Herpes Simplex Virus-1 Up-regulates IL-15 Gene Expression in Monocytic Cells Through the Activation...

doi:10.1016/j.jmb.2006.12.060 J. Mol. Biol. (2007) 367, 25–35

Herpes Simplex Virus-1 Up-regulates IL-15 GeneExpression in Monocytic Cells Through the Activationof Protein Tyrosine Kinase and PKC Zeta/LambdaSignaling Pathways

Rasheed Ahmad1,2, Jamila Ennaciri1,2, Paulo Cordeiro1

Souad El Bassam1,2 and José Menezes1,2⁎
1Laboratory of Immunovirologyand Viral and Immune DiseasesProgram, Sainte JustineHospital Research Center,3175 Chemin CoteSte-Catherine, Montreal,QC, H3T 1C5, Canada2Department of Microbiologyand Immunology, Faculté deMedecine, University ofMontreal, Montreal,QC, H3C 3J7, Canada
Abbreviations used: HSV-1, herpesNK, natural killer; IL-15, interleukinlymphocyte; PTK, protein tyrosine kkinase C; pfu, plaque-forming unit.E-mail address of the correspondi

[email protected]

0022-2836/$ - see front matter © 2007 E

IL-15 plays a seminal role in innate immunity through enhancing thecytotoxic function as well as cytokine production by NK and T cells. Wehave previously shown that exposure of PBMC as well as monocytic cellsto different viruses results in immediate up-regulation of IL-15 geneexpression and subsequent NK cell activation as an innate immuneresponse of those cells to these viruses. However, no signaling pathwayinvolved in this up-regulation has been identified. Here we show for thefirst time that HSV-1-induced up-regulation of IL-15 gene expression isindependent of viral infectivity/replication. IL-15 gene is up-regulated byHSV-1 in human monocytes, but not in CD3+ T cells. HSV-1 induces thephosphorylation of protein tyrosine kinases (PTKs) and protein kinase C(PKC) for inducing IL-15 expression in monocytic cells. Inhibitors forPTKs reduced HSV-1-induced PTK activity, DNA binding activity of NF-kB as well as IL-15 gene expression. In contrast, an inhibitor formembrane-bound tyrosine kinases had no effect on these events.Experiments using PKC inhibitors revealed that phosphorylation ofPKC zeta/lambda (PKC ζ/λ), DNA binding activity of NF-kB andHSV-1-induced up-regulation of IL-15 were all decreased. Furthermore,we found that HSV-1-induced IL-15 up-regulation was also dependent onPTKs regulation of PKC phosphorylation. Thus, we conclude that IL-15up-regulation in HSV-1-treated monocytic cells is dependent on theactivity of both PTKs and PKC ζ/λ.

© 2007 Elsevier Ltd. All rights reserved.

*Corresponding author
Keywords: IL-15; up-regulation; HSV-1; protein tyrosine kinase; THP-1 cells
Introduction

During the initial phase of an infection, a stronginnate host immune response is a key defensemechanism aimed at controlling and eliminatingthe invading pathogen. This involves the activa-tion of natural killer (NK) cells and macrophagesand the generation of cytokines and chemokines.

simplex virus type 1;-15; CTL, cytotoxicinase; PKC, protein

ng author:c.ca

lsevier Ltd. All rights reserve

Herpes simplex 1 (HSV-1) infection induces theproduction of a variety of cytokines includinginterleukin 15 (IL-15).1–4 IL-15 is a cytokine thatbelongs to the four-helix bundle cytokine familyand is constitutively expressed in several humantissues and cell lines.5,6 Among the immunocytes,IL-15 is produced mainly by macrophages, mono-cytes and dendritic cells, shares many biologicalproperties with IL-2 but only has limitedsequence homology with the latter. IL-15 playsan important role in innate immunity throughmultifunctional aspects including enhancing thecytotoxic function of NK and cytotoxic lympho-cyte (CTL) cells as well as cytokine production byNK and T cells. IL-15 is essential for thedevelopment of NK cells7–9 and also plays animportant role in NK survival.7,10 Also, it is

d.

mailto:[email protected]

26 IL-15 Up-regulation by HSV-1 via PTK and PKC ζ/λ

required for the maintenance and renewal oftumor or viral-specific memory and naïve CD8+ Tcells.11–13 IL-15 is known as a pleiotropic cytokinethat, in addition, functionally acts as an interfacebetween the innate and the adaptive immunesystem.14

To be able to produce proinflammatory cyto-kines, cells are equipped with various mechanismsthat are able to sense viral and other pathogenscomponents and initiate intracellular signal trans-duction mediated by protein kinases whose ulti-mate targets are nuclear factors. These pathwaysconsist of cascades of biochemical events thatinclude the phosphorylation of a variety of proteinkinases. In turn, these kinases modulate otherfactors and control gene expression.15–18 Proteinkinases are important components of signallingpathways and play a central role in the regulationof cytokines. Human protein kinases can bedivided into two main classes: the protein tyrosinekinases and the serine/threonine kinases (S/T Ks).The tyrosine kinases consist of both receptortyrosine kinases (RTKs) and cytosolic kinases thatparticipate in signalling events in monocytes.10,19

The serine/threonine kinase family consistsmainly of PKA, PKG, PKC and CaM KII. Amajor portion of these kinases is in a soluble andinactive form in most cell types. Interaction ofviral surface proteins with cell membrane pro-teins or receptors triggers the production ofthe initial lot of cytokines. In addition, many otherproteins are produced during the viral lifecycle, which also lead to the induction of cyto-kines. Monocytes respond against different viralproteins through the activation of protein kinases.Following activation, these kinases phosphory-late their downstream targets and activate tran-scription factors including NF-kB, CREB andIRF3.20

We have previously shown that monocytesrespond to HSV-1 by up-regulating IL-15production.1 Since viruses may activate tyrosineand serine/threonine kinases, we hypothesizedthat HSV-1 up-regulates IL-15 through the invol-vement of these kinases. Here, therefore, weinvestigated the signal transduction pathwaysinvolved in the induction of IL-15 in HSV-1-treated cells. To this end, we chose a monocyticcell line, THP-1, as a model for our investigation.Here, we show that initiation of the cellularresponse in the induction of IL-15 mRNA andprotein expression in monocytic cells treated withHSV-1 is independent of viral infectivity andreplication. IL-15 induction in these cells consider-ably decreased when different specific inhibitorsblocked phosphorylation of tyrosine kinases andprotein kinase C (PKC) and also blocked the DNAbinding of NF-kB. It was also found that solubleprotein tyrosine kinases (PTKs) were activatedand membrane-bound PTKs were not involved.Moreover, we found that such signalling involvesthe activation of PTKs followed by the phospho-rylation of PKC.

Results

HSV-1 up-regulates biologically active IL-15production in monocytic cells

THP-1 cells constitutively express low levels of IL-15 and upon stimulation with HSV-1, there is aremarkable up-regulation of IL-15. To test whetherthis increase in response to HSV-1 depends on virusinfectivity or simply on virus−cell surface binding,cells were treated with heat-inactivated or UV-inactivated HSV-1 particles. Mock-treated cellswere used as a control. Quantification of IL-15mRNA levels showed a significant increase in cellstreated with viral particles compared to the mock-treated control. These results were comparable atboth the mRNA and protein levels (Figure 1(a), (b)and (c)). Interestingly, we did not find any sig-nificant difference in IL-15 levels between cellstreated with infectious and inactivated viral parti-cles. Also, primary monocytes highly expressed IL-15 mRNA in response to HSV-1 (Figure 1(d)).

Kinetics of HSV-1-mediated up-regulation ofIL-15 in THP-1 cells

To determine the kinetics of HSV-1-mediated up-regulation of IL-15 gene expression as well as theoptimal viral dose to cause this enhancement, cellswere treated with various concentrations of virus for6 h or virus-treated cells were harvested at varioustime points post-infection for a fixed amount ofvirus and IL-15 mRNA levels measured. Theselevels reached a maximum of fourfold at 3 plaque-forming units (pfu)/cell. No further increase wasobserved at higher concentrations, i.e. 5 pfu/cell and7 pfu/cell (Figure 2(a)). Also, IL-15 mRNA levelsstarted increasing at 3 h post-infection and reached apeak at 7 h; the peak level remained steady until 9 hand then declined (Figure 2(b)).

HSV-1-induced IL-15 up-regulation: involvementof protein tyrosine kinases

To investigate whether HSV-1-induced up-regula-tion of IL-15 was dependent on PTKs activity, cellswere pre-incubated with specific inhibitors of thesekinases: Herbimycin A, SU6656, Tyrphostin AG1478and Genistein, and then incubated with HSV-1 for6 h; RNA was isolated then for RT-PCR. Allinhibitors, except for Tyrphostin AG1478 (a specificinhibitor for membrane-bound tyrosine kinases),significantly blocked the HSV-1 induction of IL-15mRNA compared to cells that were only pre-treatedwith HSV-1 (Figure 3(a)). These results suggest thatsoluble tyrosine kinases are involved in this induc-tion, whereas surface-bound receptor tyrosinekinases are not. To determine whether the reductionof IL-15 protein expression by these reagents wascorrelated with the corresponding mRNA levels,THP-1 cells were incubated in the presence orabsence of these inhibitors and then treated with

Figure 1. HSV-1-induced up-regulation of IL-15 expression in THP-1 cells. (a) IL-15 mRNA expression in THP-1 cells.Total RNA was extracted from THP-1 cells treated with mock (control), HSV-1, heat-inactivated HSV-1 and UV-inactivated HSV-1 and RT-PCR with primers for IL-15 and 18 S rRNA performed. This experiment was repeated threetimes and similar results were obtained. 18 S rRNA served as a gel loading/RT-PCR control (lower band). (b) IL-15 proteinexpression. THP-1 cells were treated with mock (control), infectious HSV-1, HI-HSV-1 and UV-HSV-1. Expression of IL-15was determined by flow cytometry. Data shown represent mean fluorescence±SD from three independent experiments.Comparison of results between HSV-1 and mock-treated cells was performed using the t-test. (c) FACS analysis of IL-15protein expression. Flow cytometry histograms show representative data from one of three experiments. (d) IL-15 mRNAexpression in human monocytes and CD3+ T cells. Monocytes and CD3+ T cells were isolated from PBMCs, then treatedwith mock and HSV-1. Total RNA was extracted and RT-PCR with primers for IL-15 and 18 S rRNA performed. Thisexperiment was repeated three times and similar results were obtained. 18 S rRNA served as a gel loading/RT-PCRcontrol (lower band).

27IL-15 Up-regulation by HSV-1 via PTK and PKC ζ/λ

HSV-1. After 24 h, IL-15 expression on the cells wasdetermined by staining with FITC-conjugated IL-15antibodies (Figure 3(b)) Results for protein levelswere comparable to those of mRNA levels.To test the involvement of PTK in HSV-1-induced

up-regulation of IL-15, PTK activity was measuredas described in Materials and Methods. THP-1 cellsincubated with HSV-1 showed a rapid increase in

total PTK activity (Figure 3(c)). The increase wasevident as early as 5 min after the incubation andbegan to decline slowly at first, and more rapidlyafterward, within 20 min. The effects of HerbimycinA, SU6656, Tyrphostin AG1478 and Genistein onPTK activity induced by HSV-1 were also examined.Cells pre-treated with these inhibitors and thenstimulated with HSV-1 showed a decrease in PTK

Figure 2. (a) HSV-1 dose-dependent expression of IL-15. THP-1 cells were exposed to various concentrations ofHSV-1 (i.e. 1, 2, 3, 5, and 7 pfu/cell). Total RNA was iso-lated and used for determining IL-15 expression throughRT-PCR using primers for IL-15 and 18 S rRNA.Quantification of IL-15 mRNA was based on its expres-sion relative to the amount of 18 S ribosomal RNA (inter-nal control). (b) Kinetics of IL-15 mRNA expression inTHP-1 cells exposed to HSV-1. THP-1 cells were exposedto HSV-1 for different time periods (1, 3, 5, 7, 9 and 11 h).Mock and HSV-1-treated cells were harvested and totalmRNA was isolated. IL-15 mRNA was amplified by RT-PCR.


activity compared with controls (stimulated withHSV-1 in the absence of inhibitors). However, cellspre-treated with Tyrphostin AG1478 and stimulatedwith HSV-1 did not show lower PKTactivity (Figure3(d)). These results clearly indicate that onlycytoplasmic tyrosine kinases are involved in HSV-1-induced tyrosine kinase activity. Receptor-boundtyrosine kinases are not involved in HSV-1-inducedtyrosine kinase activity.To assure that inhibitors did not have a direct

effect on the induction of IL-15, we treated cells withinhibitors alone and measured the IL-15 levels. Wefound no difference compared to mock-treated cells(data not shown).

Involvement of PKC in the up-regulation of IL-15expression

Like protein tyrosine kinases, PKC is also animportant component in signal transduction. Toevaluate the role of PKC in the HSV-1-induced up-regulation of IL-15, THP-1 cells were pre-incubatedwith PKC inhibitor peptide 19-31, RO-31-8220,Bisindolylmaleimide 1 (inhibitors for PKC) orStaurosporine (a broad-spectrum inhibitor of ser-ine/threonine kinases) and then stimulated withHSV-1. Bisindolylmaleimide 1 and Staurosporine

greatly reduced HSV-1 induction of IL-15 at both themRNA and protein levels (Figure 4(a) and (b)).Although there was some variation among theeffects of different inhibitors, the reduction in IL-15expression was nevertheless significant.We then further analyzed the involvement of

signal transduction components in terms of theability of HSV-1 to activate PKC by inducingphosphorylation during the IL-15 up-regulation. Inpreliminary experiments, we used antibodiesagainst different PKC isoforms and found thatHSV-1-induced phosphorylation of only PKC ζ/λ(data not shown). Time-course experiments, usinganti-phospho PKC ζ/λ antibodies, indicated thatincreased PKC ζ/λ levels were detectable 5 minafter HSV-1 treatment, reaching maximal levels by15 min, and then returning to basal levels (Figure4(c)). In order to confirm PKC ζ/λ activation byHSV-1, the effect of specific inhibitors (PKC inhibitorpeptide 19-31 and Bisindolylmaleimide 1) on theactivation of these kinases was also examined. Asshown in Figure 4(d), cell lysates prepared fromTHP-1 cells treated with specific inhibitors andstimulated with HSV-1 for 15 min, showed a cleardecrease in the intensity of the PKC ζ/λ immuno-reactive bands compared to the controls. We ob-served that the activation due to HSV-1 stimulationwas inhibited, as was the baseline expression ofphosphorylated PKC ζ/λ. These results suggestthat PKC ζ/λ are important in HSV-1 induced IL-15up-regulation.To determine whether PKC is involved in the

activation of PTK in HSV-1-induced up-regulationof IL-15, PTK activity was measured in THP-1 cellspre-treated with PKC inhibitors (Bisindolylmalei-mide 1 and PKC inhibitor peptide 19-31) and thenstimulated with HSV-1. Pre-treated cells did notshow a decrease in PTK activity compared withcontrols (stimulation with HSV-1 in the absence ofinhibitors) (Figure 4(e)). From these results, it is clearthat PKC kinases are not involved in HSV-1-inducedtyrosine kinase activity.

Activation of PKC in response to HSV-1 ismediated through PTK activation

Our results have shown that PKC ζ/λ phosphor-ylation represents a downstream effect of cellularresponse to HSV-1. During HSV-1-induced cellularactivation, PKC ζ/λ might be phosphorylated byPTK. In earlier experiments (Figures 3(a) and (b)and 4(a) and (b)) we showed that inhibition of PTKhad a strong effect on the reduction of HSV-1-induced IL-15 up-regulation as compared to PKCinhibition. To investigate the combined effects ofthese kinases (i.e. PKC and PTK) on this induction,THP-1 cells were pre-treated with a combination ofPTK and PKC inhibitors followed by treatmentwith virus. Results shown in Figure 5(a) and (b)indicate that HSV-1-induced IL-15 up-regulationwas greatly reduced following treatment with thecombination as compared to the cells pre-treatedwith the PKC or PTK inhibitors separately. Since

Figure 3. Effect of protein tyrosine kinase (PTK) inhibitors on HSV-1-induced IL-15 up-regulation. (a) IL-15 mRNAexpression in THP-1 cells pre-treated with PTK inhibitors. THP-1 cells were pre-treated with the following inhibitors: (1)Herbimycin A, (2) SU6656, (3) Tyrphostin AG1478 and (4) Genistein followed by treatment with HSV-1. Total RNAwasisolated and used for RT-PCR using primers for IL-15 and 18 S rRNA. (b) IL-15 protein expression in THP-1 cells pre-treated with PTK inhibitors. Cells were pre-treated with the PTK inhibitors andHSV-1 as described above. Cells were thenstained for IL-15 and analyzed by flow cytometry. Similar results were obtained in two additional experiments. (c)Phosphorylation of tyrosine kinases in THP-1 cells treated with HSV-1. THP-1 cells were treated with HSV-1 for theindicated times. Kinase activity was measured in cellular lysates by ELISA at different times post-treatment. (d) Effect ofPTK inhibitors on HSV-1-induced phosphorylation of tyrosine kinases. THP-1 cells were pre-treated with PTK inhibitorsas indicated. Then, cells were incubated with HSV-1 and cell lysates were analyzed for kinase activity as described inMaterials and Methods.


HSV-1 induced the activation of PKC and PTKs, wealso examined the contribution of PTK activity toIL-15 up-regulation by this virus. Cells treated withPKC inhibitor (Bisindolylmaleimide 1) and PTKinhibitors (Herbimycin A and SU6656) showed areduced response to HSV-1-induced IL-15 produc-tion and a reduction in PKC ζ/λ phosphorylation(Figure 5(c)). However, inhibition of PKC did notaffect the activation of PTKs (Figure 4(e)). Thesedata suggest that PKC ζ/λ activity is, at leastpartly, dependent on the activity of PTK in thepresent system. From these results, it is also clearthat PTKs are more effective, as compared to PKC,in IL-15 up-regulation in monocytic cells.

Effect of protein kinase inhibitors on NF-kBactivation in HSV-1-induced IL-15 up-regulation

Since the IL-15 promoter contains a specificsequence for NF-kB binding, the role of PTK andPKC in NF-kB activation for IL-15 up-regulation byHSV-1 was examined. THP-1 cells pre-incubatedwith PTK and PKC inhibitors were treated with viralparticles and nuclear cell extracts were harvested forEMSA. Both kinds of inhibitors decreased thebinding of nuclear proteins to the oligonucleotideencoding the NF-kB consensus binding sequence(Figure 6). PTK inhibitors highly suppressed theDNA binding of NF-kB (SU6656) as compared to

Figure 4. Effect of PKC inhibitors on HSV-1-induced IL-15 up-regulation. (a) IL-15 mRNA expression in THP-1cells pre-treated with PKC inhibitors. THP-1 cells were pre-treated with PKC inhibitors: (1) PKC inhibitor peptide 19-31, (2) Ro-31-8220, (3) Bisindolylmaleimide 1 and (4) Staurosporine followed by treatment with HSV-1. Total RNA wasextracted and used for RT-PCR. (b) IL-15 protein expression in THP-1 cells pre-treated with PKC inhibitors. Forprotein expression, cells were pre-treated with inhibitors as described earlier. After treatment with HSV-1, cells werestained for IL-15. Similar results were obtained in two additional experiments. (c) Kinetic of HSV-1-induced PKCphosphorylation in THP-1 cells. THP-1 cells were treated for the indicated time with HSV-1. Cellular lysates wereprepared and used for immunoblot analysis using an antibody against p-PKC ζ/λ. The membrane was restripped andincubated with an antibody against β-actin (gel loading control). (d) Effect of PKC inhibitors on PKC ζ/λphosphorylation. THP-1 cells were pre-treated with PKC inhibitors: (1) PKC inhibitor peptide 19-31 and (2)Bisindolylmaleimide 1 then treated with HSV-1. Cell lysates were prepared and used for immunoblot. (e) Effect ofPKC inhibitors on HSV-1-induced phosphorylation of tyrosine kinases. THP-1 cells were pre-treated with PKCinhibitors: Bisindolylmaleimide 1 and PKC inhibitor peptide 19-31. Then, cells were incubated with HSV-1 and celllysates were analyzed for kinase activity as described in Materials and Methods.


PKC inhibitors (PKC inhibitor peptide and Bisindo-lylmaleimide 1). Tyrphostin did not reduce the HSV-1-induced DNA binding of NF-kB. Combination of

PTK and PKC inhibitors also showed an additiveeffect on the DNA binding of NF-kB (SU6656+PKCinhibitor peptide 19-31 and SU6656+Bisindolylma-

Figure 5. Combined effect of PKC and PTK inhibitors on HSV-1 induced up-regulation of IL-15. (a) IL-15 mRNAexpression in THP-1 cells pre-treated with PKC and PTK inhibitors. Cells were pre-treated with inhibitors: (1) HerbimycinA + Bisindolylmaleimide 1, (2) Herbimycin A + PKC inhibitor peptide 19-31, (3) SU6656 + Bisindolylmaleimide 1 and (4)SU6656 + PKC inhibitor peptide 19-31, then treated with HSV-1. Total RNAwas isolated and used for RT-PCR. (b) IL-15protein expression in THP-1 cells pre-treated with PKC and PTK inhibitors. Cells were treated with inhibitors as describedearlier, after treatment with HSV-1, cells were incubated for 23 h for protein expression detected by IL-15 stainingprocedure as described in Materials and Methods. (c) Effect of PTK inhibitors on PKC ζ/λ phosphorylation. Cells werepre-treated with inhibitors: (1) Bisindolylmaleimide 1, (2) Herbimycin A, (3) SU6656 and then treatedwith HSV-1. Cellularlysates were prepared and used for immunoblot analysis using an antibody against p-PKC. The membrane wasrestripped and incubated with an antibody against β-actin.


leimide 1). On the other hand, for cells not treatedwith inhibitors, HSV-1 significantly increased thebinding of nuclear proteins to the oligonucleotide ascompared to mock treated cells. Dimethylsulfoxide(DMSO) and acetic acid were used as a control forthe solvents with which the stock solutions ofinhibitors were prepared.

Effect of the PTK or PKC inhibitors on CD3+T cell proliferation induced by IL-15 produced inHSV-1-treated monocytes

IL-15 is a potent growth factor for T cell pro-liferation.5,22 To determine the ability of the super-natant as well as membrane-bound IL-15 to up-regulate T cell proliferation, Con A-stimulatedhuman purified CD3+ T cells were co-cultured withmitomycin-treated purified monocytes that hadpreviously been treated with HSV-1. The prolifera-tion of CD3+ T cells was significantly enhanced bythe presence of HSV-1-treated monocytes as com-pared with the mock treated monocytes or with T

cells alone. The addition of neutralizing anti-IL-15antibody to the culture significantly inhibited theCD3+ T cell proliferation induced by HSV-1-treatedmonocytes. The antibody matched isotype controlIgG1 showed no effect (Figure 7(a)). These resultssuggest that the HSV-1-induced IL-15 is functionallyactive. We did not find any significant difference inIL-15-induced T cell proliferation between mono-cytes treated with activated and inactivated viralparticles (Figure 7(b)).We also examined the activity of IL-15 produced

by monocytes (that were pretreated by differentinhibitors of PTK and PKC and then treated byvirus) on T cell proliferation. All these inhibitors,except tyrphostin, blocked IL-15-induced prolifera-tion of T cells (Figure 7(c)).

Discussion

We show here that IL-15 is up-regulated inTHP-1 cells after cell surface contact with viral

Figure 7. (a) HSV-1-induced IL-15 in monocytes andits biological activity. CD3+ Tcells (T) were incubated withmedium, HSV-1 and mitomycin C-treated monocytes (M)and later with anti-IL-15, anti-IL-2 antibodies and IgG1(isotype matched control antibody). Proliferative activitywas assessed by an [3H]thymidine incorporation assay. (b)Effect of infectious and inactivated HSV-1 on the biologicalactivity of IL-15. Monocytes were treated with HSV-1, HI-HSV-1 and UV-HSV-1 prior to incubation with CD3+ Tcells. The proliferation of CD3+ T cells induced by IL-15was measured. (c) Effect of PTK, PKC or combination ofthese inhibitors on the HSV-1-induced biological activityof IL-15. Monocytes were treated with PTK, PKC orcombination of these inhibitors prior to the stimulationwith HSV-1. CD3+ T cells were incubated with monocytesand [3H]thymidine incorporation was measured.

Figure 6. HSV-1-induced NF-kB activation abrogatedby inhibitors of PTK and PKC. THP-1 cells were pre-treated with inhibitors then stimulated with HSV-1. Celllysates were subjected to EMSA analysis with a radi-olabeled IL-15 promoter NF-kB site. Unlabeled duplexwas used with wild-type (lanes a) or a non-specificcompetitor (lanes b). NF-kB binding was visualized byautoradiography. Samples were: (1) mock-treated, (2)HSV-1, (3) Tyrphostin AG1478, (4) SU6656, (5) PKCinhibitor peptide 19-31, (6) Bisindolylmaleimide 1, (7)DMSO + acetic acid: control, (8) SU6656 + PKC inhibitorpeptide 19-31, (9) SU6656 + Bisindolylmaleimide 1.


particles, from both infectious and inactivated (i.e.with heat or UV) viral preparations. We also foundthat inactivated virus was as effective as theinfectious virus, indicating that viral infectivity andreplication is not necessary for the production of IL-15 and contrasting with observations relating tosome other virus-induced cytokines that requireviral replication and cell cycle proteins for theirproduction.23–26 Our data show that HSV-1 initiatesa signalling cascade that leads to the activation ofdifferent cellular signalling components, whichultimately up-regulate the transcription factor NF-kB leading to the up-regulation of the IL-15 gene.Despite considerable number of reports indicat-

ing that viral particles induce the up-regulation ofcytokines that are crucial in controlling innateand adaptive immune responses, the role ofprotein kinases that may govern the inductionof IL-15 expression in response to HSV-1 (or any

others virus) has not yet been reported. Multiplesignalling molecules are activated in response toviral particles, of which the PTKs and PKC areprominent. Our particular interest was to exam-ine the HSV-1 activated PTKs and PKC and theireffect on HSV-1-induced up-regulation of IL-15. Inthis context, our data provide information onsignalling pathways in which activation of PTKand PKC takes place leading to NF-kB and IL-15gene activation. Active PTK increases transcrip-tion of IL-15, whereas inhibition of PTK activitydecreases IL-15 induction and also slows downthe translocation of NF-kB. However, inhibitionof PTK did not completely block IL-15 produc-tion, whereas it blocked NF-kB activation,


suggesting that IL-15 up-regulation by HSV-1may not occur through one single mechanism, butrather through multiple pathways (including tyr-osine phosphorylation).One of the interesting findings in the present

study was the fact that HSV-1 not only up-regulatesIL-15 through PTK activity but it also activates othersignalling components belonging to the S/T kinasefamily. In this context, we found that HSV-1 inducedphosphorylation of PKC. On the other hand, PKAand PKG were not activated (data not shown).Inhibition of the phosphorylation or activity of PKCζ/λ significantly suppressed the induction of IL-15and also of the translocation of NF-kB to the nucleus,suggesting that phosphorylation of PKC ζ/λ isimportant for the induction of IL-15. Previousstudies have shown that HSV-1-induced PKCphosphorylation played a role in the replication ofthe virus.27 However, our results demonstrate thatthe treatment of cells with HSV-1 activates PKC ζ/λ,which leads to the activation of NF-kB resulting inthe up-regulation of IL-15. This would suggest thatPKC activation works on two aspects: it helps viralreplication as well as the transcription of the IL-15gene through NF-kB. Since UV-inactivated viruswas used in this study, it might only activate thosePKC molecules that are involved in the activation ofNF-kB. It has been found that phosphorylated formsof PKC were linked to active forms of NF-kB.28

Interestingly, PTK inhibitors significantly inhib-ited HSV-1-mediated PKC ζ/λ activation, indicat-ing that the tyrosine kinase activity of PTKs isrequired for maximal HSV-1-mediated PKC ζ/λactivation. PTK and PKC can phosphorylate and/or activate one another, leading to a signallingcrosstalk between these two different classes ofkinases. In particular, PTKs have been proposed toincrease signal transduction via PKC.29,30 Ourstudies indicate that PTKs participate in HSV-1-mediated NF-kB activation in the signalling net-work consisting of PTKs/PKC ζ/λ or independentpathways that converge at NF-kB to induce IL-15gene activation.In conclusion, we have shown that a variety of

cellular signalling pathways are activated in mono-cytic cells in response to HSV-1, leading to IL-15gene up-regulation. Our data show that the keycellular signalling components are soluble proteintyrosine kinases (including Src kinase family mem-bers) and serine/threonine kinases, particularlyPKC ζ/λ. Interestingly, these multiple signallingnetworks mediate activation in both interdependentand independent manners but the precise nature ofthis interaction remains to be determined.

Materials and Methods

Reagents

Herbimycin A, Staurosporine, protein kinase C inhi-bitor peptide 19-31, Bisindolylmaleimide 1, Genistein,SU6656, Tyrphostin AG1478 and RO-31-8220 were

purchased from Calbiochem (La Jolla, CA, USA). FITC-conjugated IL-15 antibody, FITC-conjugated mouse IgG1antibody, PE-conjugated CD14 antibody and FITC-conjugated CD3 antibody were all purchased from R&DSystems Technology (Minneapolis, MN, USA). Phospho-PKC antibody kit and goat anti-rabbit IgG HRP-linkedantibody were purchased from Cell Signalling Technol-ogy (Beverly, MA, USA). The ECL kit was purchasedfrom Amersham Biosciences (Baie d'Urfé, QC, Canada).The Gel Shift Assay System kit and alkaline phosphataseconjugated goat anti-rabbit IgG were obtained fromPromega (Madison, WI, USA). Monoclonal anti-β-actin,Mammalian cells protease inhibitor cocktail and theProtein Tyrosine Kinase Assay kit were purchased fromSigma (Oakville, ON, Canada). The Cytofix/Cytopermkit was purchased from BD Biosciences (Mississauga,ON, Canada).

Cell culture

Humanmonocytic cell lines were cultured in RPMI 1640medium supplemented with 10% (v/v) Fetal BovineSerum (FBS), 100 units/ml penicillin, 100 μg/ml strepto-mycin, 0.25 μg amphotericin B and 2 mM L-glutamine, at37 °C and 5% CO2. For all experiments, a cell concentra-tion of 2×106 cells/ml was used.

Preparation of HSV-1

HSV-1 (McIntyre strain) was produced in Vero cells asdescribed.3,4

Viral treatment

Heat inactivated virus was generated by incubatingthe purified virus in a 56 °C water bath for 1 h. Toobtain replication deficient virus (UV-inactivated), HSV-1was exposed in a 100 mm2 Petri dish (resting on an icesurface) to a 254 nm UV lamp at a distance of 23 cm for2 h with gentle agitation of the dish every 20 min. ThisUV treatment abrogated viral infectivity completely asdetermined by the inability of the inactivated viralpreparation to produce plaques on Vero cell monolayer.Based on results from preliminary experiments todetermine optimal viral dose (please see Results), unlessotherwise specified, all the following virus treatmenttests were performed using UV-inactivated virus at3 pfu/cell for 1 h with mixing every 15 min. The cellswere then washed and resuspended in RPMI containing10% FBS.

Detection of mRNA expression by RT-PCR

Total RNA was extracted from cells using the RNeasymini kit (Qiagen) as per manufacturer's instructions. RT-PCR was performed using the One Step RT-PCR kit(Qiagen) with 0.5 μg of total RNA per reaction andgene-specific primer pairs. The following thermal cyclerconditions were used: reverse transcription at 50 °C for30 min; reverse transcriptase inactivation step at 95 °Cfor 15 min; 35 cycles of denaturation at 94 °C for 1 min,annealing at 50 °C for 1 min and extension at 72 °C for1 min; and final extension at 72 °C for 10 min. The gene-specific primer pairs used were IL-15 (Fwd): 5′-GGATT-TACCGTGGCTTTGAGTAATGAG-3′ and IL-15 (Rev): 5′-GAATCAATTGCAATCAAGAAGTG-3′ for interleukin


15, which produces two bands at 550 bp and 640 bp21

and 18 S RNA (Fwd): 5′-TGCATGTCTAAGTACGCAC-GGCC-3′ and 18 S RNA (Rev): 5′-GATAGGGCAGACGT-TCGAATGGG-3′ for the 18 S ribosomal subunit, used ascontrol, which produces a 310 bp band. PCRproductswererun on a 2% (w/v) agarose gel that was soaked in TAEbuffer containing 0.5 μg/ml ethidium bromide for 20 minand then visualized under a UV light using the AlphaImager System (Alpha Innotech: San Leandro, CA, USA).Relative gene expression was determined by band densitycomparison using AlphaEase software (Alpha Innotech:San Leandro, CA, USA).

IL-15 protein expression by flow cytometry

IL-15 protein expression in THP-1 cells followingdifferent treatments was analyzed by flow cytometry.Briefly, cells were washed with cold PBS and permeabi-lized with the Cytofix/Cytoperm solution for 20 min onice. Then, cells were washed with the perm/wash bufferand resuspended with mouse IgG1 for 10 min to blocknon-specific binding. Finally, FITC-conjugated IL-15 anti-bodywas added. After 40min incubation on ice, cells werewashed with perm/wash buffer prior to flow cytometryanalysis.

Western blot analysis of phosphorylated PKC

After different treatments, cells were lysed with lysisbuffer (100 mM Tris (pH 6.8), 2% (w/v) SDS,mammalian cells protease inhibitor cocktail) and theprotein was measured using the BCA Protein Assay kitfrom Pierce (Rockford, IL, USA). Soluble proteins wereresolved on polyacrylamide gels and transferred toImmobilon-PVDF membranes (Millipore: Nepean, ON,Canada) and blocked overnight in PBS with 5% (w/v)milk. Membranes were subsequently incubated over-night at 4 °C with the primary antibody (Phospho-PKCor β-actin) diluted in 5% (w/v) BSA, washed in PBSand incubated for 1 h with goat anti-rabbit IgGantibody conjugated with horseradish peroxidase inPBS containing 5% milk. Immunoreactive bands werevisualized by chemiluminescent detection using theAmersham ECL Western blotting system (GE Health-care: Buckinghamshire, UK).

Tyrosine kinase assay

Cells pre-treated for 45min in the presence or absence ofinhibitors (Herbimycin A at 0.5 μg/ml, Genistein at 25 μM,SU6656 at 1 μM, Tyrphostin AG1478 at 100 μM, Bisindo-lylmaleimide 1 at 20 μM and PKC inhibitor peptide 19-31at 200 nM) were exposed to mock or HSV-1 for 10 min andwashed with cold PBS. Lysis buffer (50 mM Hepes (pH7.4), 0.1% Triton X-100, 10% (v/v) glycerol, 1 mM DDT,1 mM activated sodium vanadate and containing themammalian cell protease inhibitor cocktail (10 μl/ml cellsuspension)) was added to the washed cell pellets andthen left on ice for 20 min. Lysates were centrifuged at10,000g for 15 min at 4 °C. Supernatants were collectedand used for measuring PTK activity using the ProteinTyrosine Kinase Assay kit (Sigma: St-Louis, Missouri,USA), according to manufacturer's instructions. Celllysates were incubated for 30 min in 96-well plates coatedwith the tyrosine kinase substrate (poly-Glu-Tyr). Phos-phorylated substrate was quantified by chromogenicdetection using horseradish peroxidase-conjugated anti-

phosphotyrosine antibody. Optical densities were mea-sured at 492 nm.

Electrophoretic mobility shift assay (EMSA)

THP-1 cells were pre-treated with Tyrphostin AG1478(100 μM), SU6656 (1 μM), PKC inhibitor peptide 19-31(200 nM), Bisindolylmaleimide 1 (20 μM), DMSO+aceticacid, SU6656 (1 μM)+PKC inhibitor peptide 19-31(200 nM) and SU6656 (1 μM)+Bisindolylmaleimide 1(20 μM). Then pre-treated and untreated THP1 cellswere incubated for 2 h with UV-inactivated HSV-1.Nuclear cell lysates were prepared from these samplesand subjected to EMSA analysis with a radiolabeled IL-15 promoter NF-kB site using the Gel Shift AssaySystem kit (Promega: Madison, WI, USA). The double-stranded oligonucleotide containing the NF-kB consen-sus sequence (5′ GCCCGGGGGAATCCCAGCTGA) wasend labeled with [γ-32P]ATP by the T4 polynucleotidekinase. Nuclear cell extracts (5−10 μg) were incubatedwith 20,000 CPM of labeled probe for 20 min atroom temperature in binding buffer containing poly(dI·dC), and DNA-protein complexes were resolvedon a 5−6% non-denaturing polyacrylamide gel at roomtemperature. Competition assays were performed by in-cubating twofold molar excess of cold probes for 15 minat room temperature before the addition of the 32P-labeled oligonucleotide. NF-kB binding was visualizedby autoradiography.

Proliferation assay

Monocytes and CD3+ Tcells were purified from PBMCsby using monocyte and CD3+ T cell subset enrichmentcolumns (Stem Cell Technologies) as per instructions.Purified CD3+ Tcells were incubated in complete mediumfor 6 h and then Concanavalin A (2 μg/ml) was added.After 48 h, CD3+ T cells were harvested for further use.Monocytes were incubated with various inhibitors for45 min and then treated with mock and HSV-1, followedby a 48 h incubation. Before the proliferation assay,monocytes were treated with Mitomycin-C (Sigma) at20 μg/ml for 40 min. For proliferation assay, 40×103 CD3+T cells were cultured alone or with 12.5×103 monocytes.Each experiment was done in triplicate. Cultures wereincubated for 70 h at 37 °C. At 16 h before the harvesting,the plates were pulsed with 0.5 μCi/well [3H]thymidine.The cells were harvested on paper filters and [3H]thymidine uptake was measured in a liquid scintillationcounter and expressed as total CPM.

Acknowledgement

This study was supported by Canadian Institutesof Health Research (CIHR).

References

1. Fawaz, L. M., Sharif-Askari, E. & Menezes, J. (1999).Up-regulation of NK cytotoxic activity via IL-15induction by different viruses: a comparative study.J. Immunol. 163, 4473–4480.

2. Kanangat, S., Babu, J. S., Knipe, D. M. & Rouse, B. T.(1996). HSV-1-mediated modulation of cytokine gene


expression in a permissive cell line: selective up-regu-lation of IL-6 gene expression. Virology, 219, 295–300.

3. Gosselin, J., Flamand, L., D'Addario, M., Hiscott, J. &Menezes, J. (1992). Infection of peripheral bloodmononuclear cells by herpes simplex and Epstein-Barr viruses. Differential induction of interleukin 6and tumor necrosis factor-alpha. J. Clin. Invest. 89,1849–1856.

4. Gosselin, J., Flamand, L., D'Addario, M., Hiscott, J.,Stefanescu, I., Ablashi, D. V. et al. (1992). Modulatoryeffects of Epstein-Barr, herpes simplex, and humanherpes-6 viral infections and coinfections on cytokinesynthesis. A comparative study. J. Immunol. 149,181–187.

5. Grabstein, K. H., Eisenman, J., Shanebeck, K., Rauch,C., Srinivasan, S., Fung, V. et al. (1994). Cloning of a Tcell growth factor that interacts with the beta chain ofthe interleukin-2 receptor. Science, 264, 965–968.

6. Jonuleit, H., Wiedemann, K., Muller, G., Degwert, J.,Hoppe, U., Knop, J. & Enk, A. H. (1997). Induction ofIL-15 messenger RNA and protein in human blood-derived dendritic cells: a role for IL-15 in attraction ofT cells. J. Immunol. 158, 2610–2615.

7. Carson, W. E., Fehniger, T. A., Haldar, S., Eckhert, K.,Lindemann, M. J., Lai, C. F. et al. (1997). A potentialrole for interleukin-15 in the regulation of humannatural killer cell survival. J. Clin. Invest. 99, 937–943.

8. Mrozek, E., Anderson, P. & Caligiuri, M. A. (1996).Role of interleukin-15 in the development of humanCD56+ natural killer cells from CD34+ hematopoieticprogenitor cells. Blood, 87, 2632–2640.

9. Leclerc, G. (1986). The role of bacterial components inthe induction process of macrophage activation. Ann.Inst. Pasteur Immunol. 137C, 215–218.

10. Cooper, M. A., Bush, J. E., Fehniger, T. A., VanDeusen,J. B., Waite, R. E., Liu, Y. et al. (2002). In vivo evidencefor a dependence on interleukin 15 for survival ofnatural killer cells. Blood, 100, 3633–3638.

11. Roychowdhury, S., May, K. F., Jr, Tzou, K. S., Lin, T.,Bhatt, D. & Freud, A. G. (2004). Failed adoptiveimmunotherapy with tumor-specific T cells: reversalwith low-dose interleukin 15 but not low-doseinterleukin 2. Cancer Res. 64, 8062–8067.

12. Becker, T. C., Wherry, E. J., Boone, D., Murali-Krishna,K., Antia, R.,Ma,A.&Ahmed, R. (2002). Interleukin 15is required for proliferative renewal of virus-specificmemory CD8 T cells. J. Exp. Med. 195, 1541–1548.

13. Azimi, N., Nagai, M., Jacobson, S. & Waldmann, T. A.(2001). IL-15 plays a major role in the persistence ofTax-specific CD8 cells in HAM/TSP patients. Proc.Natl Acad. Sci. USA, 98, 14559–14564.

14. Lodolce, J., Burkett, P., Koka, R., Boone, D., Chien, M.,Chan, F. et al. (2002). Interleukin-15 and the regulationof lymphoid homeostasis. Mol. Immunol. 39, 537–544.

15. D'Addario, M., Ahmad, A., Xu, J. W. & Menezes, J.(1999). Epstein-Barr virus envelope glycoproteingp350 induces NF-kappaB activation and IL-1betasynthesis in human monocytes-macrophages invol-ving PKC and PI3-K. Faseb J. 13, 2203–2213.

16. D'Addario, M., Ahmad, A., Morgan, A. & Menezes, J.(2000). Binding of the Epstein-Barr virus majorenvelope glycoprotein gp350 results in the up-regula-tion of the TNF-alpha gene expression in monocytic

cells via NF-kappaB involving PKC, PI3-K andtyrosine kinases. J. Mol. Biol. 298, 765–778.

17. D'Addario, M., Libermann, T. A., Xu, J., Ahmad, A. &Menezes, J. (2001). Epstein-Barr Virus and its glyco-protein-350 upregulate IL-6 in human B-lymphocytesvia CD21, involving activation of NF-kappaB anddifferent signaling pathways. J. Mol. Biol. 308, 501–514.

18. Shapira, L., Takashiba, S., Champagne, C., Amar, S. &Van Dyke, T. E. (1994). Involvement of protein kinaseC and protein tyrosine kinase in lipopolysaccharide-induced TNF-alpha and IL-1 beta production byhuman monocytes. J. Immunol. 153, 1818–1824.

19. Bolen, J. B. & Brugge, J. S. (1997). Leukocyte proteintyrosine kinases: potential targets for drug discovery.Annu. Rev. Immunol. 15, 371–404.

20. Mogensen, T. H. & Paludan, S. R. (2001). Molecularpathways in virus-induced cytokine production.Microbiol. Mol. Biol. Rev. 65, 131–150.

21. Musso, T., Calosso, L., Zucca, M., Millesimo, M.,Ravarino, D., Giovarelli, M. et al. (1999). Humanmonocytes constitutively express membrane-bound,biologically active, and interferon-gamma-upregu-lated interleukin-15. Blood, 93, 3531–3539.

22. Musso, T., Calosso, L., Zucca, M., Millesimo, M.,Puliti, M., Bulfone-Paus, S. et al. (1998). Interleukin-15activates proinflammatory and antimicrobial func-tions in polymorphonuclear cells. Infect. Immun. 66,2640–2647.

23. Ankel, H., Westra, D. F., Welling-Wester, S. & Lebon, P.(1998). Induction of interferon-alpha by glycoproteinD of herpes simplex virus: a possible role ofchemokine receptors. Virology, 251, 317–326.

24. Burysek, L., Yeow, W. S., Lubyova, B., Kellum, M.,Schafer, S. L., Huang, Y. Q. & Pitha, P. M. (1999).Functional analysis of human herpesvirus 8-encodedviral interferon regulatory factor 1 and its associationwith cellular interferon regulatory factors and p300.J. Virol. 73, 7334–7342.

25. Burysek, L., Yeow, W. S. & Pitha, P. M. (1999). Uniqueproperties of a second human herpesvirus 8-encodedinterferon regulatory factor (vIRF-2). J. Hum. Virol. 2,19–32.

26. Revilla, Y., Callejo, M., Rodriguez, J. M., Culebras, E.,Nogal, M. L., Salas, M. L. et al. (1998). Inhibition ofnuclear factor kappaB activation by a virus-encodedIkappaB-like protein. J. Biol. Chem. 273, 5405–5411.

27. Zhi, Y. & Sandri-Goldin, R. M. (1999). Analysis of thephosphorylation sites of herpes simplex virus type 1regulatory protein ICP27. J. Virol. 73, 3246–3257.

28. Page, K., Li, J., Zhou, L., Iasvovskaia, S., Corbit, K. C.,Soh, J. W. et al. (2003). Regulation of airway epithelialcell NF-kappa B-dependent gene expression byprotein kinase C delta. J. Immunol. 170, 5681–5689.

29. Saijo, K., Schmedt, C., Su, I. H., Karasuyama, H.,Lowell, C. A., Reth, M. et al. (2003). Essential role ofSrc-family protein tyrosine kinases in NF-kappaBactivation during B cell development.Nature Immunol.4, 274–279.

30. Huang, W. C., Chen, J. J., Inoue, H. & Chen, C. C.(2003). Tyrosine phosphorylation of I-kappa B kinasealpha/beta by protein kinase C-dependent c-Srcactivation is involved in TNF-alpha-induced cyclooxy-genase-2 expression. J. Immunol. 170, 4767–4775.

Edited by J. Karn

(Received 2 November 2006; received in revised form 14 December 2006; accepted 19 December 2006)Available online 28 December 2006

Herpes Simplex Virus-1 Up-regulates IL-15 Gene Expression in Monocytic Cells Through the Activation...

Documents

Transcript of Herpes Simplex Virus-1 Up-regulates IL-15 Gene Expression in Monocytic Cells Through the Activation...