[CANCER RESEARCH 53,227-230, January 15, 1993]

Advances in Brief

Molecular Cloning of a Complementary DNA Encoding a Prostate-specific

Membrane Antigen I

Ron S. Israeli, C. Thomas Powell, William R. Fair, and Warren D. W. Heston z

Urologic Oncology Research Laboratory, Memorial Sloan-Kettering Cancer Center, New York, New York 10021

Abstract

Recently, a novel Mr 100,000 prostate-specific membrane glycoprotein (PSM) has been detected by the prostate-specific monoclonal antibody 7Ell-C5, raised against the human prostatic carcinoma cell line LNCaP. The PSM antigen is expressed exclusively by normal and neoplastic pros- tate cells and metastases. We now report the molecular cloning of a full-length 2.65-kilobase complementary DNA encoding the PSM antigen from a human LNCaP complementary DNA library by polymerase chain reaction using degenerate oligonucleotide primers. Analysis of the com- plementary DNA sequence has revealed that a portion of the coding region, from nucleotide 1250 to 1700, has 54% homology to the human transferrin receptor mRNA. The deduced polypeptide has a putative transmembrane domain enabling the delineation of intra- and extracellu- lar portions of this antigen. In contrast to prostate-specific antigen and prostatic acid phosphatase which are secreted proteins, PSM as an integral membrane protein may prove to be effective as a target for imaging and cytotoxic targeting modalities.

Introduction

Prostate cancer represents the most common malignancy in Amer-

ican males and is the second leading cause of cancer-related death in

the male population (1). The disease has diverse manifestations, from

slow growing, indolent primary lesions to aggressive, refractory met- astatic disease, with a predilection toward bone metastases. PAP 3 was

one of the earliest serum markers for detecting metastatic spread of prostate cancer (1); this marker has been augmented in recent years by

PSA (1). PSA has been shown to correlate with tumor burden, serve

as an indicator of metastatic involvement, and provide an excellent

parameter for following the response to surgery, irradiation, and an-

drogen ablation therapy in patients with prostate cancer. Both of these

proteins are secreted and are readily measured in the serum, as well as

in prostatic secretions. The LNCaP human prostate cancer cell line was established from a metastatic lymph node from a heavily pre-

treated patient with hormone-refractory prostate carcinoma (2). This

cell line serves as the best in vitro model for human prostatic carci-

noma in that it possesses an aneuploid male karyotype, maintains

prostatic differentiation functionality in that it produces PAP and PSA, and expresses a high affinity androgen receptor. Cell membranes were

isolated from these cells and mice were immunized with them to form

hybridomas. A prostate-specific monoclonal antibody was generated using spleen cells of mice immunized with LNCaP cell membranes

and designated 7El 1-C5 (3). The antibody staining exhibited a mem-

Received 10/15/92; accepted 11/25/92. The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

~The MSKCC Microchemistry Core Facility is supported in part by NIH Grant P30-CA-08748. R. S. I. receives partial support from NIH Training Grant CA-09501-07. Genback Accession Number M99487. PSM, Homo sapiens, 2653 base pairs.

2 To whom requests for reprints should be addressed, at Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, Box 334, New York, NY 10021.

3 The abbreviations used are: PAP, prostatic acid phosphatase; PSA, prostate-specific antigen; PSM, prostate-specific membrane glycoprotein; SDS, sodium dodecyl sulfate; cDNA, complementary DNA; MSKCC, Memorial Sloan-Kettering Cancer Center; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction.

brane location with LNCaP cells reacting strongly. Both benign and

neoplastic prostate cells stained positively, with more intense staining

seen with malignant cells. Lymph node and bone metastases also stain

positively with the antibody, with the highest expression seen in

hormone-refractory lesions (4). The epitope of the antibody has been

shown to include a carbohydrate portion of the PSM antigen and the

antigen has an apparent molecular weight of approximately 100,000

on SDS-polyacrylamide gel electrophoresis (5). In this paper, we

report the molecular cloning of a full-length cDNA encoding the Mr

100,000 prostate-specific membrane antigen.

Materials and Methods

Cells and Reagents. The LNCaP, DU-145, and PC-3 cell lines used were obtained from the American Type Culture Collection. Details regarding the development of these cell lines and their characteristics have been published previously (2, 6, 7). Unless specified otherwise, LNCaP cells were grown in RPMI 1640 supplemented with L-glutamine, nonessential amino acids, and 5% fetal calf serum (Gibco-BRL) in a CO2 incubator at 37~ DU-145 and PC-3 cells were grown in minimal essential medium supplemented with 10% fetal calf serum. All media was obtained from the MSKCC Media Preparation Facility. Routine chemical reagents were obtained from Sigma Chemical Com- pany, St. Louis, MO. The modified 7El 1-C5 monoclonal antibody to the PSM antigen (CYT-356) was obtained from Cytogen Corporation, Princeton, NJ.

lmmunopreeipitation of the PSM Antigen. LNCaP cells were starved in methionine-depleted RPMI for 2 h, after which [35S]methionine was added at 100 jaCi/ml and the cells were grown for another 16-18 h. Cells were then washed and lysed by addition of 1 ml of lysis buffer [1% Triton X-100, 50 mM Hepes (pH 7.5), 10% glycerol, 15 mM MgC12, 1 rnM phenylmethylsulfonyl fluoride, and 1 mM [ethylenebis(oxyethylenenitrilo)]tetraacetic acid] and incu- bated for 20 min at 4~ Lysates were precleared by mixing with Pansorbin cells (Calbiochem) for 90 min at 4~ Cell lysates were then mixed with protein A-Sepharose CL-4B beads (Pharmacia) previously bound with CYT- 356 monoclonal antibody and rabbit anti-mouse IgG (Accurate Scientific) for 4 h at 4~ Beads were then washed with 20 rr~ 4-(2-hydroxyethyl)-1-piper- azineethanesulfonic acid (pH 7.5), 150 mM NaCI, 0.1% Triton X-100, 10% glycerol, and 2 mM sodium o-vanadate buffer, resuspended in Laemmli sample loading buffer, and denatured prior to electrophoresing on a 10% SDS-PAGE gel at 10 mA overnight. Gels were dried down at 60~ in a vacuum dryer and autoradiographed for 1 6-24 h at -70~ For the large scale purification of 5-10 jag of PSM antigen, the above procedure was repeated using approximately 6 x 107 LNCaP cells. The immunoprecipitation product was pooled and loaded into two lanes of a 10% SDS-PAGE gel and electrophoresed for 16 h at 10 mA. Proteins were electroblotted onto nitrocellulose membranes and stained with Ponceau red to visualize the proteins.

Peptide Microsequencing. This work was performed with the assistance of the Sloan-Kettering Institute Microchemistry Core Facility: Briefly, the Mr 100,000 PSM antigen band was excised from the membrane, solubilized, and digested proteolytically with trypsin. High performance liquid chromatography was performed on the digested sample using a HPLC Applied Biosystems Model 171C, and clear dominant peptide peaks were selected and sequenced on a modified post-liquid Applied Biosystems Model 477A Protein/Peptide Microsequencer (8). Nine peptides were sequenced ranging in size from 7 to 22 amino acids and all were screened for homology with the Genbank database and found to be unique. A similar technique was used to sequence the amino terminus of the PSM antigen and it was determined that it was in fact blocked, and no protein sequence was obtained.

227

Research. on June 11, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from

MOLECUI.AR CLONING OF eDNA ENCODING PSM

RNA Isolation. Total cellular RNA was isolated from LNCaP cells by standard techniques (9). Polyadenylate-enriched RNA was prepared from total RNA by oligo-deoxythymidylate cellulose chromatography (10).

PCR with Degenerate Primers. Sense and antisense 5'-unphosphorylated degenerate oligonucleotide primers 17 to 20 nucleotides long corresponding to portions of the previously sequenced peptides were synthesized on an Applied Biosystems Model 394A DNA Synthesizer. These primers consisted of mix- tures of 32 to 144 different sequences, in order to account for the degeneracy of the genetic code. PCR (11) was performed on a Perkin-Elmer Model 480 DNA Thermal Cycler, using a cDNA template prepared by reverse transcribing LNCaP mRNA with Superscript reverse transcriptase (Gibco-BRL) according to the manufacturer's recommendations. The PCR profile used was 94~ for 30 s, 45-55~ for 1 rain (varied with the Tm of the primers used), followed by 72~ for 2 min. This was carried out for 30 cycles. Reactions were performed in a total volume of 50 lal containing 5 lal 10• PCR buffer (166 rnM NH4SO4- 670 mM Tris, pH 8.8-2 mg/ml bovine serum albumin), 5 lal 2.5 mM deoxynu- cleotide triphosphate mix, 5 lal Primer mix (0.5-1.0 lag each of sense and antisense primers), 5 lal 100 rnM f3-mercaptoethanol, 2 lal cDNA template, 5 lal 25 rnM MgC12, 2 lal diluted Taq polymerase at 0.5 unit/lal (Promega), and 21 lal dH20.

Cloning of PCR Products. PCR products were cloned into the pCR II plasmid vector using the TA cloning system (Invitrogen). These plasmids were transformed into competent Escherichia coli cells using standard methods (12) and plasmid DNA was isolated using Magic Minipreps (Promega) and screened by restriction analysis.

DNA Sequencing of PCR Products. TA clones were then sequenced by the dideoxy method (13) using Sequenase (United States Biochemical). From 3 to 4- lag of each plasmid were denatured with NaOH and ethanol precipitated. Labeling reactions were carried out according to the manufacturer's recom- mendations using [35]dATP (NEN), and the reactions were terminated as dis- cussed in the same protocol. Sequencing products were then analyzed on 6% polyacrylamide/7 M urea gels run at 120 W for 2 h. Gels were fixed for 20 rain in 10% methanol/10% acetic acid, transferred to Whatman No. 3MM paper, and dried down in a vacuum dryer for 2 h at 80~ Gels were then autorad- iographed at room temperature for 16-24 h. Confirmation of correct clones was determined by reading DNA sequences adjacent to primer sequences looking for predicted peptide sequences that agreed with our peptide se- quences.

eDNA Library Construction/Cloning of Full.Length eDNA. A eDNA library from LNCaP mRNA was constructed using the Superscript plasmid system (Gibco-BRL). The library was transformed using competent DH5-a cells (Gibco-BRL) and plated onto 100-ram plates containing L-Broth plus 100 lag/ml of carbenicillin. Plates were grown overnight at 37~ and colonies were transferred to nitrocellulose filters. Filters were processed and screened fol- lowing techniques described by Grunstein and Hogness (14), using the 1.1- kilobase partial eDNA homologous probe, radiolabeled with [32p]dCTP by random priming (15). Positive colonies were sequenced by the Sequenase, method as described previously.

Northern Analysis of PSM Gene Expression. Analysis of PSM mRNA was performed according to previously described techniques (16). Ten tag of total RNA were denatured and electrophoresed through 1.1% agarose/ formaldehyde gels at 60 mA for 8 h. RNA was then transferred to Nytran nylon membranes (Schleicher and Schuell) by pressure blotting in 10• standard saline-citrate with a Posi-blotter (Stratagene). RNA was cross-linked using a UV Stratalinker (Stratagene) and then baked in a vacuum oven for 2 h at 80~ Blots were prehybridized at 65~ for 2 h and subsequently hybridized with denatured 32p-labeled random-primed eDNA probe. Blots were washed twice in 1 • saline-sodium phosphate-EDTA/0.5% SDS at 42~ and twice in 0.1• saline-sodium phosphate-EDTA/0.5% SDS at 50~ for 20 rain each. Mem- branes were air-dried and autoradiographed for 12-36 h at -70~ with Kodak X-Omat film.

Results

Immunoprecipitation of the PSM Antigen. In agreement with previous results obtained by Western analysis using the CYT-356 monoclonal antibody (5), immunoprecipitation of the PSM antigen

from metabolically labeled LNCaP cells yielded a single protein spe-

cies with an apparent molecular weight of 100,000 on SDS-PAGE

electrophoresis (Fig. 1).

PSM Antigen Peptide Sequencing. Approximately l0 lag of PSM

antigen were purified as described in "Materials and Methods" and we

obtained the following 9 peptide sequences:

1. SLYESWTK 2. SYPDGXNLPGGGVQR 3. FYDPMFK 4. IYNVIGTLK 5. FLYXXTQIPHLAGTEQNFQLAK 6. GVILYSDPADYFAPDGVK 7. AFIDPLGLPDRPFYR 8. YAGESFPGIYDALFDIESK 9. TILFASWDAEEFGXXGSTEWAE

Each of these 9 peptide sequences was found within the predicted amino acid sequence translated from the PSM antigen eDNA with only a few minor changes, presumably due to limitations of the

protein sequencing technology. An attempt was also made to sequence the amino terminus of the PSM antigen but no sequence data could be obtained and it was concluded that the amino terminus of the protein is blocked.

Polymerase Chain Reaction, Degenerate primers designed from peptides 5 and 9 listed above were used in the polymerase chain

reaction to amplify a 1.1-kilobase partial eDNA which was confirmed correct by DNA sequencing by the identification of the above peptide sequences contained within it. This eDNA sequence was screened on the Genbank computer database (Los Alamos, NM) and was found to be unique.

Cloning of the Full-Length PSM Antigen eDNA. Using the 1.1- kilobase partial PSM eDNA as a hybridization probe, 4 cDNAs en- coding the PSM antigen were detected in the LNCaP eDNA library. The complete sequence of the longest eDNA; clone 55A (2.65 kilo- bases) and its deduced protein sequence are shown in Fig. 2. The entire 1.1-kilobase partial eDNA sequence is contained within the

full-length PSM eDNA without changes. The open reading frame is 750 amino acids with a predicted protein molecular weight of 84,000, excluding carbohydrate. The presence of 5 in-frame stop codons be- tween nucleotides -120 and -94 indicates that the ATG at nucleotide + 1 is probably the actual initiator codon. Partial sequence analysis of the other 3 cDNAs indicated that they are identical to clone 55A, except the 5' ends of these cDNAs terminate at different positions

100.5

72.0

43.0

28.5

Fig. 1. Immunoprecipitation of the Mr 100,000 PSM antigen from [35S}methionine- labeled LNCaP cells. Protein markers are shown on the left.

228

Research. on June 11, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from

Fig. 2. Complete nucleotide sequence for the 2653-base pair PSM cDNA and the translated 750- amino acid predicted protein sequence. The trans- membrane domain is double-underlined and poly- adenylation signal is single-underlined. The area of homology with the human transferrin receptor is contained within the boxed region. Potential N- glycosylation sites are indicated with asterisks.

MOLECULAR CLONING OF eDNA ENCODING PSM

-261 C ~ ~ -239 C T C C T O G A G O C A ~ T O T T O C C T C T C T C T C I ~ , ~ G A ~ A G A A a C ~ - ~ a O ( : G A A ~ I ~ . ~ O G G C T - 120

ATG 'I"OG AAT CTC CTT CAC ~ A ACC ~ C T~3 GeT G'1"G GCC ACC GCG CGC ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 90 Hot Trp Asn Lea Leu HLs Glu Thr Asp Set Ale Vel Ale Thr Ale Ax$ A.rj Pro Are Tr~ Lou C~s Ale GI 7 Ale Lea Vel LOU Ale GI~ 30

GGC TTC TTT CTC CTC GGC TTC CTC TTC GGG TOG TTT ATA A.qA TCC TCC AAT GAA GCT ACT ~ A ~ ~ ~ ~ ~ T ~ T A ~ ~ ~ 180 G ~ Phe Pho Lena Leu Gl~r Phe Lou Pho GI~ Tr~ Pho l i e Lye Sot Set Ash Glu Ale Thr As . I I 0 Thr Pro Lye His ASh Hot Lys Ale 60

TTT TTG GAT GAA ~ AAA GCT GAG AAC ATC /LAG AAG TTC TTA TAT AAT TTT Ad~A CAG ATA CCA CAT TTA GCA GG~ ACA GAA CAA AAC TTT 270 Pho Lou ASp GIu Lou Lys Ale Glu ASh l i e Lye Lye Phe Lea TTr A~n Phe Thr Gin 110 Pro His Lena iLLs GIy Thr Glu Gin Ash Phe 90

CAG CTT GCA AAG CAA ATT CAA TCC CAG TOG AAA GAA TTT GGC CTG CAT TCT ~ T GAG CTA GCA CAT TAT GAT GTC CTG TTG TCC TAC CCA 360 Gin Lee Ale Lye Gin 11o Gl.n Set Gin Trp Lye Glu Phe Oly Lea Asp Se t Val Glu Lou Ale His Tyr Asp Val Lee Leu Set TTr Pro 120

AAT AAG ACT CAT CCC AAC TAC ATC TCA AIA ATT AAT GAA GAT GGA AAT GAG ATT TTC AAC ACA TCA TTA 1Tr GAA CCA CCT CCT CCA GGA 450 A~p Lye Thr His Pro Ash T~r l l e Sot 110 110 Ash Glu Asp Gly ASh GLu 11o Phe A ~ Th= Sot Leu Phe Glu Pro Pro Pro Pro Gly 180

TAT GAA AAT GTT TCG CAT ATT GTA (:CA CCT TIC AGT GCT TTC TCT CCT CAA GGA ATG CCA GAG GGC CAT CTA GTG TAT ~ AAC TAT GCA 540 T~r Glu A~n r e 1 Se t ASp I1o Val Pro Fro Phe 8or 118 Phe Set Pro Gin GIy Hot Pro Glu Gly ASp Lee Val T~r Vel ASh Tyr Ale 180

C~A ACT GAA Z TTC TTT AAA T '~ GAA CGG GAC A'J~ AAA ATC AAT TGC TCT ~ ~ A ~ ~ A A ~ ~ ~ IAI ~ ~ ~ ~ ~ 630 A~$ Th: Glu Asp Phe Phe Lye Leu Glu A:8 Asp Hot Lye Xle A~n CTs 8er Gly Lye lLe Val I18 Ale A=i T~r Gly Lye VeX Phe Are 210

GGA AAT AAG GTT A~t AAT GCC CAG CTC; GCA GGG GCC A ~ GGA GTC ATT ~ T ~ ~ ~ ~ ~ ~ T ~ ~ ~ ~ ~ ~ ~ 720 GIy ASn Lye Vel Lye ASh Ale Gin Lou Ale Gly Ale Lys Gly Vel lZe Leu T~r Set Asp Pro Ale ASp Tyr Phe Ale Pro Gly VaL Lys 240

TCC TAT (:CA GAT GGT TGG AAT CTT CCT GGA GGT GGT GTC CAG CGT GGA AAT ATC CTA AAT CTG #,AT 0GT GCA GGA GAC CCT CTC ACA CCA 810 Set Tyr Pro Asp Gly Trp Ash Lea Pro Gly Gly Gly Val Gin At8 GIy A~n l i e Lea Ash Lea Asn Gly Aim Gly Asp Pro Lea 11~ Pro 270

GGT TAC CCA GCA AAT GAA TAT OCT TAT AGG CGT GGA ATT GCA GAG OCT GTT GGT CTT CCA AGT ATT CCT GTT CAT CCA ATT GGA TAC TAT 900 GIy ~ r Pro Ale ASh Glu Tyr Ale Tyr Ar t Ar8 Gly 118 Ale Glu Ale Vel Gly Lou Pro Set 11o Pro Vel HAs Pro I10 Gly Tyr Tyr 300

GAT GCA CAG AAG CTC CTA GAA AAA ATG GGT GGC TCA GCA CCA CCA GAT AGC AGC TGG ~ ~ ~ ~ ~ ~ ~ T ~ ~ T ~ ~ 990 Asp ALl Gin Lye Leu Lea Glu Lye Hot Gly Gly S i r Ale Pro Pro Asp Set Set Trp At8 Gly Se t Leu Lye V81 Pro Tyr Ash Vsl Gly 330

CCT GGC TTT ACT GGA AAC TTT TCT ACA CAA AAA GTC AAG ATG CAC ATC CAC TCT ACC AAT ~ ~ ~ ~ & ~ T ~ ~ T ~ &T& ~ 1080 Pro GLy Phe Thr Gly A ~ Pho Set Thr Gin Lye V*I Lye Met His 11o HLs Set Thr ASh Glu Val Thr At8 110 TTr ASh VeX l i e Oly 360

ACT CTC AGA GGA GCA GTG GAA CCA GAC AGA TAT GTC ATT CTG GGA GGT CAC CGG GAC TCA ~ ~ ~ ~ ~ A ~ ~ ~ ~ ~ 1170 Thr Leu Ar s Gly Ale Vel Glu Pro ASp A~$ Ty= VeX 11o Lee Gly Gly His At8 ASp Set Trp Val Pho GIy GIy l i e ASp Pro Gin Set 390

GGA GCA GCT GTT GTT CAT GAA ATT GTG AGG AGC TTT GGA ACA CTG ~Ut ~ GAA GGG TGG AGA CCT AGA AG~ ACA ATT 111)ITTT GCA AGC 1260 m

Gly &la Ale V i i V i i His Glu 118 Vel Ar 8 Set Fhe GLy Th: Lee Lye Lye Glu Gly Trp Arl~ Pro &e$ A:8 Thr 118 u JLe Phe AXe Set 420 . . . . . too GAT GCA ~ A G~A TTT ~ ~ CTT r rp Asp Ale Glu Glu Ph, Oly Leu Leu

~.T ~ ; T ~ TCT ATA ~ 0GA AAC U n AIa ASp Set Set 11o Glu Gly A~n

L'rG AAA AGC CCT GAT GAA GGC TTT GAA Lou Lye Sot Pro Amp Glu Gly Phe OZu

A ~ ATA AGC AJ~A TTG GGA l ~ r GGA AAT !At8 l l e Set Lye Lea Gly Set Gly Asn

TGG GAA ACA AAC AAA TTC AGC GGC TAT Trp Glu Thr ASh Lys Phe Sot GIy TTr

GGT TCT ACT GAG TGG GCA GAG GAG AAT TCA AGA CTC CTT CAA GAG COT GGC GTG GCT TAT ATT 1350 Oly Set Thr Olu Trp Ale GIu G1u ASh Set Ar t Leu Leu Gin Glu Ar8 Oly Vsl Al.a TTr I I 0 450

TAC ACT CTG AGA GTT GAT TGT ACA CCG CTG ATG TAC AGC TTG GTA CAC AAC CTA ACA A~q GAG 1440 l ~ r Th= Lou At8 Vsl ASp Cys Thr Pro Leu Hot Tyr Ser Leu Val His A ~ Lee Thr Lye Glu 480

GGC AAA TCT CTT TAT GILA AG'r TI~ ACT AAA AAA AGT CCT TCC CCA GAG TTC AGT ~ ATG CCC 1530 Gly Lys Set Lee Tyr Glu Sot Trp Thr Lys Ly8 Sot Pro Set Pro GIu Phe Sot Gly Hot Pro $10

GAT TTT GAG GTG TTC TTC CAA CGA CTT GGA ATT GCT TCA GGC AGA GCA CGG TAT ACT AAA AAT 1620 ! ASp Phe Glu VeX Phe Phe Gin Ar8 Leu GIy I18 Ale Sot Gly Ar8 J~Ls Ar l TTr Thr Lye ASh 540

(:CA CTG TAT CAC AGT GTC TAT GAA ACA TAT GAG TTG GTG GAA AAG TTT TAT GA~CCA A1'G ~ 1710 Pro Leu Tyr His So= Val Tyr GLu Thr Tyr Glu Lou Val Glu Lye Phe Tyr ~AS Pro Hot Phe 570

AAA TAT CAC CTC ACT GTG OCC CJ~ GTT C ~ G G A Lys Tyr H18 Lena Thr VeX Ala Gin V81 A~ 8 Gly

GCT GTA GTT TTA AGA /LAG TAT OCT GAC AAA ATC Ala r e1 VeX Lena Ar$ Lye Tyr Ale Asp Lye 11o

TCA CTT TTT TCT GC& GTA AAG M,T TTT ACA GAA Set Lea Fhe Sot Ale Val Ly8 A~u Phe Thr Glu

TTA ~ ATG ATG AAT GAT CAA CTC ATG TTT CTG Lou Ar 8 Her Hot ASn ASp Gin Lea Hot Pho Lea

ATC TAT GCT CCA AGC AOC CAC AAC AAG TAT ( ~ ILo Tyr At* Pro b r Set His Ash Lys TTr AII~

~ 'T TCC AAG OCC TGG GGA GAA GTG AAG AGA CAG Pro

TAA __.

GGG ATG GTG TTT GAG CTA GCC AAT TCC ATA GTG CTC CCT Gly Hot Val Pho Glu Lou AIa ASh Set l i e Vet Lee Fro

TAC AGT ATT TCT ATG AAq CAT CCA CAG GAA ATG AAG ACA TTr Sot 11o Set Hot Lye His Pro Gin Glu Hot Lye Thr

AT'f GC']r TCC ~ TTC .4G"r ~ .~l~,?~A CTC CAG GAC 1"I'1' GAC 11o Ale Sot Lye Phe S o t Glu Are Lou Gin Asp Phe Asp

Glu Arli Ale ~ e I18 ASp Pro Lea Gly Lea Pro Asp Ar$

GAG ~ ~ (::CA Gffak ATT TAT ~ T ~ ~ 'l'fT GAT Gty GLu Ser Pho Pxo Gly I l o Tyr Asp Ale Leu Pbe Asp

ATT TAT GTT OCA OCC TTC ACA GTG CAG (~..A OCT OCA ~

TTT CAT ~ CGA GAT TAT 1800 l~e Asp Cys Ar 8 Asp Tyr 600

T ~ AGT GTA TCA TTT GAT 1890 Ty: Set Val Set Phe Asp 630

AAA AGC AAC CCAATAGTA 1980 Lye Set Ash Pro I l o Val 660

CCT TTT TAT A~GCAT GTC 2070 Pro Phe T y r A r s His Val 690

ATTGAAAGCAAAGTGGAC 2160 I1o GLu Set Lye Vsl Asp 720

~ ~ GAAGTA ~ 2250 Sot Lye k ta Trp Gly Glu Val Lye Are Gln I10 Ty~ Val Ale Ale Phe Thr Val GIn Ale Ale AIm Glu Thr Leu Set Glu re1 Ale 750

GAGGATTCTTTAGAGAATCCGTATTGAA~ATGTCACTCAGAAAGAATCGTAATGGGTATATTGATAAATTTTA~AAT~HATATTTGAAAT~TA~A 2368

TATATAAAAAAAAAAAAAAAAA~q2393

between the initiator codon and the 5' end of clone 55A. The se- quences of two of these additional cDNAs extend upstream of the five in-frame stop codons; thus these stop codons are probably part of authentic PSM RNA and not a 5' artifact sequence. This provides further evidence that the coding region of PSM mRNA begins at nucleotide + 1 of the sequence shown in Fig. 2.

Although the predicted protein sequence does not contain an NH2- terminal hydrophobic signal sequence, a segment of hydrophobic residues from amino acids 20 through 43 forms a putative transmem- brane domain (17). The major portion of the protein is COOH terminal to the transmembrane domain and contains multiple potential N-gly- cosylation sites. Greater than 54% homology on the nucleic acid level from nucleotides 1250 through 1700 within the coding region has been demonstrated with the human transferrin receptor mRNA by means of a Genbank homology search. Similar homologies have been identified for the chicken and rat transferrin receptor mRNAs. The entire full-length cDNA sequence has been compared to the Genbank database and confirmed to be unique.

Expression of the PSM Gene. Northern analysis using the PSM cDNA probe has revealed expression of a 2.8-kilobase message in the LNCaP cell line, with no expression in the DU-145 and PC-3 cell lines (Fig. 3). Expression of the PSM antigen appears to be limited to

prostatic tissues, both benign and neoplastic, with no detectable expression in any of the nonprostatic tissues and cell lines tested to date. 4

Discussion

Organ-specific antigens permit insight into the processes that occur uniquely within a particular tissue. The prostate is a very unusual organ in that with aging most organs atrophy, whereas the prostate gland almost invariably hypertrophies and in a very high percentage of cases develops a malignancy. A cell model that has proven valuable in fostering our understanding of prostatic cancer has been the LNCaP prostate cancer cell line. These cells express markers characteristic of prostatic epithelial cells such as PSA and PAP as well as a functional androgen receptor. These cells were used to immunize mice and resulted in the generation of the 7El 1-C5 monoclonal antibody and its subsequent modified derivative, CYT-356, which we used to clone the PSM cDNA. The PSM antigen appears to have many interesting and potentially significant properties. The presence of 3 arginine residues at the NH2-terminal end of the putative transmembrane domain sug- gests that the PSM protein is a type II integral membrane protein, with

4 Unpublished data.

229

Research. on June 11, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from

MOLECULAR CLONING OF cDNA ENCODING PSM

9 . 5 . _ . .

7.5__.

4.4_._

1 2 3 transferrin or another ligand and possibly facilitates metastatic spread is presently being addressed in our laboratory. Transferrin may prove to be more than a transport molecule, because apotransferrin has been shown to be mitogenic to some tumor cells (21).

Finally, we are presently developing new antibodies directed against peptide epitopes of the PSM antigen which are predicted to be highly antigenic, with the expectation that these may be used to develop serum enzyme-linked immunosorbent assays, aid in tissue diagnoses, and serve as new agents for the immunotherapy of ad- vanced, hormone-refractory prostate cancer.

2.4

1.4___

Fig. 3. Autoradiogram of Northern analysis revealing expression of 2.8-kilobase PSM message unique to the LNCaP cell line (Lane 1) and absent from the DU-145 (Lane 2) and PC-3 cell lines (Lane 3). RNA size ladder is shown on the left (kilobases), and 28S and 18S rRNA bands are indicated on the right.

a short NH2-terminal region on the cytoplasmic side of the membrane and a large COOH-terminal domain on the extracellular side (17). This prediction is supported by the finding that removal of basic residues from the NH2-terminal side of type II integral membrane protein transmembrane domains can reverse the orientation of such proteins in the membrane (18).

As an integral membrane protein unique to prostatic epithelial cells, the antigen or perhaps a specific PSM ligand may serve as an excellent site for use in the imaging and/or targeting of metastatic deposits. Indeed, current studies suggest that the CYT-356 antibody may be useful in imaging extraprostatic deposits of cancer cells (5). The CYT-356 antibody recognizes an epitope that is at least in part car- bohydrate. It is possible that a unique peptide-recognizing antibody may have less nonspecific binding and that, additionally, multiple antibodies recognizing multiple areas of the PSM antigen may en- hance the ability to image and treat metastatic prostate cancer.

PSA expression tends to decrease in hormone-refractory disease and bone metastases, while the expression of PSM appears to increase, again implying that it may provide an attractive target for therapy and diagnosis.

The homology to the human transferrin receptor is an interesting finding. It is of interest that the expressed prostatic secretions of patients with prostate cancer are enriched with respect to their content of transferrin and that prostatic cancer cells are rich in transferrin receptors (19). It was previously hypothesized that the microenviron- ment of bone would serve to stimulate prostatic cancer cell growth. This was recently observed to be the case, inasmuch as bone stroma cell transferrin dramatically stimulated the growth of metastatic pro- static cancer cell lines (20). In these experiments, the androgen re- ceptor-negative DU-145 and PC-3 cell lines were used and LNCaP cells were not examined. Whether the PSM antigen interacts with

230

Acknowledgments

We wish to thank Dr. Kevin Kelley of the Mount Sinai School of Medicine and Dr. Lewis Freedman of MSKCC for their helpful discussions and sugges-

tions throughout this work, Dr. Paul Tempst and Scott Geromanos of the

MSKCC Microchemistry Core Facility for their outstanding protein sequenc-

ing work and technical advice, and Robert Huryk for his expert technical

assistance in the laboratory.

References

1. Chiarodo, A. National Cancer Institute roundtable on prostate cancer; future research directions. Cancer Res., 51: 2498-2505, 1991.

2. Horoszewicz, J. S., Leong, S. S., Kawinski, E., Karr, J. P., Rosenthal, H., Chu, T. M., Mirand, E. A., and Murphy, G. P. LNCaP model of human prostatic carcinoma. Cancer Res., 43: 1809-1818, 1983.

3. Horoszewicz, J. S., Kawinski, E., and Murphy, G. P. Monoclonal antibodies to a new antigenic marker in epithelial cells and serum of prostatic cancer patients. Anticancer Res., 7: 927-936, 1987.

4. Axelrod, H. R., Gilman, S. C., D'Aleo, C. J., Petrylak, D., Reuter, V., Gulfo, J. V., Saad, A., Cordon-Cardo, C., and Scher, H. I. Preclinical results and human immu- nohistochemical studies with 9~ a new prostatic cancer therapeutic agent. AUA Proceedings. Abstract 596, 1992.

5. Abdel-Nabi, H., Wright, G. L., Gulfo, J. V., Petrylak, D. P., Neal, C. E., Texter, J. E., Begun, F. P., Tyson, I., Heal, A., Mitchell, E., Purnell, G., and Harwood, S. J. Monoclonal antibodies and radioimmunoconjugates in the diagnosis and treatment of prostate cancer. Semin. Urol., 10: 45-54, 1992.

6. Stone, K. R., Mickey, D. D., Wunderli, H., Mickey, G. H., and Paulson, D. E Isolation of a human prostate carcinoma cell line (DU-145). Int. J. Cancer, 21: 274-281, 1978.

7. Kaign, M. E., Narayan, K. S., Ohnuki, Y., and Lechner, J. F. Establishment and characterization of a human prostatic carcinoma cell line (PC-3). Invest. Urol., 17: 16-23, 1979.

8. Tempst, P., and Riviere, L. Examination of automated polypeptide sequencing using standard phenyl isothiocyanate reagent and subpicomole high-performance liquid chromatographic analysis. Anal. Biochem., 183: 290-300, 1989.

9. Glisin, V., Crkvenjakov, R., and Byus, C. Ribonucleic acid isolated by cesium chlo- ride centrifugation. Biochemistry, 13: 2633-2637, 1974.

10. Aviv, H., and Leder P. Purification of biologically active globin messenger RNA by chromatography on oligo-thymidylic acid cellulose. Proc. Natl. Acad. Sci. USA, 69: 1408-1412, 1972.

11. Lee, C. C., Wu, X., Gibbs, R., Cook, R. G., Muzny, D. M., and Caskey, C. T. Generation of cDNA probes directed by amino acid sequence: cloning of urate oxidase. Science (Washington DC), 239: 1288-1292, 1988.

12. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol., 166: 557-580, 1983.

13. Sanger, F., Nicklen, S., and Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, 74: 5463-5467, 1977.

14. Grunstein, M., and Hogness, D. S. Colony hybridization: a method for the isolation of cloned DNAs that contain a specific gene. Proc. Natl. Acad. Sci. USA, 72: 3961-3965, 1975.

15. Feinberg, A. P., and Vogelstein, B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem., 132: 6-13, 1983.

16. Rave, N., Crkvenjakov, R., and Boedtker, H. Identification of procollagen mRNAs transferred to diazobenzyloxymethyl paper from formaldehyde agarose gels. Nucleic Acids Res., 6: 3559-3567, 1979.

17. von Heijne, G. Transcending the impenetrable: how proteins come to terms with membranes. Biochim. Biophys. Acta, 947: 307-333, 1988.

18. Parks, G. D., and Lamb, R. A. Topology of eukaryotic type II membrane proteins: importance of N-terminal positively charged residues flanking the hydrophobic do- main. Cell, 64: 777-787, 1991.

19. Keer, W. P., Koslowski, J. M., Tsai, Y. C., Lee, C., McEwan, R. N., and Grayhack, J. T. Elevated transferrin receptor content in human prostate cancer cell lines assessed in vitro and in vivo. J. Urol., 143: 381-385, 1990.

20. Rossi, M. C., and Zetter, B. R. Selective stimulation of prostatic carcinoma cell proliferation by transferrin. Proc. Natl. Acad. Sci. USA, 89: 6197-6201, 1992.

21. Sirbasku, D. A., Pakala, R., Sato, H., and Eby, J. E. Purification of an equine apotransferrin variant (thyromedin) essential for thyroid hormone dependent growth of GH~ rat pituitary tumor cells in chemically defined culture. Biochemistry, 30: 7466-7477, 1991.

Research. on June 11, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from

1993;53:227-230. Cancer Res   Ron S. Israeli, C. Thomas Powell, William R. Fair, et al.   Prostate-specific Membrane AntigenMolecular Cloning of a Complementary DNA Encoding a

  Updated version

  http://cancerres.aacrjournals.org/content/53/2/227

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/53/2/227To request permission to re-use all or part of this article, use this link

Research. on June 11, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from