High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD)

Victoria ClokeCMGS Spring ConferenceApril 2010

Overview

• High density dystrophin gene aCGH platform

• Validation

• Application to specialised testing– Complex mutations– Therapeutic exon skipping trials

Cy3 labelled patient DNA

Cy5 labelled control DNA

Principle of aCGH

High density dystrophin array

• 4x44K format array designed by Madhuri Hegde’s group at Emory University

• 16,248 unique probes for the dystrophin gene region plus their reverse compliments

Exons Introns

10bp

60bp

100bp

High density aCGH Validation

+1

-1

0

Dystrophin gene

Stage 1: Normal control vs Normal control

+7+6+5+4+3+2+1

0-1-2-3-4-5-6-7

Dystrophin exons 9 8 7 6 5 4 3 2

32.58743Mb 32.719041Mb 32.850653Mb 32.982265Mb

High density aCGH Validation

CNV in intron 2Deletion dystrophin

exons 3-7

Stage 2: Known exonic deletions and duplications

Hemizygous male deletion

31.77632Mb 31.936032Mb 32.095744Mb 32.255457Mb

Dystrophin exons 48 47 46 45 44 43 42

31.645784Mb 31.71414Mb 31.78250Mb 31.85086Mb

Dystrophin exons 52 51 50 49 48

+2

+1

0

-1

-2

+2

+1

0

-1

-2

Heterozygous deletion dystrophin

exon 45

High density aCGH ValidationStage 2: Known exonic deletions and duplications

Heterozygous female deletions and duplications

31.77632Mb 31.936032Mb 32.095744Mb 32.255457Mb

Dystrophin exons 48 47 46 45 44 43 42

31.645784Mb 31.71414Mb 31.78250Mb 31.85086Mb

Dystrophin exons 52 51 50 49 48

+2

+1

0

-1

-2

+2

+1

0

-1

-2

High density aCGH Validation31.77632Mb 31.936032Mb 32.095744Mb 32.255457Mb

Dystrophin exons 48 47 46 45 44 43 42

31.645784Mb 31.71414Mb 31.78250Mb 31.85086Mb

Dystrophin exons 52 51 50 49 48

+2

+1

0

-1

-2

+2

+1

0

-1

-2

Stage 2: Known exonic deletions and duplications

Heterozygous female deletions and duplications

Heterozygous duplication dystrophin exons 49-50

High density aCGH ValidationStage 3: Inversion samples

31.827229Mb 31.935944Mb 32. 044659Mb 32.153374Mb

+7+6

+5+4

+3+2

+1

0-1-2-3

-4-5

-6-7

Dystrophin exons 47 46 45 44

Deletions in dystrophin introns 44 and 45

Inversion Exon 45 c.6438+96064_6614+1540

IL1RAPL1

High density aCGH Validation

Dystrophin

Deletion dystrophin

Exon 52

-2-3

+6+5+4+3+2+1

0-1

-4-5-6

Stage 3: Inversion samplesInversion Exon 53 –> 79

3’ deletion including 11 genes

+7

-7

High density aCGH ValidationStage 3: Inversion samplesInversion Ex62 c.9164-10300_c.9224+12600

31.183465Mb 31.217965Mb 31.252466Mb 31.286967Mb

+7+6

+5+4

+3+2

+1

0-1-2-3

-4-5

-6-7

+7+6

+5+4

+3+2

+1

0-1-2-3

-4-5

-6-7

Dystrophin exons 63 62 61

Intron 62 deletion

Applications of high density dystrophin aCGH

Finding mutations in MLPA and point mutation negative patients

Dystrophin

Exon 44

Applications of dystrophin high density aCGH

• Difficulties in exon skipping for duplications—Orientation —Structure—Position of breakpoints

• Dystrophin aCGH study of 25 duplications—Structure of duplications—Rapid breakpoint mapping—Understanding how dystrophin duplications arise

Informing a exon skipping trial targeting duplications

Duplication of dystrophin exons 17-45

Duplication aCGH results

31.741906Mb 32.04018Mb 32.33846Mb 32.63674Mb

+2

+1

-1

-2

+2

+1

-1

-2

0

Dystrophin exons 50 - 46 45 44 - 17 16 - 8

31.692239Mb 31.698543Mb 31.704848Mb 31.711153Mb

+2

+1

-1

-2

+2

+1

-1

-2

0

Dystrophin exons 51

Duplication of dystrophin exon 51

+1

Duplication breakpoint mapping

31.692239Mb 31.698543Mb 31.704848Mb 31.711153Mb

+2

+1

-1

-2

+2

+1

-1

-2

0

Dystrophin exons 51

1 2 3 4 5 2 5 63 42 5 Exon 51 Exon 511 2 3 4 5 2 5 63 42 51 2 3 4 5 2 5 63 42 5

Breakpoint sequencing results

• Ease of breakpoint mapping– 15/25 breakpoints (60%) needed just one round of PCR

and sequencing

• 20/25 (80%) central breakpoints amplified and sequencedTandem orientation

Breakpoint sequencing results32775529 atgggaggcatgtatactatagaacagaaattttagtattctactcagaagc 32775478 <<<<<<<< ||||||||||||||||||||||||||| || | || | ||| | <<<<<<<< atgggaggcatgtatactatagaacagggatctaggttgtgtgctccttatg <<<<<<<< | | | ||||||||||||||||||||||||||| <<<<<<<< 32850655 aaccctattgtgacctgcgcatgcgagggatctaggttgtgtgctccttatg 32850604 32323093 catgaagatgataaatacttatgttaatatgattaggagatggaattaatta 32323042 <<<<<<<< |||||||||||||||||||||||| | | | | | <<<<<<<< catgaagatgataaatacttatgtattttaaaaaccggctttgttaagcaat <<<<<<<< | || | |||||||||||||||||||||||| <<<<<<<< 32462155 gtattttgttatgtaagtgctagctgactaaaaaccggctttgttaagcaat 32462105

attaaggatctgtgtgagattctgctggatggtgtagattttcttgaaaa ||||||||||||||||||||||||| | | | | || attaaggatctgtgtgagattctgcataaattcagcttatgttaaggaag | | || ||||||||||||||||||||||||| ggcttttgtgttacattgaacagagataaattcagcttatgttaaggaag

Intron 7

Duplication sequence

Intron 2

Intron 30

Intron 17

Duplication sequence

Intron 1

Intron 4

Duplication sequence

Microhomology

1-4 nucleotides

14/20 (70%)

Small insertion

1-4 nucleotides

4/20 (20%)

Clean breakpoint

2/20 (10%)

gtattcagaaacttaaatagccatataatacatattttggagcatgtcagaa |||||||||||||||||||||||||||| | || ||| | gtattcagaaacttaaatagccatataagaattaactgtttgcacaatctac || | | || |||||||||||||||||||||||||||| tctaacacatgcaattttaagaggataagaattaactgtttgcacaatctac

• Genomic DNA: Duplication Exons 3-37 • Breakpoint close to exon 37

• RNA level: Duplication Exons 3-36

Duplication study

Exon 37

13bp

Exon 36 Exon 3Exon 36 Exon 3

Exon 4-37 Exon 38->Exon 1-2 Exon 3-35

Comparison with RNA results

Duplication study

• Non-allelic homologous recombination (NAHR)– Lack of homology between breakpoints

• 34% - 48% (mean 42%) sequence identity• No shared repetitive element homology

• Non-homologous recombination (NHR)– Simple tandem structure– Non-recurrent breakpoints– Microhomology and insertions

DNA repair mechanism such as non-homologous endjoining (NHEJ) Replication based mechanism such as fork stalling and template

switching (FoSTeS)

Understanding the mechanism of duplications

E.g.

• Array CGH vs MLPA

• Array CGH as a specialist test– Solving difficult cases– Rapid breakpoint mapping e.g. to Inform therapeutic

strategies

Conclusions

High Density aCGH MLPA

Consumable Cost £178 £40

Information provided 44K probes Limited to ~1 probe/exon

Reliability Multiple 60nucleotide probes/aberration

Risk of false positives

Flexibility Custom design Limited kit availability

Acknowledgements

• Dr Steve Abbs• Dr Michael Yau• Jo McCauley• Dr Joo Wook Ahn

• Prof Francesco Muntoni• Jihee Kim

• Dr Madhuri Hegde• Ephrem Chin