High Throughput Cloning and Expression of NESG Targets
description
Transcript of High Throughput Cloning and Expression of NESG Targets
![Page 1: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/1.jpg)
1
High Throughput Cloning and Expression of NESG Targets
Jan 2006
Dongyan Wang
![Page 2: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/2.jpg)
2
Cloning and Expression Procedures (1)
*Design and order primers
*PCR& Gel extraction
Restriction Digestions
Digestion cleanup
Drying and filtration
Restriction Digestion
*Ligation
Transformation into XL-Gold cells
*Colony screeningPCR & gel
@Miniprep(Archive DNA and GS)
*Miniprep culture
* : Data entry into Excel spreadsheet@ : Enter target set into Platemaster : Steps involving Robot
Fragments cloned into vectors
![Page 3: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/3.jpg)
3
Transformation into Magik cells
Take gel pictures (or scan and upload) and score.
*Run samples on SDS-PAGE gels, stain and de-stain.
IPTG induction
Harvest, sonication, and sample preparation
MJ9 culture and dilution
@Expression LB culture(Archive GS)
Upload to Spine
Competition analysis and decision making
*Data entry @Verify Archive
*Transfer to fermentation
Cloning and Expression Procedures (2)
Fragments cloned into vectors
![Page 4: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/4.jpg)
4
Work Flow of a Single Process
![Page 5: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/5.jpg)
5
>ER84 atgtcccgagtctgccaagttactggcaagcgtccggtgaccggtaacaaccgttcccacgcactgaacgcgactaaacgccgtttcctgccgaacctgc actctcaccgtttctgggttgagagcgagaagcgttttgtcaccctgcgc gtatctgctaaaggtatgcgtgtaatcgataaaaaaggcatcgatacagt
tctggctgaactgcgtgcccgtggcgaaaagtactaa
Primers for Target sets-2 weeks
Target sequence in FASTA format:
Copy & Paste
Primer seq. output
SR430,pET 21-23C,F,NdeI,66,34,172,,ATCGATCGCATATGATGAGCCGCTATGCAAAATG
SR430,pET 21-23C,R,XhoI,66,36,172,,TGACTCTCGAGTATAATACTCTTCCATTTGTTTCCC
![Page 6: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/6.jpg)
6
A1 SR430,pET 21-23C,F,NdeI,66,34,172,,ATCGATCGCATATGATGAGCCGCTATGCAAAATG
Well Target Plasmid Dir Sequence Size(bp)Ext RE Int RE
A1 SR430 pET 21-23C F ATCGATCGCATATGATGAGCCGCTATGCAAAATG 172 NdeI none
B1 SR482 pET 21-23C F ATCGATCGCATATGTTGAACATTGAAAGGCTCACTAC 352 NdeI HindIII
Primer data copied from Primer pri’mer is pasted into Excel worksheet:
Primer data parsed into different fields
Well TargetSize (bp)
MW (KD) Ext RE Site
Internal RE Sites Vector PCR Lig Dig
A1 SR430 172 7.1 NdeI/XhoI none 21-23C BamHI
B1 SR482 352 13.7 NdeI/XhoI HindIII 21-23C BamHI
Target data entered into Set Summary Worksheet
Same data used to order primer synthesis in 96-well format from Operon
![Page 7: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/7.jpg)
7
1 set = 96 targets
PCR and purification of target fragments (1)Day 1-2
96 pairs of gene-specific primers
And
Genomic DNA template
96 PCR reactionsPCR products separated
On 2% agarose gel
Well TargetSize (bp)
MW (KD) Ext RE Site
Internal RE Sites Vector PCR Lig Dig
A1 SR430 172 7.1 NdeI/XhoI none 21-23C yes BamHI
B1 SR482 352 13.7 NdeI/XhoI HindIII 21-23C no BamHI
Results entered into Excel worksheet
Gel pic storage
Comment field:reason/size
![Page 8: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/8.jpg)
8
PCR and purification of target fragments (2)
Day 1-2
Bands of right sizes are manually cut and put into a
96-well block. Gel slices melted at 55 C.Automated gel extraction using Qiagen robot.
![Page 9: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/9.jpg)
9
Problems that may arise
Some organism’s genome is GC rich. Requires GC-
rich PCR kit and longer elongation times.No PCR products or wrong size.Robot malfunctions.
Target sequence GC%
![Page 10: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/10.jpg)
10
Day 2-3
5’ and 3’ restriction endonuclease digestions for
directional cloning.2 overnight 37 C reactions.
Restriction Digestions
Well TargetSize (bp)
MW (KD) Ext RE Site
Internal RE Sites Vector PCR Lig Dig
A1 SR430 172 7.1 NdeI/XhoI none 21-23C yes BamHI
B1 SR482 352 13.7 BamHI/XhoI HindIII 21-23C no EcoRII
Graphic tools for helping locating different RE/Lig wells
![Page 11: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/11.jpg)
11
Cleaning and filtrationDay 4
Automated digestion cleaning up using Qiagen
robot.Lyophilize the plate in speed vacuum till dry.Resuspend in dH2O.Purify DNA using 96-well Centri-Sep plate.
Explore non Centri-Sep methods
![Page 12: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/12.jpg)
12
LigationDay 4-5
Ligation reaction at 16 C overnight with: Cut and purified target DNA PCR product. Appropriate precut pET vectors. T4 DNA ligase.
65 C 10 min to inactivate the ligase.Ligation digestion at 37 C for 1 hr.
Well TargetSize (bp)
MW (KD) Ext RE Site
Internal RE Sites Vector PCR Lig Dig
A1 SR430 172 7.1 NdeI/XhoI none 21-23C yes BamHI
B1 SR482 352 13.7 BamHI/XhoI HindIII 21-23C no EcoRII
Graphic tools for helping locating different RE/Lig wells
![Page 13: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/13.jpg)
13
Transformation into XL-gold
Day 5-6
Mix XL-gold competent cells with digested ligated
DNA on ice. Heat shock at 42 C 1 min.Incubate with SOC 37 C 1 hr.Plate on LB/Amp plates.Incubate overnight 37 C.
96 LB/Amp plates
![Page 14: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/14.jpg)
14
Result of transformation into XL-gold
Day 6
Primer Well # of colonies
A1 5
B1 0
C1 20
D1 12
E1 20
F1 20
G1 20
H1 20
Enter the number of colonies of each target into worksheet
![Page 15: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/15.jpg)
15
Colony screening (1)Day 6-7
Pick 2 colonies per target, resuspend in water. PCR reactions with T7 primers, which anneals to
vector sequences flanking the inserts.Run PCR products on 2% agarose gel.Select clones with right size.Enter result into Excel worksheets.
WellPrimerWell Target
Clone # Plasmid Full Name
Expected Size (bp)
Right Size?
Picked?
A1 A1 SR430 1 21-23C SR430-21.1 372 no no
B1 A1 SR430 2 21-23C SR430-21.2 372 yes yes
C1 B1 SR482 1 21-23C SR482-21.1 552 yes yes
D1 B1 SR482 2 21-23C SR482-21.2 552 yes yes
![Page 16: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/16.jpg)
16
Colony screening (2)
For the targets with only one or no positive clones,
pick more clones from the XL-gold transformation
plate. Repeat colony PCR.Enter result into Excel worksheets.Repeat these steps if needed.
Extra1-2 days
WellPrimerWell
Clone # Plasmid Full Name
Expected Size (bp)
Right Size? Picked?
A1 A1 3 21-23C SR430-21.3 372 no no
B1 A1 4 21-23C SR430-21.4 372 yes yes
C1 E8 3 21-23C SR465-21.3 555 yes yes
D1 E8 4 21-23C SR465-21.4 555 yes yes
192 clones
![Page 17: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/17.jpg)
17
Miniprep cultureDay 7-8
Fill out the Miniprep Setup Excel worksheet. Inoculate 10 ul of the right construct into LB/Amp.Shake 37 C overnight.
WellCol
PCR#Col PCR
Well TargetSize (bp)
Size (KD)
Ext RE Sites
Clone # Plasmid Full Name
A7 1 A7 SR478 238 9.53 NdeI/XhoI 1 21-23C SR478-21.1
B7 1 B7 SR478 238 9.53 NdeI/XhoI 2 21-23C SR478-21.2
C7 3 A2 SR423 379 14.7 NdeI/XhoI 3 21-23C SR423-21.3
4 X
![Page 18: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/18.jpg)
18
MiniprepDay 8
Obtain archiving labels for the DNA and glycerol
stock of the target set. Make duplicate glycerol stock plates of the miniprep
culture according to the archive SOP.Spin to collect cell pellets.Miniprep using Qiagen robot.Archive DNA plates according to the archive SOP.
Barcode?
![Page 19: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/19.jpg)
19
Transformation into expression cells
Day 8-9
Mix 1 ul of miniprep DNA with Magik competent
cells on ice.Heat shock 42 C 1 min.Plate on 24-well LB/Amp/Kan/Glucose plates.Incubate overnight at 37 C.
8 X 24-well platesMiniprep DNA
![Page 20: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/20.jpg)
20
Small scale expressionand inductions (1)
Day 9-11
Inoculate 1 colony from the Magik transformation
plate into 0.5 ml LB/Amp/Kan/Glucose.Shake 6 hr 37 C.Make glycerol stock plate of the culture according
to the archive SOP.Inoculate 0.5 ml MJ9 mediaShake overnight at 37 C.
2 Xcolonies
![Page 21: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/21.jpg)
21
Small scale expressionand inductions (2)
Day 9-11
Read OD600 of the overnight MJ9 culture. Select a
few wells and dilute 1:10. Inoculate 2 ml MJ9 with the overnight culture so
that the staring OD600 is 0.1 to 0.2..Grow at 37 C until OD600 reaches 0.5 to 0.7.Induce with IPTGShake overnight at 17 C.
2 X 8 X
![Page 22: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/22.jpg)
22
Expression proteinsample preparations
Day 11
Spin plates to collect cell pellets.Add Lysis buffer to resuspend cells and keep on ice.Sonicate for 40 min.Save sonicated TOTAL lysate sample (T).Spin to collect SUPERNATANT sample (S).Add protein gel loading buffer to the samples.
2 X 2 X(T) s + (S) s
= 384 samples
![Page 23: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/23.jpg)
23
SDS-PAGE gelsDay 12-13
Gel #261 Gel #262
Lane Well Target Name MW Expression SolubilityCompetition
analysis
1 --- MW Ladder --- --- --- ---
2 A7 SR478-21.1 9.5
3 B7 SR478-21.2 9.5
4 C7 SR423-21.3 14.7
5 D7 SR423-21.2 14.7
6 E7 Size? Size?
7 F7 SR501-21.1 15.0
8 G7 SR417-21.1 14.7
9 H7 SR417-21.2 14.7
10 A8 SR461-21.1 9.9
11 B8 SR461-21.2 9.9
12 C8 SR452-21.1 14.8
![Page 24: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/24.jpg)
24
SDS-PAGE gelsDay 12-13
Heat samples at 72 C for 10 min.Run samples on SDS-PAGE gels.Wash and stain gels.De-stain gels.Take gel pictures/scan.
384 samples 36 SDS-PAGE gels
96-well Ni-NTA plate?
![Page 25: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/25.jpg)
25
Data Management Overview
Analyze SDS-PAGE gels, score expression and
solubility.Enter data into Excel worksheet.Verify that all the wet reagents are archived.Upload cloned constructs and small scale
expression data into SPiNE. Perform competition analysis.Transfer to fermentation.
![Page 26: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/26.jpg)
26
Gel #261 Gel #262
Lane Well Target Name MW Expression SolubilityCompetition
analysis
1 --- MW Ladder --- --- --- ---
2 A7 SR478-21.1 9.5 5 5
3 B7 SR478-21.2 9.5 5 5
4 C7 SR423-21.3 14.7 4 3
5 D7 SR423-21.2 14.7 4 3
6 E7 Size? Size?
7 F7 SR501-21.1 15.0 3.5 0
8 G7 SR417-21.1 14.7 2 2
9 H7 SR417-21.2 14.7 2 2
Expression and Solubility Scores
Gel picture storage
![Page 27: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/27.jpg)
27
Spine construct upload
TARGET
NEW ENTR
Y ResearcherINSERT
TYPE VECTOR TAGN-Tag
SequenceC-Tag
Sequence CLONED ON
ER229 -15.1 Dongyan Wang Full Protein pET15 N-HexHis mghhhhhhsh 8/30/2005
ER229 -15.2 Dongyan Wang Full Protein pET15 N-HexHis mghhhhhhsh 8/30/2005
ER228A -15.1 Dongyan Wang Subsequence pET15 N-HexHis mghhhhhhsh 8/30/2005
![Page 28: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/28.jpg)
28
Spine small scale expression upload
TARGETNEW
ENTRY Researcher Exp.onHOST
STRAINGrowth. TEMP
Induct.
Temp MEDIAExpr. Scale EXPR PHASE Solubility
SR482-21.1 -ss
Dongyan Wang 7/25/2005
BL21(DE3)+Magic 37 17 MJ9 Analytical 5
soluble+inclusion 5
SR482-21.2 -ss
Dongyan Wang 7/25/2005
BL21(DE3)+Magic 37 17 MJ9 Analytical 5
soluble+inclusion 5
SR490-21.1 -ss
Dongyan Wang 7/25/2005
BL21(DE3)+Magic 37 17 MJ9 Analytical 3
inclusion body 0
![Page 29: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/29.jpg)
29
Gel #261 Gel #262
Lane Well Target Name MW Expression SolubilityCompetition
analysis
1 --- MW Ladder --- --- --- ---
2 A7 SR478-21.1 9.5 5 5 selected
3 B7 SR478-21.2 9.5 5 5 selected
4 C7 SR423-21.3 14.7 4 3 purified
5 D7 SR423-21.2 14.7 4 3 purified
6 E7 Size? Size?
7 F7 SR501-21.1 15.0 3.5 0
8 G7 SR417-21.1 14.7 2 2 cloned
9 H7 SR417-21.2 14.7 2 2 cloned
10 A8 SR461-21.1 9.9 3 3 Crystallized
11 B8 SR461-21.2 9.9 0 0
12 C8 SR452-21.1 14.8 4 4 PDB e-09
Competition analysis
Link/Buttons
![Page 30: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/30.jpg)
30
Transfer to FermentationEnter into Excel worksheet the targets that satisfy
the following criteria:EXS >=8No PDB/PDBH hits or E value >= 0.01.Other criteria?
Transfer to fermentation
WellPrimer
Well TargetOriginal Size
(bp)
Original Size (KD)
Ext RE Sites
Clone # Plasmid Full Name
A7 A4 SR478 238 9.526667 NdeI/XhoI 1 21-23C SR478-21.1
C7 B4 SR423 379 14.69667 NdeI/XhoI 3 21-23C SR423-21.3
G7 D4 SR417 379 14.69667 NdeI/XhoI 1 21-23C SR417-21.1
![Page 31: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/31.jpg)
31
Target set statistics
Example Set Result:
Working Step # Failed #Success
Selected 0 96
PCR 3 93
Cloning 2 91
Expression 11 80
Solubility 15 65
Low Solubility 15 50
PDB Hit 5 45
Fermentation 45
![Page 32: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/32.jpg)
32
Summary of a target’s life in the NESG cloning pipeline
![Page 33: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/33.jpg)
33
Target Selected
PCR success
Cloned Not cloned
Clone #1 Clone #2
Primers designed
PCR failure
Target sequence
Primer data
Ligation well Ligation dateTransformation colony #
•Well locations & Clone #•Col PCR gel pics•Miniprep well locations•Miniprep culture•Archive locations
PCR result, gel picture
Data Recorded at Each Step
Die Step
Success
![Page 34: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/34.jpg)
34
Clone of target
Expression failure Expressed
Insoluble Soluble
Low solubility High solubility
E value <=0.01 E value >0.01
Fermentation
•Expression transformation results•Expression date•Archive locations•SDS-PAGE gel setup•SDS-PAGE gel pictures•Gel scores•Competition analysis results•Fermentation list
Data Recorded
Die Step
Success
![Page 35: High Throughput Cloning and Expression of NESG Targets](https://reader035.fdocuments.us/reader035/viewer/2022070410/56814634550346895db340df/html5/thumbnails/35.jpg)
35
It would be nice to have in PLIM
Target data recorded at each working step.Search by target name.Statistics of target results.Graphic tool to help working with 96-well plates. Notes of problems during the processesLink to archiving.Buttons for PDB competition analysis (current e-
mail search).