ORIGINAL ARTICLE

Hh-Gli SIGNALING PATHWAY ACTIVITY IN ORAL ANDOROPHARYNGEAL SQUAMOUS CELL CARCINOMA

Dinko Leovic, MD, PhD,1 Maja Sabol, PhD,2 Petar Ozretic, BSc,2 Vesna Musani, PhD,2

Diana Car, BSc,2 Ksenija Marjanovic, MD,3 Vedran Zubcic, MD,1 Ivan Sabol, BSc,4

Miroslav Sikora, DMD,1 Magdalena Grce, PhD,4 Ljubica Glavas-Obrovac, PhD,5

Sonja Levanat, PhD2

1Department of Maxillofacial Surgery, University Hospital Osijek, Osijek, Croatia2 Laboratory for Hereditary Cancer, Division of Molecular Medicine, Rudjer Boskovic Institute, Zagreb, Croatia.E-mail: levanat@irb.hr

3Department of Pathology, University Hospital Osijek, Osijek, Croatia4 Laboratory for Molecular Virology and Bacteriology, Division of Molecular Medicine, Rudjer Boskovic Institute,Zagreb, Croatia

5Department of Nuclear Medicine, Radiation Protection and Pathophysiology, University Hospital Osijek, Osijek, Croatia

Accepted 22 October 2010Published online 11 April 2011 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/hed.21696

Abstract: Background. The aim of this study was to

examine the role of Hh-Gli signaling in oral and oropharyngeal

squamous cell carcinoma (SCC). The role of this signaling

pathway in SCC formation has not yet been elucidated.

Methods. Sixty-four tissue and blood samples were col-

lected from 60 patients with SCC, all tobacco and alcohol

users. An additional six buccal mucosa tissue samples were

collected from nonsmokers and nondrinkers as control tissue.

Results. Hedgehog-Gli pathway components were associ-

ated with clinical and pathologic features. Broders’ grade and

N stage were associated with higher Ptch1 and lower Gli1

expression. Tumor stage was negatively associated with Smo

expression, and tumor size was positively associated with p16

expression. Ptch1 and Shh were frequently detected in the

surrounding stroma. Ptch1 was found to be correlated with

p16 expression, as well as with survivin expression.

Conclusions. The signaling pathway is activated in SCC

and inducible in vitro by Shh protein. VVC 2011 Wiley Periodicals,

Inc. Head Neck 34: 104–112, 2012

Keywords: Hedgehog-Gli signaling; oral cancer; survivin;

squamous cell carcinoma

Oral and oropharyngeal cancer is a relatively com-mon disease, the sixth most common cancer in theworld, with an annual estimated incidence of 275,000for oral and 130,300 for pharyngeal cancers, exclud-ing nasopharynx. Squamous cell carcinoma (SCC) isthe most common histologic type, with more than

90% of cases. SCC most commonly affects men from50 to 70 years of age and is associated with alcoholand tobacco consumption.1 Very little is known aboutthe molecular mechanisms responsible for its cellularproliferation, which include changes in p16INK4A, p53,cyclin D1, FHIT, RASSF1A, EGFR, and Rb.2

The Hedgehog-Gli (Hh-Gli) signaling pathway isinvolved in embryonic development of various tissues;for example, taste papillae on the tongue,3 teeth,4 sal-ivary glands,5 and foregut and is associated with fore-gut malignancies in adult organisms.6 In all thesecases, Hh-Gli signaling regulates epithelial-mesenchy-mal transition mediated by Hh ligands.

The Hh-Gli pathway is initiated by the secretedprotein Hedgehog (Hh) (any of its three isomers inhumans Shh, Ihh, and Dhh), which binds to its trans-membrane receptor Patched (Ptch). Ptch relieves itsrepression of the coreceptor Smoothened (Smo), lead-ing to activation of the transcription factor Gli1.7

Many of the Gli1 targets are associated with cell pro-liferation, including Ptch. Gli transcription factors canalso be activated via noncanonical pathways.8

Survivin is also involved in embryonic developmentand is usually inactive in adult tissues. Survivin is aninhibitor of apoptosis, active in the G2/M phase of thecell cycle, and its overexpression enables survival ofcancer cells.9 Its expression is very high in most can-cers and is related to increased recurrence rates andresistance to radiotherapy and chemotherapy.

To the best of our knowledge, this is the firststudy of expression of Hh-Gli pathway genes in oraland oropharyngeal SCC. To date there is only 1 invitro study that addresses Hh-Gli signaling in oralsquamous cell cancer cell lines10 and 1 very recentstudy that examined the protein expression patternsin SCC of the skin and head and neck.11

Additional Supporting Information may be found in the online version ofthis article.

Correspondence to: S. Levanat

This research was supported by grant 098-0982464-2461 from CroatianMinistry of Science, Education and Sports.

VVC 2011 Wiley Periodicals, Inc.

104 Hh-Gli Signaling in SCC HEAD & NECK—DOI 10.1002/hed January 2012

PATIENTS AND METHODS

Samples. Sixty-four SCC samples from 60 patients,52 (87%) male and 8 (13%) female, were collectedfrom Department of Maxillofacial Surgery, UniversityHospital Osijek, during 2007, 2008, and 2009. Threepatients had synchronous second or third primarytumors. All patients had a long-term history of alco-hol and tobacco consumption.

For clarification of our results, an additional 6control samples of healthy buccal mucosa frompatients without a history of alcohol and tobacco con-sumption were collected. All samples were collectedfollowing the ethical principles approved by Institu-tional Ethical Board (number 29-1:1688-12/2006, Clin-ical Hospital Osijek Ethical Board) and in accordancewith the Declaration of Helsinki and were obtainedbefore any treatment. The samples from the mostprominent and characteristic part of each tumor andthe samples of the adjacent mucosa were obtained inthe most sterile conditions possible, with separatesets of surgical gloves and instruments used, thusavoiding possible cross-contamination.

There were 43 (67.2%) oral and 21 (32.8%) oropha-ryngeal carcinomas. All tumors were staged followingthe American Joint Committee on Cancer stagingrules.12 Unilateral or bilateral neck dissections wereperformed in 56 patients. The distribution of tumorstages were as follows: stage I, 5 (7.8%); stage II, 14(21.9%); stage III, 12 (18.8%); and stage IV, 33(51.6%). Fifty-eight of 60 patients have been surgi-cally treated, whereas in 2 patients, because of incur-ability of their tumors, only chemoradiotherapy hasbeen applied. In the group of surgically treatedpatients, 62 neck dissections were performed. Fifty-two of 58 surgically treated patients underwent radio-therapy or chemoradiotherapy; 49 (94.2%) after sur-gery and 3 (5.8%) before surgery. For the purpose ofstatistics, in 2 patients who underwent only chemora-diotherapy and in 2 patients in whom the tumorswere treated only via transoral tumor resection with-out any neck dissection, a pN stage was considered asclinical N status at presentation. Clinical parametersused in correlation with expression of examined geneswere as follows: T grade (1–4), tumor stage (I–IV),site (oral cavity/oropharynx), Broders’ grade of tumordifferentiation (1–4), and pN status (þ/�). Broders’grade shows the differentiation stage of a tumor: fromstage 1 (well differentiated) to stage 4 (poorly differ-entiated). Demographic, clinical, and pathohistologicdata are presented in Table 1, and the complete sam-ple list with associated pathohistologic features canbe seen in Supplemental Table 1.

RNA and DNA Extraction. RNA was successfullyextracted from 53 SCC samples from 50 patients. Ofthese, 35 (66%) were oral SCC, and 18 (34%) wereoropharyngeal SCC. An additional 45 samples of

intact mucosa adjacent to tumor were also collectedand used as control tissue.

RNA extraction was performed with TRIzol Rea-gent (Invitrogen, Carlsbad, CA) according to the man-ufacturer’s instructions, and the purity of the RNAwas examined on a 1% agarose gel, using an ImageMaster VDS (Pharmacia Biotech, Uppsala, Sweden).DNA from tissue samples was extracted by the stand-ard phenol-chloroform method and from blood by thedesalting method.

Quantitative Real-Time Polymerase Chain Reac-

tion. Quantitative real-time polymerase chain reac-tion (qRT-PCR) was performed on 53 tumor samplesand 45 referent control tissues. RNA 1 lg was reversetranscribed into cDNA with TaqMan Reverse Tran-scription Reagents (Applied Biosystems, Foster City,CA). The qRT-PCR was performed in a Chromo4machine (Bio-Rad, Berkeley, CA) using SYBR GreenSupermix (Bio-Rad) and the following primer pairs:ARP F: 50 GGCACCATTGAAATCCTGAGT GATGTG30, R: 50 TTGCGGACACCCTCCAGGAAGC 30,13

PTCH1 F: 50 TCCTCGTGTGCGCTGTCTTCCTTC 30,R: 50 CGTCAGAAAGGCCAAAGCAACGTGA 30,14 SMOF: 50 CTGGTACGAGGACGTGGAGG 30, R: 50 AGGGT-GAAGAGCGTGCAGAG 30,15 GLI1 F: 50

GCCGTGTAAAGCTCCAGTGAACACA 30, R: 50

TCCCACTTTGAGAGGCCCATAGCAAG 30,14 SHH F:50 GAAAGCAGAGAACTCGGTGG 30, R: 50 GGTAAGT-GAGGAAGTCGCTG 30,15 p16 F: 50 CAACGCACCGAA-TAGTTACG 30, R: 50 AGCACCACCAGCGTGTC 30,16

Table 1. Patients’ characteristics (n ¼ 64).

Characteristic No. of patients (%)

Age, y

Median 60

Range 39-78

Sex

Male 56 (87.5)

Female 8 (12.5)

Site

Oral cavity 43 (67.2)

Oropharynx 21 (32.8)

T classification

1 7 (10.9)

2 22 (34.4)

3 16 (25.0)

4 19 (29.7)

Stage

I 5 (7.8)

II 14 (21.9)

III 12 (18.8)

IV 33 (51.6)

Broders

1 27 (42.2)

2 22 (34.4)

3 13 (20.3)

4 2 (3.1)

pN status

� 22 (34.4)

þ 42 (65.6)

Hh-Gli Signaling in SCC HEAD & NECK—DOI 10.1002/hed January 2012 105

and Survivin F: 50 ATGGGTGCCCCGACGTTG 30,17 R:50 CAACCGGACGAATGCTTTTT 30.18 The primers forARP, PTCH1, p16, SUFU, SHH and Survivin are allexon-spanning, whereas the primers for SMO andGLI1 are located in the last exon of the gene.

The PCR conditions were as follows: initial dena-turation at 95�C for 3 minutes, 40 cycles of 95�C for15 seconds, 61�C for 1 minute, and finally meltingcurve from 70�C to 95�C. All experiments were per-formed at least in duplicate. The Ct values of eachsample were normalized with the housekeeping geneArp (acidic ribosomal protein, also known as RPLP0),and the results are shown as 2�DCt (difference inexpression of each gene relative to Arp).

Detection of Human Papillomaviruses. For thedetection of human papillomaviruses (HPV) in thesamples we used the HPV detection and genotypingPCR methods described before,19 with an additionalconsensus primer–driven PCR. Briefly, 2 consensusprimer–driven PCR reactions, detecting most mucosalHPV types, were performed with PGMY09/11 andL1C1/L1C2-1/L1C2-2 primers. Sample adequacy wasdetermined by amplification of a 268 bp sequence ofthe b-globin gene by use of PC04/GH20 primers in amultiplex PCR with PGMY primers. The first 2 PCRreactions detected HPV in only 1 sample; thus anadditional third consensus PCR reaction (FAP59/64)was used to detect a broader spectrum of HPV types,including those common to the skin lesions.20 Sam-ples positive for HPV by any consensus reaction weregenotyped with 3 multiplex HPV-type specific PCRreactions with primers for HPV types (HPV 6/11 and31; HPV 16, 18 and 33; and HPV 45 and 58) and 1single PCR to amplify HPV 52.19 Aliquots of eachPCR product (10 lL) were analyzed by electrophoresison 2% agarose gels stained with ethidium bromide.The amplified products were visualized by ultravioletirradiation of the gels and photographed with theAlliance 4.7 Image Analyzer (Uvitec, Cambridge,United Kingdom).

Immunohistochemistry. Immunohistochemical (IH)analysis was performed on 20 samples of oral and 10of oropharyngeal cancer and their adjacent mucosafor Ptch1, Shh, Smo, and Gli1 proteins. Slides werestained with LSABþ System-HRP (Dako, Glostrup,Denmark) with the primary antibodies: goat polyclo-nal anti-Ptch (sc-6147, Santa Cruz, CA), rabbit poly-clonal anti-Shh (sc-9024, Santa Cruz, CA), rabbitpolyclonal anti-Smo (sc-19943, Santa Cruz, CA), andrabbit polyclonal anti-Gli (sc-20687, Santa Cruz, CA),followed by secondary antibody (Biotinylated link,Dako LSABþ System-HRP K0679, Dako). For nega-tive control, slides were treated with 2% bovine se-rum albumin in phosphate-buffered saline solutioninstead of the primary antibody. All slides were coun-terstained with hematoxylin (Dako). Slides were

examined by an experienced pathologist. The stainingintensity was determined as follows: no staining, 0;weak staining, 1; intermediate staining, 2; or heavystaining, 3. The percentage of stained cells was scoredas follows: <5% of cells, 0; 5%–25% of cells, 1; 25%–50% of cells, 2; 50%–75% of cells, 3; >75% of cells, 4.The percentage of positivity of the tumor cells andthe staining intensity were then multiplied to gener-ate the immunoreactivity score (IS) for each tumorsample. Thus IS can vary from 0 to 12.18 Because ofvarious structures stained in control mucosal sam-ples, only epithelial staining was taken in considera-tion, and the expression was presented in terms ofstaining intensity alone.

Cell Culture Experiments. FaDu, human pharyn-geal SCC cells (ATCC number HTB-43), were grownin Dulbecco’s modified Eagle medium containing 10%or 0.5% fetal bovine serum for 24 hours and thentreated with either cyclopamine (1 lg/mL) inhibitor,tomatidine (1 lg/mL) negative control, or Shh protein(2.8 lg/mL) activator. RNA and proteins wereextracted 24 hours after treatment.

Western Blot. Protein concentrations were deter-mined by use of a Protein Assay solution (Bio-Rad).Primary antibodies were the same ones used for im-munohistochemical staining, and goat polyclonal anti-Actin (sc-1616, Santa Cruz, CA) was used as loadingcontrol. Signal was detected by use of chemilumines-cent reagent SuperSignal West Pico (Thermo Scien-tific, Waltham, MA). Quantitation of bands wasperformed with UVIBand software (Uvitec, Cam-bridge, United Kingdom).

Loss of Heterozygosity Analysis. Loss of hetero-zygosity (LOH) analysis was done with fluorescent-la-beled forward primers, followed by fragmentalanalysis detection on ABI PRISM 310 Genetic Ana-lyzer (Applied Biosystems, Foster City, CA). DNA of64 tumor samples with corresponding constitutionalDNA were typed for CGG repeat in 50UTR of PTCH1gene (rs71366293) by use of the following primers: F:50 CCCCCGCGCAATGTGGCAATGGAA 03 and R: 50

CGTTACCAGCCGAGGCCATGTT 03. Samples thatwere uninformative were further typed for additionalSTR markers (WI-19346, 203 WH8, D9S287 andD9S180).

PCR conditions for CGG repeat were as follow:initial denaturation at 95�C for 10 minutes, followedby 30 cycles of 95�C for 30 seconds, 61�C for 2minutes, 72�C for 1 minute, and final extension at72�C for 30 minutes with AmpliTaq Gold polymerase(Applied Biosystems).

PCR conditions for the multiplex PCR with otherSTR markers were as follow: initial denaturation at95�C for 15 minutes, followed by 19 cycles of 95�C for30 seconds, 55�C for 90 seconds, 72�C for 1 minute,

106 Hh-Gli Signaling in SCC HEAD & NECK—DOI 10.1002/hed January 2012

and final extension at 72�C for 30 minutes withQiagen Multiplex PCR kit (Qiagen, Dusseldorf,Germany).

Statistical Analysis. Kolmogorov-Smirnov test wasused for testing normality of distribution of the exper-imental results. Because non-Gaussian distributionwas found for the expression data of all genes, thenonparametric Mann-Whitney U test was used tocompare 2 and Kruskal-Wallis test to compare morethan 2 groups. For positive Kruskal-Wallis testresults, post-hoc analysis was automatically per-formed for pairwise comparison of subgroups. Non-parametric Spearman rank correlation coefficient wasused to assess the correlation between variables.Fisher’s exact test and chi-square test were used toassess the association and distribution of categoricalvariables. Receiver operator characteristic (ROC)curve analysis was used to dichotomize the geneexpression data into two groups, ‘‘lower’’ and ‘‘higher.’’Two-tailed p values < .05 were considered statisti-cally significant. Statistical analyses were performedwith MedCalc for Windows, version 7.2.0.2 (MedCalcSoftware, Mariakerke, Belgium).

RESULTS

Hh-Gli Signaling Pathway is Active in SCC

Samples. Expression of Hh-Gli pathway genes byqRT-PCR was detected in SCC samples, but also in alarge subset of control tissues (Table 2, SupplementalTable 2). A significant difference between tumor andcontrol tissue was detected for Survivin (p < .001).

Because expression of pathway genes wasdetected in both tumor and control tissue, we decidedto divide fold change values into ‘‘higher’’ or ‘‘lower’’on the basis of ROC analysis. Expression studieswere extended to 6 healthy controls (no alcohol ortobacco consumption) to check the effect of theseagents on the control tissues where we detected only‘‘lower’’ gene expression for Survivin and PTCH1gene. For the other genes, SHH and SMO had mostly‘‘higher’’ expression (5 of 6 samples, 83.3%), p16 hadmostly ‘‘lower’’ expression (5 of 6 samples, 83.3%),whereas GLI1 expression was divided equally (50%each) (Table 2).

The association of Hh-Gli pathway genes in tumorsamples was compared with their extent of expression(Table 3). In samples with ‘‘lower’’ SMO expression,SHH expression was predominantly ‘‘lower’’ (22/23

Table 2. Expression of Hh-Gli pathway genes in SCC samples, accompanying control mucosa or healthy nondrinker and nonsmoker controls.

Control mucosa (smokers and

drinkers)

Tumor samples (smokers and

drinkers)

Healthy nondrinkers and

nonsmokers mucosa

High Low High Low High Low

Survivin 8 (17.8%) 37 (82.2%) 40 (75.5%) 13 (24.5%) 0 6 (100%)

Ptch 11 (24.4%) 34 (75.6%) 26 (49.1%) 27 (50.9%) 0 6 (100%)

Smo 31 (68.9%) 14 (31.1%) 30 (56.6%) 23 (43.4%) 5 (83.3%) 1 (16.7%)

Gli1 3 (6.7%) 42 (93.3%) 8 (15.1%) 45 (84.9%) 3 (50%) 3 (50%)

Shh 18 (40%) 27 (60%) 16 (30.2%) 37 (69.8%) 5 (83.3%) 1 (16.7%)

p16 23 (51.1%) 22 (48.9%) 36 (67.9%) 17 (32.1%) 1 (16.7%) 5 (83.3%)

Note. Analysis was performed by qRT-PCR, and fold change values were divided in ‘‘high’’ or ‘‘low’’ expression groups on the basis of ROC curve analysis.

Table 3. The association of Hh-Gli pathway gene expression in tumor samples.

Ptch

p value

Shh

p value

Smo

p value

Sur

p value

p16

p valueLow High Low High Low High Low High Low High

Gli 1.000 .224 .118 .662 .010

Low 23 22 33 12 22 23 12 33 11 34

High 4 4 4 4 1 7 1 7 6 2

Ptch .372 .785 .526 .018

Low 17 10 11 16 8 19 13 14

High 20 6 12 14 5 21 4 22

Shh <.001 .043 .108

Low 22 1 6 31 9 28

High 15 15 7 9 8 8

Smo .349 .074

Low 4 19 4 19

High 9 21 13 17

Sur .734

Low 5 8

High 12 28

Note. Each set of gene expression data was binarized into 2 categories—‘‘low’’ and ‘‘high’’ —on the basis of cutoff values obtained by ROC curve analysis. The p values are forFisher’s exact test.

Hh-Gli Signaling in SCC HEAD & NECK—DOI 10.1002/hed January 2012 107

samples, 95.6%) (p < .001). The positive association ofSMO and SHH expression was verified by calculatingthe correlation coefficient (q ¼ 0.623, p < .001). Anegative association was detected between GLI1 andp16 genes; in samples with ‘‘higher’’ p16 expression,GLI1 expression was predominantly ‘‘lower’’ (34/36samples, 94.4%), which was confirmed by negativecorrelation coefficient (q ¼ �0.351, p ¼ .011). Positivecorrelation was also observed between ‘‘higher’’ p16expression and "higher" PTCH1 expression (p ¼ .018)(22/36 samples, 61.1%) (Supplemental Table 3).

IH staining intensities were compared by use ofthe Mann-Whitney test and showed that a significantdifference between control and tumor tissue can bedetected for Ptch1 (p ¼ .014) and Smo (p ¼ .013) pro-teins. For both proteins staining intensities are stron-ger in tumor tissues compared with controls.

IH staining patterns are consistent in control andtumor tissue for several structures for all tested pro-teins, Ptch1, Smo, Gli1, and Shh. These structuresinclude the epithelial lining of small salivary ducts,serous acinar cells, submucous muscle fibers and infil-

trating plasma cells, fibrocytes, and fibroblasts. Dif-ferences in staining in tumor tissue compared withcontrol tissue refer primarily to epithelial lining (ba-sal cells and suprabasal cells) and tumor stroma. Allproteins are localized as could be expected for theactive pathway: Ptch1 is located on the membrane,and Gli1, Shh, and Smo in the cytoplasm (Figure 1).In control tissues the staining is usually eventhroughout the epithelium, whereas tumor stainingshows varied and usually stronger intensities and isnot evenly distributed throughout the structures(Supplemental Table 4). We found no correlationbetween gene expression and immunohistochemicalscore.

Hh-Gli Signaling Pathway is Associated with

Clinical and Pathologic Parameters. Several clini-cal parameters were compared with mRNA and pro-tein expression of Hh-Gli pathway genes: site, Tgrade, tumor stage, Broders’ grade, and pN status.For this analysis, IH staining results of tumor cells

FIGURE 1. IH staining of control tissue epithelium (left column), control gland tissue (middle column) and tumor tissue (right column)

for Ptch, Smo, Gli and Shh proteins. Original magnification � 200, bar ¼ 200 lm. The insets inside each panel are magnifications

showing localization of the staining.

108 Hh-Gli Signaling in SCC HEAD & NECK—DOI 10.1002/hed January 2012

were determined as positive if IS was 4 or higher,21

and mRNA expression was classified as ‘‘higher’’ or‘‘lower’’ on the basis of ROC analysis.

For p16 mRNA there is a significant difference inexpression according to tumor size (T value accordingto the TNM staging system) (p ¼ .045). Post hoc anal-ysis showed that T3 tumors showed the highestexpression of the p16 gene. It would seem that thep16 gene becomes more expressed at higher tumorstages, which is unusual; usually the loss of p16 isassociated with head and neck tumor formation.

Broders’ classification showed that tumors withhigher Broders’ grade are more frequently negativefor Gli1 protein staining (p ¼ .022). The opposite istrue for PTCH1 gene expression in relation toBroders’ grade: more samples show ‘‘higher’’ expres-sion in higher Broders’ stages (p ¼ .049). This wasalso demonstrated by correlating PTCH1 gene expres-sion in tumors with Broders’ grade (q ¼ 0.294, p ¼.034). According to these results, differentiatedtumors have a higher Gli1 expression than dediffer-entiated ones. In contrast, PTCH1 expression ishigher in poorly differentiated tumors relative tohighly differentiated ones.

Finally, an association of GLI1 mRNA expressionand pN status was detected (p ¼ .006). High GLI1expression is associated with negative lymph nodes(7/8 samples, 87.5%), whereas low GLI1 expression isassociated with positive lymph nodes (30/45 samples,66.7%). For PTCH1 mRNA expression, associationwith pN status was marginally significant (p ¼ .051).High PTCH1 expression is associated with positivelymph nodes (19/31 samples, 61.3%) and low PTCH1expression is associated with negative lymph nodes(15/22 samples, 68.2%). This study used samples col-lected during 2007, 2008, and 2009. Because the mini-mum time of 2 years of follow-up has not yet beenreached for the entire investigated group of patients,we did not perform any survival analysis.

Tumor Samples Are Predominantly Negative for HPV

Infection. DNA for HPV analysis was available for55 of 60 samples included in this study. The b-globingene was successfully amplified in all available sam-ples. However, only 1 sample of 55 tested sampleswas positive for PGMY consensus PCR (1/55, 1.8%).The same sample was also positive for FAP consensusPCR. Thus HPV typing was performed only on this 1sample, and it was positive for HPV type 16. DNAprepared from healthy tissue from the same patientwas negative for HPV. Because of this extremely lownumber of HPV-positive samples, no association stud-ies were performed.

Expression of Pathway Proteins in Tumors Affects

the Surrounding Stroma. Stromal staining for Ptch1protein was present in 27 samples (90%), for Shh pro-tein in 26 samples (86.6%), for Gli1 in 12 samples

(40%), and for Smo in only 6 samples (20%). Stromalstaining is associated with staining of tumor cells forGli1 protein (p ¼ .019); samples with low Gli1 proteinexpression show negative stromal staining (19/20samples, 95%). These findings are in accordance withrecently published results, which demonstrate a para-crine model of action for this signaling pathway.22

Hh-Gli Pathway Correlates with Survivin Expres-

sion. Survivin is frequently expressed in tumors. Toexamine a possible link with the Hh-Gli signalingpathway, we calculated correlation coefficients of Sur-vivin with different Hh-Gli pathway genes. SurvivinmRNA expression in tumor tissues showed a weakpositive correlation with mRNA expression of PTCH1(q ¼ 0.403, p ¼ .004), p16 (q ¼ 0.339, p ¼ .014), and aweak negative correlation with SHH (q ¼ �0.311, p ¼.025) (Supplemental Table 3).

Hh-Gli Pathway Is Inducible in SCC Cells. ThemRNA and protein expression levels of Ptch1, Smo,Gli1, Shh, p16, and Survivin were analyzed in FaDucells in normal and serum-starved conditions. In nor-mal conditions, Ptch1, Smo, and Gli1 proteins weredetectable, whereas Shh protein was not. In serum-starved conditions, only Ptch1 protein was detectable,whereas Smo, Gli1, and Shh proteins were not.

Surprisingly, cyclopamine did not cause a decreasein expression levels of these pathway genes on eithermRNA or protein level. However, addition of Shh pro-tein increased Ptch1 protein level in normally growncells but not mRNA level, whereas it decreased Gli1protein levels. Smo protein levels remained unaf-fected (Figure 2).

PTCH1 Locus Is Frequently Lost in SCC

Samples. LOH of the PTCH1 region was deter-mined in 34 of 64 tumor samples (53.1%). In 25samples (39.1%) LOH was not found, and 5 samples(7.8%) were noninformative on all 5 markers used(CGG repeat in 50 UTR of the PTCH1 gene, WI-19346, 203 WH8, D9S287 and D9S180).

DISCUSSION

Different genetic alterations in p16INK4A, p53, Fhit,Ras, and EGFR, are involved in pathology of SCC,2

and the most frequently observed is p16INK4A tumorsuppressor gene alteration. Although p16INK4A is usu-ally inactivated in cancer, we detected its expression intumor samples, which is in accordance with anotherstudy,23 which reported upregulation of p16INK4A

expression in head and neck SCC as a common phe-nomenon. Our previous study on basocellular carci-noma of the skin and melanoma also showed a highproportion of samples stained for p16 protein.24 There-fore the finding of elevated levels of p16 mRNA inthese samples is not completely surprising. The p16regulates cyclin D1 expression, but this expression is

Hh-Gli Signaling in SCC HEAD & NECK—DOI 10.1002/hed January 2012 109

also regulated by the Hh-Gli signaling pathway.25,26

Therefore Hh-Gli pathway activity may bypass p16 ac-tivity by directly inducing transcription of Cyclin D1.This interaction remains to be investigated further.

We established that another tumor suppressor,Ptch, and the Hh-Gli signaling pathway, are alsoinvolved in pathology of SCC. This is supported by astudy performed by Ishiyama et al27 where theauthors found that mRNA expression of PTCH1 isassociated with poor prognosis in patients with esoph-ageal SCC. We have detected a weak correlation ofsurvivin with the Hh-Gli signaling pathway. Low orno expression of Survivin in healthy samples, andhigher level in tumor samples, show clear distinctionbetween tumor and nontumor groups.28 Survivinexpression is associated with cell survival through in-hibition of apoptosis.

Here we have demonstrated the activity of Hh-Glisignaling pathway in oral and oropharyngeal SCCs.However, we have also detected a signal in matchedcontrol tissue from the same patients. We can postu-late that the mucosa of long-term alcohol and tobaccousers can not be used as a good negative control,because of the damaging effects of these agents.Indeed, when compared with several samples ofhealthy oral mucosa of nondrinkers and nonsmokers,it is possible that the partial signal detected inpatients’ control samples may be due to general stateof their mucosa. This supports the ‘‘field canceriza-tion’’ theory, which suggests that the mucosa sur-rounding the SCC is also genetically altered, evenbeyond surgical margins.2,29 This is also supported bya recent study of protein expression in the skin andmucosa SCCs of the head and neck which showedthat protein staining of Ptch, Smo, Gli1, Gli2, Gli3,Shh, and Ihh can be frequently detected in tumors,but not in healthy control tissue.11

Alcohol has multiple effects on the oral mucosa:increase in cell membrane permeability, general inflam-

mation of oral mucosa, direct cell damage and formationof lesions, atrophy of oral mucosa, and increased basallayer thickness, which occurs because of hyperregener-ation of the damaged tissue.30 On the other hand,tobacco consumption is mostly associated with variousforms of DNA damage: mutations, DNA adducts, chro-mosomal abnormalities, or DNA fragmentation.31

A multicenter study on HPV in oral cancer per-formed by International Agency for Research on Can-cer has found HPV in 3.9% (30/766) of oral cavitycancer samples and 18.3% (26/142) within oropharyn-geal cancers.32 Furthermore HPV DNA was foundless often in patients with a history of smoking. Thisobservation might explain the low prevalence of HPVDNA in our samples (1/55, 1.8%). Another study alsofound a low prevalence of HPV in the oral cavity (2/53, 4%) but found HPV very often in oropharyngealsamples (16/22, 73%).33

Although HPV is becoming increasingly importantin head and neck cancers, especially of the oropharynxwhere HPV DNA incidence varies (20%–90%),34 this vi-rus does not seem to be as prevalent in our samples.This is probably due to the fact that HPV-positiveHNSCC are associated with younger patients and theirsexual behavior whereas HPV-negative HNSCC areassociated with older patients and with alcohol andtobacco usage,34 which are the descriptive characteris-tics of the samples tested in this study.

It has been demonstrated that Hh-Gli signaling isrequired for normal wound healing35 and for mainte-nance and proliferation of stem cells in human epider-mis.36 It is likely that the Hh-Gli signal becomesactive in mucosa of frequent alcohol and tobacco usersto enable wound healing and stem cell proliferation. Itwas demonstrated that Hh-Gli signaling is involved information of sporadic odontogenic cysts,37 and thoseassociated with a hereditary disorder Gorlin syndrome,caused by mutations in PTCH1 gene.38 There are alsorare incidences of SCC developing from previously

FIGURE 2. Western blot of Hh-Gli pathway proteins in FaDu cell line treated with Shh protein compared with untreated cells. Panels

on the right show quantitation of bands for Ptch1 and Gli1 protein normalized to Actin, using UVIBand software (Uvitec, Cambridge,-

United Kingdom).

110 Hh-Gli Signaling in SCC HEAD & NECK—DOI 10.1002/hed January 2012

existing odontogenic cysts,39 suggesting that Hh-Glisignaling deregulation may be one of the first steps inSCC formation. Increased staining for Hh-Gli signalingpathway proteins was previously detected in SCC ofthe uterine cervix, compared with normal epitheliumwhere it was not detectable for Ptch1, Smo, Gli1, andIhh.21 Also, expressional analyses, as well as in vitrostudies, demonstrated activation of Hh-Gli signalingpathway in esophageal SCCs.40 Hh-Gli signaling path-way is also involved in growth of various digestivetract tumors, pancreatic cancers, and breast cancer.41

We have demonstrated that Ptch1 protein can beinduced in SCC cells by addition of Shh protein. Simi-lar results related to Shh induction have been demon-strated in a subset of a human oral SCC cell lines.10

Because no change in mRNA levels of PTCH1 wasdetected after Shh treatment, we speculate that thiseffect is the result of increased stability or recyclingof the Ptch1 protein. The same treatment, on theother hand, decreased the Gli1 protein level. Thisinverse relation of these proteins was detected on tu-mor samples, as well as in the tested cell line. It wasshown that PTCH1 expression is higher in poorly dif-ferentiated tumors, whereas GLI1 showed a lowerexpression in this subset. The opposite is true for thewell differentiated tumors (Supplemental Table 3).Furthermore, high mRNA levels of Gli1 negativelycorrelates with pN status. This observation is surpris-ing because in tumors of other sites of the body Gli1gene expression represents strong predictor of unfav-orable outcome.42,43 This intriguing finding demandsfurther investigations for its clarification.

Frequent loss of the PTCH1 locus in SCC may bethe initial step that causes the deregulation of thispathway, because Ptch1 protein is a sensitive regula-tor of the pathway. Events in the mucosa of long-termalcohol users that lead to hyperproliferation of basallayer may induce local Shh production, which canlead to the initial upregulation of Gli1 protein andpathway activation. Gli1 protein was detected only inlow Broders’ stages, when the tumor is well differenti-ated. Because one of the target genes of the Hh-Glisignaling pathway is Cyclin D1,25 it is possible thatpathway activation bypasses the p16-regulated cellcycle checkpoint and enables cell cycle progression.When, during tumor progression, a series of otherchanges, aided by tobacco use and survivin-inducedinhibition of apoptosis, transforms cells into a moremalignant phenotype, the Hh-Gli signaling maybecome obsolete and eventually shut down. This maybe the result of the reactivated feedback loop of Ptch1protein, whose gene expression is upregulated inpoorly differentiated tumors.

Acknowledgment. We would like to thank Dr.Anna Kenney for Shh protein, and Dr. JasminkaPavelic for the FaDu cell line. We also thank all thepatients who agreed to participate in this study.

REFERENCES

1. Warnakulasuriya S. Global epidemology of oral and oropharyngealcancer. Oral Oncol 2009;45:309–316.

2. Perez-Ordonez B, Beauchemin M, Jordan RCK. Molecular biol-ogy of squamous cell carcinoma of head and neck. J Clin Pathol2006;59:445–453.

3. Hall JM, Hooper JE, Finger TE. Expression of Sonic Hedgehog,Patched and Gli1 in developing taste papillae of the mouse. JComp Neurol 1999;406:143–155.

4. Gritli-Linde A, Bei M, Maas R, et al. Shh signaling within thedental epithelium is necessary for cell proliferation, growth andpolarization. Development 2002;129:5323–5237.

5. Jaskoll T, Leo T, Witcher D, et al. Sonic hedgehog signalingplays an essential role during embriogenic salivary gland epithe-lial branching morphogenesis. Dev Dyn 2004;229:722–732.

6. Watkins DN, Peacock CD. Hedgehog signaling in foregut malig-nancy. Biochem Pharmacol 2004;68:1055–1060.

7. Cohen MM Jr. The Hedgehog signaling network. Am J MedGenet 2003;123A:5–28.

8. Lauth M, Toftgard R. Non-canonical activation of GLI transcrip-tion factors. Cell Cycle 2007;6:2458–2463.

9. Sah NK, Khan Z, Khan GJ, et al. Structural, functional andtherapeutic biology of survivin. Cancer Lett 2006;244:164–171.

10. Nishimaki H, Kasai K, Kozaki K, et al. A role of activated Sonichedgehog signaling for the cellular proliferation of oral squa-mous cell carcinoma cell line. Biochem Biophys Res Comm2004;314:313–320.

11. Schneider S, Thurnher D, Kloimstein P, et al. Expression of theSonic hedgehog pathway in squamous cell carcinoma of the skinand mucosa of the head and neck. Head Neck 2010 [Epub aheadof print]

12. Greene FL, Page DL, Fleming ID, et al (editors). AJCC CancerStaging Manual, 6th ed. New York: Springer; 2002.

13. Eichberger T, Sander V, Scnidar H, et al. Overlapping and dis-tinct regulator properties of the GLI1 and GLI2 oncogenes.Genomics 2006;87:616–632.

14. Regl G, Neill GW, Eichberger T, et al. Human GLI2 and GLI1are part of a positive feedback mechanism in Basal Cell Carci-noma. Oncogene 2002;21:5529–5539.

15. Kallassy M, Toftgard R, Ueda M, et al. Patched (ptch)-associatedpreferential expression of smoothened (smoh) in human basalcell carcinoma of the skin. Cancer Res 1997;57:4731–4735.

16. Bocker W, Yin Z, Drosse I, et al. Introducing a single-cell-derivedhuman mesenchymal stem cell line expressing hTERT after len-tiviral transfer. J Cell Mol Med 2008;12:1347–1359.

17. Song H, Xin X-Y, Xiao F, et al. Survivin gene RNA interferenceinhibits proliferation, induces apoptosis and enhances radiosen-sitivity in HeLa cells. Eur J Obstet Gynecol Reprod Biol2006;136:83–89.

18. Hoffmann A-C, Warnecke-Eberz U, Luebke T, et al. SurvivinmRNA in peripheral blood is frequently detected and signifi-cantly decreased following resection of gastrointestinal cancers.J Surg Oncol 2007;95:51–54.

19. Milutin-Gasperov N, Sabol I, Halec G, Matovina M, Grce M. Ret-rospective study of the prevalence of high-risk human papilloma-viruses among Croatian women. Coll Antropol 2007;31:89–96.

20. Forslund O, Antonsson A, Nordin P, Stenquist B, Goran Hans-son B. A broad range of human papillomavirus types detectedwith a general PCR method suitable for analysis of cutaneoustumours and normal skin. J General Virol 1999;80:2437.

21. Xuan YH, Jung HS, Choi Y-L, et al. Enhanced expression ofhedgehog signaling molecules in squamous cell carcinoma ofuterine cervix and its precursor lesions. Modern Pathol2006;19:1139–1147.

22. Yauch RL, Gould SE, Scales SJ, et al. A paracrine requirementfor hedgehog signalling in cancer. Nature Lett 2008;455:406–411.

23. Wang D, Grecula JC, Gahbauer RA, et al. P16 gene alterationsin locally advanced squamous cell carcinoma of the head andneck. Oncol Rep 2006;15:661–665.

24. Cretnik M, Poje G, Musani V, et al. Involvement of p16 andPTCH in pathogenesis of melanoma and basal cell carcinoma.Int J Oncol 2009;34:1045–1050.

25. Duman-Scheel M, Weng L, Xin S, Du W. Hedgehog regulatescell growth and proliferation by inducing Cyclin D and Cyclin E.Nature 2002;417(6886):299–304.

26. Levanat S, Kappler R, Hemmerlein B et al. Analysis of thePTCH1 signaling pathway in ovarian dermoids. Int J Mol Med2004;14:793–799.

Hh-Gli Signaling in SCC HEAD & NECK—DOI 10.1002/hed January 2012 111

27. Ishiyama A, Hibi K, Koike M, et al. PTCH gene expression as apotential marker for esophageal squamous cell carcinoma. Anti-cancer Res 2006;26:195–198.

28. Fukuda S, Pelus LM. Survivin, a cancer target with an emerg-ing role in normal adult tissues. Mol Cancer Ther 2006;5:1087–1098.

29. Slaughter DP, Southwick HW. Field cancerization in oral strati-fied squamous epithelium. Clinical implications of multicentricorigin. Cancer 1953;6:963–968.

30. Riedel F, Goessler U, Hormann K. Alcohol-related diseases ofthe mouth and throat. Best Practice Res Clin Gastroenterol2003;17:543–555.

31. Proia NK, Paszkiewicz GM, Sullivan Nasca MA, et al. Smokingand smokeless tobacco-associated human buccal cell mutationsand their association with oral cancer—a review. Cancer Epide-miol Biomarkers Prev 2006;15:1061–1077.

32. Herrero R. Human Papillomavirus and Oral Cancer: The Inter-national Agency for Research on Cancer Multicenter Study. Can-cerSpectrum Knowledge Environment 2003;95:1772–1783.

33. Machado J, Reis PP, Zhang T, et al. Low prevalence of humanpapillomavirus in oral cavity carcinomas. Head Neck Oncol2010;2:6.

34. Marur S, D’souza G, Westra WH, Forastiere AA. HPV-associatedhead and neck cancer: a virus-related cancer epidemic. LancetOncol 2010;11:781–789.

35. Le H, Kleinerman R, Lerman OZ, et al. Hedgehog signaling isrequired for normal wound healing. Wound Repair Regen 2008;16:768–773.

36. Zhou J-x, Jia L-w, Liu W-m, et al. Role of Sonic hedgehog inmaintaining a pool of proliferating stem cells in the human fetalepidermis. Hum Reprod 2006;21:1698–1704.

37. Levanat S, Pavelic B, Crnic I, et al. Involvement of PTCH genein various noninflammatory cysts. J Mol Med 2000;78:140–146.

38. Levanat S, Gorlin RJ, Fallet S, et al. A two-hit model for devel-opmental defects in Gorlin syndrome. Nat Genet 1996;12:85–87.

39. Makowski GJ, McGuff S, Van Sickles JE. Squamous cell carci-noma in a maxillary odontogenic keratocyst. J Oral MaxillofacSurg 2001;59:76–80.

40. Ma X, Sheng T, Zhang Y, et al. Hedgehog signaling is activated insubsets of esophageal cancers. Int J Cancer 2006;118:139–148.

41. Katoh Y, Katoh M. Hedgehog target genes: mechanisms of carci-nogenesis induced by aberrant hedgehog signaling activation.Curr Mol Med 2009;9:873–886.

42. Feldmann, G, Dhara S, Fendrich V, et al. Blockade of hedgehogsignaling inhibits pancreatic cancer invasion and metastases: anew paradigm for combination therapy in solid tumors. CancerRes 2007;67:2187–2196.

43. Ma X, Chen K, Huang S, et al. Frequent activation of the hedgehogpathway in advanced gastric adenocarcinomas. Carcinogenesis2005;26:1698–1705.

112 Hh-Gli Signaling in SCC HEAD & NECK—DOI 10.1002/hed January 2012