGAACCCAGGACAGCCTAA 3�F: 5� TCAGTCCTTGGAGTTGCACA 3�R: 5� ACACAGCAGGAGGCAAGATT 3�F: 5�CTG TTG AAG ATG CGG CGA GAC 3�R: 5�GGC CAA ACC TTG GTG AGA TCG 3�F: 5� TGC TCG GTT TCC CGT GCA A 3�R: 5� ACC GTT CAC CTC GCA CTT CT 3�

231241175139

Primer sets for human Mn superoxide dismutase (MnSOD or SOD2,mitochondrial), CuZn superoxide dismutase (CuZnSOD or SOD1, soluble),and glutathione reductase (GSR) were designed using the software PrimerExpress (ABI). Primer sets for glutamyl-cysteine ligase catalytic (GCLC) andmodifier (GCLM) subunits were designed using Primer3 software, whereasprimer for catalase (CAT) and glutathione peroxidase (GSHPX) were frompublished sequences.1

Table 2. ATPase activity of mitochondrial ATP synthase (complex V).

Cybrids

Total ATPase activity Oligomycin-sensitive ATPase activity

nmol NADH /min/mgprotein �SEM

Percentageof control

nmol NADH/ min/mgprotein �SEM

Percentageof control

Percentageof total

MK1 796 � 54 100 390 � 41 100 49CF2D2 301 � 32 38 47 � 10 12 15JE1B2 437 � 41 55 75 � 16 19 17

ATPase activity was measured as described in Materials and Methods. The amount of NADH converted to NAD� was calculated by comparing theabsorbance at 340 nm resulting from the initial NADH concentration in the samples (200 �M) to the absorbance at 340 nm 2 min after the addition of pyruvatekinase and lactate dehydrogenase. Data are the mean � SEM from three separate experiments performed in duplicate.


T1-T2


Oxidative Stress and Antioxidant Defenses. The de-fective properties of ATP synthase in the mutantcybrids (Table 2) suggested a possibility of the in-creased ROS production. Basal ROS values in themutant cybrids were 5–7 times higher than in wtcontrols, clearly suggesting that this newly identified9035T�C mutation could be responsible for puttingthe mutant cybrids under a constant burden of ex-cessive oxidative stress (Fig. 3A, P 0.001 for bothmutants as compared to wt controls, Bonferroni’smultiple comparisons test). No statistically signifi-cant difference in ROS levels was seen between themutant cybrids (P � 0.05). Although cells, in gen-eral, are equipped with strong antioxidant defensesystems to offset the toxic nature of ROS, the ques-tion was, how did these cybrids adapt to such a heavyburden of these species? Here we examined theexpression levels of ROS scavenging enzymes, i.e.,Mn and CuZn superoxide dismutases (SOD), cata-lase, glutathione reductase, and the glutathione(GSH) system in both wt control and mutant cybrids(Figs. 3, 4, and Tables 1 and 3). Although the ex-pression level of cytosolic CuZnSOD was similar inall cybrids (Fig. 3B), the transcripts of mitochondrialMnSOD were significantly upregulated in the mu-tants, i.e., 3–7 fold higher in JE2G1 and CF2D2than in the wt MK1 control (Fig. 3C). The upregu-lation of MnSOD was also evident at the protein level(Fig. 3D). This implied that the mutant cybrids pro-duced high levels of superoxide anions that had tobe detoxified. We did not find any differences be-tween wt and mutant cybrids in the expression levelsof glutathione reductase or catalase (data notshown).

Typically, the detoxification of superoxide an-ions leads to a production of hydrogen peroxide,

and its inactivation depends on the capacity of thecellular GSH system. Therefore, we also examinedGSH biosynthesis (Fig. 4) as well as the cellularcontent of GSH (Table 3). �-Glutamyl cysteine ligase(�GCS), a heterodimer of a catalytic heavy chain(GCLC) and a regulatory light chain (GCLM), is arate-limiting enzyme in GSH synthesis. Both of thesesubunits were expressed in the cybrids (Fig. 4).There was no difference in the expression of GCLCbetween the mutants and wt controls, either at themRNA (Fig. 4A) or at the protein (Fig. 4C) level.However, the mutant cybrids had significantly up-regulated expression of GCLM. Both the GCLMmessage (Fig. 4B, 7- and 9-fold over control inCF2D2 and JE2G1, respectively, and the protein lev-els (Fig. 4C) were increased in the mutants. Therewas no difference in the mRNA level of glutathionereductase between control and mutant cybrids (datanot shown). The GSH content was also significantlyhigher (2–4-fold) in the mutants than in controls(Table 3), suggesting that the survival of the mutantcybrids might have required a significant upregula-tion of the GSH antioxidant system.

Cybrid Viability Under Stress. Thus far, we have es-tablished that cybrids that carried mutant mtDNA,

FIGURE 3. ROS and ROS-scavenging genes. (A) Basal ROSlevels. ROS levels were measured using a Coulter ELITE ESPflow cytometer, and a minimum of 20,000 events were analyzedper sample. Bars are mean � SEM from four separate experi-ments performed in duplicate. ***Significant (P 0.001) differ-ences between wt cybrid and mutant cybrids. (B,C) qPCR anal-ysis. qPCR was performed using primers (Table 1) specific forCuZnSOD (B) or MnSOD (C). Bars represent the mean � SDfrom 3 replicates. (D) Western blot analysis. Cybrids were lysedand protein samples were separated and immunoblotted withanti-MnSOD. Anti-�-actin shows equal protein loading.

FIGURE 4. Glutathione system. (A,B) qPCR analysis. qPCR wasperformed using primers (Table 1) specific for (A) GCLC (B)GCLM. Bars represent the mean � SD from three replicates. (C)Western blot analysis. Cybrids were lysed, and protein sampleswere separated and immunoblotted with anti-GCLC and anti-GCLM antibodies. Anti-�-actin shows equal protein loading.

Table 3. Cellular content of GSH.

CybridsGSH pmol/�g protein

�SEM Fold increase

MK1 14.70 � 1.42 —JE1B2 24.74 � 5.87 1.68CF2D2 43.41 � 10.79 2.95

Cell pellets (1 x 106 cells/sample) were treated with 5% perchloric acid,precipitated proteins were separated and GSH content was measured inthe supernatants by HPLC, as described in Materials and Methods. Dataare the mean � SEM from two separate experiments in duplicate.


F3

F4-T3


regardless of whether it was derived from subject II1

or III1, had low basal levels of ATP, defective catalyticproperty of ATP synthase, and excessive productionof ROS. In spite of the high ROS productions, thecells showed evidence of adaptation, as evidenced byupregulation of the MnSOD and GSH system, andwere able to survive. An important question waswhether the cells could also cope with any additionalexogenous stresses?

The cybrids were first subjected to glucose depri-vation (GD), which inhibits the glycolytic pathwayand forces cells to rely primarily on OXPHOS forenergy production. This phenomenon has been de-scribed for human HepG2 hepatoma cells grown inthe absence of glucose for up to 96 h.46 Thus, thecybrids were placed in glucose-free media for 48 h,and their viability was measured by CFDA assay (Fig.5A). Both control cybrids survived well under theseconditions (nearly 100% survival rate, i.e., 94.1 �2.0% for MK1). The mutant cybrids were more sen-sitive, and between 25%–35% of cells lost viabilityafter 48 h (i.e., 72.4 � 4.9% of viable CF2D2 and62.5 � 4.0% of JE1B2 after 48 h of GD, P 0. 01 forall mutants as compared to wt controls, Dunnett’smultiple comparisons test). GD did not significantlyalter the basal levels of ATP. Despite a diminishingsupply of ATP from the glycolytic pathway, all cybridsmaintained ATP at the pretreatment levels (Fig. 5B).

In separate sets of experiments, cybrids werebriefly exposed to tertiary-butyl hydroperoxide,tBHP (1.5 mM for 45 min), which transiently putsthe cells under excessive oxidative stress (Fig. 6).Here again, the majority of control cybrids were ableto survive the treatment; 10% of cells lost viability

after 16 h (Fig. 6A). The mutant cybrids, on theother hand, were very vulnerable, with a survival rateof 30%–60% (i.e., 33.1 � 6.9% for cybrid JE1B2 and63.2 � 3.7% for CF2B1, P 0. 01 for all tBHP-treated mutants as compared to tBHP-treated con-trols, Dunnett’s multiple comparisons test). Thishigh rate of cell death was also reflected in thesignificant drop of basal ATP content. In all mutants,ATP content decreased by more than 50% (Fig. 6B,P 0. 05, Tukey’s multiple comparisons test); nochange was seen in wt controls.

Morphological examination of cybrids exposedto 48 h of GD revealed the presence of shrunkencells, small brightly stained nuclei with collapsedchromatin, and occasional apoptotic bodies (Fig. 7A,panels b, e, h, k, n, q). These features were presentin both wt (panels b, e) and mutants (panels h, k, n,q) and were indicative of apoptotic cell death. In-deed, activation of apoptotic caspase 3 was observedin all cybrids, and statistically significant increases inits activity were measured after 4 h of GD (Fig. 7B,P 0. 05, Tukey’s multiple comparisons test). Onthe other hand, in tBHP-treated cells the apoptoticfeatures (Fig. 7A, panels c, f) and caspase 3 activation(Fig. 7C, P 0. 05, Tukey’s multiple comparisonstest) were detected only in wt controls. The tBHP-treated mutants, on the other hand, died by necro-sis, as many large, swollen cells with disintegratingnuclei were seen frequently (Fig. 7A, panels i, l, o, r).

Cytoprotective Effects of Antioxidants. Finally, weaddressed the issue of whether antioxidants couldoffset these effects of mitochondrial dysfunction andcould be appropriate for therapeutic intervention in

FIGURE 5. The effects of glucose deprivation (GD). (A) Cellviability. Cell viability was measured by CFDA assay after 48 h ofGD and is expressed as percent of control. Bars represent themean � SEM from three separate experiments performed intriplicate. Significant differences are shown as **P 0.01. (B)Cellular ATP levels. ATP was measured after 24 h of GD. Barsrepresent the mean � SEM from three separate experimentsperformed in duplicate. No statistically significant differences be-tween treated and untreated samples were observed.

FIGURE 6. The effects of tertiary butyl hydroperoxide (tBHP). (A)Cell viability. Cell viability was measured by CFDA assay 16 hafter tBHP treatment and is expressed as percent of control. Barsrepresent the mean � SEM from three separate experimentsperformed in triplicate. Significant differences are shown as **P 0.01. (B) Cellular ATP levels. ATP was measured 4 h after thetreatment. Bars represent the mean � SEM from three separateexperiments performed in duplicate. *Significant (P 0.05) dif-ferences between control and mutant cybrids.


F5

F6

F7


the afflicted family. For many years now CoQ10, ahighly mobile carrier of electrons and protons be-tween the flavoproteins and the cytochrome system,has been investigated as a potential therapeuticagent to treat cardiovascular diseases, neurodegen-erative diseases, and mitochondrial disorders.24,36,48

It can modify respiratory chain function and reducethe level of cytotoxic metabolites, including ROS.However, although numerous beneficial outcomes,both experimental and clinical, have been reportedin response to CoQ10 supplementation, its full ther-apeutic potential is greatly limited by the lack ofsolubility in aqueous media. We have produced awater-soluble formulation of CoQ10 and PTS (alpha-tocopherol derivatized to polyoxyethanyl-alpha-toco-pheryl sebacate).2,37 Here we tested the effects of thiscombination of two active antioxidants on the cybridbehavior under stress (Fig. 8, Table 4).

The cybrids readily internalized both CoQ10 andPTS. After a week of growth in medium containingPTS/CoQ10, all cybrids contained PTS and metabo-lized it to vitamin E, and all cybrids internalizedCoQ10, increasing its level 2–5-fold (Table 4). Thistreatment led to a statistically significant elevation ofATP in wt cybrids (P 0.05, Bonferroni’s multiplecomparisons test), but not in mutants (Fig. 8A).Furthermore, there was a significant reduction ofROS in the treated mutant cybrids (Fig. 8B). Thiseffect also was observed in cybrids treated with PTSalone (P 0.05, Bonferroni’s multiple comparisonstest).

However, the most significant effects of the PTS/CoQ10 treatment on cybrid viability were observed inthe mutant cybrids subsequently exposed to tBHP(Fig. 8C, P 0. 05, Tukey’s multiple comparisonstest). Here we observed nearly a complete protectionfrom the cytotoxic effects of this compound. Thebasal ATP content did not drop (Fig. 8D), and therewas no further increase in ROS (not shown) in re-sponse to the tBHP treatment. These protective out-comes could be measured by the CFDA viability assay(Fig. 8C), and there was clear evidence of morpho-logically intact cells under microscopy (Fig. 8E).

DISCUSSION

We have identified two homoplasmic basepair variantsin the mitochondrial genome, 4452T�C and9035T�C, in a family affected by developmental delay,sensory neuropathy, learning disability, and progres-sive ataxia. These nucleotide transitions were notpresent in unrelated ataxia patients, based on furtherscreening of 140 subjects including those with SCAand NARP phenotypes. Although 4452T�C hasbeen reported, 9035T�C has not been listed in theexistingdatabases(http://www.mitomap.org;http://www.genpat.uu.se/mtDB). The 4452T�C base sub-stitution locates to the tRNAMet gene, and 9035T�Cconverts an amino acid Leu-170 to a proline in themitochondrially encoded ATP6 gene. Although

FIGURE 7. Morphological and biochemical features of cell death.(A) Fluorescent micrographs. Cybrids were treated with eitherGD or tBHP and stained with Hoechst 33258. Nuclear morphol-ogy of wt MK1 (a–c) and MK4 (d–f) cybrids and mutant CF2B1(g–i), CF2D2 (j–l), JE1B2 (m–o), and JE2G1 (p–r) cybrids isshown before (control panel) and after the treatments (GD andtBHP panels). Arrows point to apoptotic cells and arrowheadsindicate necrotic cells. Magnification: 200�. (B,C) Caspase-3activity. Caspase-3 activation was measured 24 h after GD (B)and 4 h after tBHP treatment (C). Data are the mean � SEM fromthree experiments performed in duplicate. *Significant (P 0.05)differences between treated and untreated.


F8-T4


these basepair variants could be clearly linked to thematernally transmitted disease symptoms, their ho-moplasmic nature puts their pathogenicity in ques-tion. In the majority of mitochondrial cytopathies,the pathogenic mutations are heteroplasmic, with aquantitative correlation between phenotype and het-eroplasmy.26,32,49 Furthermore, homoplasmic muta-tions are frequently found during systematic screen-

ing of mtDNA, but most often they representpolymorphisms and have no pathogenic signifi-cance. We performed extensive biochemical analysesof transmitochondrial cybrids carrying mutantmtDNA from female subjects from two generationsand identified metabolic defects likely attributable tothese base transitions. The results revealed that themutant cybrids had the defective F0 portion of ATPsynthase and, consequently, the reduced output ofATP and abnormally high levels of ROS. The mutantcybrids were also much more vulnerable to addi-tional injuries (i.e., metabolic or oxidative stress),most likely due to insufficient energy buffers re-quired to detoxify ROS.

Although both of these point mutations werehomoplasmic, it seemed more likely that the ob-served defects were due to the 9035T�C transitionin the ATP6 gene rather than the 4452T�C substi-tution in tRNA.Met This assertion is based on the factthat no obvious defects in mitochondrial proteinsynthesis were observed, which would be expected ifthe function of this tRNA was affected. Mammalianmitochondria utilize a single tRNA,Met and its func-tion is critical for mitochondrial translation.12 How-ever, in our case the activities of complex I � III,complex II � III and IV measured in patient III1, aswell as the activity of complex IV (cytochrome coxidase) measured in the mutant cybrids (Fig. 2),were within the normal range. Thus, the 4452T�Ctransition, which occurred at a nonconserved nucle-otide 51, did not seem to alter the function of the

4™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™FIGURE 8. The effects of antioxidants. (A) ATP levels. ATPcontent of CoQ10/PTS treated and untreated wt MK1 and mutantCF2D2 and JE2G1 cybrids. Bars represent the mean � SEMfrom two separate experiments performed in duplicate. *Signifi-cant (P 0.05) difference between MK1 treated with CoQ10/PTSand untreated. (B) ROS levels. ROS levels were measured byflow cytometry in mutant cybrids cultured in the presence ofCoQ10/PTS or PTS alone. Data is expressed as percentages ofuntreated samples. Bars represent the mean � SEM from twoexperiments performed in duplicate. *Significant (P 0.05) dif-ferences between the antioxidant treated and untreated. (C) Cellviability. Cell viability was measured by CFDA assay in wt andmutant cybrids 16 h after tBHP treatment. Bars represent themean � SEM from three experiments performed in duplicate.*Significant (P 0.05) differences between antioxidant treatedand untreated. (D) ATP levels. ATP content was measured 4 hafter tBHP exposure in wt and mutants, treated and untreated for1 week with CoQ10/PTS. Data are the mean � SEM from threeseparate experiments performed in duplicate. No significant dif-ferences were found in antioxidant treated and untreated sam-ples. (E) Phase contrast micrographs. Control (a–c) and mutant(d–e) cybrids were examined 16 h after tBHP exposure (b,e) orfollowing pretreatment with PTS (c,f); untreated cultures areshown in a and d. Arrows indicate swollen dead cells. Magnifi-cation: 200�.



tRNAMet gene17 (http://mamit-trna.u-strasbg.fr/).According to the http://www.mitomap.org/ data-base, three different point mutations in tRNAMet

gene have been linked to mitochondrial diseases.These include: a homoplasmic 4435A�G transitionat nucleotide 37 of the anticodon domain that mod-ulates phenotypic expression of the 11778G�A mu-tation associated with LHON29 and two heteroplas-mic mutations, 4409T�C at nucleotide 8 of theacceptor stem and 4450G�A at the nucleotide 50 ofT-stem, both linked to mitochondrial myop-athy.17,40,41,44 We have confirmed that 4452T�C is apolymorphism, due to the lack of obvious defects inmitochondrial protein synthesis. Still, the possibilitythat 4452T�C contributes to the phenotype throughan interaction with the 9035T�C mutation cannotbe entirely excluded from our data.

The 9035T�C mutation, on the other hand,caused a conversion of a highly conserved leucine toa helix that destabilizes proline at codon 170 of theA6 subunit. Its secondary structure predicts that thisamino acid is located within the third transmem-brane �-helix of A6, more specifically, at the criticalinterface of the A6 and c subunit contacts. TheF1F0-ATP synthase is a molecular motor, in whichproton translocation from intermembrane space tothe matrix through the F0 portion drives the rotationof oligomeric c subunits (c ring). This, in turn,induces rotation of the central part of F1 relative toits catalytic site where the synthesis of ATP from ADPand Pi takes place.30,34,35 Thus, the correct secondarystructure of the A6 subunit is critical for subunitcoupling; hence, the formation of the proton chan-nel and turning of the rotor for ATP synthesis. Ac-cording to the current understanding of F0 subunitcoupling, the rotation of the c ring relies on sevendirect interhelix contacts between A6 and c subunits(Leu-170 on A6 is in contact with C-64 on subunitc).30,34,35 Therefore, the replacement of neutralamino acid leucine for a classical helix breaker pro-line would be expected to impair the properties ofthe ATP synthase. Indeed, the results revealed asignificantly diminished oligomycin-sensitive ATP

hydrolyzing activity, consistent with the defective F0

portion of the synthase and, consequently, a signifi-cant reduction in the steady-state level of ATP. Fur-thermore, it would appear that this impairment ofthe F0 function was responsible for creating highprotonic potential within the matrix space leading toabnormal ROS production, especially superoxideanions. Thus, the ROS levels in the mutant cybridswere nearly 8-fold higher than normal, and theirsurvival clearly required the upregulation of MnSOD(Fig. 3) and GSH (Fig. 4, Table 3) antioxidant sys-tems to neutralize them. Superoxide anions can beproduced by both complex I and complex III, whicheven under normal conditions can convert oxygen tosuperoxides.39 Mitochondrial ROS productionwould increase when respiratory flux is depressedand protonic potential in the matrix is high, such asmight be the case here.16 It seems more likely, how-ever, that superoxides were generated by complex Iand were released mainly into the mitochondrialmatrix, as indicated by the upregulation of mito-chondrial antioxidant systems, such as MnSOD andGSH. Complex III, on the other hand, can releaseROS on both sides of the mitochondrial membrane.It would also require engagement of cytoplasmicantioxidants,27 but we did not observe any change inthe levels of either CuZnSOD or catalase (Fig. 3).

It is interesting to note that the observed increasein the GSH content was due to its de novo synthesisinvolving a �GCS heterodimeric enzyme complexconsisting of GCLC and GCLM subunits.23 Our dataindicated that of these two subunits, the rate-limitingcomponent in the GSH synthesis was the modifierGCLM whose expression was significantly induced inthe mutant cybrids (Fig. 4). Although by itself GCLMhas no enzymatic activity, its function is to alter theKi of GCLC for GSH and, thus, to increase theformation of enzymatically active holoenzyme com-plex.21 Others have shown that overexpression ofGCLM in HeLa cells increases �GCS activity by 2–3-fold.43 Since the GCLM gene contains the ARE (an-tioxidant response element) sequence, its expres-

Table 4. Antioxidant content.

Cybrids

CoQ10 ng/g proteinPTS �g/g

protein Vitamin E ng/g protein

Endogenous Loaded Loaded Endogenous Loaded

Controls (MK1, MK4) 100.7 � 5.2 198.8 � 9.0 2.38 � 0.67 Trace 12.15Mutants (CF2B1, JE1B2, JE2G1) 42.0 � 16.0 210.4 � 32.9 6.02 � 1.78 Trace 7.61

Cell pellets (1 x 107 cells/sample) were lysed by osmotic shock in 100 �l of water. CoQ10, PTS, and vitamin E were extracted from the lysates with 1-propanoland n-hexane solvents and were analyzed by HPLC.



sion could be upregulated through the ARE-Nrf2pathway.5

In summary, of the two identified homoplasmicbasepair variants, we confirmed that the 4452T�Ctransition in tRNAMet represented a polymorphism.However, the 9035T�C transition in the ATP6 gene(A6 subunit) led to metabolic deficiencies and likelyis pathogenic in this family. Several point mutationswithin the ATP6 gene, mainly heteroplasmic, havebeen reported thus far (http://www.mitomap.org).Of these, the best-characterized are the transitions incodon 156 and 217, 8993T�G/C, and 9176T�G/C,which convert leucine to either arginine or proline,respectively, and are responsible for a subgroup ofmaternally inherited striatal necrosis syndromes(i.e., NARP and MILS).32,33 In all these cases thesubstitution of proline for leucine gives less severedisease symptoms than arginine for leucine. Thissuggests that the interference with the ATP synthesismechanism is far greater from the charged aminoacid arginine than from the helix destabilizing pro-line. An elegant discussion regarding the effects ofthese transitions on the catalytic properties of ATPsynthase are presented by Schon et al.34 To these, wecan now add the homoplasmic T9035G mutationthat converts leucine to proline at codon 170, whichmost likely is responsible for the described mater-nally transmitted mitochondrial cytopathy with clin-ical features of cognitive developmental delay/learn-ing disability and progressive ataxia.

REFERENCES

1. Aksenov MY, Tucker HM, Nair P, Aksenova MV, ButterfieldDA, Estus S, et al. The expression of key oxidative stress-handling genes in different brain regions in Alzheimer’s dis-ease. J Mol Neurosci 1998;11:151–164.

2. Borowy-Borowski H, Sodja C, Docherty J, Walker PR, SikorskaM. Unique technology for solubilization and delivery ofhighly lipophilic bioactive molecules. J Drug Target 2004;12:415–424.

3. Boyer PD. A research journey with ATP synthase. J Biol Chem2002;277:39045–39061.

4. Carelli V, Giordano C, d’Amati G. Pathogenic expression ofhomoplasmic mtDNA mutations needs a complex nuclear-mitochondrial interaction. Trends Genet 2003;19:257–262.

5. Chen XL, Kunsch C. Induction of cytoprotective genesthrough Nrf2/antioxidant response element pathway: a newtherapeutic approach for the treatment of inflammatory dis-eases. Curr Pharm Des 2004;10:879–891.

6. Chomyn A. The myoclonic epilepsy and ragged-red fibermutation provides new insights into human mitochondrialfunction and genetics. Am J Hum Genet 1998;62:745–751.

7. Ciafaloni E, Ricci E, Shanske S, Moraes CT, Silvestri G, HiranoM, et al. MELAS: clinical features, biochemistry, and molec-ular genetics. Ann Neurol 1992;31:391–398.

8. Ciafaloni E, Santorelli FM, Shanske S, Deonna T, Roulet E,Janzer C, et al. Maternally inherited Leigh syndrome. J Pedi-atr 1993;122:419–422.

9. Debray FG, Lambert M, Lortie A, Vanasse M, Mitchell GA.Long-term outcome of Leigh syndrome caused by the NARP-

T8993C mtDNA mutation. Am J Med Genet A 2007;143:2046–2051.

10. DiMauro S, Moraes CT. Mitochondrial encephalomyopathies.Arch Neurol 1993;50:1197–1208.

11. Finsterer J. Mitochondriopathies. Eur J Neurol 2004;11:163–186.

12. Florentz C, Sohm B, Tryoen-Toth P, Putz J, Sissler M. Humanmitochondrial tRNAs in health and disease. Cell Mol Life Sci2003;60:1356–1375.

13. Florholmen G, Aas V, Rustan AC, Lunde PK, Straumann N,Eid H, et al. Leukemia inhibitory factor reduces contractilefunction and induces alterations in energy metabolism inisolated cardiomyocytes. J Mol Cell Cardiol 2004;37:1183–1193.

14. Graves S, Sikorska M, Borowy-Borowski H, Ho RJ, Bui T,Woodhouse C. Analysis of coenzyme Q10 content in humanplasma and other biological samples. Methods Mol Biol 1998;108:353–365.

15. Hammans SR, Sweeney MG, Brockington M, Lennox GG,Lawton NF, Kennedy CR, et al. The mitochondrial DNAtransfer RNA(Lys)A–�G(8344) mutation and the syndromeof myoclonic epilepsy with ragged red fibres (MERRF). Rela-tionship of clinical phenotype to proportion of mutant mito-chondrial DNA. Brain 1993;116:617–632.

16. Han D, Williams E, Cadenas E. Mitochondrial respiratorychain-dependent generation of superoxide anion and its re-lease into the intermembrane space. Biochem J 2001;353:411–416.

17. Helm M, Brule H, Friede D, Giege R, Putz D, Florentz C.Search for characteristic structural features of mammalianmitochondrial tRNAs. RNA 2000;6:1356–1379.

18. Holt IJ, Harding AE, Petty RK, Morgan-Hughes JA. A newmitochondrial disease associated with mitochondrial DNAheteroplasmy. Am J Hum Genet 1990;46:428–433.

19. Issartel JP, Dupuis A, Garin J, Lunardi J, Michel L, Vignais PV.The ATP synthase (F0–F1) complex in oxidative phosphory-lation. Experientia 1992;48:351–362.

20. Jayaraman S. Flow cytometric determination of mitochondrialmembrane potential changes during apoptosis of T lympho-cytic and pancreatic beta cell lines: comparison of tetrameth-ylrhodamineethylester (TMRE), chloromethyl-X-rosamine(H2-CMX-Ros) and MitoTracker Red 580 (MTR580). J Im-munol Methods 2005;306:68–79.

21. Lee JI, Kang J, Stipanuk MH. Differential regulation of glu-tamate-cysteine ligase subunit expression and increased ho-loenzyme formation in response to cysteine deprivation. Bio-chem J 2006;393:181–190.

22. McFarland R, Chinnery PF, Blakely EL, Schaefer AM, MorrisAA, Foster SM, et al. Homoplasmy, heteroplasmy, and mito-chondrial dystonia. Neurology 2007;69:911–916.

23. Meister A. Glutathione metabolism and its selective modifica-tion. J Biol Chem 1988;263:17205–17208.

24. Miquel J. Can antioxidant diet supplementation protectagainst age-related mitochondrial damage? Ann N Y Acad Sci2002;959:508–516.

25. Moraes CT, DiMauro S, Zeviani M, Lombes A, Shanske S,Miranda AF, et al. Mitochondrial DNA deletions in progres-sive external ophthalmoplegia and Kearns-Sayre syndrome.N Engl J Med 1989;320:1293–1299.

26. Morgan-Hughes JA, Hanna MG. Mitochondrial encephalo-myopathies: the enigma of genotype versus phenotype. Bio-chim Biophys Acta 1999;1410:125–145.

27. Muller FL, Liu Y, Van RH. Complex III releases superoxide toboth sides of the inner mitochondrial membrane. J BiolChem 2004;279:49064–49073.

28. Pavlakis SG, Phillips PC, DiMauro S, De Vivo DC, Rowland LP.Mitochondrial myopathy, encephalopathy, lactic acidosis, andstrokelike episodes: a distinctive clinical syndrome. Ann Neu-rol 1984;16:481–488.

29. Qu J, Li R, Zhou X, Tong Y, Lu F, Qian Y, et al. The novelA4435G mutation in the mitochondrial tRNAMet may mod-ulate the phenotypic expression of the LHON-associated ND4



G11778A mutation. Invest Ophthalmol Vis Sci 2006;47:475–483.

30. Rastogi VK, Girvin ME. Structural changes linked to protontranslocation by subunit c of the ATP synthase. Nature 1999;402:263–268.

31. Sandhu JK, Sodja C, McRae K, Li Y, Rippstein P, Wei YH, et al.Effects of nitric oxide donors on cybrids harboring the mito-chondrial myopathy, encephalopathy, lactic acidosis andstroke-like episodes (MELAS) A3243G mitochondrial DNAmutation. Biochem J 2005;391:191–202.

32. Schon EA. Mitochondrial genetics and disease. Trends Bio-chem Sci 2000;25:555–560.

33. Schon EA, Bonilla E, DiMauro S. Mitochondrial DNA muta-tions and pathogenesis. J Bioenerg Biomembr 1997;29:131–149.

34. Schon EA, Santra S, Pallotti F, Girvin ME. Pathogenesis ofprimary defects in mitochondrial ATP synthesis. Semin CellDev Biol 2001;12:441–448.

35. Sgarbi G, Baracca A, Lenaz G, Valentino LM, Carelli V, So-laini G. Inefficient coupling between proton transport andATP synthesis may be the pathogenic mechanism for NARPand Leigh syndrome resulting from the T8993G mutation inmtDNA. Biochem J 2006;395:493–500.

36. Shults CW, Oakes D, Kieburtz K, Beal MF, Haas R, Plumb S,et al. Effects of coenzyme Q10 in early Parkinson disease:evidence of slowing of the functional decline. Arch Neurol2002;59:1541–1550.

37. Sikorska M, Borowy-Borowski H, Zurakowski B, Walker PR.Derivatised alpha-tocopherol as a CoQ10 carrier in a novelwater-soluble formulation. Biofactors 2003;18:173–183.

38. Simon DK, Johns DR. Mitochondrial disorders: clinical andgenetic features. Annu Rev Med 1999;50:111–127.

39. St-Pierre J, Buckingham JA, Roebuck SJ, Brand MD. Topologyof superoxide production from different sites in the mito-chondrial electron transport chain. J Biol Chem 2002;277:44784–44790.

40. Sternberg D, Chatzoglou E, Laforet P, Fayet G, Jardel C,Blondy P, et al. Mitochondrial DNA transfer RNA gene se-

quence variations in patients with mitochondrial disorders.Brain 2001;124:984–994.

41. Sternberg D, Danan C, Lombes A, Laforet P, Girodon E,Goossens M, et al. Exhaustive scanning approach to screen allthe mitochondrial tRNA genes for mutations and its applica-tion to the investigation of 35 independent patients withmitochondrial disorders. Hum Mol Genet 1998;7:33–42.

42. Tarnopolsky MA, Simon DK, Roy BD, Chorneyko K, LowtherSA, Johns DR, et al. Attenuation of free radical productionand paracrystalline inclusions by creatine supplementation ina patient with a novel cytochrome b mutation. Muscle Nerve2004;29:537–547.

43. Tipnis SR, Blake DG, Shepherd AG, McLellan LI. Overexpres-sion of the regulatory subunit of gamma-glutamylcysteinesynthetase in HeLa cells increases gamma-glutamylcysteinesynthetase activity and confers drug resistance. Biochem J1999;337:559–566.

44. Vissing J, Salamon MB, Rlien-Soborg P, Norby S, Manta P,DiMauro S, et al. A new mitochondrial tRNA(Met) genemutation in a patient with dystrophic muscle and exerciseintolerance. Neurology 1998;50:1875–1878.

45. Wallace DC. Mitochondrial defects in neurodegenerative dis-ease. Ment Retard Dev Disabil Res Rev 2001;7:158–166.

46. Weber K, Ridderskamp D, Alfert M, Hoyer S, Wiesner RJ.Cultivation in glucose-deprived medium stimulates mitochon-drial biogenesis and oxidative metabolism in HepG2 hepa-toma cells. Biol Chem 2002;383:283–290.

47. White SL, Collins VR, Wolfe R, Cleary MA, Shanske S, Di-Mauro S, et al. Genetic counseling and prenatal diagnosis forthe mitochondrial DNA mutations at nucleotide 8993. Am JHum Genet 1999;65:474–482.

48. Young AJ, Johnson S, Steffens DC, Doraiswamy PM. Coen-zyme Q10: a review of its promise as a neuroprotectant. CNSSpectr 2007;12:62–68.

49. Zeviani M, Di DS. Mitochondrial disorders. Brain 2004;127:2153–2172.



IDENTIFICATION OF ATAXIA-ASSOCIATED mtDNA MUTATIONS … Nerve 09.pdf · 2009-09-14 · mitted...

Documents

Transcript of IDENTIFICATION OF ATAXIA-ASSOCIATED mtDNA MUTATIONS … Nerve 09.pdf · 2009-09-14 · mitted...