1477-3627/03/$ – see front matter ©2003 Elsevier Science Ltd. All rights reserved. PII: S1477-3627(03)02383-3

World-wide genome projects have led tothe identification of thousands of uncharac-terised open reading frames (ORFs). Conse-quently, turning sequence information intofunction is the major challenge of the post-genomic era and is well depicted by the factthat, for example, 44% of the 225 genes onhuman chromosome 21 represent ORFsencoding putative proteins with unknownfunction [1]. To accomplish the task of func-tional annotation in a reasonable time, theelucidation of gene function must be carriedout on a large, genome-wide scale openingnew opportunities for the fields of functionalgenomics and proteomics. This new dimensionin life sciences demands the development ofhigh-throughput approaches to systematicallyanalyse the proteome and to provide a linkbetween the sequence deposited in the genomeand the function exerted by the protein [2].

There are several technologies available forthe study of protein expression levels andprotein–protein interaction, such as antibodyarray technology, the two-hybrid system andtwo-dimensional gel-electrophoresis (2DE)combined with mass spectrometry (reviewedin [3–6]). Here, we concentrate on the use ofsurface display technologies – more specificallyphage display.

Phage display technologySurface display technology is defined as asystem in which the cloned gene and its cor-responding protein are physically linked. Itallows efficient handling of large molecularlibraries in small volumes, and target-specificisolation of specific binders is achieved byexploiting the discriminative power of affinityselection during consecutive rounds of en-richment in a process called biopanning. Themost prominent surface display technologyis M13-based bacteriophage surface display,first reported by George P. Smith in 1985(Box 1). In phage display, the linkage betweenthe genotype and the phenotype is obtainedby direct or indirect fusion of the recombi-nant protein to a coat protein of a bacterio-phage. The viral coat of M13 contains onlyfive different proteins, one major and fourminor proteins in ~2700 and five copies,respectively. Fusion to all five coat proteinshas been exploited for phage display, re-sulting in monovalent or multivalent dis-play of combinatorial libraries, as recentlyreviewed [7].

The most common application is the N-ter-minal fusion to protein pVIII or protein pIII.However, pVIII is primarily suitable forpeptides of around eight amino acids only,because larger inserts hamper the phagecapsid assembly process [8]. By contrast, pIIItolerates larger polypeptide inserts of up to300 amino acids but only if phage infectivityis not disturbed. To overcome size limitationsand to present proteins as large as 86 kDa [9],phagemid vectors are in use, which needhelper phage superinfection. The helperphage contributes all wild-type proteinsnecessary for phage assembly and infectivityand, therefore, the desired recombinant peptide/protein is presented on the phage surface as amixture with wild-type proteins.

▼

High-throughput applications of phagedisplay in proteomic analysesZoltán Konthur and Reto Crameri

Zoltán KonthurMax Planck Institute for

Molecular GeneticsIhnestrasse 73

D-14195 BerlinGermany

e-mail: konthur@molgen.mpg.deReto Crameri

Swiss Institute of Allergy andAsthma Research (SIAF)

Obere Strasse 22CH-7270 Davos

Switzerland

261

TARGETS Vol. 2, No. 6 December 2003

One of the key issues of molecular biology at the beginning of the

21st century is the disclosure of complex interactions involved in cellular

function. The availability of sequenced genomes sets the stage for

functional analysis of the proteins. However, this task demands new

technologies to warrant the characterisation of interactions at a higher

pace. Here, we discuss phage display as one of the emerging technologies

to address functional relationships between proteins and give examples of

its use by focusing on antibody generation for protein expression analysis,

discovery of novel disease markers and therapeutic targets, and mapping

of protein–protein interactions.

www.drugdiscoverytoday.com

REVIEWS

RESEARCH FOCUS

Next to bacteriophage M13, other – alternative – phagedisplay systems are in use, such as the lytic phage l, T7 orT4 (reviewed in [10]). Potential advantages of these systemsare (1) the possibility to clone desired molecules (e.g. cDNAexpression products as C-terminal fusion), and (2) thatafter lysis, the presentation of, for example, globular orhydrophobic proteins unable to cross the host membraneessential for M13 surface display might be allowed.Moreover, (3) the presented proteins can be displayed inhigher copy on the surface without size limitation.Drawbacks of alternative systems can be (1) the increaseddisplay of mis-folded proteins due to lack of disulfide bondformation occurring only in the periplasm of the host (e.g.during M13 phage assembly), (2) cumbersome handlingdue to large genomic vectors, and (3) the necessity tosubclone DNA inserts to allow analyses at the protein level.

In conclusion, alternative phage display systems canenable the presentation of subsets of expression productson the viral coat not displayed by M13-based technologyand, therefore, the different display concepts should beregarded as complementary.

Selection of specific bindersDuring biopanning, the procedure used to select interactingpartners, specific binders against a target of choice areenriched from a phage display library by consecutivecycles of incubation, washing, amplification and re-selectionof bound phage. For this purpose, the target molecule isimmobilised on a solid support either by non-specific ad-sorption to the surface or by specific spatially orientatedbinding via a tag sequence (e.g. the poly-histidine tag).Several materials have been used as solid supports for

panning, including immunotubes [11], microtitre platewells [12], magnetic beads [13] and molecules blotted ontomembranes [14,15]. Also, selection on whole cells is estab-lished [16]. The support-bound target is incubated with apreviously batch-amplified unselected phage displaylibrary (~1012 phage particles) and, after a defined periodof time, the surface is washed extensively to remove unboundphage. Remaining phage particles containing enrichedtarget-specific phage are eluted and amplified by infectingtheir bacterial host. After propagation, the selection cycleis repeated several times, until an increase in binding activ-ity is observed using an appropriate monitoring assay, forexample enzyme-linked immunosorbent assay (ELISA; [13]),fluorometric microvolume assay technology (FMAT; [17])or chromophore-assisted laser inactivation (CALI; [18]).FMAT is comparable to traditional ELISA and utilisesmagnetic beads as the solid support. For the readout, onlybead-bound fluorescence is measured by scanning with ahelium/neon laser and not by measuring the backgroundfluorescence of the solution. This enables single-step detec-tion of binding molecules without the need for extensivewashing steps as in ELISA [19]. CALI is primarily a screeningmethod to determine the function of the targeted mol-ecule and is in situ-based. The ligand is labeled with a dyethat emits free radicals when irradiated by laser or light,which in turn modifies the ligand-bound target moleculeand inactivates its function. The damage caused by thefree radicals is spatially limited to 15–40 Å and, hence,unbound ligands do not cause significant damage [20].Eventually, single clones are picked from selection roundsdisplaying the best signal to noise ratio and re-screened forspecificity. The identity of an individual binder is deter-mined by either sequencing, as with artificial ligands,and/or by hybridisation to genome-wide DNA arrays, asdescribed below.

Biopanning is necessary, because phage display librariesare highly diverse, containing between 106 and 1011 differ-ent ligands in a population of >1012 phage molecules. Thismeans that in a library with a diversity of 108, every singleclone is represented at ~100–1000 copies, since routinely1–10% of phage molecules display a recombinant proteinon its surface when utilising phagemid systems. To date,several groups have overcome this limitation by usingnovel helper phage (e.g. the hyperphage), which ensures ahigher percentage of fusion protein display [21]. Hence,selection of a binding molecule by phage display is oftencompared to ‘finding a needle in a haystack’ [22].

Because an infected host cell and its progeny produceonly 104–105 phage molecules, more than one round ofselection is necessary to enrich a specific binder above thebackground of non-cognate phage. Generally, the ratio

262

TARGETS Vol. 2, No. 6 December 2003

www.drugdiscoverytoday.com

REVIEWS

RESEARCH FOCUS

Box 1. Landmarks of M13 phage display

Over the years, phage display has been continuously fine-tuned and developed into a versatile tool in recombinantDNA technology. With more than 1700 publications inPubMed listed under the search phrase ‘phage display’ since1985, this is a success story.

1985 First report of phage display; display of peptides [82]1988 Development of phagemid vectors [83]1990 Phage display of antibody fragments [84]1993 Display of cDNA library expression products [38]1994/1995 Development of ‘phage two-hybrid’ methods

(SIP/SAP; [85,86])1996 First in vivo biopanning experiment [87]1998 Phage display vector as gene transfer vehicle [88]1999 Combination of phage display with high-density

arrays [47]2001 Automated phage display selection [12,28]

between specific and non-specific binders after one roundis initially two or three orders of magnitude and is overcomeby sequential rounds of selection. However, increasingrounds of selection also means a gradual disadvantageousloss of diversity in the target-specific phage population(Fig. 1). Specifically binding molecules compete for theselection target and ligands showing desired characteristicsin respect of binding, but having unfavourable propertieswith respect to growth and/or presentation efficiency onthe phage surface, or specific phage with lower affinities,are outcompeted and lost.

Phage display in proteomic analysesThe number of phage display applications to investigateproteome complexity has been steadily growing andcan be divided into two major groups; the generation ofartificial ligands used as investigative tools, and the selec-tion of natural binding partners for the identification ofprotein–protein interaction.

Artificial ligandsMolecular display libraries are believed to be an almost un-limited source for the generation of artificial ligands againstany given target, because vast numbers of rearrangementsand modifications can be performed on the ligands bymolecular biological means. By spotting these ligands ontoplanar surfaces, protein arrays or chips can be generated,which eventually offer the possibility to monitor changesthroughout any process in life on a proteome-wide scale [23].

Many phage display formats of artificial ligands havebeen developed, ranging from linear and conformationallyconstrained peptide libraries obtained by introduction ofdisulfide bonds (reviewed in [24]), recombinant antibodyfragments (reviewed in [25]) and antibody mimetics, suchas Protein A-based affibodies [26] or lipocalin-based anti-calins [27].

Antibody fragments (Box 2) are the most promising andprominent candidates for a fast application in proteome-wide analyses, since antibodies are the most commonlyused biochemical reagents for the detection of proteins.However, for the elucidation of complex protein mixtures,large numbers of different antibodies are necessary and,hence, generation of antibodies on a large scale has to berealised. Multiple concepts for high-throughput generationof antibodies have been proposed. (1) The generation ofrecombinant phage display antibodies by automatedselection against recombinant proteins expressed in high-throughput format in microtitre plates [12,28,29]. (2) Liuet al. proposed the generation of antibodies on a proteome-wide scale by phage display selection on blotted 2DE-gelsonto membrane [15] and, (3) the generation of antibodies

by animal mass immunisation with recombinant proteinswas proposed [30,31]. While both systems, phage displayand animal immunisation, have their distinct advantagesand disadvantages, one has to keep in mind that incontrast to the limited amount of serum available fromimmunised animals, phage display-derived molecules rep-resent an endless source of antibodies.

Antibody arrays and phage displayThe publications describing utilisation of antibody arrayswere recently surveyed [32]. In future, antibody arrays willundoubtedly have a tremendous impact on the functionalanalysis of cellular protein activity and will allow quantita-tive monitoring of protein expression levels in normalversus diseased state. Next to linking gene expressionprofiling with protein expression data, these ligand arrayswill have a major impact on disease diagnosis and diseaseprogression monitoring [33].

263

TARGETS Vol. 2, No. 6 December 2003

www.drugdiscoverytoday.com

REVIEWS

RESEARCH FOCUS

Figure 1.The ‘trade off ’ in phage display selection.With increasingrounds of selection, the number of specific phage grows and finallyout-competes the unspecific phage always present. However, this isachieved at the expense of the diversity of specific binders in theenriched library and, hence, biopanning has to be carefully designed.

TARGETS

Pha

ge p

artic

les

Rounds of selection

Unspecific phage

Specific phage

Diversity

10e4

10e8

10e12

1 2 3 40

Box 2:Antibody fragments used in phage display

Antibody fragments used in phage display are either of scFv(single-chain Fv) or Fab format (reviewed in [13]). Generally,three types of antibody libraries can be distinguished: immu-nised, naive and synthetic (reviewed in [25,89,90]).The pri-mary difference between these libraries is their origin.Whilethe first libraries were mainly derived from the immune reper-toire of immunised animals, most naive and synthetic librariesare of human origin. They have been derived either fromgermline immunoglobulin sequences [91,92] or are graftedfrom a single antibody molecule by randomising the comple-mentarity determining regions by PCR [93]. Libraries ofhuman origin are used to obtain therapeutic molecules withimproved tolerance by the patients, and several phage displayderived antibodies are now applied in clinical trials [94].

However, to achieve this ambitious goal, multiple obsta-cles have to be overcome. For instance, during a survey ofmultiple surface materials, Angenedt et al. [34] showed thatseveral monoclonal antibodies are non-functional whenattached on surfaces such as glass slides. Furthermore,monitoring of additional parameters apart from thesurface chemistry, such as composition and pH of buffers,blocking reagents and storing conditions will be of crucialimportance for reproducibility of the data, which is pivotalfor large-scale applications [35].

In vitro antibody selection methods such as phage dis-play might have an advantage over polyclonal or mono-clonal antibodies: they can be selected under the optimalconditions needed for immobilisation and, hence, will in-crease the success rate of antibodies suitable for microarraygeneration. As demonstrated by de Wildt and colleagues[36], during screening of single chain antibody fragmentsderived from a synthetic antibody phage display libraryspotted on a PVDF membrane macroarray, only functionalscFv remain attached to the membrane.

Yet, attachment to solid support might not be necessary.In the past few years, nanovial technology has emerged.Borrebaeck and colleagues [37] have shown that scFvs canbe deposited into silicon nanovials by piezoelectric dis-pensing and retain functionality to perform binding assayswith fluorescently labeled sample material. However,future experiments will have to prove the reproducibilityand robustness of this concept.

Natural ligands as novel disease markersIn recent years, screening of cDNA expression productsdisplayed on phage surface has become more and morepopular. This concept became primarily available with thedevelopment of vectors allowing the cloning of cDNAlibraries as C-terminal fusions to phage coat proteins.C-terminal fusion is desirable because cDNA inserts obtainedafter poly(A)-priming and reverse transcription always con-tain translation stop codons and prevent the synthesis ofhybrid coat proteins in N-terminal fusion vectors. In M13,the phage coat proteins pIII and pVIII are presenting theirN-terminus to the solvent and the integrity of their C-ter-minus is believed to be obligatory for efficient phage as-sembly. Therefore, Crameri and Suter [38] used a ‘trick’ anddesigned a vector (pJuFo) that utilises the strong naturalinteraction of the leucine-zippers to indirectly displaycDNA expression products on the phage surface. For thispurpose, the leucine zipper domain of Jun is cloned at the5¢ terminus of the phage coat protein pIII and the leucinezipper domain of Fos is cloned as an N-terminal fusion tothe cDNA expression product to be displayed. Both domainsare expressed from the same phagemid vector to produce

zipper-decorated interaction partners. During phage as-sembly, the Jun leucine zipper is fixed on the phage surfaceand heterodimerises with a Fos-decorated cDNA product,establishing the physical link between genotype and phe-notype (reviewed in [39]). Nevertheless, cDNA libraryexpression products were also displayed on M13 as C-ter-minal fusions with pVI [40] and also as N-terminal fusionsto pIII. However, this can be done only with fragmentedgene libraries with or without prior screening of the cDNAfor ORFs by, for example, b-lactamase activity [41,42]. Nextto M13, alternative phage display vectors for cDNA expres-sion product-presentation are in use, based on fusion togpD or gpV in phage land gp10B in phage T7. Table 1 in-cludes a selection of cDNA libraries displayed on the dif-ferent type of phage.

The main application of cDNA phage display libraries hasbeen the identification of natural binders to antibodiesderived from patients suffering from allergy, autoimmunediseases or certain cancers (Table 1). However, phage dis-played cDNA libraries are also increasingly used for theidentification of protein–protein interaction partners. Forexample, Yamamoto and colleagues [43] identified carbohy-drate-binding proteins from a HELA cell line cDNA library,Danner and Belasco [44] selected RNA-binding proteins froma human brain cDNA library and, more recently, Hertveldt et al.[45] used a genomic DNA expression library of Saccharomycescerevisiae to identify proteins interacting with Gal80p.

DNA arrays and phage displayDuring selection of binding partners by phage display, thecomplexity of the initial library gradually decreases withevery round of biopanning (Fig. 1). However, the totalnumber of amplified phage particles remains constantthroughout all cycles of biopanning and it can be con-cluded that only the ratio between cognate and non-cognatephage is changing in the library. This, in turn, is influencedby many aspects: first, the heterogeneity of the selectiontarget, for example, patient serum; second, external factorssuch as growth condition, for example, temperature andaeration; and third, biological constraints of the phagedisplay systems, such as expression level, codon usage andpresentation efficiency [46].

As a direct consequence, the analysis of the enrichedlibrary by picking a small number of clones and subjectingthem to DNA restriction analysis or random sequencingwill not reveal gene products derived from rare mRNAspecies or poor performers. Therefore, we have proposed asystematic approach to overcome this limitation by intro-ducing array technology readily available from genomicprojects and subjecting the enriched library to robotics-based high-throughput screening [47,48].

264

TARGETS Vol. 2, No. 6 December 2003

www.drugdiscoverytoday.com

REVIEWS

RESEARCH FOCUS

The protocol comprises multiple steps, which can befurther divided into two major areas: the generation ofenriched libraries in arrayed format (Fig. 2), and theassessment of the complexity by production of DNA(micro-) arrays and interative hybridisation experiments(Fig. 3).

Generation of arrayed librariesFirst, a cDNA library is cloned from the source of choiceinto a suitable display vector and a large number of pri-mary clones is generated, covering the expected sourcecomplexity at least 5–10 fold. From the transformants,phage particles are propagated, which are used in the first

265

TARGETS Vol. 2, No. 6 December 2003

www.drugdiscoverytoday.com

REVIEWS

RESEARCH FOCUS

Table 1. A selection of cDNA expression product libraries displayed on bacteriophage surface

Source Display type Refs

MouldsAlternaria alternata cDNA M13 – pJuFo [59]Aspergillus fumigatus cDNA M13 – pJuFo [60]Cladosporium herbarum cDNA M13 – pJuFo [50]

Coprinus comatus cDNA M13 – pJuFo [61]Mallassezia furfur cDNA M13 – pJuFo [62]Saccharomyces cerevisiae genomic DNA M13 – pIII (N-term) [45]

PlantsCelery cDNA M13 – pJuFo [47]

Chloroplast cDNA M13 – pJuFo [47]Peanut cDNA M13 – pJuFo [63]Wheat germ cDNA M13 – pJuFo [64]

HumanHELA cell line cDNA λ – gpV [65]

HELA cell line cDNA T7 [43]Human B-cell cDNA M13 – pJuFo [66]Human breast cancer cell lines cDNA M13 – pVI [67]

Human breast carcinoma cDNA T7 [68]Human brain cDNA T7 [69]Human brain cDNA λ – gpD [70]

Human colorectal cancer cell line cDNA M13 – pVI [71]Human foetal kidney cDNA T7 [72]Human invasive ductal breast carcinoma cDNA T7 [73]

Human Leukocytes cDNA M13 – pIII (N-term) [42]Human lung cDNA M13 – pJuFo [74]Human lung cDNA T7 [44]Human prostate cancer cDNA M13 – pJuFo [75]

Non-humanDust mite Lepidoglyphus destructor cDNA M13 – pJuFo [76]Human parasite Necator americanus cDNA M13 – pVI [77]Parasite Ancylostoma caninum cDNA M13 – pVI [40]

Mouse B cell cDNA M13 – pJuFo [78]Mouse embryo cDNA λ – gpD [70]

Prokaryotes and virusesBorrelia burgdorferi chromosomal DNA M13 – pJuFo a

Escherichia coli chromosomal DNA M13 – pJuFo [79]

Klebsiella pneumoniae chromosomal DNA λ – gpD [80]Hepatitis C virus cDNA λ – gpD [81]aMueller, M., personal communication.

round of the biopanning procedure. During biopanning,three to five consecutive rounds of affinity selection areperformed on an immobilised target (e.g. patient serum)and from the last round, infected host cells are plated ontosquare 23 ·23 cm agar plates to obtain 3000–5000 singlecolonies per plate. The plates are subjected to visualisationof the colonies by a CCD camera mounted on the pickingarm of a robot (e.g. the Q-bot, GENETIX) to choose a fewthousand well-separated single clones to be arrayed intomedium pre-filled and bar-coded 384-well microtitreplates, as recently described [17]. The plates are placed forincubation at 37°C over night and the next day replicationof the cultures in microtitre plates generates several workingcopies of the library. Master plates as well as the workingcopies are stored at –80°C until further use.

Assessment of enriched library complexityThe arrayed library is an ideal starting point for high-throughput analysis. We have chosen to adopt one of theprobably most robust analytical tools available: hybridisation

of DNA probes. Before this, however, DNA arrays have to begenerated by PCR-amplification of the cDNA inserts presentin each individual clone of the arrayed library. Followingamplification, the PCR products are purified and, finally,robotically gridded onto a solid support, such as modifiedmicroscope glass slides to obtain microarrays unequivocallydefined by the exact coordinates of the clones from the ar-rayed library. Because of the small volume of PCR productneeded to produce an array, multiple copies can be gener-ated. Thereafter the identical arrays can be subjected to hy-bridisation with individual dye-conjugated probes. Probescan be either already known binders (e.g. known genesequences) or a set of randomly chosen clones from the en-riched library. For each individual probe, a hybridisation isperformed, resulting in a distinct binding pattern, which isentered in a scoring list to identify identical clones. Addingup the lists, the total number of hybridisation positive andhybridisation negative clones is obtained and from thenegative clones a new set of probes is randomly selected forfurther hybridisations. This cycle is repeated, until virtually

266

TARGETS Vol. 2, No. 6 December 2003

www.drugdiscoverytoday.com

REVIEWS

RESEARCH FOCUS

Figure 2. General selection scheme for cDNA expression-products displayed on phage surface. (a) Generation of a phage display library by mRNAextraction, cDNA cloning into phagemid vector and phage propagation. (b) Affinity-driven enrichment of target-specific binders in several rounds ofbiopanning. (c) Generation of arrayed target-specific libraries suitable for high-throughput screening by picking and arraying individual clones intomicrotitre plates.

TARGETS

Target immobilisation

Librarycloning

cDNAsynthesis

Phagepropagation

Binding

Washing

Elution

Picking and arrayingof individual clones

Phagepropagation

Binder verification by high-throughput screening

3 – 5 x

(a)

(b)

(c)

all clones have given a hybridisation signal, or the numberof non-hybridised clones is acceptably low for direct se-quencing. Sequencing representative clones of all distincthybridising patterns obtained will reveal the identity ofputative interaction partners for the selection target usedduring enrichment of the phage display library. Specificbinding, however, will have to be re-evaluated by biochemi-cal methods utilising techniques such as ELISA, Dot blotexperiments and BIAcore measurements [49].

We have successfully applied this technology to severalenriched phage-displayed cDNA libraries originating from dif-ferent sources, such as moulds (Aspergillus fumigatus, Coprinuscomatus, Cladosporium herbarum and Malassezia furfur),peanut and human lung tissue [50]. Screening six differentcDNA libraries and ~38,000 individual clones from the fifthround of selection, we were able to identify 233 different pro-teins, of which 47 represented already known and publishedallergens and 186 are new putative allergenic molecules [48].

In the case of the enriched A. fumigatus cDNA library,we screened 13,440 single clones by only three rounds ofhybridisation, starting with 12 known sequences in the

first round and a total of 153 sequencing reactions. Thisscreen resulted in 67 potentially novel allergens of which52 were cloned, expressed and tested for specific IgE-bindingto serum from a panel of A. fumigatus sensitised patients.All proteins were reactive with serum IgE and, therefore,encode allergenic proteins [51]. This complex exampleclearly shows the potential of phage display combinedwith high-density array technology for the fast discoveryof protein–protein interaction networks.

In future, screening cDNA libraries derived from fullysequenced organisms, such as the human genome, will becompleted even faster. More and more whole-genome DNAarrays will become available. Applying enriched libraries tothese chips, it will be possible to trace the diversity of all hy-bridising probes in one step, because the coordinates in awhole genome array correspond with known gene sequences.

Phage display in mapping protein–protein interactionnetworksScreening for interaction partners with single target molecules(e.g. Oct-4) or parts thereof [52], such as the cytoplasmic

267

TARGETS Vol. 2, No. 6 December 2003

www.drugdiscoverytoday.com

REVIEWS

RESEARCH FOCUS

Figure 3. Scheme for the elucidation of the complexity of enriched cDNA expression-product phage display libraries. (a) Enriched libraries are used togenerate DNA (micro-)arrays. (b) Identification of different inserts. First, labeled probes are generated by PCR from a single clone and hybridised to thecDNA array of the enriched library. Positive signals represent identical clones and are added to a positive hit list.A negative clone is selected, and theprocedure is consecutively repeated until all clones are listed in the hit list and hence, the total complexity is revealed. (c) Evaluation of identifiedproteins by biochemical means. Proteins in the hit list (interaction database) are expressed and re-tested for specific binding by, for example, ELISA,Dot Blot analysis and BIAcore measurements.

TARGETS

X rounds

Arrayed enriched libraries

Interactiondatabase

Insert PCR

Generation ofDNA arrays

DNA hybridisation

Choosingnegatives

Probegeneration

by PCR

DNA sequencing

GGGTCCCTAACTCTCCTATGCA

-50

0

50

100

150

200

250

300

350

400

450

-200 -140 -80 -20 40 100 160 220 280 340 400 460 520 580 640 700Tim e s

RU

BIAcore

Dot blot

ELISA

Scoring

(a)

(b)

(c)

peptide tail of the epidermal growth factor receptor(EGFR; [53]), can already be performed. However, genome-or proteome-wide studies with phage display are justemerging. Two different approaches are currently applied,the use of random peptide libraries and of domain libraries.Screening with random peptide libraries on targets con-taining core structural binding motifs such as SH3 or WWdomains reveals potential peptide recognition modules,which can be mapped back to complete genome sequencesand therefore, used to identify potential binding partners[54], whereas screening domain libraries works the otherway round. Screening with a peptide recognition motif,such as a proline-rich peptide sequence derived from anatural protein, allows the identification of differentbinding molecules or domains with varying affinity andselectivity [55].

Yet, in general, predictions of interaction partnersshould be regarded with caution until verification bybiochemical methods is completed. In fact, even theS. cerevisiae protein–protein interaction network mappedby two different groups with yeast two-hybrid screens showsonly a small overlap of identified interactions [56,57].

The interpretation of genome-wide interaction analysesdeals, independently from experimental setups and intrin-sic problems related to experimental procedures, with hugeamounts of data. Success in this area will strongly dependon the availability of appropriate bioinformatic tools al-lowing a correct evaluation of huge datasets [58], on ourability to identify and eliminate false positive hints, andon our understanding and correct interpretation of com-plex biological systems. The real challenge posed by globaldiscovery platforms consists in the development of suit-able correlation-related methods to turn large amounts ofraw measurement data into function, which is essential tounderstand biological phenomena.

ConclusionPhage display has a wide variety of applications in pro-teomic and functional genomic approaches, increasingthe speed at which complex functional mechanisms aredissected and conceptualised.(i) Phage display can be used for fast generation of artifi-

cial ligands for proteomic applications, such as proteinexpression profiling.

(ii) Screening of cDNA expression products displayed onphage is a versatile tool for the identification of proteinsinvolved in immune response in, for example, allergy,autoimmunity and certain types of cancer.

(iii) Screening with random peptide or domain librariesfollowed by computational analysis at a whole genomelevel can identify potential interaction partners.

However, these networks need careful interpretationand validation by additional, independent methods.

(iv) Finally, the combination between robot technologydeveloped for genomic applications and phage displayfully unleashes the selective power of this affinity-driven in vitro selection technology.

AcknowledgementWe thank Prof. H. Lehrach, Prof. K. Blaser and Dr. G. Walterfor continuous support and fruitful discussions. Work atSIAF was supported by the Swiss National ScienceFoundation grant no. 31–63381.00.

References1 Hattori, M. et al. (2000) The DNA sequence of human chromosome 21.

Nature 405, 311–3192 Blackstock, W.P. and Weir, M.P. (1999) Proteomics: quantitative and

physical mapping of cellular proteins. Trends Biotechnol. 17, 121–1273 Lal, S.P. et al. (2002) Antibody arrays: an embryonic but rapidly

growing technology. Drug Discov. Today 7, S143–S1494 Uetz, P. (2002) Two-hybrid arrays. Curr. Opin. Chem. Biol. 6, 57–625 Auerbach, D. et al. (2002) The post-genomic era of interactive

proteomics: facts and perspectives. Proteomics 2, 611–6236 Aebersold, R. and Mann, M. (2003) Mass spectrometry-based

proteomics. Nature 422, 198–2077 Crameri, R. et al. (2003) Identification of natural protein-protein

interactions with cDNA libraries. In Phage Display in Biotechnology andDrug Discovery (Sidhu, S.S., ed.), Marcel Dekker, Inc., in press.

8 Greenwood, J. et al. (1991) Multiple display of foreign peptides on a filamentous bacteriophage. Peptides from Plasmodiumfalciparum circumsporozoite protein as antigens. J. Mol. Biol. 220,821–827

9 Verhaert, R.M. et al. (1999) Processing and functional display of the86 kDa heterodimeric penicillin G acylase on the surface of phage fd.Biochem. J. 342, 415–422

10 Castagnoli, L. et al. (2001) Alternative bacteriophage display systems.Comb. Chem. High Throughput Screen. 4, 121–133

11 Borsi, L. et al. (1998) Preparation of phage antibodies to the ED-Adomain of human fibronectin. Exp. Cell Res. 240, 244–251

12 Krebs, B. et al. (2001) High-throughput generation and engineering ofrecombinant human antibodies. J. Immunol. Methods 254, 67–84

13 Konthur, Z. and Walter, G. (2002) Automation of phage display forhigh-throughput antibody development. TARGETS 1, 30–36

14 Liu, B. and Marks, J.D. (2000) Applying phage antibodies toproteomics: selecting single chain Fv antibodies to antigens blotted onnitrocellulose. Anal. Biochem. 286, 119–128

15 Liu, B. et al. (2002) Towards proteome-wide production of monoclonalantibody by phage display. J. Mol. Biol. 315, 1063–1073

16 Noronha, E.J. et al. (2002) Isolation of human tumor-associated cellsurface antigen-binding scFvs. Methods Mol. Biol. 178, 227–233

17 Hallborn, J. and Carlsson, R. (2002) Automated screening procedurefor high-throughput generation of antibody fragments. Biotechniques(Suppl), 30–37

18 Rubenwolf, S. et al. (2002) Functional proteomics using chromophore-assisted laser inactivation. Proteomics 2, 241–246

19 Swartzman, E.E. et al. (1999) A homogeneous and multiplexedimmunoassay for high-throughput screening using fluorometricmicrovolume assay technology. Anal. Biochem. 271, 143–151

20 Ilag, L.L. (2003) Direct methods for modulating protein function. Curr. Opin. Drug Discov. Dev. 6, 262–268

21 Rondot, S. et al. (2001) A helper phage to improve single-chainantibody presentation in phage display. Nat. Biotechnol. 19, 75–78

268

TARGETS Vol. 2, No. 6 December 2003

www.drugdiscoverytoday.com

REVIEWS

RESEARCH FOCUS

22 Rodi, D.J. and Makowski, L. (1999) Phage-display technology–finding aneedle in a vast molecular haystack. Curr. Opin. Biotechnol. 10, 87–93

23 Borrebaeck, C.A. (2000) Antibodies in diagnostics - from immunoassaysto protein chips. Immunol. Today 21, 379–382

24 Cesareni, G. et al. (1999) Phage displayed peptide libraries. Comb. Chem. High Throughput Screen. 2, 1–17

25 Hoogenboom, H.R. (2002) Overview of antibody phage-displaytechnology and its applications. Methods Mol. Biol. 178, 1–37

26 Eklund, M. et al. (2002) Anti-idiotypic protein domains selected fromprotein A-based affibody libraries. Proteins 48, 454–462

27 Skerra, A. (2001) ‘Anticalins’: a new class of engineered ligand-bindingproteins with antibody-like properties. J. Biotechnol. 74, 257–275

28 Walter, G. et al. (2001) High-throughput screening of surface displayedgene products. Comb. Chem. High Throughput Screen. 4, 193–205

29 Rhyner, C. et al. (2003) High-throughput isolation of recombinantantibodies against recombinant allergens. BioTechniques 35, 672–676

30 Zhang, W.W. (2003) The use of gene-specific IgY antibodies for drugtarget discovery. Drug Discov. Today 8, 364–371

31 Agaton, C. et al. (2003) Affinity proteomics for systematic proteinprofiling of chromosome 21 gene products in human tissues. Mol. Cell. Proteomics 2, 405–414

32 Kusnezow, W. and Hoheisel, J.D. (2002) Antibody microarrays:promises and problems. Biotechniques (Suppl.), 14–23

33 Cahill, D.J. (2001) Protein and antibody arrays and their medicalapplications. J. Immunol. Methods 250, 81–91

34 Angenendt, P. et al. (2002) Toward optimized antibody microarrays: a comparison of current microarray support materials. Anal. Biochem.309, 253–260

35 Kusnezow, W. et al. (2003) Antibody microarrays: An evaluation ofproduction parameters. Proteomics 3, 254–264

36 de Wildt, R.M. et al. (2000) Antibody arrays for high-throughputscreening of antibody-antigen interactions. Nat. Biotechnol. 18, 989–994

37 Borrebaeck, C.A. et al. (2001) Protein chips based on recombinantantibody fragments: a highly sensitive approach as detected by massspectrometry. Biotechniques 30, 1126–1130

38 Crameri, R. and Suter, M. (1993) Display of biologically active proteinson the surface of filamentous phages: a cDNA cloning system forselection of functional gene products linked to the genetic informationresponsible for their production. Gene 137, 69–75

39 Crameri, R. et al. (2002) Direct selection of cDNAs by phage display.Methods Mol. Biol. 185, 461–469

40 Jespers, L.S. et al. (1995) Surface expression and ligand-basedselection of cDNAs fused to filamentous phage gene VI. Biotechnology13, 378–382

41 Zacchi, P. et al. (2003) Selecting open reading frames from DNA.Genome Res. 13, 980–990

42 Cochrane, D. et al. (2000) Identification of natural ligands for SH2domains from a phage display cDNA library. J. Mol. Biol. 297, 89–97

43 Yamamoto, M. et al. (1999) Phage display cDNA cloning of protein withcarbohydrate affinity. Biochem. Biophys. Res. Commun. 255, 194–199

44 Danner, S. and Belasco, J.G. (2001) T7 phage display: a novel geneticselection system for cloning RNA-binding proteins from cDNA libraries.Proc. Natl. Acad. Sci. U. S. A. 98, 12954–12959

45 Hertveldt, K. et al. (2003) Identification of Gal80p-interacting proteinsby Saccharomyces cerevisiae whole genome phage display. Gene 307,141–149

46 Rhyner, C. et al. (2002) Direct selection of cDNAs from filamentousphage surface display libraries: potential and limitations. Curr. Pharm.Biotechnol. 3, 13–21

47 Crameri, R. and Walter, G. (1999) Selective enrichment andhigh-throughput screening of phage surface-displayed cDNA librariesfrom complex allergenic systems. Comb. Chem. High Throughput Screen.2, 63–72

48 Crameri, R. and Kodzius, R. (2001) The powerful combination of phagesurface display of cDNA libraries and high throughput screening. Comb. Chem. High Throughput Screen. 4, 145–155

49 Malmqvist, M. (1999) BIACORE: an affinity biosensor system forcharacterization of biomolecular interactions. Biochem. Soc. Trans. 27,335–340

50 Crameri, R. et al. (2001) Tapping allergen repertoires by advancedcloning technologies. Int. Arch. Allergy Immunol. 124, 43–47

51 Kodzius, R. et al. (2003) Rapid identification of allergen-encodingcDNA clones by phage display and high-density arrays. Comb. Chem.High Throughput Screen. 6, 147–154

52 Butteroni, C. et al. (2000) Phage display screening reveals an associationbetween germline-specific transcription factor Oct-4 and multiplecellular proteins. J. Mol. Biol. 304, 529–540

53 Zozulya, S. et al. (1999) Mapping signal transduction pathways byphage display. Nat. Biotechnol. 17, 1193–1198

54 Tong, A.H. et al. (2002) A combined experimental and computationalstrategy to define protein interaction networks for peptide recognitionmodules. Science 295, 321–324

55 Zucconi, A. et al. (2001) Selection of ligands by panning of domainlibraries displayed on phage lambda reveals new potential partners ofsynaptojanin 1. J. Mol. Biol. 307, 1329–1339

56 Uetz, P. et al. (2000) A comprehensive analysis of protein-proteininteractions in Saccharomyces cerevisiae. Nature 403, 623–627

57 Ito, T. et al. (2001) A comprehensive two-hybrid analysis to explore theyeast protein interactome. Proc. Natl. Acad. Sci. U. S. A. 98, 4569–4574

58 Puntervoll, P. et al. (2003) ELM server: a new resource for investigatingshort functional sites in modular eukaryotic proteins. Nucleic Acids Res.31, 3625–3630

59 Weichel, M. et al. (2003) Nuclear transport factor 2 represents a novelcross-reactive fungal allergen. Allergy 58, 198–206

60 Crameri, R. (1998) Recombinant Aspergillus fumigatus allergens: fromthe nucleotide sequences to clinical applications. Int. Arch. AllergyImmunol. 115, 99–114

61 Brander, K.A. et al. (1999) IgE-binding proliferative responses and skintest reactivity to Cop c 1, the first recombinant allergen from thebasidiomycete Coprinus comatus. J. Allergy Clin. Immunol. 104, 630–636

62 Lindborg, M. et al. (1999) Selective cloning of allergens from the skincolonizing yeast Malassezia furfur by phage surface display technology.J. Invest. Dermatol. 113, 156–161

63 Kleber-Janke, T. et al. (1999) Selective cloning of peanut allergens,including profilin and 2S albumins, by phage display technology. Int. Arch. Allergy Immunol. 119, 265–274

64 Rozynek, P. et al. (2002) TPIS - an IgE-binding wheat protein. Allergy57, 463

65 Niwa, M. et al. (2000) Affinity selection of cDNA libraries by lambdaphage surface display. Gene 256, 229–236

66 Hottiger, M. et al. (1995) The large subunit of HIV-1 reversetranscriptase interacts with beta-actin. Nucleic Acids Res. 23, 736–741

67 Sioud, M. and Hansen, M.H. (2001) Profiling the immune response inpatients with breast cancer by phage-displayed cDNA libraries. Eur. J. Immunol. 31, 716–725

68 Essler, M. and Ruoslahti, E. (2002) Molecular specialization of breastvasculature: a breast-homing phage-displayed peptide binds toaminopeptidase P in breast vasculature. Proc. Natl. Acad. Sci. U. S. A. 99,2252–2257

69 Sche, P.P. et al. (1999) Display cloning: functional identification of naturalproduct receptors using cDNA-phage display. Chem. Biol. 6, 707–716

70 Santi, E. et al. (2000) Bacteriophage lambda display of complex cDNAlibraries: a new approach to functional genomics. J. Mol. Biol. 296,497–508

71 Somers, V.A. et al. (2002) A panel of candidate tumor antigens incolorectal cancer revealed by the serological selection of a phagedisplayed cDNA expression library. J. Immunol. 169, 2772–2780

72 Bukanov, N.O. et al. (2000) A modified two-step phage display selectionfor isolation of polycystin-1 ligands. Funct. Integr. Genomics 1, 193–199

73 Hansen, M.H. et al. (2001) Identification of immunogenic antigensusing a phage-displayed cDNA library from an invasive ductal breastcarcinoma tumour. Int. J. Oncol. 19, 1303–1309

269

TARGETS Vol. 2, No. 5 October 2003

www.drugdiscoverytoday.com

REVIEWS

RESEARCH FOCUS

74 Appenzeller, U. et al. (1999) IgE-mediated reactions to autoantigens inallergic diseases. Int. Arch. Allergy Immunol. 118, 193–196

75 Fossa, A. (2003) Serological cloning of cancer/testis antigens expressedin prostate cancer using cDNA phage surface display. Cancer Immunol.Immunother., in press.

76 Eriksson, T.L. et al. (2001) Cloning of three new allergens from the dustmite Lepidoglyphus destructor using phage surface display technology.Eur. J. Biochem. 268, 287–294

77 Viaene, A. et al. (2001) Identification of a collagen-binding proteinfrom Necator americanus by using a cDNA-expression phage displaylibrary. J. Parasitol. 87, 619–625

78 Geisberger, R. et al. (2002) Phage display based cloning of proteinsinteracting with the cytoplasmic tail of membrane immunoglobulins.Dev. Immunol. 9, 127–134

79 Palzkill, T. et al. (1998) Mapping protein-ligand interactions usingwhole genome phage display libraries. Gene 221, 79–83

80 Stolz, J. et al. (1998) Bacteriophage lambda surface display of a bacterialbiotin acceptor domain reveals the minimal peptide size required forbiotinylation. FEBS Lett. 440, 213–217

81 Santini, C. et al. (1998) Efficient display of an HCV cDNA expressionlibrary as C-terminal fusion to the capsid protein D of bacteriophagelambda. J. Mol. Biol. 282, 125–135

82 Smith, G.P. (1985) Filamentous fusion phage: novel expressionvectors that display cloned antigens on the virion surface. Science 228,1315–1317

83 Mead, D.A. and Kemper, B. (1988) Chimeric single-stranded DNAphage-plasmid cloning vectors. Biotechnology 10, 85–102

84 McCafferty, J. et al. (1990) Phage antibodies: filamentous phagedisplaying antibody variable domains. Nature 348, 552–554

85 Duenas, M. and Borrebaeck, C.A. (1994) Clonal selection andamplification of phage displayed antibodies by linking antigenrecognition and phage replication. Biotechnology (N. Y.) 12, 999–1002

86 Krebber, C. et al. (1995) Co-selection of cognate antibody-antigen pairsby selectively-infective phages. FEBS Lett. 377, 227–231

87 Pasqualini, R. and Ruoslahti, E. (1996) Organ targeting in vivo usingphage display peptide libraries. Nature 380, 364–366

88 Larocca, D. et al. (1998) Targeting bacteriophage to mammalian cellsurface receptors for gene delivery. Hum. Gene Ther. 9, 2393–2399

89 Hoogenboom, H.R. and Chames, P. (2000) Natural and designerbinding sites made by phage display technology. Immunol. Today 21,371–378

90 Holt, L.J. et al. (2000) The use of recombinant antibodies in proteomics.Curr. Opin. Biotechnol. 11, 445–449

91 de Haard, H.J. et al. (1999) A large non-immunized human Fabfragment phage library that permits rapid isolation and kinetic analysisof high affinity antibodies. J. Biol. Chem. 274, 18218–18230

92 Knappik, A. et al. (2000) Fully synthetic human combinatorial antibodylibraries (HuCAL) based on modular consensus frameworks and CDRsrandomized with trinucleotides. J. Mol. Biol. 296, 57–86

93 Soderlind, E. et al. (2000) Recombining germline-derived CDRsequences for creating diverse single-framework antibody libraries. Nat. Biotechnol. 18, 852–856

94 Hudson, P.J. and Souriau, C. (2003) Engineered antibodies. Nat. Med. 9,129–134

270

TARGETS Vol. 2, No. 5 October 2003

www.drugdiscoverytoday.com

REVIEWS

RESEARCH FOCUS

NEW Drug Discovery Gateway!http://www.bmn.com/drug-discovery

As a busy scientist, searching through the wealth of information available can be a bit daunting – the new gateway to drug discovery is designed to help!

The Drug Discovery Gateway is updated every two weeks and features expertly selected content from the leading publications in drug discovery, including Drug Discovery Today, Bioorganic & Medicinal Chemistry,Advanced Drug Delivery Reviews, Chemistry & Biology and Cell.

The regular updates include:

Research Articles and Research Updates – browse specially selected hot topics to keep up-to-date onwhat’s happeningsome of the top new research papers relevant to drug discovery in Research Articles, and readcommentaries on some of the key papers in Research Updates – right now.

Reviews – a selection of the best review and opinion articles on drug discovery, from chemistry togenomics/proteomics to drug delivery.

Features– learn about the latest developments and catch up on with conference reports from key meetings in the drug discovery field – providing a quick but comprehensive report of what you missed by staying home.

Reviews – a selection of the best review and opinion articles from all our drug discovery titles, including Drug Discovery Today, Bioorganic & Medicinal Chemistry, Advanced Drug Delivery Reviews, Chemistry & Biology and Cell.

Books– find out about the latest book releases addressing all aspects of drug discovery.

So why not visit: http://www.bmn.com/drug-discoverySIGN-UPSign up to receive the latest issue updates every 2 weeks: http://news.bmn.com/alerts