How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr...
-
Upload
alexandra-roy -
Category
Documents
-
view
214 -
download
0
Transcript of How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr...
![Page 1: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/1.jpg)
How many beans make five? How many beans make five? Genetic diversity analysis Genetic diversity analysis
and taxonomy in the legume and taxonomy in the legume OnonisOnonis
Jane KlodaDr D MacDonald, Dr PGD
Dean and Dr S Mayes
![Page 2: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/2.jpg)
Morphology
O. repens O. spinosa
![Page 3: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/3.jpg)
MorphologyOnonis repens subsp maritima
![Page 4: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/4.jpg)
Morphology
Ononis spinosa
![Page 5: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/5.jpg)
Geography
Ononis repens Ononis spinosaPreston, CD, Pearman, DA and Dines, TD (2002) New Atlas of the British and Irish Flora
![Page 6: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/6.jpg)
Cytology
O. repens2n=60
O. spinosa2n=30
Scale bar = 2μm
Morisset (1967) Watsonia 12:145-153
![Page 7: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/7.jpg)
Flow Cytometry
O. spinosa
O. repens
Mode =59
Mode = 30
![Page 8: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/8.jpg)
TaxonomyLinnaeus (1753), Morisset (1967)
O. spinosa L. O. repens L.
Greuter (1986)
O. spinosa subsp. spinosa
O. spinosa subsp. intermedia (Rouy) P. Fourn.
O. spinosa subsp. procurrens (Wallr.) Briq.
O. spinosa subsp. maritima (Dumort.) P. Fourn.
Jarvis, Cannon and Ivimey Cook (1983)
O. campestris G. Koch O. repens L.
Sirjaev (1932)
O. spinosa L. (divided into four subspecies plus 11 varieties)
O. repens L. (divided into 8 varieties)
Stace (1997) O. spinosa L. O. x pseudohircina Schur.
O. repens L. O. repens subsp. maritima
Rouy and Foucaud (1897)
O. campestris Koch et Ziz
O. intermedia Mey
O. procurrens Wallr
O. repens L.
![Page 9: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/9.jpg)
Aims
• How many groups are British Restharrows divided into genetically?
• Are Ononis repens and Ononis spinosa interbreeding?
• How does this compare with samples from continental Europe?
• Do present levels of genetic diversity give cause for concern?
![Page 10: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/10.jpg)
Tools
• Ten microsatellite markers• DNA sequence
– chloroplast – nuclear: coding and non-coding DNA
• 700 plant samples from 40 populations
![Page 11: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/11.jpg)
Collection
sitesKey:
O. spinosaO. repensO. natrixOther
![Page 12: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/12.jpg)
Ten highly polymorphic microsatellites
LocusNo of alleles
Mean alleles per population
1 47 8.53 33 4.6
11 21 4.316 25 6.317 24 3.721 46 5.622 39 8.424 42 7.126 47 8.728 46 6.2
![Page 13: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/13.jpg)
The trouble with tetraploids
10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC08 ACCCTCGCATTACACACACACACACACAAAGGTCGACCGTTCAC
Is indistinguishable from:
10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC08 ACCCTCGCATTACACACACACACACACAAAGGTCGACCGTTCAC08 ACCCTCGCATTACACACACACACACACAAAGGTCGACCGTTCAC
Quantitative scoring: 10,10,10,08 and 10,10,08,08Qualitative scoring: 10,08,00,00 and 10,08,00,00
![Page 14: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/14.jpg)
Principal Coordinates Analysis
• Similarities between cases• Euclidian distance
– xik variable Xk individual i
– xjk same variable individual j
p
kjkikij xxd
1
2)(
![Page 15: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/15.jpg)
PCO British individualsPCO case scores (Euclidean)
repens
Intermedia
maritima
spinosa
Axi
s 2
Axis 1
-0.5
-1.0
-1.4
-1.9
-2.4
0.5
1.0
1.4
1.9
2.4
-0.5-1.0-1.4-1.9-2.4 0.5 1.0 1.4 1.9 2.4
Axis 1 = 10.3 %Axis 2 = 4.2 %
![Page 16: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/16.jpg)
PCO British populations PCO case scores (Euclidean)
repens
spinosa
Axi
s 2
Axis 1
-0.3
-0.5
-0.8
-1.0
-1.3
0.3
0.5
0.8
1.0
1.3
-0.3-0.5-0.8-1.0-1.3 0.3 0.5 0.8 1.0 1.3
Axis 1 = 27 %Axis 2 = 11.5 %
![Page 17: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/17.jpg)
PCO all populationsPCO case scores (Euclidean)
Spanish O. spinosa
British O. repens
German O. repens
British O. spinosa
Spanish O. natrix
Spanish O. diffusa
French O. repens
French O. spinosa
Spanish O. viscosa
Axi
s 2
Axis 1
-0.3
-0.7
-1.0
0.3
0.7
1.0
1.3
1.7
-0.3-0.7-1.0 0.3 0.7 1.0 1.3 1.7
Axis 1 = 19.5 %Axis 2 = 14.8 %
![Page 18: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/18.jpg)
Nei’s genetic distance
)/(log YXXYe JJJDs
xi, yi frequencies of ith allele in populations X and Y
probability that two randomly chosen genes in population X are identical is jx=Σxi
2,
in population Y it is jy=Σyi2
probability of identity for both populations is jxy=Σxiyi.
Jx, Jy and Jxy arithmetic means of jx, jy and jxy, over all loci.
![Page 19: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/19.jpg)
Nei’s genetic distance
1
O.repens 19
O.repens 8
O.repens 1 O.repens 22
O.repens 4 O.repens 5 O.repens 2
O.repens 10 O.spinosa 13
O.repens 12r
O.spinosa 12s
O.repens 6
O.repens 17
O.repens 18
O.spinosa 3
O.spinosa 7 O.spinosa 14
O.spinosa 21
O.spinosa 15
O.spinosa 9
O.spinosa 16
![Page 20: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/20.jpg)
DNA sequencing
• Chloroplast DNA – trnL spacer• Nuclear – β-amyrin
sequence:intron/exon/protein• Nuclear – microsatellite locus 1
flanking region
![Page 21: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/21.jpg)
DNA sequencing
• For O. repens and O. spinosa: – No variation in chloroplast DNA
sequence (except German)– Low variation in β-amyrin sequence, no
species differentiation– High variation in microsatellite flanking
regions, no species differentiation• For other Ononis species, consistent
relationships were revealed
![Page 22: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/22.jpg)
Conclusions
• The ten microsatellites are effective – at differentiating O. spinosa and O.
repens in Britain– for studying genetic diversity in
populations of continental Ononis species
• The DNA sequences are effective– for cross-species comparisons
![Page 23: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/23.jpg)
Conclusions
• Ononis spinosa and O. repens are not freely interbreeding in Britain
• The same pattern appears in France• There is no further genetic
differentiation between ecotypes• O. spinosa and O. repens are similar in
the DNA sequences studied• Levels of genetic diversity are high and
do not give cause for concern
![Page 24: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.](https://reader035.fdocuments.us/reader035/viewer/2022081602/5515cf9d550346e26f8b4586/html5/thumbnails/24.jpg)
Thanks!It is my pleasure to acknowledge:
Dr Sean MayesDr Don MacDonaldDr Peter DeanChris MaddrenDr. François BallouxDr. Johannes Vogel
Cambio and BBSRC