HSP101 Interacts with the Proteasome and Promotes the ......HSP101 Interacts with the Proteasome and...

HSP101 Interacts with the Proteasome and Promotes theClearance of Ubiquitylated Protein Aggregates1[OPEN]

Fionn McLoughlin,a,b Minsoo Kim,a Richard S. Marshall ,b Richard D. Vierstra,b,2,3 andElizabeth Vierlinga,2,3,4

aDepartment of Biochemistry and Molecular Biology, University of Massachusetts, Amherst, Massachusetts01009bDepartment of Biology, Washington University in St. Louis, St. Louis, Missouri 63130

ORCID IDs: 0000-0002-2430-5074 (F.M.); 0000-0002-6844-1078 (R.S.M.); 0000-0003-0210-3516 (R.D.V.); 0000-0002-0066-4881 (E.V.).

Stressful environments often lead to protein unfolding and the formation of cytotoxic aggregates that can compromise cellsurvival. The molecular chaperone heat shock protein (HSP) 101 is a protein disaggregase that co-operates with the small HSP(sHSP) and HSP70 chaperones to facilitate removal of such aggregates and is essential for surviving severe heat stress. To betterdefine how HSP101 protects plants, we investigated the localization and targets of this chaperone in Arabidopsis (Arabidopsisthaliana). By following HSP101 tagged with GFP, we discovered that its intracellular distribution is highly dynamic and includesa robust, reversible sequestration into cytoplasmic foci that vary in number and size among cell types and are potentiallyenriched in aggregated proteins. Affinity isolation of HSP101 recovered multiple proteasome subunits, suggesting afunctional interaction. Consistent with this, the GFP-tagged 26S proteasome regulatory particle non-ATPase (RPN) 1atransiently colocalized with HSP101 in cytoplasmic foci during recovery. In addition, analysis of aggregated (insoluble)proteins showed they are extensively ubiquitylated during heat stress, especially in plants deficient in HSP101 or class IsHSPs, implying that protein disaggregation is important for optimal proteasomal degradation. Many potential HSP101clients, identified by mass spectrometry of insoluble proteins, overlapped with known stress granule constituents and sHSP-interacting proteins, confirming a role for HSP101 in stress granule function. Connections between HSP101, stress granules,proteasomes, and ubiquitylation imply that dynamic coordination between protein disaggregation and proteolysis is required tosurvive proteotoxic stress caused by protein aggregation at high temperatures.

Proteotoxic stress induced by conditions that en-hance protein misfolding is detrimental to the survivalof all organisms. One main environmental condition

that induces such stress is exposure to above-optimaltemperatures. Heat stress can result in protein mis-folding/unfolding that exposes normally sequesteredhydrophobic residues, which can then promote theaccumulation of the affected proteins in cytotoxic pro-tein aggregates. To limit the detrimental effects ofprotein unfolding and aggregation, cells engage severalfolding/refolding and degradation pathways to restoreprotein homeostasis (Chen et al., 2011; Mogk et al.,2018). Included are molecular chaperones that limit ir-reversible protein unfolding or work to restore thecorrectly folded state, aggregation mechanisms thatsequester misfolded proteins, and catabolic pathwaysthat remove damaged proteins when repair fails(Protter and Parker, 2016). For plants, understandingthese protective responses has important agronomicvalue for maintaining yield in the face of unpredictabledaily temperature fluctuations and the anticipated im-pacts of elevated temperatures due to global climatechange.Small heat shock proteins (sHSPs) are the first lines of

cellular defense against irreversible protein aggrega-tion. sHSPs assemble into multi-subunit oligomers (12→ 24 subunits, depending on the sHSP) that are in rapidequilibrium with substructural dimers. As tempera-tures increase, this equilibrium shifts to the dimericform, which is proposed to be the species that binds

1This work was supported by grants from the National Institutesof Health/National Institute of General Medical Science (GM-124452)and the National Science Foundation Plant Genome Research Pro-gram (IOS-1339325) to R.D.V., and by grants from the U.S. Depart-ment of Energy (DE-SC0006646) and the Massachusetts Life SciencesCenter (New Faculty Research Award) to E.V.

2These authors contributed equally to the article.3Senior authors.4Author for contact: [email protected] author responsible for distribution of materials integral to the

findings presented in this article in accordance with the policy de-scribed in the Instructions for Authors (www.plantphysiol.org) is:Elizabeth Vierling ([email protected])

F.M. performedmost experimental work and themass spectromet-ric analyses. M.K. generated the new transgenic lines expressingHSP101-StrepII/RFP. F.M. andM.K. conducted themicroscopic stud-ies and HSP101-StrepII affinity purifications, where M.K. observedthe initial interaction between HSP101 and the proteasome. R.S.M.helped with the proteasome activity assays and provided technicaladvice. F.M., M.K., E.V., and R.D.V designed the research and ana-lyzed the data. F.M., E.V., and R.D.V. wrote the paper with inputfrom all authors.

[OPEN]Articles can be viewed without a subscription.www.plantphysiol.org/cgi/doi/10.1104/pp.19.00263

Plant Physiology�, August 2019, Vol. 180, pp. 1829–1847, www.plantphysiol.org � 2019 American Society of Plant Biologists. All Rights Reserved. 1829

https://plantphysiol.orgDownloaded on February 19, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://orcid.org/0000-0002-2430-5074

http://orcid.org/0000-0002-2430-5074

http://orcid.org/0000-0002-6844-1078

http://orcid.org/0000-0002-6844-1078

http://orcid.org/0000-0003-0210-3516

http://orcid.org/0000-0003-0210-3516

http://orcid.org/0000-0002-0066-4881

http://orcid.org/0000-0002-0066-4881

http://orcid.org/0000-0002-2430-5074

http://orcid.org/0000-0002-6844-1078

http://orcid.org/0000-0003-0210-3516

http://orcid.org/0000-0002-0066-4881

http://crossmark.crossref.org/dialog/?doi=10.1104/pp.19.00263&domain=pdf&date_stamp=2019-07-20

mailto:[email protected]

http://www.plantphysiol.org

mailto:[email protected]

http://www.plantphysiol.org/cgi/doi/10.1104/pp.19.00263

https://plantphysiol.org

heat-sensitive unfolding proteins and helps themregain their near-native conformation (Basha et al.,2012; Haslbeck and Vierling, 2015; Santhanagopalanet al., 2018). Although conserved in all kingdoms oflife, sHSP diversity is particularly striking in plants,with at least 11 gene clades found in monocots andeudicots (Waters, 2013). Two major clades of cytosolicsHSPs are found in all land plants, class I (CI; sixmembers in Arabidopsis [Arabidopsis thaliana]) andclass II (CII; two members in Arabidopsis; Scharf et al.,2001). Studies with transgenic Arabidopsis, in whichexpression of either the CI or CII clades was reducedusing RNA interference (RNAi) strategies, demon-strated that both clades are required for maximumthermotolerance. While affinity experiments showedthat CI sHSPs are more effective than CII sHSPs atcapturing substrates during heat stress in vivo, overlapin potential CI and CII clients exists (McLoughlin et al.,2016). Some of these sHSP-associated clients have beenidentified by their aggregation during heat stress andfailure to resolubilize during recovery in plants defi-cient in either CI or CII sHSPs or the protein dis-aggregase HSP101 (McLoughlin et al., 2016).

HSP101 belongs to the Hsp100/casein lytic proteinase(Clp) B family of AAA1 chaperones (ATPase associatedwith diverse cellular activities) present in both prokar-yotes and eukaryotes that assemble into homohexamerscapable of disaggregating misfolded proteins. Theirdisaggregation mechanism involves coupling ATP hy-drolysis to unfolding of the misfolded state, threadingthe unfolded polypeptide through a central pore, andthen attempting proper refolding to the native state incombination with other molecular chaperones (Parsellet al., 1994; Haslberger et al., 2008; Watanabe et al.,2009). Each monomer contains two nucleotide-bindingdomains that, when assembled, form two stacked ringsconnected by a coiled-coil (middle) domain which isunique to Hsp100/ClpB AAA1 proteins (Lee et al.,2003). This middle domain is important for interactionswith HSP70, which decorates the surface of protein ag-gregates and recruits and activatesHSP101 (Seyffer et al.,2012; Winkler et al., 2012; Lee et al., 2013).

Bacterial members of the AAA1 protein family, suchas ClpA or ClpX (which lack the coiled-coil middledomain of Hsp100/ClpB proteins), associate with pro-teases like ClpP or ClpQ that can directly break downmisfolded proteins if refolding fails (Kirstein et al.,2009). In contrast, the cytosolic version of Hsp100/ClpB in budding yeast (Saccharomyces cerevisiae),Hsp104, favors client protein refolding (Weibezahnet al., 2004) over facilitating degradation and has notbeen found associated with proteases. In fact, Hsp104engineered to deliver substrates directly to an associ-ated peptidase was unable to support thermotolerance(Weibezahn et al., 2004; Tessarz et al., 2008), implyingthat refolding of Hsp104 clients is strongly preferredover degradation during recovery from heat stress.Mammals lack a Hsp100/ClpB-type disaggregationsystem but harbor a disaggregation machinery com-prising HSP110, HSP70, and HSP40 (Nillegoda et al.,

2015). They also rely on proteasomes for clearing ag-gregated proteins, with the shuttle factor Ubiquilin 2recognizing HSP70-bound clients and delivering themto the proteasome complex for breakdown (Hjerpeet al., 2016).

Plants express multiple nuclear-encoded HSP100/ClpB proteins that are directed to three cellular com-partments, the cytosol/nucleus, chloroplasts, and mi-tochondria. Of these, cytosolic/nuclear HSP101 (ClpB1;At1g74310 in Arabidopsis) is a major isoform essentialfor tolerance of extreme heat (Hong and Vierling, 2000;Queitsch et al., 2000). While Hsp100/ClpB homologs innonplant species are reasonably well studied (Mogket al., 2018), the substrates and interacting (adaptor)proteins for plant HSP100/ClpB proteins remainlargely unknown.

Heat stress also induces the formation of cytoplasmicstress granules that coalesce aggregates of heat-labilemisfolded proteins as a mechanism to mitigate pro-teotoxic stress (Cherkasov et al., 2013; Mitrea andKriwacki, 2016). These membrane-less organelles playimportant roles in plant development and stress toler-ance, as demonstrated by the analysis of mutantseliminating various stress granule constituents thatdisplayed defects in seedling morphology and/orstress acclimation (Cherkasov et al., 2013; Merret et al.,2013; Sorenson and Bailey-Serres, 2014; Perea-Resaet al., 2016). These granules appear as highly dynamicfoci with biophysical properties typical of fluid bio-molecular condensates that rapidly exchange theircontents with the surrounding cellular milieu. They arealso highly mobile via actin filament cytosolic stream-ing, which likely encourages misfolded protein accre-tion and granule fusion (Hamada et al., 2018). A subsetof stress granules accumulates mRNAs and associatedRNA-binding proteins that protect translation-stalledmRNAs from degradation (Nover et al., 1989; Protterand Parker, 2016; Gomes and Shorter, 2019). Duringheat stress recovery, HSP70 and HSP101 are recruitedto these granules, which collectively promote granuledissolution and restoration of mRNA translation(Cherkasov et al., 2013; McLoughlin et al., 2016; Merretet al., 2017).

Given the importance of HSP101 to thermotolerancein plants, we addressed several unanswered questionspertaining to its functions during recovery from severeheat stress in Arabidopsis. We document that thischaperone reversibly decorates several morphologi-cally distinct biomolecular condensates during heatstress and recovery, one of which has signatures ofstress granules. Mass spectrometry (MS), coimmuno-precipitation, and microscopic studies detected an un-anticipated interaction between HSP101 andproteasomes, with HSP101 and this proteolytic com-plex transiently colocalizing in amorphous foci duringheat shock recovery. Differences in ubiquitylated pro-tein profiles from wild-type and hsp101 null seedlingsafter heat stress indicate that the disaggregase activityof HSP101 is important for clearing insoluble proteinfractions modified with ubiquitin. Comparisons of

1830 Plant Physiol. Vol. 180, 2019

McLoughlin et al.



soluble and insoluble proteins enriched in aggregatedproteins identified over 600 Arabidopsis proteins whoseaggregation is suppressed by HSP101. The subset ofproteins most severely affected by heat stress partiallyoverlaps with known stress granule constituents andsHSP-interacting proteins, indicating that HSP101 isimportant for, but not limited to, stress granule disas-sembly during heat stress recovery. Although mostHSP101 clients appeared destined for refolding, syn-ergy between HSP101 and the proteasome was appar-ent in clearing a subset of insoluble, ubiquitylatedproteins.

RESULTS

HSP101 Forms Dynamic Foci during Acclimation, HeatStress, and Recovery

HSP101 is typically present at low levels in non-stressed Arabidopsis seedlings but rapidly accumulatesupon heat stress (Hong and Vierling, 2001). To studythe role(s) of this protein disaggregase during heatstress, we applied a protocol in which seedlings grownat 22°C were treated with a 1.5-h moderate heat shockat 38°C, followed by a 2-h recovery at 22°C (designatedas acclimation) to induce the synthesis of HSP101 andother molecular chaperones important for thermotol-erance (Hong et al., 2003). The acclimation treatmentwas followed by a severe heat shock at 45°C for 1 h anda variable-length recovery phase at 22°C, during whichHSP101 dynamics and activity were studied (Fig. 1A).The acclimation process protects wild-type seedlingsfrom the severe 45°C treatment, but results in growtharrest of hsp101 null seedlings (hot1-3 allele; Hong andVierling, 2000). The heat sensitivity of the hsp101 nullmutant could be complemented by expressing aHSP101-GFP fusion under control of the nativeHSP101promoter (McLoughlin et al., 2016); this HSP101-GFPhsp101 line was used to interrogate HSP101 localizationand dynamics. As expected, the fluorescent signal inHSP101-GFP expressing plants was strongly enhancedafter heat stress acclimation (Supplemental Fig. S1A).Detailed analysis of root cortical cells from HSP101-

GFP hsp101plants revealed thatHSP101 exhibits dynamiclocalization patterns during heat stress and recovery.During acclimation, HSP101-GFP became concentratedin discrete cytoplasmic foci that were highly mobile(Fig. 1B). By overlaying consecutive images from 0 and8 min, this cytoplasmic movement was easily docu-mented (Fig. 1B; Supplemental Video S1). The foci wererelatively large for intracellular structures, having anaverage diameter of 0.49 6 0.12 mm and a maximumdiameter of 0.75 mm. Although increased protein ag-gregation would be expected with the 45°C treatment,the HSP101-GFP signal surprisingly became mostlydiffuse after the severe heat stress, implying thatHSP101 dissociated from these foci (Fig. 1C). How-ever, after an initial phase of recovery at 22°C, HSP101-GFP again coalesced into small foci that increased

in size over time (Fig. 1C; Supplemental Fig. S1B;Supplemental Video S2), resulting in larger mobilefoci, with an average diameter of 0.656 0.15 mm andmaximum diameter of 0.91 mm (Fig. 1D), afterovernight recovery.To assess whether this dynamic localization of

HSP101-GFP occurred in all cell types or was unique toroot cortical cells, we studied the response in leaf epi-dermal pavement and guard cells subjected to the sameheat stress regime (Fig. 1E). Although the kinetics foraggregation, dispersal, and reaggregation of HSP101-GFP were nearly indistinguishable to those in roots,several differences were evident. First, the foci in ac-climated leaves were ;3-fold larger than those seen inroots (1.56 6 0.50 mm average diameter, with a maxi-mum of 2.64 mm; Fig. 1F; Supplemental Video S3).Second, the accretion of HSP101-GFP into small fociduring the initial recovery was more pronounced inleaves, although the foci seen after 45 min of recoverywere smaller by comparison (1.03 6 0.29 mm averagediameter with a maximum of 1.71 mm; Fig. 1G) andappeared static in consecutive images over a timeframeof 15 min (Supplemental Video S4). Third, the HSP101-GFP signal in guard cells was concentrated at the edgesof the cytoplasm adjacent to the neighboring guard cellduring severe heat stress (Fig. 1E). Whether this phe-nomenon reflected a unique positioning of cytoplasm inguard cells or some other novelty of this cell type isunknown. Fourth, the reformation of cytoplasmic fociin guard cells varied even within the same leaf, withsome pairs either containing many smaller foci, a dif-fuse cytoplasmic distribution, or just a few larger foci atthe same recovery time point (Supplemental Fig. S1D).Finally, while the foci in root cortical cells persistedeven after 16 h of recovery, they dissipated after thesame period of recovery in both epidermal pavementcells and the majority of guard cells, which could implythat leaves more quickly disaggregate/refold theirprotein complement and/or are better protectedagainst protein misfolding/aggregation.To eliminate the possibility that prolonged confocal

imaging induced foci formation, we monitoredHSP101-GFP in epidermal pavement cells that were notsubjected to severe heat stress; no foci appeared evenafter 1 h of fluorescence excitation (Supplemental Fig.S1C). In addition, when roots expressing yellow fluo-rescent protein alone were subjected to the same heatstress regime, they did not accumulate fluorescent foci(Supplemental Fig. S1A). Together, these data showthat HSP101 is rapidly recruited to dynamic cytoplas-mic foci after heat stress and that the kinetics of thisassociation is dependent on the heat stress regime andcell type.We reported previously that HSP101-GFP colocalizes

with sHSPs and several sHSP-interacting proteins inheat stress-induced foci, including translation elonga-tion factor 1B (EF1B;McLoughlin et al., 2016), which is astress granule constituent in yeast (Cherkasov et al.,2015; Wallace et al., 2015; Jain et al., 2016) and Arabi-dopsis (Kosmacz et al., 2019). To assess how the

Plant Physiol. Vol. 180, 2019 1831

Protein Disaggregation after Heat Stress


http://www.plantphysiol.org/cgi/content/full/pp.19.00263/DC1











HSP101-GFP foci are related to stress granules, we si-multaneously localized HSP101-GFP with the stress-granule marker poly(A) binding protein (PAB)-2fused to red fluorescent protein (RFP; Sorenson andBailey-Serres, 2014; Merret et al., 2017; Kosmacz et al.,2019). As shown by merged confocal fluorescence im-ages and subsequent rendering and statistical analysisby surface three-dimensional plots (Fig. 2, A–C), bothmarkers could be detected in the same foci in roots aftersevere heat stress followed by 30 min of recovery.However, unlike HSP101-GFP, PAB2-RFP was notdetected in foci during acclimation, nor during the laterstages of recovery from severe heat stress, when it in-stead displayed a diffuse cytosolic distribution (Fig. 2,A–C). Consequently, it appears that HSP101 and PAB2transiently coexist in the same foci, and that under the

conditions examined here, stress granule componentsappear to be highly dynamic.

Based on work with yeast showing that Hsp104and other chaperones interact with protein aggre-gates (Glover and Lindquist, 1998), along withour studies colocalizing Arabidopsis HSP101, sHSPs,and several sHSP-associated proteins in cytoplas-mic foci possibly enriched in aggregated proteins(McLoughlin et al., 2016), we examined the extent ofprotein aggregation during and after heat stress. Theaggregated protein fraction was enriched by centrif-ugation of total cell extracts and the pellets repeatedlywashed and recollected to remove trapped solublematerial. As shown in Figure 2D, subjecting seedlingsto severe heat stress at 45°C dramatically increasedthe complexity and abundance of proteins in this

Figure 1. HSP101-GFP rapidly accumulates in cytosolic foci during heat stress and recovery. A, Overview of the heat stressregime. Six-day-old HSP101-GFP hsp101 seedlings grown on solid medium at 22°C in long days (16-h light/8-h dark) were heatacclimated at 38°C for 1.5 h and allowed to recover at 22°C for 2 h to induce the synthesis of molecular chaperones, includingHSP101 (Acc). Seedlings were then subjected to a more severe heat stress at 45°C (HS) for 1 h followed by a recovery phase (Rec)of variable length at 22°C. B, Intracellular distribution of HSP101-GFP in root cortical cells after heat stress acclimation. Left, Cellswere imaged for GFP (green) and propidium iodide (red) by confocal fluorescence microscopy. Right, Overlay of HSP101-GFPimages collected at t5 0 (blue) and t5 8 min (yellow) to demonstrate movement of the foci. C and E, Images of root cortical cells(C) and leaf epidermal pavement (E, upper) and guard cells (E, lower) expressing HSP101-GFPat the indicated phases of the heatstress regime. Scale bars 5 5 mm (B, C, and E). D, F, and G, Diameter of HSP101 foci measured after heat stress and recovery inroot and leaf cells. Each bar represents the measurement of 50 foci from multiple cells plotted in a box and whisker plot. Thecentral line locates the median value,1 indicates the average value, the box encompasses the upper and lower quartiles, and theerror bars show the maxima and minima of the size distributions.


McLoughlin et al.



aggregated, insoluble fraction, which was further el-evated during acclimation, after heat stress, andduring recovery in the hsp101 mutant. Consistentwith prior studies (Lee et al., 2005; McLoughlin et al.,2016), a substantial portion of the CI sHSP pool alsoentered the aggregated, insoluble fraction duringsevere heat stress and was retained during recoveryin the hsp101 mutant (Fig. 2D). On the contrary,HSP101 was not bound to this aggregated/insolublematerial but instead was retained in the solublefraction both before and after heat stress (Fig. 2D),suggesting that HSP101 loosely binds to the surface of

protein aggregates, similar to that observed forHsp104 in yeast (O’Driscoll et al., 2015).

HSP101 Interacts with Other Chaperones and theProteasome during Heat Stress

We sought to identify proteins that interact withHSP101 as possible functional partners by using affinityisolation followed by MS. For this purpose, we gener-ated hsp101 plants rescued with a C-terminal Strepta-vidin II-tagged version of HSP101 expressed under thecontrol of its native promoter. The HSP101-StrepII

Figure 2. HSP101 is recruited to stress granules during heat stress and is important for disaggregating insoluble proteins duringrecovery. A, Localization of HSP101-GFP and the stress-granule marker PAB2-RFP in root cortical cells after heat stress accli-mation (Acc), and after 30 min (HS1Short Rec) or 5 h (Rec) of recovery following a severe heat stress at 45°C (HS; see Fig. 1A).Colocalizationwas assessed bymerging the fluorescence signalswhereHSP101-GFP is shown in cyan and PAB2-RFP inmagenta.Arrowheads locate positions of HSP101-containing foci; orange arrowheads indicate colocalization with PAB2-RFP and whitearrowheads a lack thereof. Nuc, nucleus. Scale bars5 5 mm. B, Evidence for colocalization of HSP101-GFPand PAB2-RFP soonafter recovery (Rec) based on analysis of surface three-dimensional plots of the images in A. C, Quantification of colocalization incytosolic regions by Pearson’s correlation coefficients. Each bar represents the average correlation coefficient (6SD) of five in-dividual cells obtained from multiple roots. D, The effect of HSP101 on protein disaggregation during heat stress recovery. Theinsoluble (aggregated) proteins enriched by centrifugation from wild-type (WT) and hsp101 seedlings either after acclimation,immediately after a 1-h heat stress at 45°C, or after 3 h of recovery at 22°C. The soluble fractions represent the supernatant,whereas the insoluble fractions represent the repeatedly washed pellets resuspended in an equal volume of buffer. Equal aliquotswere subjected to SDS-PAGE and either silver stained for total protein content or immunoblotted with anti-HSP101 or anti-CIsHSP antibodies.





fusion accumulated at levels similar to that of HSP101in wild-type plants and fully restored thermotoleranceto the hsp101 line, as judged by the maintenance ofhypocotyl elongation after heat stress (SupplementalFig. S2, A and B). Following affinity enrichment fromextracts prepared from heat-stressed plants, a numberof possible HSP101-StrepII-interacting proteins weredetected by one-dimensional SDS-PAGE based on theirabsence in samples isolated in parallel from wild-typeplants also subjected to heat stress (Fig. 3A). TandemMS analysis of individual bands excised from the gelsdetected HSP70, which was previously identified asassociated with yeast Hsp104, a homolog of Arabi-dopsis HSP101 (Winkler et al., 2012), thus demon-strating the validity of the approach. Unexpectedly, theproteasome regulatory particle (RP) subunit RPN1awas also identified (Fig. 3A). The interactions betweenHSP101 and HSP70 or RPN1a were confirmed by im-munoblot analyses of the pulldowns with anti-HSP70

and anti-RPN1a antibodies (Supplemental Fig. S2, Cand D).

To expand this analysis, the HSP101-StrepII eluateswere separated by two-dimensional PAGE followed bysilver staining. TandemMS analysis of spots specific tothe HSP101-StrepII precipitates identified the HSP88.1chaperone (Hsp90 family) and other RP subunits of theproteasome (RPN5a, RPN10, RPN11, RPN12a, andRPT1a [Yang et al., 2004; Book et al., 2010]) asHSP101 interactors (Fig. 3, B and C). The association ofchaperones and proteasome subunits was further con-firmed by MS analysis of affinity-purified samplesfrom seedlings without electrophoretic fractionation,which revealed enrichment of several molecular cha-perones and additional proteasome subunits, includ-ing those for the core protease (CP) subparticle of theproteasome (PAB1, PAE1, PAF1, and PBG1; Fig. 3D).(See Supplemental Datasets S1 and S2 for the fulllists of HSP101-interacting proteins identified by MS.)

Figure 3. HSP101 interacts with proteasome subunits and other molecular chaperones following heat stress.Wild-type (WT) andHSP101-StrepII hsp101 were grown on soil for 4 weeks, heat stress acclimated, and subjected to a severe heat stress for 2 h at45°C. HSP101-StrepII and associated proteins were enriched from total clarified protein extracts by Strep-Tactin affinity chro-matography. A, HSP101-StrepII interacts with HSP70 and the proteasome subunit RPN1. Following SDS-PAGE of the affinity-enriched fractions, the indicated bands that were exclusively detected in the HSP101-StrepII eluates were excised and identifiedvia tandem MS. B, HSP101-StrepII interacts with other HSPs and proteasome subunits. Following two-dimensional PAGE of theaffinity enriched fractions, spots exclusively detected in the HSP101-StrepII sample were excised (indicated by arrowheads) andidentified by tandem MS. C, MS identification of labeled spots in B. D, HSP101-StrepII-interacting proteins identified from2-week-old seedlings which were grown on agar medium, acclimated, and subjected to a severe heat stress for 1 h at 45°C bytandem MS from affinity-purified samples without PAGE fractionation. Proteins listed were exclusively detected in the HSP101-StrepII samples and were identified by at least two unique peptides (FDR , 5%). The interaction between HSP101 andproteasome subunits was observed in at least five independent experiments.


McLoughlin et al.








Unexpectedly, some proteins (HSP23.6 and ClpC1) thatwere enriched in the HSP101-StrepII samples arethought to exclusively localize to organelles; we pre-sume that they represent post-lysis interactions, whichlikely do not interact with HSP101 in intact cells. Takentogether, the data confirm interactions betweenHSP101and several chaperones during heat stress and implythat proteasomes are also HSP101 partners.

RPN1a Transiently Localizes with HSP101 afterHeat Stress

To further investigate the observed associationof HSP101 with proteasomes, we tracked movementsof RPN1a-GFP (a RP subunit) and proteasomea-subunit (PAG)1-GFP (a CP subunit) under our heatstress regime for possible colocalization. Prior studiesshowed that both proteasome reporters faithfullyintegrate into the holo-proteasome complex and res-cue the aberrant phenotypes of the correspondingnull mutants (Yao et al., 2012; Marshall et al., 2015).When analyzed by confocal fluorescence microscopy,both RPN1a-GFP and core proteasome a subunit G1 (PAG1)-GFP displayed a diffuse intracellular pat-tern under nonstressed conditions, with most of thesignal detected in the nucleus, consistent with theconcentration of proteasomes in this compartment(Kolodziejek et al., 2011; Marshall et al., 2015). Afteracclimation, the RPN1a-GFP signal coalesced intolarge, irregularly shaped condensates (Fig. 4A;Supplemental Fig. S3). Interestingly, the localizationpattern of PAG1-GFP only partially overlapped withthat of RPN1a-GFP, with PAG1-GFP near exclusivelypresent in the nucleus, suggesting that a sizable poolof proteasomes remains unassembled, or that RP as-sociation with the CP is very dynamic in Arabidopsisroot cells.Like HSP101, the intracellular distributions of both

proteasome reporters were altered following severeheat stress at 45°C. In addition to diffuse backgroundsignals, both RPN1a-GFP and PAG1-GFP appeared indiscrete cytoplasmic and nuclear foci, in direct contrastto HSP101-GFP, which instead became more dispersedduring severe heat stress (Figs. 1C and 4, B–D,Supplemental Figs. S1 and S3). The RPN1a-GFP andPAG1-GFP foci seen during severe heat stress were alsomorphologically distinct from the foci containingHSP101-GFP that appear during acclimation or recov-ery. Whereas the HSP101-containing foci were sharplydelineated and numerous, the RPN1a-containing fociwere fewer, substantially larger, and relatively amor-phous. To verify that the proteasome-containing fociwere different, we colocalized RPN1a-GFP with thePAB2-RFP stress-granule marker. Unlike the resultswith HSP101-GFP and PAB2-RFP, little overlap wasevident by surface three-dimensional plots and subse-quent statistical analysis of the merged fluorescenceimages (Fig. 4, B–D). The RPN1a-containing foci werealso substantially larger than the PAB2-containing foci

(Fig. 4E), suggesting that the proteasome condensatesare distinct from PAB2-containing stress granules(Fig. 4, B–D).To test further when and where RPN1a and HSP101

interact, we generated wild-type plants expressing bothRPN1a-GFP and an RFP-tagged version of HSP101, andsimultaneously imaged both proteins during heat stressrecovery. As expected, based on colocalization studieswith PAB2, RPN1a-GFP and HSP101-RFP accreted indistinct foci during acclimation, as seen by the surfacethree-dimensional plots of the fluorescence images (Fig. 4,F–H). Notably, during heat stress recovery, a partialoverlap was observed between HSP101 and RPN1a, es-pecially after 3 h of recovery (Fig. 4H). However, by 16 hof recovery the RPN1a-GFP foci disappeared, while theHSP101-RFP signal continued to accumulate in larger foci(Fig. 4, F and G), as can be also seen in Figure 1, C and D,and Supplemental Figure S1A. Altogether, these datasuggest thatHSP101 localization is strongly dependent onthe heat stress regime, and that the protein accretes todistinct cytosolic foci during heat stress recovery.

Possible Functional Interactions between HSP101and Proteasomes

Given the interaction of HSP101 with proteasomesubunits (Fig. 3; Supplemental Fig. S2, C and D) andthe transient colocalization of RPN1a-GFP andHSP101-RFP during heat stress recovery (Fig. 4, F–H),we hypothesized that (1) proteasomes could degradeHSP101, (2) HSP101 could impact the abundance oractivity of proteasomes, (3) RPN1a could be impor-tant for the disaggregase activity of HSP101, or (4)HSP101 could work synergistically with proteasomesto clear protein aggregates. To test the first hypothe-sis, we monitored HSP101 levels during heat stressrecovery in seedlings incubated with the proteasomeinhibitor MG132 [(N-benzyloxycarbonyl)-leucinyl-leucinyl-leucinal] or the translational inhibitor cy-cloheximide. Concurrently, we analyzed seedlingsexpressing the known, short-lived proteasome sub-strate His6-HA3-IAA1, which was used as a control(Gilkerson et al., 2015). As shown in SupplementalFigure S4A, the levels of HSP101 were unaffectedby the inhibitors during heat stress recovery, whileHis6-HA3-IAA1 hyper-accumulated in the presenceof MG132 and was nearly absent in the pres-ence of cycloheximide. The fact that HSP101 levelsremained constant in the presence of MG132 sup-ported the conclusion that HSP101 is not a target ofproteasomes.To test the second hypothesis, that HSP101 impacts

proteasome accumulation, we measured the abun-dance of the RPN1a and PBA1 subunits by immunoblotanalysis of total seedling extracts. Levels of both pro-teins were unaffected by the heat stress regime or theabsence of HSP101 (Supplemental Fig. S4B). Withthe samewild-type and hsp101 samples, we also assayedthe activity of proteasomes, using the substrates












Figure 4. The proteasome subunit RPN1a accretes in distinct cytosolic foci and colocalizes with HSP101 during recovery fromheat stress. Six-day-old seedlings harboring the indicated reporters were subjected to the heat stress regime and imaged byconfocal fluorescencemicroscopy. A, RPN1a-GFPaccretes in foci during acclimation (Acc) and heat stress (HS) but is diffuse after16 h of recovery (Rec). Root cortical cells were imaged for GFP (green) and propidium iodide (red, to locate cell walls) by confocalfluorescence microscopy. Overlays of RPN1a-GFP images collected in acclimated and heat stressed cells at t5 0 (blue) and t58 min later (yellow) are shown to demonstrate that the RPN1a-GFP foci are immobile (similar to the images in Fig. 1, B, C, and E).Arrowheads locate the positions of RPN1a-GFP condensates. Nuc, nucleus. B, RPN1a and the stress granule marker PAB2-RFPaccumulate in distinct foci during heat stress. Fluorescence from RPN1a-GFP and the stress granule marker PAB2-RFP werevisualized in the same cells after a 30-min recovery from severe heat stress. GFP, RFP, and merged signals (RPN1a-GFP in cyan;PAB2-RFP in magenta) are shown. Arrowheads indicate positions of RPN1a-GFP condensates, which do not overlap with PAB2-RFP. C, Poor colocalization of RPN1a-GFPwith PAB2-RFPas determined by analysis of surface three-dimensional plots of cells inB subjected to 30 min of recovery. D, Quantification of colocalization in cytosolic regions by Pearson’s correlation coefficients.


McLoughlin et al.



Suc-LLVY-AMC (N-succinyl-leucyl-leucyl-valyl-tyrosyl-7-amino-4-methylcoumarin) andLFP [(7-methoxycoumarin-4-yl)-acetyl-alanyl-lysyl-valyl-tyrosyl-prolyl-tyrosyl-prolyl-methionyl-glutamyl-(2,4-DNP-(2,3-diaminopropionicacid))-amide], whichmeasure the proteolytic activityof the CP subcomplex and the holo-proteasome, re-spectively (Smith et al., 2005; Marshall and Vierstra,2018). The heat stress regime diminished both activi-ties, with severe heat stress causing a 50% decrease,but these activities were the same in hsp101 as in thewild type (Supplemental Fig. S2C). Therefore, HSP101does not appear to be essential for proteasome activityin response to heat stress.To examine the possibility that proteasomes are im-

portant for the disaggregase activity of HSP101, weseparated by centrifugation total seedling extracts fromwild-type, hsp101, and rpn1a-4 seedlings subjected to theheat stress regime into soluble and insoluble fractions asdescribed above (see Fig. 2D), and examined the distri-bution of HSP101 and RPN1a in each fraction by im-munoblot analysis (Supplemental Fig. S5). The rpn1a-4allele is known to strongly reduce RPN1a protein levels,modestly compromise proteasome function, and confera hypersensitivity to heat, oxidative stress, and MG132treatment (Wang et al., 2009), while even stronger alleleshave a host of phenotypic defects (Brukhin et al., 2005;Yao et al., 2012). RPN1a partitioned into the solublefraction along with HSP101 after acclimation and sub-sequent severe heat stress (Supplemental Fig. S5). Incontrast, CI sHSP and the sHSP-interacting protein-stranslation elongation factor (eEF)-1Ba, eEF-1Bb, andeEF-1Bg accumulated in the insoluble fraction after se-vere heat stress and subsequently returned to the solublefraction during recovery, indicating that the disaggre-gation activity of HSP101 was not affected by the rpn1amutation (Supplemental Fig. S5). Interestingly, the levelsof sHSP-interacting proteins were reproducibly moreabundant in the soluble fraction of rpn1a seedlings ascompared to wild type, which could imply that theseproteins are substrates of proteasomes (SupplementalFig. S5).

HSP101 and Proteasomes Work in Concert toRestore Proteostasis

Considering the fourth possibility, as to the potentialfunction(s) of an HSP101/proteasome interaction, weexplored whether they might work in concert to clear

intracellular aggregates by refolding and/or turnover.We first determined, by immunoblot analysis of theinsoluble fractions fromwild-type and hsp101 seedlingsduring heat stress and recovery, whether the levels ofubiquitin-protein conjugates were altered in the ab-sence of HSP101. The insoluble fraction from hsp101seedlings after acclimation displayed a weak ubiquitinsignal that was absent in the wild type, suggesting thateven moderate temperature stress results in both in-creased aggregation/sequestration and ubiquitylationof thermosensitive proteins (Fig. 5A). Strikingly, thelevels of insoluble ubiquitylated species dramaticallyrose after the severe heat stress, with the highest levelsseen in the hsp101 mutant, indicating either that ubiq-uitylated proteins entered the insoluble pool uponmodification or that the insoluble proteins that remainedaggregated were preferentially modified (Fig. 5, Aand B).To determine whether there is a contribution of

proteasomes to the clearance of heat-induced ubiq-uitylated aggregates, we subjected wild-type andhsp101 seedlings to heat stress and allowed recovery inthe presence of MG132. The insoluble pool of ubiquitinconjugates decreased during the recovery phase inwild-type seedlings but was retained in the hsp101seedlings (Fig. 5, A and B), implying that HSP101 helpspromote their resolubilization and/or turnover. Theaddition of MG132 had little effect on the profile andabundance of ubiquitylated proteins in the insolublefraction during this recovery, indicating that most ag-gregated and ubiquitylated proteins were unavailablefor proteasome degradation.For the soluble fraction, a reduction in ubiquitin

conjugates was observed in the heat stress samples, butno obvious differences were seen between wild-typeand hsp101 samples during these time points (Fig. 5,A [bottom] and C). However, during recovery, ubiq-uitin conjugates reappeared in the soluble fraction inthe wild-type samples after 3 and 5 h of recovery, in-dicating that the ubiquitylated aggregated proteinswere being disaggregated. This accumulationwasmorepronounced in the presence of MG132, thus implyingthat HSP101 and proteasomes work together duringheat stress recovery to solubilize and degrade ubiq-uitylated HSP101 clients after their aggregation.In parallel, we examined heat-induced changes in

protein solubility and ubiquitylation in seedlings withreduced levels of CI or CII sHSPs created by RNAisuppression (McLoughlin et al., 2016). As observed

Figure 4. (Continued.)Each bar represents the average coefficient (6SD) obtained from five individual cells from multiple roots. Colocalization data forHSP101-GFP and PAB2-RFP shown in Figure 2 were included for comparison. E, Diameter measurements of RPN1a and PAB2condensates/foci that appear after heat stress. Each bar represents the analysis of 50 condensates plotted in a box andwhisker plot.The central line locates the median value,1 indicates the average value, the box encompasses the upper and lower quartiles, anderror bars show the maxima and minima of the size distributions. F, Localization of RPN1a-GFP and HSP101-RFP during ac-climation and various times of recovery following a 45°C heat stress for 1 h. Arrowheads locate the positions of RPN1a con-densates; orange arrowheads indicate sites of colocalization with HSP101 and white arrowheads a lack thereof. G and H,Colocalization of RPN1a-GFPand HSP101-RFP during the heat stress regime as assessed by surface three-dimensional plots (G)and Pearson’s correlation coefficients (H), as described in C and D. Scale bars 5 5 mm (A, B, and F).











previously, the CI sHSP RNAi line (RNAi-CI) displayeda moderate decrease in CI sHSP protein levels, while amuch stronger decrease was seen for the CII sHSPproteins in the RNAi line impacting this group (RNAi-CII; Fig. 5D). When the seedlings were subjected to heatstress and assayed for ubiquitylated proteins in the in-soluble fraction, little influence on conjugate levels wasseen in either the RNAi-CI or RNAi-CII lines directlyafter the severe heat stress, as compared to the wildtype (Fig. 5D). However, during recovery, the RNAi-CIline retained insoluble, ubiquitylated species to agreater extent than the RNAi-CII line, even thoughlevels of CI sHSP were not impacted as strongly(Fig. 5D). These data imply that CI sHSPs are moreinfluential for dissolving/degrading ubiquitylatedproteins after aggregation, which is consistent with the

stronger interaction seen between CI sHSPs and theirsubstrates after heat stress (McLoughlin et al., 2016).

HSP101 Affects the Solubility of Numerous Proteinsduring Heat Stress Recovery

To identify which insoluble (aggregated) proteinswere disaggregated by HSP101 and then destined fordegradation by the proteasome, we applied tandemMSto the soluble and insoluble fractions prepared fromacclimated and 45°C heat-stressed seedlings treatedwith or without MG132 during recovery. We used theprecursor ion intensities of individual peptides from theMS1 scans of trypsinized samples to provide label-freequantification. In total, 3,511 protein groups were

Figure 5. HSP101 and CI sHSPs help clear aggregated ubiquitylated proteins. A, Two-week-oldwild-type (WT) and hsp101 agar-plate grown seedlingswere harvested after acclimation (Acc), immediately after a 1-h heat stress at 45°C (HS), or after 3 h recoveryat 22°C (Rec). Immediately after the 45°C heat stress, the medium was replaced with fresh medium without or with 100 mM

MG132. Protein extracts were separated by centrifugation into soluble and insoluble/aggregated fractions and then subjected toimmunoblot analysis with anti-ubiquitin antibodies. Coomassie brilliant blue (CBB) staining confirmed near-equal starting ma-terial. B and C, Ubiquitin immunoblot signals were densitometrically quantified in the insoluble (B) and soluble (C) fractions afterthe indicated heat stress regimes and in the presence and absence of MG132. Each value was normalized to the average intensitywhich was set at 100. Bars represent the average (6SD) of three independent biological replicates. *P , 0.05, as determined byStudent’s t test for relevant comparisons. D, Effects of CI and CII sHSPs in clearing the insoluble/aggregated fraction modified byubiquitylation. Extracts from wild-type seedlings and from seedlings expressing RNAi constructions that downregulate allmembers of either the CI or CII sHSP families were analyzed by immunoblot analysis with anti-ubiquitin antibodies. Efficacies ofthe lines in reducing CI and CII sHSP levels are shown by the bottom immunoblot(s) developed with the corresponding anti-bodies. The gels shown in A and D are representative of at least three biological replicates.


McLoughlin et al.



abundantly detected using whole seedling extracts, ofwhich ;2,000 were detected in the insoluble fractionafter the acute heat stress (Supplemental Dataset S3). Ofthis insoluble collection, we focused on 620 proteinsthat were less abundant in the acclimation and recoverysamples versus the acute heat stress samples, as well asbeing more abundant in hsp101 versus wild type, i.e.

possibly representing heat stress-aggregated proteinsresolubilized by HSP101. As shown by the heat map inFigure 6A, this collection displayed a profile consistentwith proteins that entered the insoluble fraction afteracute heat stress and then returned to the soluble frac-tion upon recovery via a route strongly dependent onHSP101. Notably, the abundance of most of these

Figure 6. HSP101 disaggregates numerous proteins after heat stress, which are predominantly reconstituted in the solublefraction during recovery. Two-week-old wild-type (WT) and hsp101 seedlings were subjected to the same treatments as reportedin Figure 5, including a 3- and 5-h recovery time point. Total extracts prepared from seedlings harvested after the various heatstress time points were separated into soluble and insoluble/aggregated fractions and subjected to tandem MS using the MS1precursor ion intensities for label-free quantification. A, A large collection of proteins that aggregate during heat stress are retainedin the insoluble fraction in the absence of HSP101. Shown is the abundance of 620 proteins in wild-type and hsp101 seedlings(from a total of 3,511 detected proteins [FDR, 5%]), that were at least 4-fold more abundant in the insoluble fraction after heatstress (HS) as compared to the acclimated (Acc) samples, and showed a subsequent 50% decrease in the insoluble fraction in thewild type, but not in hsp101 samples, during recovery. Shown are their dynamics displayed by a heat map based on Z-scores andranked by unrooted hierarchical clustering. Blue and red indicate a lower and higher abundance for each protein in the insolublefraction, respectively. B, HSP101 has a dramatic effect on the solubility of numerous proteins. From the dataset of insolubleproteins identified in A, 202 proteins were selected that were consistently detected in all insoluble and soluble samples from thewild type. Their solubility was calculated by their ratio in the soluble/insoluble fractions after the 45°C heat stress and then rankedby dependency on HSP101, using a heat map to visualize solubility. C, HSP101 client proteins identified in B are enriched invarious biological processes and molecular functions. Gene ontology (GO) enrichment was conducted using a singular en-richment analysis. P-values of the most significant and unique GO-terms regarding biological processes and molecular functionswere2log transformed and displayed in bar graphs. The numbers at the end of each bar reflect the number of proteins identifiedcompared to the total number of proteins in each GO category. D, Venn diagram showing the overlap betweenHSP101 clients asdetermined from the insoluble fraction (as in A), HSP101 clients detected in both the soluble and insoluble fractions (as in B),stress granule constituents, and sHSP-interacting proteins. The number of proteins in each sector is indicated. E, Dynamics ofrepresentativeHSP101 clients during heat stress and recovery. Shown are the abundanceCI sHSPs and poly(A) binding proteins inthe soluble and insoluble protein fractions fromwild-type and hsp101 seedlings after the indicated stages of the heat stress regime.CI sHSPs and the stress granule marker poly(A) binding protein showed strong partitioning into the insoluble fraction upon heatstress and then returned to the soluble fraction during recovery by a process dependent on HSP101. The dashed lines highlightprotein abundance in the soluble fraction of the wild-type samples. The data in this figure are from one representative of threebiological replicates.






proteins was unaffected by MG132 during recovery ineither wild-type or hsp101 seedlings, implying thatthese aggregated proteins were not available for pro-teasomal turnover (Fig. 6A).

To more accurately monitor the fate of disaggregatedHSP101 clients, we focused on a subset of 202 proteinsthat were consistently traceable in the soluble fractionduring acclimation and in the wild type during recov-ery (Fig. 6B; Supplemental Dataset S4). When the sol-ubility of each protein was visualized with a heat mapreflecting protein abundance, confirmation of their heatlability became evident, as almost all the proteins par-titioned into the insoluble/aggregated fraction after thesevere heat stress. However, after 3 h of recovery, asubstantial percentage of the insoluble fraction (;30%;shown in magenta) returned mostly, or fully, to thesoluble fraction via a process dependent on HSP101,which was even more striking after 5 h of recovery(;60%; Fig. 6B). Interestingly, a subset remainedmostly insoluble during recovery even in the presenceof HSP101 and thus might be either disaggregated at aslower rate or permanently misfolded.

GO enrichment analysis of these 202 putativeHSP101-clients retrieved several biological processes and mo-lecular functions, including an over-representation of the“response to heat” category that contained many HSPs(Fig. 6C). GO enrichments were also seen for the “tran-scription factor activity,” “ubiquitin ligase activity,” and“cytoskeletal protein binding” categories. Besidesseveral sHSPs, the list contained numerous sHSP-interacting proteins and predicted orthologs ofyeast stress granule constituents, including multipleRNA-binding proteins [including several poly(A)-binding proteins], translation initiation and elonga-tion factors, GTP-binding proteins, profilin2, andseveral cyclophilins, among others (SupplementalDataset S5; Cherkasov et al., 2015;Wallace et al., 2015;Jain et al., 2016; McLoughlin et al., 2016; Kosmaczet al., 2019).

To further address the identity of these putativeHSP101 clients, we compared this list to 44 knownsHSP-interacting proteins (McLoughlin et al., 2016),and 96 previously described stress granule constituents(Fig. 6D; Supplemental Dataset S3; Kosmacz et al.,2019). The HSP101 clients showed a clear overlapwith both lists, implying that many are either compo-nents of stress granules or proteins that associate fol-lowing aggregation. To better appreciate the influenceof HSP101 on this segregation during severe heat stress,we provided two examples, CI sHSPs and poly(A)-binding proteins within the PAB2 family. Both dis-played a dramatic partitioning from the soluble to theinsoluble fractions during severe heat stress and acontinuing return to the soluble fraction during recov-ery via a process strongly dependent on HSP101(Fig. 6E). For example, while most of PAB2-typepoly(A)-binding proteins were in the soluble fractionduring acclimation (91%), they dramatically seques-tered into the insoluble fraction after the severe heatstress (93%) and then eventually repartitioned back to

the soluble fraction during 3 and 5 h of recovery (53%and 71%, respectively; Fig. 6E).

HSP101 Clients Are Mostly Destined for Refolding Ratherthan Proteasomal Degradation

Expecting that some of the proteins that depend onHSP101 for solubility after heat stress eventually be-come proteasome substrates (see Fig. 5, A and B), wecompared the abundance of individual proteins in thesoluble fractions after a 5-h recovery with or withoutMG132 (Fig. 7A). Of the set of 202 proteins described inFigure 6B, we selected those that were detected in eachof three independent biological replicates (resulting in aset of 122 proteins) and calculated the average abun-dance values. When compared by scatter plots, wefound that the abundance of most, if not all, was largelyidentical in wild type 6 MG132, implying that protea-somes had little influence on their levels during recov-ery (Fig. 7A). By contrast, most were substantially moreabundant (i.e. resolubilized) when comparing wildtype to the hsp101 samples (Fig. 7A). These resultssuggest that the proteins that aggregated during heatstress were largely reconstituted into the soluble pro-tein pool and likely represent proteins targeted forrefolding by the disaggregase activity of HSP101, ratherthan proteasomal clearance.

To better illustrate this point, we analyzed in detailthe abundance of three HSP101 clients that were alsoidentified to be present in stress granules and interactwith sHSPs during heat stress (Fig. 6D): eEF1Bg, as-corbate peroxidase, and profilin2 (6 MG132 with orwithout HSP101; Fig. 7B). The addition of MG132 hadno discernable effect on the amount of protein that waspresent in the soluble fraction in the wild type after heatstress recovery. For example, of the percentage ofeEF1Bg that became insoluble during heat stress, 65%and 93% of the polypeptide returned to the solublefraction after 3 and 5 h of recovery, respectively, withsimilar percentages evident upon MG132 treatment(56% and 84%, respectively; Fig. 7B). Collectively, thesefindings implicate HSP101 in the resolubilization ofmany proteins that aggregate during heat stress incollaboration with stress granules and sHSPs.

DISCUSSION

Proteotoxic stress caused by heat-induced proteinaggregation is a major challenge to the survival of allorganisms (Queitsch et al., 2000). In their capacities asdisaggregases, the Hsp100/ClpB family of chaperoneshas an essential role in thermotolerance by minimizingprotein aggregate formation, disassembling aggre-gates, and finally enabling the correct refolding ofproteins during recovery (Mogk et al., 2018). We ex-amined the intracellular behavior and associations ofHSP101 during and after heat stress in Arabidopsis andused an hsp101 mutant to investigate the function and


McLoughlin et al.







potential clients of this chaperone in cellular proteo-stasis. Our data demonstrate that HSP101 associateswith dynamic, membraneless structures of varyingcomposition as it carries out a central role in clearingheat-induced protein aggregates. HSP101 was also di-rectly linked to proteasome function through affinityinteractions with proteasomal subunits and increasedubiquitylation of proteins in an hsp101 null mutant.Proteins dependent on HSP101 for solubility after heatstress were identified by MS and found to represent adiverse subset of molecular functions. Thus, this pro-tein disaggregase participates in complex interactionswith multiple cellular factors and heat-sensitive pro-teins to guard cells from proteotoxicity.A striking feature of HSP101 was its rapid accumu-

lation in cytoplasmic foci of different sizes, mobility,

and content. This behavior presents a fascinating ex-ample of how cells spatially and temporally organizefunctions within the cytosol during stress and recoverywithout the aid of membranes. Properties of HSP101cytosolic foci, including whether they were present ornot, depended on the severity of the heat stress, stage ofrecovery, and cell type. Affinity enrichment of HSP101after severe heat stress identified other chaperones, in-cluding HSP70 and sHSPs, as well as sHSP-interactingproteins and proteasomes, as potential partners inHSP101 function and components of the different foci.Wepreviously colocalized HSP101 in foci with CI and CIIsHSPs and with sHSP-associated proteins (eEF1Bg andeEF1Bb) after an acclimation treatment (McLoughlinet al., 2016). Notably, CI and CII sHSPs also accumu-lated in separate HSP101-free cytosolic foci, further

Figure 7. HSP101 clients are predominantly reconstituted in the soluble fraction during recovery. A, HSP101-disaggregatedproteins are mainly destined for refolding as opposed to proteasomal turnover. The soluble abundance of 122 proteins that wereconsistently detected in three independent experimentswere selected for analysis of their partitioning into the soluble fraction 5 hafter recovery of wild-type (WT) seedlings with or without treatment with MG132 (left), or comparing untreated wild-type andhsp101 seedlings (right). The dashed lines identify the hypothetical point where either the loss of HSP101 or the addition ofMG132 has no effect on protein abundance. Each point in the scatter plots represents the average values obtained from threebiological replicates. B, Abundance of representative HSP101-clients in the soluble and insoluble fractions prepared from wild-type and hsp101 seedlings after various stages of the heat stress regime in the presence and absence of MG132. Partitioning ofknown sHSP-interacting proteins and stress granule constituents (EF-1Bg, ascorbate peroxidase 1, and profilin 2) illustrates thestrong impact of HSP101 on protein resolubilization but only a marginal effect by the proteasome inhibitorMG132. Dashed lineshighlight the weak effect of MG132 on the amount of each protein in the soluble fraction during recovery. These data are from onerepresentative of three biological replicates.





highlighting how proteins may be functionally segre-gated in cells. The affinity data presented here imply thatthe associations of sHSPs with HSP101 continue throughsevere heat stress and recovery.

We were surprised to see that HSP101, whichappeared in cytosolic foci during the acclimation heattreatment, was dispersed in the cytoplasm when the45°C heat stress was applied. Assuming HSP101 asso-ciates with protein aggregates, this behavior could beexplained if cells become floodedwith unfolded proteinsthat have not yet coalesced into aggregates during heatstress. HSP101 could adsorb to these species, leading to adiffuse distribution, and then follow the sequesteredaggregated proteins to these foci. During recovery, weobserved that HSP101-containing foci exhibited chang-ing properties with regard to size and colocalizationwith other proteins. Localization of PAB2, which istypically associated with RNA-containing stress gran-ules (Sorenson and Bailey-Serres, 2014; Merret et al.,2017), and the proteasomal RP protein RPN1a alsoexhibited dynamic behavior and were partially colo-calized with HSP101 during recovery from heat stress.However, RPN1a and PAB2were not both present in thesame HSP101 foci, indicating that HSP101 activity isdistributed in different functional cytosolic compart-ments during both heat stress and recovery. Anotherinteresting feature is that HSP101-containing foci be-came less numerous and larger as recovery proceeded,suggesting that a mechanism exists to condense thesegranules into larger structures. In other organisms, actinfilament-based cytosolic streaming has been implicatedin granule formation and fusion (Hamada et al., 2018).

From studies on several cell types (root cortical, epi-dermal pavement, and guard cells), we found that thekinetics of HSP101 foci formation, dispersal, and ref-ormation diverged substantially. We suggest that thesevariations reflect the different protein composition,metabolic status, and proteostasis demands intrinsic tothe cell types. We expect that individual cell typescontain a unique composition of heat-sensitive proteins,as well as potentially different levels of other chape-rones and proteasomes. These features, along with themetabolic status of the cell, likely contribute to forma-tion, dynamics, and functions of distinct cellular con-densates like those containing HSP101.

The observed association of HSP101 with the protea-some was unexpected, and we tested a number of hy-potheses about the function of this association.We foundno evidence that the association promoted degradationof HSP101, or conversely, directly enhanced the activityof the proteasome. While we cannot exclude that thecolocalization is due to mass protein aggregation in re-sponse to heat stress, an intriguing possibility is that thisassociation reflects an important stage at which aggre-gated proteins are triaged to either proceed with deg-radation or with rescue by refolding. These resultsfurther emphasize that there is temporal complexity inthe processes occurring during recovery from stress.

An additional connection between proteasomes,HSP101, and aggregated protein removal is provided

by our results showing that the insoluble fraction iso-lated after heat stress accumulates high levels of ubiq-uitylated proteins via a process that is antagonized byHSP101, CI sHSPs, and possibly CII sHSPs. Most ofthese HSP101-influenced ubiquitin conjugates werereleased from the insoluble material during recoveryand their accumulation in the soluble fraction was sig-nificantly higher in the presence of MG132, implyingthat at least a portion of this pool is degraded by pro-teasomes. It is unlikely that their reappearance can beaccounted for by new protein synthesis, as our previousstudies documented that translation, as assessed bypolysome profiling, requires .12 h to significantly re-cover after heat stress (Zhang et al., 2017).

Our data also underscore how proteins sensitive tomisfolding and aggregation upon stress can be readilydetected by differential centrifugation, and how this ap-proach can be further employed to determine which fac-tors contribute to restoring proteostasis (Cherkasov et al.,2013; Zhou et al., 2013; Wallace et al., 2015; McLoughlinet al., 2016). This procedure allowedus to demonstrate notonly that there was increased accumulation of aggre-gated, ubiquitylated proteins in the absence of HSP101,but also, when combined with MS, allowed us to identifya collection of Arabidopsis proteins whose solubility ishighly susceptible to heat stress and subsequently pro-tected by HSP101. By deep tandem MS analysis of theproteomes of both the soluble and insoluble fractionsisolated during acclimation, heat stress, and recovery, wefound 620 possible HSP101 clients (from a total set of3,511 proteins) thatmatched the expected criteria; i.e. theystrongly aggregated during heat stress (i.e. entered theinsoluble fraction) and subsequently reentered the solublefraction during recovery. This reentry could reflect dis-solution of stress granule constituents upon recovery orHSP101-mediated refolding of thermo-labile proteins.The list ofHSP101 client/bindingpartners includedmanychaperones and a number of known or predicted stressgranule components (Kosmacz et al., 2019). Also enrichedwere RNA-binding proteins, including relatives of PAB2(Merret et al., 2017), proteins affected by heat stress,translation factors, and ubiquitin ligation components.Further characterization of individual HSP101 clients isnow needed to determine how these proteins becomeinsoluble, and the cellular mechanism(s) that are requiredfor HSP101 recruitment.

Analysis of a subset of 202 insoluble proteins thatrapidly aggregate after heat stress in vivo but return tosolubility in the presence or absence of MG132 revealedthatmost HSP101 clients are targeted for refolding, with amuch less than expected contribution from proteasome-dependent turnover. A similar observation was made inyeast, where most Hsp104 clients are refolded withoutproteasomal clearance (Wallace et al., 2015). As therefolding efficiency of heat-aggregated proteins likelydepends on the severity of the stress (Nollen et al., 1999), itis possible that increasing the strength and duration of theheat stress would increase the importance of proteasomaldegradation to stress protection. In addition, autophagylikely contributes through its ability to clear ubiquitylated


McLoughlin et al.



protein aggregates without dissolution, using ubiquitin-binding receptors such as NBR1 (Zhou et al., 2013).Surprisingly, it has been demonstrated that autophagymutants aremore heat tolerant after a prolongedperiod ofheat stress recovery, possibly due to a lack of autophagicturnover of chaperones such as HSP101 (Sedaghatmehret al., 2019).Continued studies on the roles of HSP101 and protea-

somes in providing thermotolerance, their localizationpatterns during heat stress, and the dynamics of themanyHSP101-influenced proteins identified here should revealthe importance of HSP101 and proteasomes in restoringprotein homeostasis after heat stress. In particular, ourMSapproach enabled the identification of other chaperonesthat work with HSP101 (e.g. HSP70, HSP40, and sHSPs),which has been challenged by the high number of paral-ogs present in plants (Waters, 2013; Sable and Agarwal,2018). By manipulating these factors, it might be possibleto engineer crops that are more tolerant to a variety ofenvironmental stresses. However, given the temporal andspatial regulation observed here, simple strategies in-volving overexpression of individual components areunlikely to succeed. Rather, we need a better under-standing of the overall proteostasis network, and howrefolding versus degradation is regulated, to prevent ormore rapidly repair damage caused by conditions thatdisrupt protein homeostasis in plants.

MATERIALS AND METHODS

Plant Growth Conditions

Arabidopsis (Arabidopsis thaliana) ecotype Columbia-0 (Col-0) wild-type,mutant, or transgenic seeds were surface sterilized in 70% (v/v) ethanol for1 min and in 50% (v/v) bleach for 10 min, washed six times with sterile water,and plated on solid nutrient medium {5 mM KNO3, 2 mM MgSO4, 2 mM

Ca(NO3)2, 50 mM Na[Fe(EDTA)], 2.5 mM KH2PO4/K2HPO4 (pH 5.5), 70 mM

H3BO3, 14mMMnCl2, 0.5mMCuSO4, 1mMZnSO4, 0.2mMNa2MoO4, 10mMNaCl,and 0.01 mM CoCl2} supplemented with 0.8% (w/v) agar and 0.5% (w/v) Suc.Following stratification at 4°C for 2–3 d, plates were placed in environmentalchambers under a long-day (LD) photoperiod (16-h light/8-h dark) with80 mmol m22 s21 of white light and 21°/18°C day/night temperatures. Alltemperature treatments were conducted in darkness within a calibrated hot airincubator that shielded the plates from incubator air currents to minimizevariability. The heat stress regime consisted of growth for 6 d at 22°C, an ac-climation phase comprising a 1.5-h sublethal heat stress at 38°C followed by 2 hat 22°C, a severe heat stress for 1 h at 45°C, and finally a recovery phase ofvariable length (3–16 h) at 22°C (Fig. 1A). These conditions were not lethal forany of the Arabidopsis lines used.

Hypocotyl Elongation Assays

Seeds were plated on solid medium and stratified at 4°C for 3 d before beingplaced vertically at 22°C in the dark for germination and growth. After 2.5 d, theposition of the hypocotyl tip was marked, and seedlings were subjected to theheat stress regime. After an additional 2.5 to 3 d of growth, seedlings werephotographed; hypocotyl elongation was determined using ImageJ (https://imagej.nih.gov/ij/index.html; Kim et al., 2017).

Plants Expressing Reporter Constructs

Plants expressing HSP101:HSP101-GFP, RPN1a:RPN1a-GFP, PAG1:PAG1-GFP, 35S:PAB2-RFP, and 35S:YFPwere as previously described byMcLoughlinet al. (2016), Yao et al. (2012), Marshall et al. (2015), Sorenson and Bailey-Serres

(2014), and van Leeuwen et al. (2007), respectively. To generate the HSP101-StrepII transgene, a 734-bp genomic fragment containing the HSP101 promoterand 59 untranslated region (UTR) was PCR amplified from Arabidopsis ge-nomic DNA and cloned into pBluescript II KS(1) between the KpnI and XhoIrestriction sites. The StrepII coding sequence (ATGTGGAGCCACCCGCAGTTCGAAAAA encoding MWSHPQFEK) was appended downstream of the 59-UTR by around-the-world PCR using the GTGGCTCCACATCTCGAGCGATTAGCTTTTGTA (XhoI site underlined) and CCGCAGTTCGAAAAATGATCCACTAGTTCTAGAGCG (XbaI site underlined) primer pair, which alsointroduced 59XhoI and 39XbaI sites relative to the StrepII sequence. TheHSP101coding sequence was PCR amplified from Arabidopsis Col-0 complementaryDNA using the CGGCTCGAGATGAATCCAGAGAAATTCAC and GGGCTCGAGATCCTCGATCATTT CCTCATT (XhoI sites underlined) primer pair,digested with XhoI, and inserted into the XhoI site upstream of the StrepII se-quence. The KpnI/XbaI fragment containing the promoter, 59-UTR, and thecoding sequences for HSP101with the StrepII tag was inserted into the pBIN19binary vector upstream of the transcription terminator and polyadenylationsignal from the Cauliflower mosaic virus 35S gene to generate theHSP101:HSP101-StrepII vector.

For the HSP101:HSP101-RFP transgene, a 3,471-bp fragment containing theHSP101 promoter, the 59-UTR, and the coding sequence was PCR amplifiedfrom the HSP101:HSP101-GFP template as previously described (McLoughlinet al., 2016), using the CACCTCTATTTTCAGAAGATCCAAAT and ATCCTCGATCATTTCCTCATTATCG primer pair. This product was inserted into thepENTR/D-TOPO plasmid (Thermo Fisher Scientific) by directional TOPOcloning. The translational fusion of the HSP101 coding sequence with that forRFP was generated by the Gateway LR clonase II reaction (Thermo FisherScientific) with pGWB653 binary vector. The HSP101:HSP101-StrepII andHSP101:HSP101-RFP transgenes were transformed into the Agrobacteriumtumefaciens strain GV3101, and then into the Arabidopsis hot1-3 (hsp101) mutant(Hong and Vierling, 2001) by the floral-dip method. For affinity purificationsinvolving HSP101-StrepII, transgenic line 1 was used (Supplemental Fig. S1, Aand B).

Confocal Fluorescence Microscopy

Arabidopsis seedlings were grown vertically on solid medium under a LDphotoperiod for 6 d and exposed to different heat stress regimes. Roots weretransferred to 10 mg/mL propidium iodide solution to stain cell walls, beforeimaging using a Fluoview 1000MPE, IX81 motorized inverted confocal fluo-rescence microscope (Olympus). Images were captured using a UPLSAPO 603water lens (NA 1.20) equipped with a Hamamatsu C8484-05G camera. Theexcitation/emission wavelengths were 473/510, 559/575, and 559/619 nm forGFP, RFP, and propidium iodide, respectively. Sequential line scanning wasconducted to reduce bleed-through, line Kalman was used as an averagingfactor, and the pictures were processed using FV10-ASW and ImageJ (https://imagej.nih.gov/ij/index.html). Surface three-dimensional plot renderings ofthe merged fluorescence images and quantification of the foci sizes were de-termined in Image J. The Pearson’s correlation coefficient was calculated incytosolic regions of individual cells and used to determine the strength ofcolocalization.

HSP101-StrepII Affinity Purification

Wild-type (Col-0) andHSP101-StrepII plants were grown on soil for 4 weeksin an environmental chamber, acclimated, and stressed for 2 h at 45°C, or grownon solidmedium for 2weeks, acclimated, and heat stressed for 1 h at 45°C. Afterthe stress, aerial parts of the plants were harvested and homogenized with amortar and pestle with 3 volumes of extraction buffer (40 mM HEPES [pH 8.0],20 mM MgCl2, 5% [w/v] glycerol, 2 mM ATP, and 13 Halt protease inhibitorcocktail without EDTA [Thermo Fisher Scientific]). Homogenates were clarifiedby centrifugation at 10,000 3 g for 20 min, resulting in ;1.5 to 2 mg/mL ofprotein. HSP101-StrepII and bound proteins were enriched with a 0.2 mLgravity flow columns containing StrepTactin-coated resin (IBA Life Sciences)pre-equilibrated with protein extraction buffer. After incubation with the ex-tract, the columns were washed five times with extraction buffer and elutedwith extraction buffer supplemented with 2.5 mM desthiobiotin. The eluate wasmixed with 0.25 volumes of 53 SDS-PAGE sample buffer (8% [w/v] SDS, 46%[v/v] glycerol, 20% [v/v] 2-mercaptoethanol, 250 mM Tris-HCl [pH 6.8], and0.01% [w/v] bromophenol blue), and heated for 2min at 95°C before separationby SDS-PAGE.




https://imagej.nih.gov/ij/index.html







Preparation of Soluble and Insoluble Protein Fractions

Two-week-old seedlings were either untreated or stressed using the statedheat stress regimes described above. In experiments involving MG132[(N-benzyloxycarbonyl)-leucinyl-leucinyl-leucinal] or cycloheximide, seedlingswere transferred to liquid nutrient medium 16 h before the start of the heatstress, and the mediumwas replaced with either control or inhibitor-containingmedium immediately after the 45°C heat treatment. Total extracts were pre-pared by homogenization at ice temperatures in 1.0 mL per 0.7 g fresh weight ofprotein isolation buffer (25 mM HEPES [pH 7.5], 200 mM NaCl, 0.5 mM

Na2EDTA, 0.1% [v/v] Triton X-100, 5 mM «-amino-N-caproic acid, 1 mM ben-zamidine), first using a mortar and pestle and then with a Cole-Parmer PTFEglass tissue grinder. The soluble and insoluble fractions were separated from1.0 mL of total extract by centrifugation at 16,000 3 g for 15 min. The solublefraction was prepared by adding 0.25 volume of 53 sample buffer and heatingfor 2 min at 95°C before separation by SDS-PAGE. The insoluble pelletedfraction was washed by repeated resuspension via pipetting and vortexing inprotein extraction buffer containing 0.1 g of quartz sand (Sigma-Aldrich) andrecollected by centrifugation at 16,000 3 g. After five washes, the final washused 1.0 mL of fresh protein isolation buffer without Triton X-100 followed bycentrifugation. This pellet (designated the insoluble fraction) was resuspendedin 400 mL hot 23 SDS-PAGE sample buffer and clarified by centrifugation at1,500 3 g for 30 s. Samples for MS analysis were directly processed withoutsolubilization in SDS-PAGE sample buffer.

SDS-PAGE and Immunoblot Analysis

Proteins were separated by SDS-PAGE using 7.5% to 15% (w/v) acrylamidegels. For immunoblot analyses, proteins were electrophoretically transferredonto nitrocellulose membrane (Bio-Rad), and the membranes were blockedwith 5% (w/v) fat-free milk and probedwith primary antibodies obtained fromvarious collaborators, Abcam, or Agrisera (identified here by their catalognumbers). All antibodies were raised in rabbits, unless stated otherwise, andantibody dilutions were N-ter HSP101 (1:5,000; AS07 253), HSP70 (1:5,000;AS08 371), GAPDH (Ming-Che Shih, University of Iowa; 1:5,000), RPN1a(1:1,000; Yang et al., 2004), human influenza hemagglutinin (1:5,000; Abcam),CI sHSPs (1:3,000; AS07 255), CII sHSPs (1:3,000; AS07 254), ubiquitin (chicken,1:3,000; Judy Callis, University of California Davis), eEF1Ba (1:3,000; AS10 679),eEF1Bb (1:3,000; AS10 677), and eEF1Bg (1:3,000; AS10 676).

Blots prepared for fluorescent detection were incubated with IRDye 700CWdonkey anti-rabbit antibodies (1:20,000) and analyzed using a Li-Cor OdysseyCLx imager. Ubiquitin conjugates were detected using three antibodies: ubiq-uitin (chicken, primary), rabbit anti-chicken-horseradish peroxidase (second-ary; 1:5,000; Abcam), and IRDye 700CW donkey anti-rabbit antibodies(tertiary). For chemiluminescent assays, blots were incubated withenhancedchemiluminescence (ECL) donkey anti-rabbit IgGs (1:10,000; GE Healthcare),and visualized using the Pierce ECL immunoblot substrate in combination witha Syngene G:box Imaging System. As an alternative for detecting ubiquitinconjugates, proteins were transferred onto Immobilon-P membrane (Millipore)and autoclaved for 20 min on a liquid cycle. After cooling, the membrane wasblocked with 3% (w/v) bovine serum albumin in Tris-buffered saline, incu-bated with primary rabbit anti-ubiquitin antibodies (1:1000; Marshall et al.,2015) and subsequently with goat anti-rabbit secondary antibodies conju-gated to alkaline phosphatase (1:5,000). Proteins were visualized by combining100 mg/mL nitro-blue tetrazolium chloride and 50 mg/mL 5-bromo-4-chloro-3-indolylphosphate (Research Products International) in alkaline phosphatasedevelopment buffer (100 mM diethanolamine, 100 mM NaCl, 5 mM MgCl2, pH9.5) at room temperature for 5 to 30 min, and protein quantification was con-ducted using ImageJ. For the two-dimensional gels, separation in the isoelectricfocusing dimension was performed using 3–10 nonlinear strips (11 cm; GEHealthcare) for 2 h at 150 V, 2 h at 300 V, 5 h at 500 V, and 7 h at 3,500 V. Thesecond dimension was electrophoresed in 12% SDS-PAGE gels at 200 V. Gelswere stained with silver as described (Rabilloud et al., 1988).

Tandem MS

For MS identification of HSP101-StrepII-interacting proteins followingelectrophoresis, gel spots or bands identified by silver staining were excised,destained as previously described (Shevchenko et al., 1996), and cleared of saltand SDS with a 2-D Clean-up Kit (GE Healthcare). Gel pieces were reduced,alkylated, trypsin digested, and analyzed as previously described (McLoughlinet al., 2016).

For identification of HSP101-interacting proteins in bulk, samples wereseparated briefly by SDS-PAGE (;2 cm) using a 4% to 20% gradient gel andstained for protein using the Pierce silver stain designed for MS (Thermo FisherScientific). The region surrounding HSP101 was excised to reduce interference;the remainder of the gel was destained, cut into 13 1-mmpieces, and incubatedin 1.0 mL of water. After 30 min, the water was replaced with 100 mL of 250 mM

ammonium bicarbonate and the gel slices were reduced for 30 min at 50°C byaddition of 20 mL of 45 mM dithiothreitol (DTT), alkylated at room temperatureby addition of 20 mL of 100 mM iodoacetamide, and washed twice in 25 mM

ammonium bicarbonate and 50% (v/v) acetonitrile at room temperature for 1 h.The gel slices were dehydrated with 100% (v/v) acetonitrile, vacuum dried,rehydrated, and digested overnight at 37°C in 50 mM ammonium bicarbonatecontaining 0.3 mg of sequencing-grade modified porcine trypsin and 0.01%ProteaseMAX (Promega). The supernatants were collected, and gel slices werefurther dehydrated for 30 min using 100 mL of 4:1 acetonitrile and 1% formicacid); the two peptide extractions were combined and vacuum dried.

Nano-scale liquid chromatography separation of tryptic peptides was per-formed on a Nano Acquity UPLC system (Waters). Protein digests were loadedonto a 2 cm 3 100 mm C18 Magic 5 mL particle trap column and separated on a75mm3 25 cmC18Magic 3mmparticle analytical columnusing a 1-h linear 5% to35% acetonitrile gradient in 0.1% formic acid at a flow rate of 250 nL/min. MSanalysis of eluted tryptic peptides was performed online using a Q Exactive Plusmass spectrometer (Thermo Fisher Scientific) possessing a Nanospray Flex ionsource (Thermo Fisher Scientific) operated in positive electro-spray ionizationmode. Data-dependent acquisition of full MS scans within a mass range of 300 to1,750mass to charge ratio (m/z) at a resolution of 70,000was performed, combinedwith high-energy collision-induced dissociation fragmentation of the top 10 mostintense peaks at a resolution of 17,500 with an isolation width of 1.6 D. Peptideswere assigned by Mascot (version 1.4.1.14) against the Arabidopsis proteomedatabase (TAIR10_pep_20101214;www.arabidopsis.org), using up to twomissedtrypsin cleavages, parent mass tolerances of 10 ppm, and fragment mass toler-ances of 0.05 D. Carbamidomethylation of cysteines was specified as a staticmodification, while Gln→pyro-Glu modifications, oxidation of Met, andN-terminal acetylation were specified as variable modifications. Peptide identi-fications were accepted if they could be established at .95% probability by thePeptide Prophet algorithmwithin Scaffold (version 4.4.8, Proteome Software Inc.;Keller et al., 2002). Protein identifications were accepted if they could be estab-lished at.95% probability and included at least two different matching peptides.Proteins containing related peptides that could not be differentiated based ontandem MS analysis alone were grouped to satisfy the principles of parsimony.

ForMS analysis of the soluble and insoluble protein fractions, 150 mL of eachsample was precipitated twice in 4:1:3 (v/v) methanol/chloroform/water andcollected by centrifugation. The second pellet was vacuum dried, resuspendedin 100 mL 8 M urea, reduced for 1 h at 22°C with 10 mM DTT, and alkylated with20 mM iodoacetamide for 1 h. The reaction was quenched with 20 mM DTT anddigested overnight at 37°C with 0.5 mg of sequencing-grade modified porcinetrypsin (Promega). Peptides were acidified with 10% trifluoroacetic acid anddesalted using a 100 mL Bond Elut OMIX C18 pipette tip according to themanufacturer’s instructions (Agilent Technologies).

Nano-scale liquid chromatography separation of the tryptic peptides wasperformed using a Dionex Ultimate 3000 Rapid Separation system equippedwith a 75 mm 3 25 cm Acclaim PepMap RSLC 2 mm particle C18 column(Thermo Fisher Scientific) using a 2-h linear 4% to 36% acetonitrile gradient in0.1% formic acid and a flow rate of 250 nL/min. Eluted peptides were analyzedonline by a Q-Exactive Plus mass spectrometer in the positive electrosprayionization mode. Data-dependent acquisition of full MS scans (mass range of380–1,500 m/z) at a resolution of 70,000 was collected, with the automatic gaincontrol target set to 3 x 106, and the maximum fill time set to 200 msec. High-energy collision-induced dissociation fragmentation of the 15 strongest peakswas performed with an intensity threshold of 4 x 104 counts and an isolationwindow of 3.0 m/z, and excluded precursors that had unassigned, 11, 17, 18,or.18 charge states. MS1 scans were conducted at a resolution of 17,500, withan automatic gain control target of 2 3 105 and a maximum fill time of 100 ms.Dynamic exclusion was performed with a repeat count of 2 and an exclusionduration of 30 s, while the minimum MS ion count for triggering the MS2 runwas set to 43 103 counts. Each sample was analyzed in quadruplicate; the firsttwo runs were performed without exclusion, while the third and fourth runswere performed with an exclusion list containing the 5,000 most abundantpeptides that were detected in the first two runs to increase sample coverage(McLoughlin et al., 2018). Raw files with and without exclusion lists weremerged, resulting in two technical replicates per sample. A digest of cyto-chrome c (Thermo Fisher Scientific) was analyzed every 18th run to monitorsensitivity and retention time drift.


McLoughlin et al.


http://www.arabidopsis.org


The resulting tandem MS datasets were queried by Proteome Discoverer(version 2.0.0.802; Thermo Fisher Scientific) against the Arabidopsis proteindatabase (TAIR10_PEP_20101214_UPDATED; http:/www.arabidopsis.org)supplemented with a list of common protein contaminants. Peptides wereassigned by SEQUEST HT (Eng et al., 1994), allowing a maximum of twomissed tryptic cleavages, a minimum peptide length of 6, a precursor masstolerance of 10 ppm, and fragment mass tolerances of 0.02 D. Carbamidome-thylation of Cys and oxidation of Met were specified as static and dynamicmodifications, respectively. A false discovery rate (FDR) of 0.01 (high confi-dence) and 0.05 (medium confidence) validated peptide spectral matches.Label-free quantification based onMS1 precursor ion intensities was performedin Proteome Discoverer with a minimumQuan value threshold set to 0.0001 forunique peptides. The “3 Top N” peptides were used for area calculation (Silvaet al., 2006).

Proteasome Activity Assay

To assay proteasome activity, 2-week-old wild-type or hsp101 seedlingsgrown on solid medium were frozen in liquid nitrogen after various stageswithin the heat stress regime and ground to a fine powder at liquid nitrogentemperatures. Samples were extracted using 1.0 volume of lysis buffer (50 mM

Tris-HCl, pH 7.5, 5 mM MgCl2, 1 mM Na2EDTA, 10% [v/v] glycerol), filteredthrough two layers of Miracloth (Calbiochem), and clarified at 30,000 3 g for20 min at 4°C. Equal amounts of protein (10 mg), as determined by the Bradfordassay (Bio Rad), were used to measure proteasome activity in the presence orabsence of 100 mM MG132. Each sample was incubated for 20 min at 37°C in1 mL of assay buffer (50 mM Tris-HCl, pH 7.0, and 2 mM MgCl2, with 1 mM ATPand 2mM 2-mercaptoethanol added immediately before use) containing 100 mM

of the fluorogenic substrates N-succinyl-leucyl-leucyl-valyl-tyrosyl-7-amino-4-methylcoumarin (Sigma-Aldrich) or (7-methoxycoumarin-4-yl)-acetyl-alanyl-lysyl-valyl-tyrosyl-prolyl-tyrosyl-prolyl-methionyl-glutamyl-(2,4-DNP-(2,3-diaminopropionic acid))-amide [MCA-AKVYPYPME-Dpa(Dnp)-amide,also known as LFP; GenScript]. Reactions were quenched by the addition of1 mL of 80 mM sodium acetate (pH 4.3), and the resulting fluorescence wasmonitored with an excitation wavelength of 365 nm and an emission wave-length of 460 nm. Linearity of activity was confirmed using various concen-trations of protein extract.

Accession Numbers

The rawtandemMSsequence, .msfand .xmlfiles for thewholeproteomedatasets are available in the ProteomeXchange database under accession numberPXD011483 within the PRIDE repository (http://www.proteomexchange.org/). The lists of HSP101 interacting proteins and proteins susceptible to aggre-gation and resolubilization after heat stress can be found in SupplementalDatasets S1 to S4. Sequence data can be found in the GenBank/EMBL data li-braries under the following accession numbers: HSP101 (At1G74310), PAB2(At4G34110), RPN1a (At2G20580), HSP17.4 (At3G46230), HSP17,6II(At5G121020), eEF1Bg1 (At1G57720), ascorbate peroxidase 1 (At1G07890), andprofilin 2 (At4G29350).

Supplemental Data

The following supplementary materials are available in the online version ofthis article.

Supplemental Figure S1. HSP101-GFP is rapidly recruited to cytoplasmicfoci during recovery.

Supplemental Figure S2. HSP101-StrepII functionally replaces HSP101and interacts with proteasomes.

Supplemental Figure S3. HSP101 and the proteasome subunits RPN1aand PAG1 have variable and dynamic cellular localization patterns dur-ing heat stress and recovery.

Supplemental Figure S4. HSP101 and proteasome activities are not influ-enced by each other during heat stress.

Supplemental Figure S5. The rpn1 mutant does not impact HSP101 medi-ated protein disaggregation.

Supplemental Dataset S1. HSP101-StrepII interacting proteins (Gel-based,mature plants).

Supplemental Dataset S2. HSP101-StrepII interacting proteins (Gel-free,seedlings).

Supplemental Dataset S3. Protein solubility raw dataset.

Supplemental Dataset S4. HSP101 clientele solubility.

Supplemental Dataset S5. HSP101 client orthologs in yeast.

Supplemental Video S1. Mobility of HSP101 foci in root cortex cells dur-ing acclimation.

Supplemental Video S2. HSP101 foci formation in root cortex cells afterheat stress.

Supplemental Video S3. Mobility of HSP101 foci in leaf epidermal pave-ment cells during acclimation.

Supplemental Video S4. Foci formation in leaf epidermal pavement cellsafter heat stress.

ACKNOWLEDGMENTS

We thank Dr. Dingzhong Tang for supplying the RPN1a-GFP line, Dr. JudyCallis for theHis6-HA3-IAA1 line and anti-ubiquitin antibodies, Dr. Julia Bailey-Serres for the PAB2-RFP line, and Dr. David C. Gemperline for technicalassistance.

Received March 5, 2019; accepted May 9, 2019; published May 21, 2019.

LITERATURE CITED

Basha E, O’Neill H, Vierling E (2012) Small heat shock proteins anda-crystallins: Dynamic proteins with flexible functions. Trends BiochemSci 37: 106–117

Book AJ, Gladman NP, Lee SS, Scalf M, Smith LM, Vierstra RD (2010)Affinity purification of the Arabidopsis 26S proteasome reveals a diversearray of plant proteolytic complexes. J Biol Chem 285: 25554–25569

Brukhin V, Gheyselinck J, Gagliardini V, Genschik P, Grossniklaus U(2005) The RPN1 subunit of the 26S proteasome in Arabidopsis is es-sential for embryogenesis. Plant Cell 17: 2723–2737

Chen B, Retzlaff M, Roos T, Frydman J (2011) Cellular strategies of proteinquality control. Cold Spring Harb Perspect Biol 3: a004374

Cherkasov V, Hofmann S, Druffel-Augustin S, Mogk A, Tyedmers J,Stoecklin G, Bukau B (2013) Coordination of translational control andprotein homeostasis during severe heat stress. Curr Biol 23: 2452–2462

Cherkasov V, Grousl T, Theer P, Vainshtein Y, Glässer C, Mongis C,Kramer G, Stoecklin G, Knop M, Mogk A, et al (2015) Systemic controlof protein synthesis through sequestration of translation and ribosomebiogenesis factors during severe heat stress. FEBS Lett 589: 3654–3664

Eng JK, McCormack AL, Yates JR (1994) An approach to correlate tandemmass spectral data of peptides with amino acid sequences in a proteindatabase. J Am Soc Mass Spectrom 5: 976–989

Gilkerson J, Kelley DR, Tam R, Estelle M, Callis J (2015) Lysine residuesare not required for proteasome-mediated proteolysis of the auxin/in-dole acidic acid protein IAA1. Plant Physiol 168: 708–720

Glover JR, Lindquist S (1998) Hsp104, Hsp70, and Hsp40: A novel cha-perone system that rescues previously aggregated proteins. Cell 94:73–82

Gomes E, Shorter J (2019) The molecular language of membraneless or-ganelles. J Biol Chem 294: 7115–7127

Hamada T, Yako M, Minegishi M, Sato M, Kamei Y, Yanagawa Y,Toyooka K, Watanabe Y, Hara-Nishimura I (2018) Stress granule for-mation is induced by a threshold temperature rather than a temperaturedifference in Arabidopsis. J Cell Sci 131: jcs216051

Haslbeck M, Vierling E (2015) A first line of stress defense: Small heatshock proteins and their function in protein homeostasis. J Mol Biol 427:1537–1548

Haslberger T, Zdanowicz A, Brand I, Kirstein J, Turgay K, Mogk A,Bukau B (2008) Protein disaggregation by the AAA1 chaperone ClpBinvolves partial threading of looped polypeptide segments. Nat StructMol Biol 15: 641–650

Hjerpe R, Bett JS, Keuss MJ, Solovyova A, McWilliams TG, Johnson C,Sahu I, Varghese J, Wood N, Wightman M, et al (2016) UBQLN2




http://www.arabidopsis.org

http://www.proteomexchange.org/


















mediates autophagy-independent protein aggregate clearance by theproteasome. Cell 166: 935–949

Hong SW, Vierling E (2000) Mutants of Arabidopsis thaliana defective in theacquisition of tolerance to high temperature stress. Proc Natl Acad SciUSA 97: 4392–4397

Hong SW, Vierling E (2001) Hsp101 is necessary for heat tolerance butdispensable for development and germination in the absence of stress.Plant J 27: 25–35

Hong SW, Lee U, Vierling E (2003) Arabidopsis hot mutants define mul-tiple functions required for acclimation to high temperatures. PlantPhysiol 132: 757–767

Jain S, Wheeler JR, Walters RW, Agrawal A, Barsic A, Parker R (2016)ATPase-modulated stress granules contain a diverse proteome andsubstructure. Cell 164: 487–498

Keller A, Nesvizhskii AI, Kolker E, Aebersold R (2002) Empirical statis-tical model to estimate the accuracy of peptide identifications made byMS/MS and database search. Anal Chem 74: 5383–5392

Kim M, McLoughlin F, Basha E, Vierling E (2017) Assessing plant toler-ance to acute heat stress. BioProtoc 7: e2405

Kirstein J, Molière N, Dougan DA, Turgay K (2009) Adapting the ma-chine: Adaptor proteins for Hsp100/Clp and AAA1 proteases. Nat RevMicrobiol 7: 589–599

Kolodziejek I, Misas-Villamil JC, Kaschani F, Clerc J, Gu C, Krahn D,Niessen S, Verdoes M, Willems LI, Overkleeft HS, et al (2011) Pro-teasome activity imaging and profiling characterizes bacterial effectorsyringolin A. Plant Physiol 155: 477–489

Kosmacz M, Gorka M, Schmidt S, Luzarowski M, Moreno JC, SzlachetkoJ, Leniak E, Sokolowska EM, Sofroni K, Schnittger A, et al (2019)Protein and metabolite composition of Arabidopsis stress granules. NewPhytol 222: 1420–1433

Lee J, Kim JH, Biter AB, Sielaff B, Lee S, Tsai FT (2013) Heat shock protein(Hsp) 70 is an activator of the Hsp104 motor. Proc Natl Acad Sci USA110: 8513–8518

Lee S, Sowa ME, Watanabe YH, Sigler PB, Chiu W, Yoshida M, Tsai FT(2003) The structure of ClpB: A molecular chaperone that rescues pro-teins from an aggregated state. Cell 115: 229–240

Lee U, Wie C, Escobar M, Williams B, Hong SW, Vierling E (2005) Geneticanalysis reveals domain interactions of Arabidopsis Hsp100/ClpB andcooperation with the small heat shock protein chaperone system. PlantCell 17: 559–571

Marshall RS, Vierstra RD (2018) Proteasome storage granules protectproteasomes from autophagic degradation upon carbon starvation. eLife7: e34532

Marshall RS, Li F, Gemperline DC, Book AJ, Vierstra RD (2015) Auto-phagic degradation of the 26S proteasome is mediated by the dualATG8/ubiquitin receptor RPN10 in Arabidopsis. Mol Cell 58: 1053–1066

McLoughlin F, Basha E, Fowler ME, Kim M, Bordowitz J, Katiyar-Agarwal S, Vierling E (2016) Class I and II small heat shock proteinstogether with HSP101 protect protein translation factors during heatstress. Plant Physiol 172: 1221–1236

McLoughlin F, Augustine RC, Marshall RS, Li F, Kirkpatrick LD, OteguiMS, Vierstra RD (2018) Maize multi-omics reveal roles for autophagicrecycling in proteome remodelling and lipid turnover. Nat Plants 4:1056–1070

Merret R, Descombin J, Juan YT, Favory JJ, Carpentier MC, Chaparro C,Charng YY, Deragon JM, Bousquet-Antonelli C (2013) XRN4 andLARP1 are required for a heat-triggered mRNA decay pathway in-volved in plant acclimation and survival during thermal stress. Cell Rep5: 1279–1293

Merret R, Carpentier MC, Favory JJ, Picart C, Descombin J, Bousquet-Antonelli C, Tillard P, Lejay L, Deragon JM, Charng YY (2017) Heatshock protein HSP101 affects the release of ribosomal protein mRNAsfor recovery after heat shock. Plant Physiol 174: 1216–1225

Mitrea DM, Kriwacki RW (2016) Phase separation in biology; functionalorganization of a higher order. Cell Commun Signal 14: 1

Mogk A, Bukau B, Kampinga HH (2018) Cellular handling of proteinaggregates by disaggregation machines. Mol Cell 69: 214–226

Nillegoda NB, Kirstein J, Szlachcic A, Berynskyy M, Stank A, Stengel F,Arnsburg K, Gao X, Scior A, Aebersold R, et al (2015) CrucialHSP70 co-chaperone complex unlocks metazoan protein disaggregation.Nature 524: 247–251

Nollen EA, Brunsting JF, Roelofsen H, Weber LA, Kampinga HH (1999)In vivo chaperone activity of heat shock protein 70 and thermotolerance.Mol Cell Biol 19: 2069–2079

Nover L, Scharf KD, Neumann D (1989) Cytoplasmic heat shock granulesare formed from precursor particles and are associated with a specific setof mRNAs. Mol Cell Biol 9: 1298–1308

O’Driscoll J, Clare D, Saibil H (2015) Prion aggregate structure in yeastcells is determined by the Hsp104-Hsp110 disaggregase machinery.J Cell Biol 211: 145–158

Parsell DA, Kowal AS, Singer MA, Lindquist S (1994) Protein disaggre-gation mediated by heat-shock protein Hsp104. Nature 372: 475–478

Perea-Resa C, Carrasco-López C, Catalá R, Turecková V, Novak O, ZhangW, Sieburth L, Jiménez-Gómez JM, Salinas J (2016) The LSM1-7complex differentially regulates Arabidopsis tolerance to abiotic stressconditions by promoting selective mRNA decapping. Plant Cell 28:505–520

Protter DSW, Parker R (2016) Principles and properties of stress granules.Trends Cell Biol 26: 668–679

Queitsch C, Hong SW, Vierling E, Lindquist S (2000) Heat shock protein101 plays a crucial role in thermotolerance in Arabidopsis. Plant Cell 12:479–492

Rabilloud T, Carpentier G, Tarroux P (1988) Improvement and simplifi-cation of low-background silver staining of proteins by using sodiumdithionite. Electrophoresis 9: 288–291

Sable A, Agarwal SK (2018) Plant heat shock protein families: Essentialmachinery for development and defense. J. Biol. Sci. Med. 4: 51–64

Santhanagopalan I, Degiacomi MT, Shepherd DA, Hochberg GKA,Benesch JLP, Vierling E (2018) It takes a dimer to tango: Oligomericsmall heat shock proteins dissociate to capture substrate. J Biol Chem293: 19511–19521

Scharf KD, Siddique M, Vierling E (2001) The expanding family of Ara-bidopsis thaliana small heat stress proteins and a new family of proteinscontaining a-crystallin domains (Acd proteins). Cell Stress Chaperones6: 225–237

Sedaghatmehr M, Thirumalaikumar VP, Kamranfar I, Marmagne A,Masclaux-Daubresse C, Balazadeh S (2019) A regulatory role of au-tophagy for resetting the memory of heat stress in plants. Plant CellEnviron 42: 1054–1064

Seyffer F, Kummer E, Oguchi Y, Winkler J, Kumar M, Zahn R, Sourjik V,Bukau B, Mogk A (2012) Hsp70 proteins bind Hsp100 regulatory Mdomains to activate AAA1 disaggregase at aggregate surfaces. NatStruct Mol Biol 19: 1347–1355

Shevchenko A, Jensen ON, Podtelejnikov AV, Sagliocco F, Wilm M,Vorm O, Mortensen P, Shevchenko A, Boucherie H, Mann M (1996)Linking genome and proteome by mass spectrometry: Large-scaleidentification of yeast proteins from two dimensional gels. Proc NatlAcad Sci USA 93: 14440–14445

Silva JC, Gorenstein MV, Li GZ, Vissers JP, Geromanos SJ (2006) Abso-lute quantification of proteins by LCMSE: A virtue of parallel MS ac-quisition. Mol Cell Proteomics 5: 144–156

Smith DM, Kafri G, Cheng Y, Ng D, Walz T, Goldberg AL (2005) ATPbinding to PAN or the 26S ATPases causes association with the 20Sproteasome, gate opening, and translocation of unfolded proteins. MolCell 20: 687–698

Sorenson R, Bailey-Serres J (2014) Selective mRNA sequestration byOLIGOURIDYLATE-BINDING PROTEIN 1 contributes to translationalcontrol during hypoxia in Arabidopsis. Proc Natl Acad Sci USA 111:2373–2378

Tessarz P, Mogk A, Bukau B (2008) Substrate threading through the cen-tral pore of the Hsp104 chaperone as a common mechanism for proteindisaggregation and prion propagation. Mol Microbiol 68: 87–97

van Leeuwen W, Vermeer JE, Gadella TW, Jr., Munnik T (2007) Visuali-zation of phosphatidylinositol 4,5-bisphosphate in the plasma mem-brane of suspension-cultured tobacco BY-2 cells and whole Arabidopsisseedlings. Plant J 52: 1014–1026

Wallace EW, Kear-Scott JL, Pilipenko EV, Schwartz MH, Laskowski PR,Rojek AE, Katanski CD, Riback JA, Dion MF, Franks AM, et al (2015)Reversible, specific, active aggregates of endogenous proteins assembleupon heat stress. Cell 162: 1286–1298

Wang S, Kurepa J, Smalle JA (2009) The Arabidopsis 26S proteasomesubunit RPN1a is required for optimal plant growth and stress re-sponses. Plant Cell Physiol 50: 1721–1725


McLoughlin et al.



Watanabe YH, Nakazaki Y, Suno R, Yoshida M (2009) Stability of the twowings of the coiled-coil domain of ClpB chaperone is critical for itsdisaggregation activity. Biochem J 421: 71–77

Waters ER (2013) The evolution, function, structure, and expression of theplant sHSPs. J Exp Bot 64: 391–403

Weibezahn J, Tessarz P, Schlieker C, Zahn R, Maglica Z, Lee S, ZentgrafH, Weber-Ban EU, Dougan DA, Tsai FT, et al (2004) Thermotolerancerequires refolding of aggregated proteins by substrate translocationthrough the central pore of ClpB. Cell 119: 653–665

Winkler J, Tyedmers J, Bukau B, Mogk A (2012) Hsp70 targets Hsp100chaperones to substrates for protein disaggregation and prion frag-mentation. J Cell Biol 198: 387–404

Yang P, Fu H, Walker J, Papa CM, Smalle J, Ju YM, Vierstra RD (2004)Purification of the Arabidopsis 26S proteasome: Biochemical and mo-lecular analyses revealed the presence of multiple isoforms. J Biol Chem279: 6401–6413

Yao C, Wu Y, Nie H, Tang D (2012) RPN1a, a 26S proteasome subunit, isrequired for innate immunity in Arabidopsis. Plant J 71: 1015–1028

Zhang L, Liu X, GaikwadK, Kou X,Wang F, Tian X, XinM,Ni Z, SunQ, PengH,et al (2017) Mutations in eIF5B confer thermosensitive and pleiotropic pheno-types via translation defects in Arabidopsis thaliana. Plant Cell 29: 1952–1969

Zhou J, Wang J, Cheng Y, Chi YJ, Fan B, Yu JQ, Chen Z (2013) NBR1-mediated selective autophagy targets insoluble ubiquitinated proteinaggregates in plant stress responses. PLoS Genet 9: e1003196





HSP101 Interacts with the Proteasome and Promotes the ......HSP101 Interacts with the Proteasome and...

Documents

Transcript of HSP101 Interacts with the Proteasome and Promotes the ......HSP101 Interacts with the Proteasome and...